WorldWideScience

Sample records for reaction-amplified dna fragment

  1. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  2. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  3. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Science.gov (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  4. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  5. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  6. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  7. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  8. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  9. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  10. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  11. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  12. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  13. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  14. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  16. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  17. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  18. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  19. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  20. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  1. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  2. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  3. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  5. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  6. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  8. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  9. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Science.gov (United States)

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  10. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    Directory of Open Access Journals (Sweden)

    Bartoš Jan

    2008-06-01

    Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which

  11. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  12. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  13. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  14. Amplifier channel for a fission fragment semiconductor detector

    International Nuclear Information System (INIS)

    Tyurin, G.P.

    1981-01-01

    To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

  15. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

    OpenAIRE

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-01-01

    Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

  16. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  17. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  18. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  19. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

  20. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...

  1. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  2. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  3. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  4. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  5. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  6. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  8. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  9. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  10. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  11. Characterising the potential of sheep wool for ancient DNA analyses

    DEFF Research Database (Denmark)

    Brandt, Luise Ørsted; Tranekjer, Lena D.; Mannering, Ulla

    2011-01-01

    can be PCR-amplified from wool derived from a variety of breeds, regardless of the body location or natural pigmentation. Furthermore, although DNA can be PCR-amplified from wool dyed with one of four common plant dyes (tansy, woad, madder, weld), the use of mordants such as alum or iron leads...... and content of DNA in hair shafts are known to vary, and it is possible that common treatments of wool such as dyeing may negatively impact the DNA. Using quantitative real-time polymerase chain reaction (PCR), we demonstrate that in general, short fragments of both mitochondrial and single-copy nuclear DNA...

  12. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  13. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    International Nuclear Information System (INIS)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

    2013-01-01

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

  14. Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Brouat, C; McKey, D; Douzery, E J P

    2004-05-01

    Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

  15. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  16. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    Science.gov (United States)

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  17. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  18. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

    Science.gov (United States)

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

    2003-02-01

    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  19. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  20. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  1. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  2. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  3. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Isolation of a sex-linked DNA sequence in cranes.

    Science.gov (United States)

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  5. Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

    Science.gov (United States)

    Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

    2000-01-01

    An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214

  6. Structural changes of DNA in heavy ion-induced mutants on Arabidopsis

    International Nuclear Information System (INIS)

    Tano, S.; Shikazono, N.; Tanaka, A.; Yokota, Y.; Watanabe, H.

    1997-01-01

    In order to investigate the frequency of structural changes induced by high LET radiation in plants, a comparison was made between DNA fragments amplified by the polymerase chain reaction (PCR) from C ion- and electron-induced Arabidopsis mutants at GL and TT loci. (orig./MG)

  7. Structural changes of DNA in heavy ion-induced mutants on Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Tano, S; Shikazono, N; Tanaka, A; Yokota, Y; Watanabe, H [Japan Atomic Research Research Inst., Watanuki, Takasaki (Japan). Advanced Science Research Center

    1997-09-01

    In order to investigate the frequency of structural changes induced by high LET radiation in plants, a comparison was made between DNA fragments amplified by the polymerase chain reaction (PCR) from C ion- and electron-induced Arabidopsis mutants at GL and TT loci. (orig./MG)

  8. Use of random amplified polymorphic DNA (RAPD) for generating specific DNA probes for oxyuroid species (Nematoda).

    Science.gov (United States)

    Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P

    1998-03-01

    Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.

  9. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Conversion of the random amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

  11. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    Science.gov (United States)

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  12. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  13. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  14. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    Directory of Open Access Journals (Sweden)

    Emmanuelle eFiore

    2015-08-01

    Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  15. DNA fingerprinting of pearls to determine their origins.

    Directory of Open Access Journals (Sweden)

    Joana B Meyer

    Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

  16. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

  17. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  18. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  19. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  20. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  1. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  2. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  3. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  4. Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase.

    Science.gov (United States)

    Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander

    2017-12-26

    The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).

  5. Random amplified polymorphic DNA (RAPD) markers reveal genetic ...

    African Journals Online (AJOL)

    The present study evaluated genetic variability of superior bael genotypes collected from different parts of Andaman Islands, India using fruit characters and random amplified polymorphic DNA (RAPD) markers. Genomic DNA extracted from leaf material using cetyl trimethyl ammonium bromide (CTAB) method was ...

  6. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  7. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  8. Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Angen, Øystein

    2007-01-01

    Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

  9. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  10. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  11. Chemical cleavage reactions of DNA on solid support: application in mutation detection

    Directory of Open Access Journals (Sweden)

    Cotton Richard GH

    2003-05-01

    Full Text Available Abstract Background The conventional solution-phase Chemical Cleavage of Mismatch (CCM method is time-consuming, as the protocol requires purification of DNA after each reaction step. This paper describes a new version of CCM to overcome this problem by immobilizing DNA on silica solid supports. Results DNA test samples were loaded on to silica beads and the DNA bound to the solid supports underwent chemical modification reactions with KMnO4 (potassium permanganate and hydroxylamine in 3M TEAC (tetraethylammonium chloride solution. The resulting modified DNA was then simultaneously cleaved by piperidine and removed from the solid supports to afford DNA fragments without the requirement of DNA purification between reaction steps. Conclusions The new solid-phase version of CCM is a fast, cost-effective and sensitive method for detection of mismatches and mutations.

  12. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

    Directory of Open Access Journals (Sweden)

    Carroll Bernie

    2010-03-01

    Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

  13. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  14. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  15. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    Science.gov (United States)

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  16. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  17. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  18. Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Mariia Andrianova

    2017-12-01

    Full Text Available The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10−6–1 × 10−8 M was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10−8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4.

  19. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  20. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  1. induced by cadmium using random amplified polymorphic DNA

    African Journals Online (AJOL)

    darya

    2013-04-17

    Apr 17, 2013 ... metallurgy, painting, plastic production, etc., and is being released into the biosphere, and ...... aquatic macrophytes: Random amplified polymorphic DNA analysis and identification of ... ecotoxicology. Toxicol. Ecotoxicol.

  2. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  4. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  5. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  6. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  7. Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations

    Directory of Open Access Journals (Sweden)

    DiaS Edelberto S.

    1998-01-01

    Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

  8. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  9. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  10. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Science.gov (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  11. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  12. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  13. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  14. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

    Science.gov (United States)

    Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

    2015-11-25

    DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

  15. Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

    Science.gov (United States)

    Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

    2018-04-01

    The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

  16. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  17. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

    Science.gov (United States)

    Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

  18. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  19. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1989-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

  2. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  3. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  4. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    Science.gov (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  5. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  6. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  7. Isolation and characterization of microsatellite DNA loci from Sillago ...

    Indian Academy of Sciences (India)

    A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...

  8. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  9. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  10. Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

    International Nuclear Information System (INIS)

    Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

    2011-01-01

    The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

  11. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  12. Participation of ATM in cellular response to DNA damage induced by ionizing radiation

    International Nuclear Information System (INIS)

    Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian

    2000-01-01

    Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins

  13. Application of random amplified polymorphic DNA (RAPD) markers ...

    African Journals Online (AJOL)

    The random amplified polymorphic DNA (RAPD) technique has been widely applied to identify different varieties of plants for molecular breeding. However, application of RAPD markers to identify parthenogenesis in plants has not been reported. In this investigation, we used pedigree and RAPD markers to differentiate ...

  14. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  15. ( Quercus spp. ) using random amplified polymorphic DNA (RAPD)

    African Journals Online (AJOL)

    Quercus is one of the most important woody genera of the Northern hemisphere and considered as one of the main forest tree species in Iran. In this study, genetic relationships in the genus Quercus, using random amplified polymorphic DNA (RAPD) was examined. Five species, including: Quercus robur, Quercus ...

  16. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2003-01-01

    Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

  17. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2005-01-01

    Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

  18. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  19. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  20. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  1. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  2. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  3. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  4. Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

    Directory of Open Access Journals (Sweden)

    Nguyen-Hieu Tung

    2012-09-01

    Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

  5. The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

    International Nuclear Information System (INIS)

    Schowalter, D.B.; Sommer, S.S.

    1989-01-01

    By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

  6. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

  7. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  8. A simple colorimetric assay for detection of amplified Mycobacterium leprae DNA

    NARCIS (Netherlands)

    van der Vliet, G. M.; de Wit, M. Y.; Klatser, P. R.

    1993-01-01

    A colorimetric assay for the detection of PCR-products is described. The assay is based on amplification of DNA in the presence of digoxigenin-dUTP. After immobilization of the PCR products to a microtitre plate, amplified DNA could be detected colorimetrically. The sensitivity of this colorimetric

  9. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  10. Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

    1999-01-01

    The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

  11. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  12. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  13. Development of biometric DNA ink for authentication security.

    Science.gov (United States)

    Hashiyada, Masaki

    2004-10-01

    Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press

  14. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  15. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob

    2016-01-01

    Stored neonatal dried blood spot (DBS) samples from neonatal screening programmes are a valuable diagnostic and research resource. Combined with information from national health registries they can be used in population-based studies of genetic diseases. DNA extracted from neonatal DBSs can...... be amplified to obtain micrograms of an otherwise limited resource, referred to as whole-genome amplified DNA (wgaDNA). Here we investigate the robustness of exome sequencing of wgaDNA of neonatal DBS samples. We conducted three pilot studies of seven, eight and seven subjects, respectively. For each subject...... we analysed a neonatal DBS sample and corresponding adult whole-blood (WB) reference sample. Different DNA sample types were prepared for each of the subjects. Pilot 1: wgaDNA of 2x3.2mm neonatal DBSs (DBS_2x3.2) and raw DNA extract of the WB reference sample (WB_ref). Pilot 2: DBS_2x3.2, WB...

  16. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  17. Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

    Directory of Open Access Journals (Sweden)

    Tuti Susanti Legiastuti

    2013-04-01

    Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

  18. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Science.gov (United States)

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  19. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    Science.gov (United States)

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  20. Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions

    Directory of Open Access Journals (Sweden)

    Hamed Rezaei

    2017-07-01

    Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.

  1. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  2. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  3. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  5. Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction

    International Nuclear Information System (INIS)

    Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang

    2002-01-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor

  6. Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction

    Science.gov (United States)

    Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang

    2002-12-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

  7. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  8. VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI

    Directory of Open Access Journals (Sweden)

    Gun Gun Gumilar

    2005-06-01

    Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR

  9. Design and Analysis of Compact DNA Strand Displacement Circuits for Analog Computation Using Autocatalytic Amplifiers.

    Science.gov (United States)

    Song, Tianqi; Garg, Sudhanshu; Mokhtar, Reem; Bui, Hieu; Reif, John

    2018-01-19

    A main goal in DNA computing is to build DNA circuits to compute designated functions using a minimal number of DNA strands. Here, we propose a novel architecture to build compact DNA strand displacement circuits to compute a broad scope of functions in an analog fashion. A circuit by this architecture is composed of three autocatalytic amplifiers, and the amplifiers interact to perform computation. We show DNA circuits to compute functions sqrt(x), ln(x) and exp(x) for x in tunable ranges with simulation results. A key innovation in our architecture, inspired by Napier's use of logarithm transforms to compute square roots on a slide rule, is to make use of autocatalytic amplifiers to do logarithmic and exponential transforms in concentration and time. In particular, we convert from the input that is encoded by the initial concentration of the input DNA strand, to time, and then back again to the output encoded by the concentration of the output DNA strand at equilibrium. This combined use of strand-concentration and time encoding of computational values may have impact on other forms of molecular computation.

  10. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  11. Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency

    NARCIS (Netherlands)

    Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.

    2009-01-01

    Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on

  12. High-energy nuclear reaction mechanisms - fission, fragmentation and spallation

    International Nuclear Information System (INIS)

    Kaufman, S.B.

    1987-01-01

    Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments

  13. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    Science.gov (United States)

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  14. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  15. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  16. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  17. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  18. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  19. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  20. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  1. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  2. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target.

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  3. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    International Nuclear Information System (INIS)

    Kadowaki, T.; Kadowaki, H.; Taylor, S.I.

    1990-01-01

    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  4. A Hybrid Semi-Digital Transimpedance Amplifier With Noise Cancellation Technique for Nanopore-Based DNA Sequencing.

    Science.gov (United States)

    Hsu, Chung-Lun; Jiang, Haowei; Venkatesh, A G; Hall, Drew A

    2015-10-01

    Over the past two decades, nanopores have been a promising technology for next generation deoxyribonucleic acid (DNA) sequencing. Here, we present a hybrid semi-digital transimpedance amplifier (HSD-TIA) to sense the minute current signatures introduced by single-stranded DNA (ssDNA) translocating through a nanopore, while discharging the baseline current using a semi-digital feedback loop. The amplifier achieves fast settling by adaptively tuning a DC compensation current when a step input is detected. A noise cancellation technique reduces the total input-referred current noise caused by the parasitic input capacitance. Measurement results show the performance of the amplifier with 31.6 M Ω mid-band gain, 950 kHz bandwidth, and 8.5 fA/ √Hz input-referred current noise, a 2× noise reduction due to the noise cancellation technique. The settling response is demonstrated by observing the insertion of a protein nanopore in a lipid bilayer. Using the nanopore, the HSD-TIA was able to measure ssDNA translocation events.

  5. Phylogenetic relationship of the genus Gilbertella and related genera within the order Mucorales based on 5.8 S ribosomal DNA sequences.

    Science.gov (United States)

    Papp, T; Acs, Klára; Nyilasi, Ildikó; Nagy, Erzsébet; Vágvölgyi, Cs

    2003-01-01

    The complete ITS (internal transcribed spacer) region coding the ITS1, the ITS2 and the 5.8S rDNA was amplified by polymerase chain reaction from two strains of Gilbertella persicaria, six strains in the Mucoraceae (Mucor piriformis, M. rouxii, M. circinelloides, Rhizomucor miehei, R. pusillus and R. tauricus) and four strains representing three species of the Choanephoraceae (Blakeslea trispora, Choanephora infundibulifera and Poitrasia circinans). Sequences of the amplified DNA fragments were determined and analysed. G. persicaria belongs to the monogeneric family (Gilbertellaceae), however, originally it was described as Choanephora persicaria. The goal of this study was to reveal the phylogenetic relationship among fungi belonging to Gilbertellaceae, Choanephoraceae and Mucoraceae. Our results support that the "intermediate" position of this family is between Choanephoraceae and Mucoraceae.

  6. Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

    Science.gov (United States)

    K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

    1994-01-01

    A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

  7. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  8. Randomly amplified polymorphic-DNA analysis for detecting genotoxic effects of Boron on maize (Zea mays L.).

    Science.gov (United States)

    Sakcali, M Serdal; Kekec, Guzin; Uzonur, Irem; Alpsoy, Lokman; Tombuloglu, Huseyin

    2015-08-01

    This study was carried out to investigate the genotoxic effect of boron (B) on maize using randomly amplified polymorphic DNA (RAPD) method. Experimental design was conducted under 0, 5, 10, 25, 50, 100, 125, and 150 ppm B exposures, and physiological changes have revealed a sharp decrease in root growth rates from 28% to 85%, starting from 25 ppm to 150 ppm, respectively. RAPD-polymerase chain reaction (PCR) analysis shows that DNA alterations are clearly observed from beginning to 100 ppm. B-induced inhibition in root growth had a positive correlation with DNA alterations. Total soluble protein, root and stem lengths, and B content analysis in root and leaves encourage these results as a consequence. These preliminary findings reveal that B causes chromosomal aberration and genotoxic effects on maize. Meanwhile, usage of RAPD-PCR technique is a suitable biomarker to detect genotoxic effect of B on maize and other crops for the future. © The Author(s) 2013.

  9. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  10. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

    Science.gov (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

    1998-08-28

    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  11. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  12. Microfluidic Gel Electrophoresis in the Undergraduate Laboratory Applied to Food Analysis

    Science.gov (United States)

    Chao, Tzu-Chiao; Bhattacharya, Sanchari; Ros, Alexandra

    2012-01-01

    A microfluidics-based laboratory experiment for the analysis of DNA fragments in an analytical undergraduate course is presented. The experiment is set within the context of food species identification via amplified DNA fragments. The students are provided with berry samples from which they extract DNA and perform polymerase chain reaction (PCR)…

  13. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278

  14. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala and a New DNA Mini-Barcode Target.

    Directory of Open Access Journals (Sweden)

    Ping-Shin Lee

    Full Text Available Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp DNA mini-barcode could distinguish most mammal species (including separating dark taxa and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  15. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  16. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  17. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  18. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  19. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  20. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  1. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  2. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    Science.gov (United States)

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2015-01-15

    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  4. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  5. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  6. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  7. Molecular Diversity of Antagonistic Streptomyces spp. against Botrytis allii, the agent of onion gray mold using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    M. Jorjandi

    2014-08-01

    Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.

  8. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  9. RxnFinder: biochemical reaction search engines using molecular structures, molecular fragments and reaction similarity.

    Science.gov (United States)

    Hu, Qian-Nan; Deng, Zhe; Hu, Huanan; Cao, Dong-Sheng; Liang, Yi-Zeng

    2011-09-01

    Biochemical reactions play a key role to help sustain life and allow cells to grow. RxnFinder was developed to search biochemical reactions from KEGG reaction database using three search criteria: molecular structures, molecular fragments and reaction similarity. RxnFinder is helpful to get reference reactions for biosynthesis and xenobiotics metabolism. RxnFinder is freely available via: http://sdd.whu.edu.cn/rxnfinder. qnhu@whu.edu.cn.

  10. Visualization of DNA in highly processed botanical materials.

    Science.gov (United States)

    Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

    2018-04-15

    DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  12. Fragment formation in light-ion induced reactions

    International Nuclear Information System (INIS)

    Hirata, Yuichi

    2001-01-01

    The intermediate mass fragment (IMF) formation in the 12 GeV proton induced reaction on Au target is analyzed by the quantum molecular dynamics model combined with the JAM hadronic cascade model and the non-equilibrated percolation model. We show that the sideward peaked angular distribution of IMF occur in the multifragmentation at very short time scale around 20 fm/c where non-equilibrated features of the residual nucleus fluctuates the nucleon density and fragments in the repulsive Coulomb force are pushed for the sideward direction. (author)

  13. Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

    OpenAIRE

    Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M

    1988-01-01

    We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...

  14. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

    Science.gov (United States)

    Fahrimal, Y; Goff, W L; Jasmer, D P

    1992-01-01

    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  15. Production of Energetic Light Fragments in Spallation Reactions

    Directory of Open Access Journals (Sweden)

    Mashnik Stepan G.

    2014-03-01

    Full Text Available Different reaction mechanisms contribute to the production of light fragments (LF from nuclear reactions. Available models cannot accurately predict emission of LF from arbitrary reactions. However, the emission of LF is important formany applications, such as cosmic-ray-induced single event upsets, radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The cascade-exciton model (CEM and the Los Alamos version of the quark-gluon string model (LAQGSM, as implemented in the CEM03.03 and LAQGSM03.03 event generators used in the Los Alamos Monte Carlo transport code MCNP6, describe quite well the spectra of fragments with sizes up to 4He across a broad range of target masses and incident energies. However, they do not predict high-energy tails for LF heavier than 4He. The standard versions of CEM and LAQGSM do not account for preequilibrium emission of LF larger than 4He. The aim of our work is to extend the preequilibrium model to include such processes. We do this by including the emission of fragments heavier than 4He at the preequilibrium stage, and using an improved version of the Fermi Break-up model, providing improved agreement with various experimental data.

  16. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  17. Development of Quantitative Competitive PCR and Absolute Based Real-Time PCR Assays for Quantification of The Butyrate Producing Bacterium: Butyrivibrio fibrisolvens

    Directory of Open Access Journals (Sweden)

    Mojtaba Tahmoorespur

    2016-04-01

    Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio

  18. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  19. Connecting localized DNA strand displacement reactions

    Science.gov (United States)

    Mullor Ruiz, Ismael; Arbona, Jean-Michel; Lad, Amitkumar; Mendoza, Oscar; Aimé, Jean-Pierre; Elezgaray, Juan

    2015-07-01

    Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions.Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions. Electronic supplementary information (ESI) available. See DOI: 10.1039/C5NR02434J

  20. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  1. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  2. Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

    Science.gov (United States)

    Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

    1996-12-01

    Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

  3. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  4. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  5. Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

    2014-01-01

    DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

  6. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  7. Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

    International Nuclear Information System (INIS)

    Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

    1995-06-01

    MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

  8. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  9. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  10. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  11. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  12. KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Emma Suryati

    2013-03-01

    Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

  13. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  14. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  15. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  16. Multiple displacement amplification of whole genomic DNA from urediospores of Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Zhang, R; Ma, Z H; Wu, B M

    2015-05-01

    Biotrophic fungi, such as Puccinia striiformis f. sp. tritici, because they cannot be cultured on nutrient media, to obtain adequate quantity of DNA for molecular genetic analysis, are usually propagated on living hosts, wheat plants in case of P. striiformis f. sp. tritici. The propagation process is time-, space- and labor-consuming and has been a bottleneck to molecular genetic analysis of this pathogen. In this study we evaluated multiple displacement amplification (MDA) of pathogen genomic DNA from urediospores as an alternative approach to traditional propagation of urediospores followed by DNA extraction. The quantities of pathogen genomic DNA in the products were further determined via real-time PCR with a pair of primers specific for the β-tubulin gene of P. striiformis f. sp. tritici. The amplified fragment length polymorphism (AFLP) fingerprints were also compared between the DNA products. The results demonstrated that adequate genomic DNA at fragment size larger than 23 Kb could be amplified from 20 to 30 urediospores via MDA method. The real-time PCR results suggested that although fresh urediospores collected from diseased leaves were the best, spores picked from diseased leaves stored for a prolonged period could also be used for amplification. AFLP fingerprints exhibited no significant differences between amplified DNA and DNA extracted with CTAB method, suggesting amplified DNA can represent the pathogen's genomic DNA very well. Therefore, MDA could be used to obtain genomic DNA from small precious samples (dozens of spores) for molecular genetic analysis of wheat stripe rust pathogen, and other fungi that are difficult to propagate.

  17. Study of fragmentation reactions of light nucleus

    International Nuclear Information System (INIS)

    Toneli, David Arruda; Carlson, Brett Vern

    2011-01-01

    Full text: The decay of the compound nucleus is traditionally calculated using a sequential emission model, such as the Weisskopf-Ewing or Hauser-Feshbach ones, in which the compound nucleus decays through a series of residual nuclei by emitting one particle at a time until there is no longer sufficient energy for further emission. In light compound nucleus, however, the excitation energy necessary to fully disintegrate the system is relatively easy to attain. In such cases, decay by simultaneous emission of two or more particles becomes important. A model which takes into account all these decay is the Fermi fragmentation model. Recently, the equivalence between the Fermi fragmentation model and statistical multifragmentation model used to describe the decay for highly excited fragments for reactions of heavy ions was demonstrated. Due the simplicity of the thermodynamic treatment used in the multifragmentation model, we have adapted it to the calculation of Fermi breakup of light nuclei. The ultimate goal of this study is to calculate the distribution of isotopes produced in proton-induced reactions on light nuclei of biological interest, such as C, O e Ca. Although most of these residual nuclei possess extremely short half-lives and thus represent little long-term danger, they tend to be deficient in neutrons and to decay by positron emission, which allows the monitoring of proton radiotherapy by PET (Positron Emission Tomography). (author)

  18. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  19. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  20. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

    2013-09-21

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

  1. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    International Nuclear Information System (INIS)

    Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

    2013-01-01

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

  2. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Charity, R.J.; Sobotka, L.G.

    1993-01-01

    The study of intermediate-energy heavy-ion nuclear reactions is reported. This work has two foci: the properties of nuclear matter under abnormal conditions, in this energy domain, predominately low densities and the study of the relevant reaction mechanisms. Nuclear matter properties, such as phase transitions, are reflected in the dynamics of the reactions. The process leads to an understanding of the reaction mechanism themselves and therefore to the response characteristics of finite, perhaps non-equilibrium, strongly interacting systems. The program has the following objectives: to study energy, mass, and angular momentum deposition by studying incomplete fusion reactions; to gain confidence in the understanding of how highly excited systems decompose by studying all emissions from the highly excited systems; to push these kinds of studies into the intermediate energy domain (where intermediate mass fragment emission is not improbable) with excitation function studies; and to learn about the dynamics of the decays using particle-particle correlations. The last effort focuses on simple systems, where definitive statements are possible. These avenues of research share a common theme, large complex fragment production. It is this feature, more than any other, which distinguishes the intermediate energy domain

  3. Fragment mass distribution of proton-induced spallation reaction with intermediate energy

    International Nuclear Information System (INIS)

    Fan Sheng; Ye Yanlin; Xu Chuncheng; Chen Tao; Sobolevsky, N.M.

    2000-01-01

    The test of part benchmark of SHIELD code is finished. The fragment cross section and mass distribution and excitation function of the residual nuclei from proton-induced spallation reaction on thin Pb target with intermediate energy have been calculated by SHIELD code. And the results are in good agreement with measured data. The fragment mass distribution of the residual nuclei from proton-induced spallation reaction on thick Pb target with incident energy 1.6 GeV have been simulated

  4. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  5. Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

    Science.gov (United States)

    Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

    2016-06-01

    To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

  6. Evolution of fragment-fragment correlations in reactions of 197Au and 107,109Ag with 40Ar from 7A to 34A MeV

    International Nuclear Information System (INIS)

    Ethvignot, T.; Ajitanand, N.N.; Alexander, J.M.; Bauge, E.; Elmaani, A.; Kowalski, L.; Lopez, M.; Magda, M.T.; Desesquelles, P.; Elhage, H.; Giorni, A.; Heuer, D.; Kox, S.; Lleres, A.; Merchez, F.; Morand, C.; Rebreyend, D.; Stassi, P.; Viano, J.B.; Benrachi, F.; Chambon, B.; Cheynis, B.; Drain, D.; Pastor, C.

    1992-01-01

    In-plane and out-of-plane angular correlations have been measured between fragments of Z>3, Li fragments, 3,4 He, and 1,2,3 H. The changing patterns for 40 Ar induced reactions of 7A, 17A, 27A, and 34A MeV give an overview of the decreasing importance of mass-symmetric fissionlike reactions at the expense of a broad range of more mass-asymmetric breakups. Evidence is given that these fragments come from a central collision group of reactions that have similar violence and from which many combinations of fragments and particles are ejected. Very similar azimuthal angular correlations are observed for particles with a Li fragment and for particles with a pair of heavier fragments (Z>3). This similarity suggests comparable strengths of association with the reaction plane for single Li fragments and for fragment pairs of Z>3. Azimuthal angular correlations for Li-Li pairs exhibit distinct asymmetries; their interpretation via trajectory-model calculations indicates mean delay times of ∼5x10 -22 s

  7. Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2012-09-15

    Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

  8. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    OpenAIRE

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-01-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

  9. [Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

    Science.gov (United States)

    Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

    2012-12-01

    Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

  10. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  11. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  12. Genetic variability of cultivated cowpea in Benin assessed by random amplified polymorphic DNA

    NARCIS (Netherlands)

    Zannou, A.; Kossou, D.K.; Ahanchédé, A.; Zoundjihékpon, J.; Agbicodo, E.; Struik, P.C.; Sanni, A.

    2008-01-01

    Characterization of genetic diversity among cultivated cowpea [Vigna unguiculata (L.) Walp.] varieties is important to optimize the use of available genetic resources by farmers, local communities, researchers and breeders. Random amplified polymorphic DNA (RAPD) markers were used to evaluate the

  13. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  14. Evaluation of whole genome amplified DNA to decrease material expenditure and increase quality

    Directory of Open Access Journals (Sweden)

    Marie Bækvad-Hansen

    2017-06-01

    Discussion: Whole genome amplified DNA samples from dried blood spots is well suited for array genotyping and produces robust and reliable genotype data. However, the amplification process introduces additional noise to the data, making detection of structural variants such as copy number variants difficult. With this study, we explore ways of optimizing the amplification protocol in order to reduce noise and increase data quality. We found, that the amplification process was very robust, and that changes in amplification time or temperature did not alter the genotyping calls or quality of the array data. Adding additional replicates of each sample also lead to insignificant changes in the array data. Thus, the amount of noise introduced by the amplification process was consistent regardless of changes made to the amplification protocol. We also explored ways of decreasing material expenditure by reducing the spot size or the amplification reaction volume. The reduction did not affect the quality of the genotyping data.

  15. Polymerase chain reaction as a tool for developing stress protein probes

    Energy Technology Data Exchange (ETDEWEB)

    Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

    1994-08-01

    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  16. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  17. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  18. Ames and random amplified polymorphic DNA tests for the validation of the mutagenic and/or genotoxic potential of the drinking water disinfection by-products chloroform and bromoform.

    Science.gov (United States)

    Khallef, Messaouda; Cenkci, Süleyman; Akyil, Dilek; Özkara, Arzu; Konuk, Muhsin; Benouareth, Djamel Eddine

    2018-01-28

    Chloroform and Bromoform are two abundant trihalomethanes found in Algerian drinking water. The investigation of the mutagenic hazard of these disinfection by-products was studied by Ames test as prokaryotic bioassay to show their mutagenic effects. For this, Salmonella typhimurium TA98 and TA100 strains were employed. Both chloroform and bromoform showed a direct mutagenic effect since the number of revertant colonies gradually increase in dose-dependent manner with all concentrations tested with the two bacterial strains and these were both in the absence and presence of S9 metabolic activation. The genotoxic hazard was also studied by random amplified polymorphic DNA test on the root cells of Allium cepa as eukaryotic bioassay. DNA extracted from the roots of the onion were incubated at different concentrations of chloroform and bromoform and then amplified by polymerase chain reaction. This was based on demonstrating a major effect of disappearance of bands compared to roots incubated in the negative control (distilled water). The results showed that these two compounds affected genomic DNA by breaks although by mutations.

  19. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  20. Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction

    Directory of Open Access Journals (Sweden)

    Consolandi Clarissa

    2002-09-01

    Full Text Available Abstract Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria.

  1. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

  2. DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki

    1980-09-19

    Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

  3. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  4. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  5. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  6. Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

    Science.gov (United States)

    Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

    2014-12-15

    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Dissertation: Precompound Emission of Energetic Light Fragments in Spallation Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-08-04

    Emission of light fragments (LF) from nuclear reactions is an open question. Different reaction mechanisms contribute to their production; the relative roles of each, and how they change with incident energy, mass number of the target, and the type and emission energy of the fragments is not completely understood. None of the available models are able to accurately predict emission of LF from arbitrary reactions. However, the ability to describe production of LF (especially at energies ≳ 30 MeV) from many reactions is important for different applications, such as cosmic-ray-induced Single Event Upsets (SEUs), radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The Cascade-Exciton Model (CEM) version 03.03 and the Los Alamos version of the Quark-Gluon String Model (LAQGSM) version 03.03 event generators in Monte Carlo N-Particle Transport Code version 6 (MCNP6) describe quite well the spectra of fragments with sizes up to ⁴He across a broad range of target masses and incident energies (up to ~ 5 GeV for CEM and up to ~ 1 TeV/A for LAQGSM). However, they do not predict the high energy tails of LF spectra heavier than ⁴He well. Most LF with energies above several tens of MeV are emitted during the precompound stage of a reaction. The current versions of the CEM and LAQGSM event generators do not account for precompound emission of LF larger than ⁴He. The aim of our work is to extend the precompound model in them to include such processes, leading to an increase of predictive power of LF-production in MCNP6. This entails upgrading the Modified Exciton Model currently used at the preequilibrium stage in CEM and LAQGSM. It also includes expansion and examination of the coalescence and Fermi break-up models used in the precompound stages of spallation reactions within CEM and LAQGSM. Extending our models to include emission of fragments heavier than ⁴He at the precompound stage has indeed provided results that have much

  8. Investigation of the fate and effects of acetyl cedrene on Capitella teleta and sediment bacterial community

    DEFF Research Database (Denmark)

    Ellegaard-Jensen, Lea; Selck, Henriette; Priemé, Anders

    2010-01-01

    /without Capitella teleta (formerly Capitella sp. I)). Furthermore effects of AC on microbial respiration in the system were determined by examining CO(2) flux. T-RFLP (terminal restriction fragment length polymorphism) was used to analyze PCR (polymerase chain reaction) amplified 16S DNA gene fragments from...

  9. Fragment emission in reactions of 18.5-GeV 12C ions with complex nuclei

    International Nuclear Information System (INIS)

    Porile, N.T.; Cole, G.D.

    1982-01-01

    The emission of fragments ranging from 24 Na to 52 Mn in reactions of 18.5 GeV 12 C ions with Cu, Ag, Gd, Ta, Au, and U targets has been studied by means of activation techniques. The experiments involved determination of the fragment production cross sections and thick-target recoil properties. The latter were used to obtain mean fragment kinetic energies and values of β/sub parallel to/, the forward velocity component of the struck nucleus (in units of c). The results are compared with similar data for incident protons of the same total kinetic energy. The data may be used to assess the importance of central collisions in fragment production. Such collisions lead to the near total destruction of both interacting nuclei and the resulting fragments are emitted by a system of intermediate rapidity. In such a process, the factorization hypothesis, which has been shown to be valid for target and projectile fragmentation reactions, should not be obeyed. A test for factorization is performed by means of a relation which states that the ratio of the cross sections for producing fragment /sup A/Z in 12 C reactions to that for producing the same fragment in proton reactions with the same target is unity, provided both cross sections are reduced by the values of the corresponding total reaction cross sections sigma/sub R/, and evaluated for the same total kinetic energy of the projectile. The results of this comparison for the targets studied are presented and discussed

  10. Whole-genome amplified DNA from stored dried blood spots is reliable in high resolution melting curve and sequencing analysis

    DEFF Research Database (Denmark)

    Winkel, Bo G; Hollegaard, Mads V; Olesen, Morten S

    2011-01-01

    BACKGROUND: The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted...

  11. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  12. DNA polymorphisms revealed by the RAPD technique show differences between radionuclide-contaminated and uncontaminated mosquitofish populations

    International Nuclear Information System (INIS)

    Theodorakis, C.W.; Shugart, L.R.

    1993-01-01

    In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations

  13. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  14. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  15. Chloroplast DNA variation in European white oaks phylogeography and patterns of diversity based on data from over 2600 populations

    NARCIS (Netherlands)

    Petit, R.J.; Csaikl, U.M.; Bordács, S.; Burg, K.; Coart, E.; Cottrell, J.; Dam, van B.C.; Deans, J.D.; Dumolin-LapOgue, S.; Fineschi, S.; Finkeldey, R.; Gillies, A.; Glaz, I.; Goicoechea, P.G.; Jensen, J.S.; König, A.O.; Lowe, A.J.; Madsen, S.F.; Mátyás, G.; Munro, R.C.; Olalde, M.; Pemonge, M.H.; Popescu, F.; Slade, D.; Tabbener, H.; Taurchini, D.; Vries, de S.G.M.; Ziegenhagen, B.; Kremer, A.

    2002-01-01

    A consortium of 16 laboratories have studied chloroplast DNA (cpDNA) variation in European white oaks. A common strategy for molecular screening, based on restriction analysis of four PCR-amplified cpDNA fragments, was used to allow comparison among the different laboratories. A total of 2613 oak

  16. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    Science.gov (United States)

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  17. Spatial variation of bacterial community composition near the Luzon ...

    African Journals Online (AJOL)

    Spatial variation of bacterial community composition near the Luzon strait assessed by polymerase chain reaction-denaturing gradient gel electrophoresis ... chain reaction (PCR)-amplified bacterial 16S ribosomal deoxyribonucleic acid (DNA) gene fragments and interpreted the results; its relationship with physical and ...

  18. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  19. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH.

    Science.gov (United States)

    Guillaud-Bataille, Marine; Valent, Alexander; Soularue, Pascal; Perot, Christine; Inda, Maria Mar; Receveur, Aline; Smaïli, Sadek; Roest Crollius, Hugues; Bénard, Jean; Bernheim, Alain; Gidrol, Xavier; Danglot, Gisèle

    2004-07-29

    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detection of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical 1 microg usually necessary. Using a discrete series of DNA fragments, we defined the parameters adapted to the most faithful ligation-mediated PCR amplification and the limits of the technique. The optimized protocol allows a 3000-fold DNA amplification, retaining the quantitative characteristics of the initial genome. Validation of the amplification procedure, using DNA from 10 tumour cell lines hybridized to BAC-arrays of 1500 spots, showed almost perfectly superimposed ratios for the non-amplified and amplified DNAs. Correlation coefficients of 0.96 and 0.99 were observed for regions of low-copy-level variations and all regions, respectively (including in vivo amplified oncogenes). Finally, labelling DNA using two nucleotides bearing the same fluorophore led to a significant increase in reproducibility and to the correct detection of one-copy gain or loss in >90% of the analysed data, even for pseudotriploid tumour genomes.

  20. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    OpenAIRE

    Panan Kanchanaphum

    2018-01-01

    This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...

  1. Evidence of authentic DNA from Danish Viking Age skeletons untouched by humans for 1,000 years

    DEFF Research Database (Denmark)

    Melchior, Linea; Kivisild, Toomas; Lynnerup, Niels

    2008-01-01

    -PCR work was carried out in a "clean- laboratory" dedicated solely to ancient DNA work. Mitochondrial DNA was extracted and overlapping fragments spanning the HVR-1 region as well as diagnostic sites in the coding region were PCR amplified, cloned and sequenced. Consistent results were obtained...

  2. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease.

    Science.gov (United States)

    Olsvik, B; Olsen, I; Tenover, F C

    1995-04-01

    The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.

  3. Validating PHITS for heavy ion fragmentation reactions

    International Nuclear Information System (INIS)

    Ronningen, Reginald M.

    2015-01-01

    The performance of the Monte Carlo code system PHITS is validated for heavy-ion transport capabilities by performing simulations and comparing results against experimental data from heavy-ion reactions of benchmark quality. These data are from measurements of isotope yields produced in the fragmentation of a 140 MeV/u "4"8Ca beam on a beryllium target and on a tantalum target. The results of this study show that PHITS performs reliably. (authors)

  4. Studies of complex fragment emission in heavy ion reactions: Progress report, September 1, 1987--August 31, 1988

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1988-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this emission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

  5. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  6. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  7. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  8. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

    Science.gov (United States)

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

    2011-09-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

  9. Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis

    NARCIS (Netherlands)

    Wang, G.; van Dam, A. P.; Spanjaard, L.; Dankert, J.

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA

  10. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  11. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Science.gov (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  12. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  13. Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

    Science.gov (United States)

    Tan, Ming-pu

    2010-01-01

    Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  14. Estimation of genetic variability among elite wheat genotypes using random amplified polymorphic DNA (RAPD) analysis

    International Nuclear Information System (INIS)

    BIBI, S.; Khan, I.A.; Naqvi, M.H.; Siddiqui, M.A.; Yasmeen, S.; Seema, M.

    2012-01-01

    Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)

  15. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  16. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  17. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  18. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  19. Essentials of Conservation Biotechnology: A mini review

    Science.gov (United States)

    Merlyn Keziah, S.; Subathra Devi, C.

    2017-11-01

    Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

  20. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  1. Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

    Directory of Open Access Journals (Sweden)

    Stephane Boyer

    Full Text Available DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI is over 600 base pairs (bp, amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R. This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey DNA from 46 landsnail (predator faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1 when dealing with degraded DNA for which only small fragments can be amplified, (2 for cases where no consensus has yet been reached on the appropriate barcode gene, or (3 to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

  2. Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

    Science.gov (United States)

    Boyer, Stephane; Brown, Samuel D J; Collins, Rupert A; Cruickshank, Robert H; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D

    2012-01-01

    DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

  3. Mechanism of chimera formation during the Multiple Displacement Amplification reaction

    Directory of Open Access Journals (Sweden)

    Stockwell Timothy B

    2007-04-01

    Full Text Available Abstract Background Multiple Displacement Amplification (MDA is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.

  4. Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

    Science.gov (United States)

    Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

    2016-02-02

    Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  6. Fission fragment angular distribution in the reaction 28Si+176Yb

    International Nuclear Information System (INIS)

    Tripathi, R.; Sudarshan, K.; Sharma, S.K.; Reddy, A.V.R.; Pujari, P.K.; Dutta, D.; Goswami, A.; Ramachandran, K.

    2009-01-01

    Fission fragment angular distribution has been measured in the reaction 28 Si+ 176 Yb at beam energies of 145 and 155 MeV to investigate the contribution from non-compound nucleus fission. Experiments were carried out at BARC-TIFR Pelletron-LINAC accelerator facility, Mumbai. Experimental angular anisotropies in this reaction were observed to be higher than those calculated using statistical theory, indicating contribution from non-compound nucleus fission in this reaction. (author)

  7. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  8. Studies of complex fragment emission in heavy ion reactions: Progress report, September 1, 1986 through August 31, 1987

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1987-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in non-compound reactions. This thread joins the apparently divergent subjects covered in this report. 39 refs., 24 figs., 2 tabs

  9. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  10. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  11. Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.

    Science.gov (United States)

    Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu

    2018-04-24

    We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.

  12. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  13. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  14. Silver nanoclusters-assisted ion-exchange reaction with CdTe quantum dots for photoelectrochemical detection of adenosine by target-triggering multiple-cycle amplification strategy.

    Science.gov (United States)

    Zhao, Yang; Tan, Lu; Gao, Xiaoshan; Jie, Guifen; Huang, Tingyu

    2018-07-01

    Herein, we successfully devised a novel photoelectrochemical (PEC) platform for ultrasensitive detection of adenosine by target-triggering cascade multiple cycle amplification based on the silver nanoparticles-assisted ion-exchange reaction with CdTe quantum dots (QDs). In the presence of target adenosine, DNA s1 is released from the aptamer and then hybridizes with hairpin DNA (HP1), which could initiate the cycling cleavage process under the reaction of nicking endonuclease. Then the product (DNA b) of cycle I could act as the "DNA trigger" of cycle II to further generate a large number of DNA s1, which again go back to cycle I, thus a cascade multiple DNA cycle amplification was carried out to produce abundant DNA c. These DNA c fragments with the cytosine (C)-rich loop were captured by magnetic beads, and numerous silver nanoclusters (Ag NCs) were synthesized by AgNO 3 and sodium borohydride. The dissolved AgNCs released numerous silver ions which could induce ion exchange reaction with the CdTe QDs, thus resulting in greatly amplified change of photocurrent for target detection. The detection linear range for adenosine was 1.0 fM ~10 nM with the detection limit of 0.5 fM. The present PEC strategy combining cascade multiple DNA cycle amplification and AgNCs-induced ion-exchange reaction with QDs provides new insight into rapid, and ultrasensitive PEC detection of different biomolecules, which showed great potential for detecting trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

    Science.gov (United States)

    Semina, A V; Polyakova, N E; Brykov, Vl A

    2007-12-01

    To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

  16. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  17. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  18. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  19. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  20. DNA sequences from two SSRs (CIR316 and MUCS088) linked to root-knot nematode resistance genes from diverse cottons (Gossypium spp).

    Science.gov (United States)

    We investigated DNA sequencing information from alleles (DNA amplified fragments) of two previously reported SSR markers (CIR316 and MUCS088) linked to root-knot nematode (RKN) resistance genes. Markers based on electrophoretic differences, including RFLPs, AFLPs and SSRs can sometimes mask underlyi...

  1. Growth of Fullerene Fragments Using the Diels-Alder Cycloaddition Reaction: First Step towards a C60 Synthesis by Dimerization

    Directory of Open Access Journals (Sweden)

    Julio A. Alonso

    2013-02-01

    Full Text Available Density Functional Theory has been used to model the Diels-Alder reactions of the fullerene fragments triindenetriphenilene and pentacyclopentacorannulene with ethylene and 1,3-butadiene. The purpose is to prove the feasibility of using Diels-Alder cycloaddition reactions to grow fullerene fragments step by step, and to dimerize fullerene fragments, as a way to obtain C60. The dienophile character of the fullerene fragments is dominant, and the reaction of butadiene with pentacyclopentacorannulene is favored.

  2. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  3. Amplified amperometric aptasensor for selective detection of protein using catalase-functional DNA-PtNPs dendrimer as a synergetic signal amplification label.

    Science.gov (United States)

    Zhang, Juan; Yuan, Yali; biXie, Shun; Chai, Yaqin; Yuan, Ruo

    2014-10-15

    In this work, we present a new strategy to construct an electrochemical aptasensor for sensitive detection of platelet-derived growth factor BB (PDGF-BB) based on the synergetic amplification of a three-dimensional (3D) nanoscale catalase (CAT) enzyme-functional DNA-platinum nanoparticles (PtNPs) dendrimer through autonomous layer-by-layer assembly. Firstly, polyamidoaminedendrimer (PAMAM) with a hyper-branched and three-dimensional structure was served as nanocarriers to coimmobilize a large number of PDGF-BB binding aptamer (PBA II) and ssDNA 1 (S1) to form PBA II-PAMAM-S1 bioconjugate. In the presence of PDGF-BB, the bioconjugate was self-assembled on the electrode by sandwich assay. Following that, the carried S1 propagated a chain reaction of hybridization events between CAT-PtNPs-S1 and CAT-PtNPs-ssDNA 2 (S2) to form a 3D nanoscale CAT-functional PtNPs-DNA dendrimer, which successfully immobilized substantial CAT enzyme and PtNPs with superior catalysis activity. In this process, the formed negatively charged double-helix DNA could cause the intercalation of hexaammineruthenium(III) chloride (RuHex) into the groove via electrostatic interactions. Thus, numerous RuHex redox probes and CAT were decorated inside/outside of the dendrimer. In the presence of H2O2 in electrolytic cell, the synergistic reaction of CAT and PtNPs towards electrocatalysis could further amplify electrochemical signal. Under optimal condition, the CAT-PtNPs-DNA dendrimer-based sensing system presented a linear dependence between the reduction peak currents and logarithm of PDGF-BB concentrations in the range of 0.00005-35 nM with a relatively low detection limit of 0.02 pM. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    Science.gov (United States)

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  5. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  6. A Novel Computational Method to Reduce Leaky Reaction in DNA Strand Displacement

    Directory of Open Access Journals (Sweden)

    Xin Li

    2015-01-01

    Full Text Available DNA strand displacement technique is widely used in DNA programming, DNA biosensors, and gene analysis. In DNA strand displacement, leaky reactions can cause DNA signals decay and detecting DNA signals fails. The mostly used method to avoid leakage is cleaning up after upstream leaky reactions, and it remains a challenge to develop reliable DNA strand displacement technique with low leakage. In this work, we address the challenge by experimentally evaluating the basic factors, including reaction time, ratio of reactants, and ion concentration to the leakage in DNA strand displacement. Specifically, fluorescent probes and a hairpin structure reporting DNA strand are designed to detect the output of DNA strand displacement, and thus can evaluate the leakage of DNA strand displacement reactions with different reaction time, ratios of reactants, and ion concentrations. From the obtained data, mathematical models for evaluating leakage are achieved by curve derivation. As a result, it is obtained that long time incubation, high concentration of fuel strand, and inappropriate amount of ion concentration can weaken leaky reactions. This contributes to a method to set proper reaction conditions to reduce leakage in DNA strand displacement.

  7. Fragment production in 12-GeV proton-induced reactions

    International Nuclear Information System (INIS)

    Hirata, Yuichi; Ohnishi, Akira; Ohtsuka, Naohiko; Nara, Yasushi; Niida, Koji; Chiba, Satoshi; Takada, Hiroshi

    2000-01-01

    We study mass and angular distribution of Intermediate Mass Fragment (IMF) produced from p(12 GeV)+ 197 Au reaction by using JAM cascade model combined with percolation model. Although the mass distribution of IMF is well reproduced, the experimentally observed sideward peak of IMF angular distribution is not explained within present JAM + percolation model. (author)

  8. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  9. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  10. Development of DNA marker for Fusarium resistance in Pisang Berangan

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Mohd Nazir Basiran; Rosmawati Shaharuddin

    2000-01-01

    Fusarium wilt (Panama disease), a disease caused by a soil-bome fungus Fusarium oxysporum f. sp. cubense, is regarded as one of the most significant threats to banana (Musa spp.) production worldwide. In Malaysia, it is affecting the Cavendish as well as Pisang Berangan which are widely planted for export as well as for local consumption. Pisang Berangan mutant line (MB96) which was obtained through induced mutation by gamma irradiation has showed certain degree of tolerance towards the disease. Attempts were made to utilise Polymerase Chain Reaction (PCR) based techniques i.e. RAPD (Random Amplified Polymorphic DNA) to screen for unique DNA sequences that are associated or closely linked to these tolerance characteristics. Four single 1 Obp primers and five duplex 1 Obp primers combinations were used to detect polymorphism between the DNA of control and 4 mutant lines micropropagated from MB96. As further control, DNA of Pisang Mas was included. Duplex arbitrary primer combinations 11-89 and single primer OPA-3 have produced DNA fragments that are polymorphic between cultivar, Pisang Berangan and Pisang Mas. However the RAPD analysis failed to show any polymorphism between the control and the mutant lines or in between the mutant lines

  11. Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV

    International Nuclear Information System (INIS)

    Kehoe, W.L.; Mignerey, A.C.; Bradley, S.

    1989-03-01

    Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab

  12. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  13. Applicability of SCAR markers to food genomics: olive oil traceability.

    Science.gov (United States)

    Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson

    2007-07-25

    DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

  14. UVB DNA dosimeters analyzed by polymerase chain reactors

    International Nuclear Information System (INIS)

    Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

    1997-01-01

    Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

  15. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  16. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  17. Improved molecular detection of Babesia infections in animals using a novel quantitative real-time PCR diagnostic assay targeting mitochondrial DNA.

    Science.gov (United States)

    Qurollo, Barbara A; Archer, Nikole R; Schreeg, Megan E; Marr, Henry S; Birkenheuer, Adam J; Haney, Kaitlin N; Thomas, Brittany S; Breitschwerdt, Edward B

    2017-03-07

    Babesiosis is a protozoal, tick transmitted disease found worldwide in humans, wildlife and domesticated animals. Commonly used approaches to diagnose babesiosis include microscopic examination of peripheral blood smears, detection of circulating antibodies and PCR. To screen and differentiate canine Babesia infections many PCR assays amplify the 18S rRNA gene. These sequences contain hypervariable regions flanked by highly conserved regions allowing for amplification of a broad-range of Babesia spp. However, differences in the 18S rRNA gene sequence of distantly related clades can make it difficult to design assays that will amplify all Babesia species while excluding the amplification of other eukaryotes. By targeting Babesia mitochondrial genome (mtDNA), we designed a novel three primer qPCR with greater sensitivity and broader screening capabilities to diagnose and differentiate Babesia spp. Using 13 Babesia mtDNA sequences, a region spanning two large subunit rRNA gene fragments (lsu5-lsu4) was aligned to design three primers for use in a qPCR assay (LSU qPCR) capable of amplifying a wide range of Babesia spp. Plasmid clones were generated and used as standards to determine efficiency, linear dynamic range and analytical sensitivity. Animals naturally infected with vector-borne pathogens were tested retrospectively and prospectively to determine relative clinical sensitivity and specificity by comparing the LSU qPCR to an established 18S rDNA qPCR. The LSU qPCR efficiencies ranged between 92 and 100% with the limit of detection at five copies/reaction. The assay did not amplify mammalian host or other vector-borne pathogen gDNA except Cytauxzoon felis (a feline protozoal pathogen). The LSU qPCR assay amplified 12 different Babesia. sp. and C. felis from 31/31 (100%) archived samples, whereas the 18S qPCR amplified only 26/31 (83.9%). By prospective analysis, 19/394 diagnostic accessions (4.8%) were LSU qPCR positive, compared to 11/394 (2.8%) 18S rDNA q

  18. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  19. Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification.

    Directory of Open Access Journals (Sweden)

    Yohei Nishikawa

    Full Text Available Whole genome amplification (WGA is essential for obtaining genome sequences from single bacterial cells because the quantity of template DNA contained in a single cell is very low. Multiple displacement amplification (MDA, using Phi29 DNA polymerase and random primers, is the most widely used method for single-cell WGA. However, single-cell MDA usually results in uneven genome coverage because of amplification bias, background amplification of contaminating DNA, and formation of chimeras by linking of non-contiguous chromosomal regions. Here, we present a novel MDA method, termed droplet MDA, that minimizes amplification bias and amplification of contaminants by using picoliter-sized droplets for compartmentalized WGA reactions. Extracted DNA fragments from a lysed cell in MDA mixture are divided into 105 droplets (67 pL within minutes via flow through simple microfluidic channels. Compartmentalized genome fragments can be individually amplified in these droplets without the risk of encounter with reagent-borne or environmental contaminants. Following quality assessment of WGA products from single Escherichia coli cells, we showed that droplet MDA minimized unexpected amplification and improved the percentage of genome recovery from 59% to 89%. Our results demonstrate that microfluidic-generated droplets show potential as an efficient tool for effective amplification of low-input DNA for single-cell genomics and greatly reduce the cost and labor investment required for determination of nearly complete genome sequences of uncultured bacteria from environmental samples.

  20. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  1. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  2. Isotopic resolution of fission fragments from 238U + 12C transfer and fusion reactions

    International Nuclear Information System (INIS)

    Caamano, M.; Rejmund, F.; Derkx, X.; Schmidt, K. H.; Andouin, L.; Bacri, C. O.; Barreau, G.; Benlliure, J.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Jurado, B.; Lemasson, A.; Navin, A.; Rejmund, M.; Roger, T.; Shrivastava, A.; Schmitt, C.; Taieb, J.

    2010-01-01

    Recent results from an experiment at GANIL, performed to investigate the main properties of fission-fragment yields and energy distributions in different fissioning nuclei as a function of the excitation energy, in a neutron-rich region of actinides, are presented. Transfer reactions in inverse kinematics between a 238 U beam and a 12 C target produced different actinides, within a range of excitation energy below 30 MeV. These fissioning nuclei are identified by detecting the target-like recoil, and their kinetic and excitation energy are determined from the reconstruction of the transfer reaction. The large-acceptance spectrometer VAMOS was used to identify the mass, atomic number and charge state of the fission fragments in flight. As a result, the characteristics of the fission-fragment isotopic distributions of a variety of neutron-rich actinides are observed for the first time over the complete range of fission fragments. (authors)

  3. Electrochemical detection of C-reactive protein using Copper nanoparticles and hybridization chain reaction amplifying signal.

    Science.gov (United States)

    Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong

    2017-12-15

    In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Genetic diversity and differentiation in Prunus species (Rosaceae) using chloroplast and mitochondrial DNA CAPS markers.

    Science.gov (United States)

    Ben Mustapha, S; Ben Tamarzizt, H; Baraket, G; Abdallah, D; Salhi Hannachi, A

    2015-04-27

    Chloroplast (cpDNA) and mitochondrial DNA (mtDNA) were analyzed to establish genetic relationships among Tunisian plum cultivars using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) technique. Two mtDNA regions (nad 1 b/c and nad 4 1/2) and a cpDNA region (trnL-trnF) were amplified and digested using restriction enzymes. Seventy and six polymorphic sites were revealed in cpDNA and mtDNA, respectively. As a consequence, cpDNA appears to be more polymorphic than mtDNA. The unweighted pair group method with arithmetic mean (UPGMA) dendrogram showed that accessions were distributed independently of their geographical origin, and introduced and local cultivars appear to be closely related. Both UPGMA and principal component analysis grouped Tunisian plum accessions into similar clusters. The analysis of the pooled sequences allowed the detection of 17 chlorotypes and 12 mitotypes. The unique haplotypes detected for cultivars are valuable for management and preservation of the plum local resources. From this study, PCR-RFLP analysis appears to be a useful approach to detect and identify cytoplasmic variation in plum trees. Our results also provide useful information for the management of genetic resources and to establish a program to improve the genetic resources available for plums.

  5. Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

    Science.gov (United States)

    Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

    2010-01-01

    This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

  6. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  7. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  8. DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa

    Directory of Open Access Journals (Sweden)

    Xu Yanhao

    2017-01-01

    Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.

  9. Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

    Science.gov (United States)

    Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

    2017-08-15

    Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk

    2000-07-01

    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  11. Analysis of DNA methylation in various swine tissues.

    Directory of Open Access Journals (Sweden)

    Chun Yang

    Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.

  12. Total DNA of Glycyrrhiza uralensis transformed into Hansenula anomala by ion implantation:Preparing Glycyrrhizic acid in recombined yeasts

    International Nuclear Information System (INIS)

    Jin Xiang; Mao Peihong; Lu Jie; Ma Yuan

    2010-01-01

    Glycyrrhizic acid (GA) in Glycyrrhiza uralensis (G. uralensis) is physiologically active. In this study, the total DNA of wild G. uralensis was randomly transformed into Hansenula anomaly by implantation of low-energy Ar + and N + , to produce five recombinant yeast strains relating to biological synthesis of the GA or Glycyrrhetinic acid (GAs). After culturing in liquid medium for 96 h, the resultant GA, 18α-GAs and 18β-Gas were determined by reversed-phase high performance liquid chromatography (RP-HPLC), and the corresponding concentrations were 114.49, 0.56, and 0.81 mg·L -1 . After one hundred primers were analyzed with random amplified polymorphic DNA (RAPD), the seven different DNA fragments were produced by the N7059 strain of recombined yeasts, and, the polymerase chain reaction (PCR) verified that one of them came from the genome of G. uralensis, indicating a successful transfer of genetic information by ion implantation. (authors)

  13. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  14. Effects of heat stress on gene expression in eggplant ( Solanum ...

    African Journals Online (AJOL)

    In order to identify differentially expressed genes involved in heat shock response, cDNA amplified fragment length polymorphism (cDNA-AFLP) and quantitative real-time polymerase chain reaction (QPCR) were used to study gene expression of eggplant seedlings subjected to 0, 6 and 12 h at 43°C. A total of 53 of over ...

  15. A Western-blot assay for the detection of antibodies against pathogenic Leptospira serogroups with recombinant outer membrane protein LipL32

    OpenAIRE

    Hong-yuan DUAN; Zhi-guo LIU; Shao-fu QIU; Bin HE; Hai ZHAO; Li-hua SONG; Hong ZHU; Qing DUAN

    2011-01-01

    Objective To provide a possible antigen for rapid serodiagnosis of leptospirosis,the present study focused on the activity of immune-reaction and cross-reaction between outer membrane protein LipL32 and multi-serogroup anti-pathogenic Leptospira antibodies.Methods Based on the given sequence of LipL32 gene of Leptospira icterohaemorrhagiae strain 56601,the primer pair was designed and the DNA fragment was amplified by PCR.The amplified product was inserted into vector pET-28a-(c) to construct...

  16. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  17. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  18. Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

    Science.gov (United States)

    Pegels, N; González, I; Fernández, S; García, T; Martín, R

    2012-01-01

    A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

  19. Projectile like fragment production in Ar induced reactions around the Fermi energy

    International Nuclear Information System (INIS)

    Borrel, V.; Gatty, B.; Jacquet, D.; Galin, J.

    1986-01-01

    The production of projectile like fragments (PLF) has been studied in Ar induced reactions on various targets. It shows very clearly, that besides the predominance of fragmentation for most of the products, the transfer process is still a very strong component for products nearby the projectile. The influence of the target neutron excess on the PLF production is investigated as well as the evolution with incident energy of the characteristics of the different competing processes

  20. a bare Nanocapillary for DNA Separation and Genotyping analysis in Gel-Free solutions without application of external electric field

    Science.gov (United States)

    Wang, Xiayan; Wang, Shili; Veerappan, Vijaykumar; Byun, Chang Kyu; Nguyen, Han; Gendhar, Brina; Allen, Randy D.; Liu, Shaorong

    2009-01-01

    In this work, we demonstrate DNA separation and genotyping analysis in gel-free solutions using a nanocapillary under pressure-driven conditions without application of an external electric field. The nanocapillary is a ~50-cm-long and 500-nm-radius bare fused silica capillary. After a DNA sample is injected, the analytes are eluted out in a chromatographic separation format. The elution order of DNA molecules follows strictly with their sizes, with the longer DNA being eluted out faster than the shorter ones. High resolutions are obtained for both short (a few bases) and long (tens of thousands of base pairs) DNA fragments. Effects of key experimental parameters, such as eluent composition and elution pressure, on separation efficiency and resolution are investigated. We also apply this technique for DNA separations of real-world genotyping samples to demonstrate its feasibility in biological applications. PCR products (without any purification) amplified from Arabidopsis plant genomic DNA crude preparations are directly injected into the nanocapillary, and PCR-amplified DNA fragments are well resolved, allowing for unambiguous identification of samples from heterozygous and homozygous individuals. Since the capillaries used to conduct the separations are uncoated, column lifetime is virtually unlimited. The only material that is consumed in these assays is the eluent, and hence the operation cost is low. PMID:18500828

  1. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  2. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  3. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  4. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  5. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  6. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  7. Genomic relations among 31 species of Mammillaria haworth (Cactaceae) using random amplified polymorphic DNA.

    Science.gov (United States)

    Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda

    2006-01-01

    Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.

  8. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  9. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  10. Risk assessment of cadmium-contaminated soil on plant DNA damage using RAPD and physiological indices

    International Nuclear Information System (INIS)

    Liu Wan; Yang, Y.S.; Li, P.J.; Zhou, Q.X.; Xie, L.J.; Han, Y.P.

    2009-01-01

    Impact assessment of contaminants in soil is an important issue in environmental quality study and remediation of contaminated land. A random amplified polymorphic DNA (RAPD) 'fingerprinting' technique was exhibited to detect genotoxin-induced DNA damage of plants from heavy metal contaminated soil. This study compared the effects occurring at molecular and population levels in barley seedlings exposed to cadmium (Cd) contamination in soil. Results indicate that reduction of root growth and increase of total soluble protein level in the root tips of barley seedlings occurred with the ascending Cd concentrations. For the RAPD analyses, nine 10-base pair (bp) random RAPD primers (decamers) with 60-70% GC content were found to produce unique polymorphic band patterns and subsequently were used to produce a total of 129 RAPD fragments of 144-2639 base pair in molecular size in the root tips of control seedlings. Results produced from nine primers indicate that the changes occurring in RAPD profiles of the root tips following Cd treatment included alterations in band intensity as well as gain or loss of bands compared with the control seedlings. New amplified fragments at molecular size from approximately 154 to 2245 bp appeared almost for 10, 20 and 40 mg L -1 Cd with 9 primers (one-four new polymerase chain reaction, (PCR) products), and the number of missing bands enhanced with the increasing Cd concentration for nine primers. These results suggest that genomic template stability reflecting changes in RAPD profiles were significantly affected and it compared favourably with the traditional indices such as growth and soluble protein level at the above Cd concentrations. The DNA polymorphisms detected by RAPD can be applied as a suitable biomarker assay for detection of the genotoxic effects of Cd stress in soil on plants. As a tool in risk assessment the RAPD assay can be used in characterisation of Cd hazard in soil

  11. Things fall apart: Fragmentation reactions in the oxidative aging of organic species

    Science.gov (United States)

    Kroll, J. H.; Isaacman-VanWertz, G. A.; Wilson, K. R.; Daumit, K. E.; Kessler, S. H.; Lim, C. Y.; Worsnop, D. R.

    2016-12-01

    The atmospheric oxidation of organic compounds involves a wide array of chemical transformations, including functionalization reactions (addition of polar functional groups to the carbon skeleton), fragmentation reactions (formation of lower carbon-number products via C-C bond scission), and accretion reactions (increases in molecular weight by the combination of two chemical species). Each of these reaction classes can lead to large changes in volatility, and hence can have major implications for atmospheric organic aerosol (OA). For example, the formation of OA is predominantly driven by functionalization and accretion reactions, which generally lead to decreases in volatility. Here we describe a series of laboratory studies of the subsequent organic "aging", the multiday oxidation processes that occur after the initial OA formation and growth. In these studies, the multigenerational oxidation of organic compounds in various phases (the gas phase, the condensed OA phase, and the aqueous phase) is carried out within either an environmental chamber or a flow reactor, and monitored using various high-resolution mass spectrometric techniques. In all cases it is found that fragmentation reactions play a major role in the observed aging chemistry, dominated by the formation of small, volatile oxidation products. These results suggest that multi-day oxidative aging processes do not lead to sustained aerosol growth, but rather may serve as a chemical sink for atmospheric OA.

  12. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  13. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  14. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  15. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  16. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

    Science.gov (United States)

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

    2017-02-07

    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  17. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  18. Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

    Science.gov (United States)

    Johnsen, G; Kruse, H; Hofshagen, M

    2006-12-01

    We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

  19. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  20. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  1. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  2. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  3. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

    2006-01-01

    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  4. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  5. Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi Otimização da reação de amplificação aleatória do DNA polimórfico - reação em cadeia da polimerase para tipagem molecular de Salmonella enterica sorovar Typhi

    Directory of Open Access Journals (Sweden)

    Bianca Ramalho Quintaes

    2004-03-01

    Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e

  6. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  7. Complex nuclear-structure phenomena revealed from the nuclide production in fragmentation reactions

    International Nuclear Information System (INIS)

    Ricciardi, M.V.; Kelic, A.; Napolitani, P.; Schmidt, K.H.; Yordanov, O.; Ignatyuk, A.V.; Rejmund, F.

    2003-12-01

    Complex structural effects in the nuclide production from the projectile fragmentation of 1 A GeV 238 U nuclei in a titanium target are reported. The structure seems to be insensitive to the excitation energy induced in the reaction. This is in contrast to the prominent structural features found in nuclear fission and in transfer reactions, which gradually disappear with increasing excitation energy. Using the statistical model of nuclear reactions, relations to structural effects in nuclear binding and in the nuclear level density are demonstrated. (orig.)

  8. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  9. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  10. Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

    Directory of Open Access Journals (Sweden)

    Sonal Jain

    Full Text Available Ancient DNA (aDNA analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating using confocal laser scanning microscopy (CLSM. DNA was isolated from five eggshell fragments and a 43 base pair (bp sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

  11. Fragmentation and direct transfer reactions for 40Ar incident beam on 27Al target at 1760 MeV

    International Nuclear Information System (INIS)

    Cisse, Ousmane

    1985-01-01

    Peripheral collision studies performed with 40 Ar projectiles at 44 MeV/A and 27 Al target show that both fragmentation and transfer reactions can be discerned in this type of interaction. The experimental observation of fragments with masses charges and velocities close to those of the incident beam are the signature of transfer reactions and a detailed analysis of the energy spectra of such fragments has been carried out and interpreted in terms of a direct diffraction transfer model. On the other hand, for large mass transfer reactions, abrasion is the suitable mechanism. Inclusive fragment measurement together with the appropriate residual nuclei-fragment coincidence results then provides experimental data in good agreement with the theoretical predictions obtained from a participant spectator model. These investigations also indicate that the separation energies of the participant from the spectator nucleus, at least within the framework of the above model, can be interpreted in terms of a friction force which becomes more efficient as the projectile energy decreases. (author) [fr

  12. Nuclear fragmentation reactions in extended media studied with Geant4 toolkit

    Energy Technology Data Exchange (ETDEWEB)

    Pshenichnov, Igor, E-mail: pshenich@fias.uni-frankfurt.d [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Botvina, Alexander [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Mishustin, Igor [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Kurchatov Institute, Russian Research Center, 123182 Moscow (Russian Federation); Greiner, Walter [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany)

    2010-03-15

    It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.

  13. Nuclear fragmentation reactions in extended media studied with Geant4 toolkit

    International Nuclear Information System (INIS)

    Pshenichnov, Igor; Botvina, Alexander; Mishustin, Igor; Greiner, Walter

    2010-01-01

    It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.

  14. Ontology aided modeling of organic reaction mechanisms with flexible and fragment based XML markup procedures.

    Science.gov (United States)

    Sankar, Punnaivanam; Aghila, Gnanasekaran

    2007-01-01

    The mechanism models for primary organic reactions encoding the structural fragments undergoing substitution, addition, elimination, and rearrangements are developed. In the proposed models, each and every structural component of mechanistic pathways is represented with flexible and fragment based markup technique in XML syntax. A significant feature of the system is the encoding of the electron movements along with the other components like charges, partial charges, half bonded species, lone pair electrons, free radicals, reaction arrows, etc. needed for a complete representation of reaction mechanism. The rendering of reaction schemes described with the proposed methodology is achieved with a concise XML extension language interoperating with the structure markup. The reaction scheme is visualized as 2D graphics in a browser by converting them into SVG documents enabling the desired layouts normally perceived by the chemists conventionally. An automatic representation of the complex patterns of the reaction mechanism is achieved by reusing the knowledge in chemical ontologies and developing artificial intelligence components in terms of axioms.

  15. Assessing the germplasm of Laminaria (phaeophyceae) with random amplified polymorphic DNA (RAPD) method

    Science.gov (United States)

    He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin

    2003-06-01

    Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.

  16. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  17. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  18. Molecular identification of Mango, Mangifera indica L.var. totupura

    Science.gov (United States)

    Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

    2011-01-01

    Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

  19. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Science.gov (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  20. Cu-Mediated Stille Reactions of Sterically Congested Fragments: Towards the Total Synthesis of Zoanthamine

    DEFF Research Database (Denmark)

    Nielsen, Thomas E.; Le Quement, Sebastian; Juhl, Martin

    2005-01-01

    A study on the Stille reaction of alkenyl iodides and starmanes with structural resemblance to retrosynthetic fragments of a projected total synthesis of the marine alkaloid zoanthamine was carried out. A range of reaction conditions was examined, and a protocol developed by Corey utilizing excess...

  1. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  2. DNA analysis for section identification of individual Pinus pollen grains from Belukha glacier, Altai Mountains, Russia

    International Nuclear Information System (INIS)

    Nakazawa, Fumio; Uetake, Jun; Motoyama, Hideaki; Imura, Satoshi; Kanda, Hiroshi; Suyama, Yoshihisa; Kaneko, Ryo; Takeuchi, Nozomu; Fujita, Koji

    2013-01-01

    Pollen taxon in sediment samples can be identified by analyzing pollen morphology. Identification of related species based on pollen morphology is difficult and is limited primarily to genus or family. Because pollen grains of various ages are preserved at below 0 °C in glaciers and thus are more likely to remain intact or to suffer little DNA fragmentation, genetic information from such pollen grains should enable identification of plant taxa below the genus level. However, no published studies have attempted detailed identification using DNA sequences obtained from pollen found in glaciers. As a preliminary step, this study attempted to analyze the DNA of Pinus pollen grains extracted from surface snow collected from the Belukha glacier in the Altai Mountains of Russia in the summer of 2003. A 150-bp rpoB fragment from the chloroplast genome in each Pinus pollen grain was amplified by polymerase chain reaction, and DNA products were sequenced to identify them at the section level. A total of 105 pollen grains were used for the test, and sequences were obtained from eight grains. From the sequences obtained, the pollen grains were identified as belonging to the section Quinquefoliae. Trees of the extant species Pinus sibirica in the section Quinquefoliae are currently found surrounding the glacier. The consistency of results for this section suggests that the pollen in the glacier originated from the same Pinus trees as those found in the immediate surroundings. (letter)

  3. DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.

    Science.gov (United States)

    Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan

    2015-09-01

    Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.

  4. Construction and expression of a functional monoclonal antibody SZ-51 specific for GMP-140 chimeric fab fragment in Escherichia coli

    International Nuclear Information System (INIS)

    Gu Jianming; Zhang Xiaomin; Xia Lijun; Wan Haiying; Liu Yue; Li Peixia; Ruan Changgeng

    1996-04-01

    The variable region cDNAs of a monoclonal antibody SZ-51 specific for α-granule membrane protein (GMP-140) on the surface of activated human platelets were spliced with the constant region cDNA of the heavy chain CH1 and light chain k of human Ig G by means of the gene recombination techniques. The above recombinant gene was amplified by the polymerase chain reaction (PCR). The expression vector of phage plasmid pHEN1 SZ-51 Fab/Hu was constructed. The pHEN1-51 Fab/Hu was introduced into non-suppressor E. coli HB2151. The amount of expression of SZ-51 chimeric Fab/Hu measured by quantitative ELISA was about 500 μg/L. Western blot demonstrated that the SZ-51 chimeric Fab fragment could specifically bind to GMP-140. (2 figs.)

  5. Populations of excited states and reaction mechanisms in the emission of complex fragments

    International Nuclear Information System (INIS)

    Gomez del Campo, J.

    1990-01-01

    Cross sections for emission of complex fragments (Z>2) in their ground and excited states are presented for several heavy-ion reactions at bombarding energies above 10 MeV/nucleon. Data presented are mostly on the cross sections extracted by γ-ray techniques. It is shown that a simple statistical approach to associate the ratio, of cross sections for excited states and ground states, to the temperature of the emitter fails to give the expected temperatures. However, it is shown that this is mostly due to the fact that the fragments that γ decay are secondary fragments, produced by the particle decay of the primary emitted complex fragments. A Hauser-Feshbach analysis accounts well for the cross sections and extracted temperatures. 22 refs., 6 figs

  6. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

    1986-01-01

    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  7. Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1991-01-01

    A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  8. Random amplified polymorphic DNA markers of the Brassica alboglabra chromosome of a B. campestris-alboglabra addition line

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Chen, B.Y.; Cheng, B.F.

    1996-01-01

    The alien C-genome chromosome in a Brassica campestris-alboglabra monosomic addition line was characterized by random amplified polymorphic DNA (RAPD) analysis. The alien chromosome carried three loci, E(c), W-c and Lap-1C, controlling synthesis of erucic acid, white flower colour and a fast...

  9. Real-time polymerase chain reaction assay for endogenous reference gene for specific detection and quantification of common wheat-derived DNA (Triticum aestivum L.).

    Science.gov (United States)

    Vautrin, Sonia; Zhang, David

    2007-01-01

    A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.

  10. Optimization of methods to assess mitochondrial DNA in archival paraffin-embedded tissues from mammary canine tumors Otimização dos métodos para avaliar o DNA mitocondrial obtido a partir de tumores mamários caninos incluídos em parafina

    Directory of Open Access Journals (Sweden)

    Angélica C. Bertagnolli

    2008-08-01

    Full Text Available In this study we describe the alterations used to extract and amplify mitochondrial desoxyribonucleic acid (DNA from formalin-fixed paraffin-embedded samples of canine mammary tumors. The epithelial and mesenchymal components (chondromyxoid and chondroid of each tumor, as well as the normal mammary gland tissues, were manually microdissected from 19 mixed canine mammary tumors (10 benign mixed tumors and nine carcinomas arising in mixed tumors. DNA was extracted by Invisorb® Spin Tissue Mini Kit, with protocol changes proposed by the manufacturer. A 273-bp fragment was amplified by polymerase chain reaction (PCR and submitted to automatic sequence analysis. The fragment was successfully analyzed in 100% of the samples. However, an additional lysis step, the reduction of volume in buffer solutions and PCR, a higher annealing temperature and an increase in the number of PCR cycles were required. The initial PCR products were diluted and re-amplified in six samples so that they could be successfully analyzed.A presente comunicação descreve as modificações usadas para extrair e amplificar o DNA mitocondrial obtido de amostras de tumores mamários caninos fixados em formol tamponado a 10% e incluídos em parafina. Os componentes epiteliais e mesenquimais (condromixóide e condróide, bem como a mama normal adjacente, foram microdissectados manualmente de 19 tumores mamários (10 tumores mistos benignos e nove carcinomas em tumores mistos. O DNA foi extraído utilizando-se o Invisorb® Spin Tissue Mini Kit com modificações do protocolo proposto pelo fabricante. Um fragmento de 273-pb foi amplificado por reação em cadeia da polimerase (PCR e seqüenciado em seqüenciador automático. O fragmento foi analisado em 100% das amostras, entretanto modificações como lise adicional, redução do volume das soluções de extração e PCR, aumento da temperatura de anelamento e do número de ciclos de amplificação foram necessárias. Em seis

  11. Chemical modifications and reactions in DNA nanostructures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2017-01-01

    such as hydrocarbons or steroids have been introduced to change the surface properties of DNA origami structures, either to protect the DNA nanostructure or to dock it into membranes and other hydrophobic surfaces. DNA nanostructures have also been used to control covalent chemical reactions. This article provides......DNA nanotechnology has the power to form self-assembled and well-defined nanostructures, such as DNA origami, where the relative positions of each atom are known with subnanometer precision. Our ability to synthesize oligonucleotides with chemical modifications in almost any desired position...... provides rich opportunity to incorporate molecules, biomolecules, and a variety of nanomaterials in specific positions on DNA nanostructures. Several standard modifications for oligonucleotides are available commercially, such as dyes, biotin, and chemical handles, and such modified oligonucleotides can...

  12. Analysis for fragmentation products of proton-induced reactions on Pb with energy up to GeV

    International Nuclear Information System (INIS)

    Fan Sheng; Li Zhuxia; Zhao Zhixiang; Ding Dazhao

    2002-01-01

    The mass and charge distribution of residual products produced in the spallation reaction needs to be studied because it can provide useful information for the disposal of nuclear and the radiation damage in the spallation target. The mass and charge distribution of the spallation products is studied by using quantum molecular dynamic (QMD) models. The simulation results are well agreed with the experimental data of the spallation fragment and empirical formula. However, QMD model does not include the fission process; the calculations can not reproduce the fission fragment. The fission model is introduced into QMD model to investigate the fragment products from proton-induced reactions on Pb. The results are in good agreement with the experimental data

  13. Antigen-antibody reactions of UV-irradiated phage DNA

    International Nuclear Information System (INIS)

    Fink, A.

    1976-01-01

    The observation of others could be confirmed that UV-irradiated DNA is a better immunogen than unirradiated DNA. The author's immune sera contained a high amount of antibodies with a specific action against photoproducts in the DNA. The thymine dimer was identified as relevant photoproduct and thus as antigenic determinant. In comparison, the amount of unspecific antibodies reacting with denaturated DNA was low and varied between sera. Thymin-dimer antibodies showed a high specificity without cross-reaction with other pyrimidine dimers such as anti CC and anti CT; they belong to the class of IgG molecules. UV-irradiated dinucleotide dTpT is sufficient to induce the formation of antibodies reacting with the cis-syn thymine dimers in UV-irradiated DNA. Antibody binding is proportional to the UV doses applied to the DNA. When using completely denaturated DNA, there is a linear increase changing into a plateau at higher doses. The extent of antigen-antibody binding is strongly dependent on the degree of denaturation of the DNA. With increasing denaturation, the antibody binding of the DNA increases. The antigen-antibody reaction can thus be used to estimate the degree of denaturation of the DNA. There were no signs of an influence of the degree of denaturation of the DNA on the quantum yield of thymine dimers. The different amounts of antibodies is therefore due to the masking of thymine dimers in native DNA. When irradiating intact phage particles, there was no sign of an influence of the phages' protein covers on the antibody binding capacity of DNA compared with DNA irradiated in vitro. (orig.) [de

  14. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  15. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  16. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  19. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  20. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  1. Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

    2011-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

  2. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  3. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  4. PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)

    Energy Technology Data Exchange (ETDEWEB)

    McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))

    1991-09-25

    Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.

  5. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  6. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  7. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  8. Search for ternary fragmentation in the reaction 856 MeV 98Mo + 51V: Kinematic probing of intermediate-mass-fragment emissions

    International Nuclear Information System (INIS)

    Vardaci, Emanuele; Kaplan, Morton; Parker, Winifred E.; Moses, David J.; Boger, J.T.; Gilfoyle, G.T.; McMahan, M.A.; Montoya, M.

    2000-05-01

    A new technique has been applied to coincidence measurements between fission fragments (FF) and intermediate mass fragments (IMF) emitted from the composite system 149 65 Tb at an excitation energy of 224 MeV. The method permits simultaneous observation of IMF emissions along and normal to the FF separation axes. For the integrated total of 0.10 +-0.02 IMF emitted per fission, we find no significant correlation with FF direction, suggesting that IMFs associated with fission reactions are predominantly emitted from the system prior to fission

  9. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  10. [Construction of a low-pH-sensing system in Streptococcus mutans].

    Science.gov (United States)

    Di, Kang; Yuqing, Li; Xuedong, Zhou

    2017-06-01

    To construct a low-pH-sensing system in Streptococcus mutans (S. mutans) and to visually detect the pH in situ. Promoter of ureaseⅠ(PureⅠ) and green fluorescence protein (gfp) DNA fragments were amplified by polymerase chain reaction (PCR) from the genome of Streptococcus salivarius 57.I and S. mutans containing the gfp fragment. The two amplified DNA fragments were ligated together and further integrated into pDL278 to construct the recombinant plasmid pDL278-pureⅠ-gfp. This recombinant plasmid was then transformed into S. mutans UA159 cells. Subsequently, the intensity of the optical density per unit area of the low-pH-sensing system was measured and compared under different pH conditions and different processing times. PureⅠ and gfp DNA fragments were amplified successfully with the correct molecule sizes (450 and 717 bp, respectively). The recombinant plasmid pDL278-pureⅠ-gfp was constructed and further verified by PCR and sequencing. The intensity of the optical density per unit area of the low-pH-sensing system increased with decreasing pH and increasing processing time. A low-pH-sensing system was constructed successfully in S. mutans. Our research verified that pureⅠ of Streptococcus salivarius can function well in S. mutans as an acid induced promoter, and provided a new method of detecting the pH of plaque biofilms in situ.

  11. Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

    Science.gov (United States)

    Rosser, A; Rollinson, D; Forrest, M; Webster, B L

    2015-09-04

    Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

  12. Knockout and fragmentation reactions using a broad range of tin isotopes

    Science.gov (United States)

    Rodríguez-Sánchez, J. L.; Benlliure, J.; Bertulani, C. A.; Vargas, J.; Ayyad, Y.; Alvarez-Pol, H.; Atkinson, J.; Aumann, T.; Beceiro-Novo, S.; Boretzky, K.; Caamaño, M.; Casarejos, E.; Cortina-Gil, D.; Díaz-Cortes, J.; Fernández, P. Díaz; Estrade, A.; Geissel, H.; Kelić-Heil, A.; Litvinov, Yu. A.; Mostazo, M.; Paradela, C.; Pérez-Loureiro, D.; Pietri, S.; Prochazka, A.; Takechi, M.; Weick, H.; Winfield, J. S.

    2017-09-01

    Production cross sections of residual nuclei obtained by knockout and fragmentation reactions of different tin isotopes accelerated at 1 A GeV have been measured with the fragment separator (FRS) at GSI, Darmstadt. The new measurements are used to investigate the neutron-excess dependence of the neutron- and proton-knockout cross sections. These cross sections are compared to Glauber model calculations coupled to a nuclear de-excitation code in order to investigate the role of the remnant excitations. This bench marking shows an overestimation of the cross sections for the removal of deeply bound nucleons. A phenomenological increase in the excitation energy induced in the remnants produced in these cases allows us to reproduce the measured cross sections.

  13. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  14. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  15. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    Energy Technology Data Exchange (ETDEWEB)

    Caetano-Anolles, G [Department of Biology, University of Oslo, Oslo (Norway)

    2001-11-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  16. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    International Nuclear Information System (INIS)

    Caetano-Anolles, G.

    2001-01-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  17. Gene expression analysis by cDNA-AFLP highlights a set of new signaling networks and translational control during seed dormancy breaking in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe

    2005-03-01

    Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.

  18. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  19. Systematic evaluation of bias in microbial community profiles induced by whole genome amplification.

    Science.gov (United States)

    Direito, Susana O L; Zaura, Egija; Little, Miranda; Ehrenfreund, Pascale; Röling, Wilfred F M

    2014-03-01

    Whole genome amplification methods facilitate the detection and characterization of microbial communities in low biomass environments. We examined the extent to which the actual community structure is reliably revealed and factors contributing to bias. One widely used [multiple displacement amplification (MDA)] and one new primer-free method [primase-based whole genome amplification (pWGA)] were compared using a polymerase chain reaction (PCR)-based method as control. Pyrosequencing of an environmental sample and principal component analysis revealed that MDA impacted community profiles more strongly than pWGA and indicated that this related to species GC content, although an influence of DNA integrity could not be excluded. Subsequently, biases by species GC content, DNA integrity and fragment size were separately analysed using defined mixtures of DNA from various species. We found significantly less amplification of species with the highest GC content for MDA-based templates and, to a lesser extent, for pWGA. DNA fragmentation also interfered severely: species with more fragmented DNA were less amplified with MDA and pWGA. pWGA was unable to amplify low molecular weight DNA (microbial communities in low-biomass environments and for currently planned astrobiological missions to Mars. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  1. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    Science.gov (United States)

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  2. Branched-DNA signal amplification combined with paper chromatography hybridization assay and used in hepatitis B virus DNA detection

    International Nuclear Information System (INIS)

    Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.

    2002-01-01

    Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal

  3. Fragment formation in GeV-energy proton and light heavy-ion induced reactions

    International Nuclear Information System (INIS)

    Murakami, T.; Haga, M.; Haseno, M.

    2002-01-01

    We have investigated similarities and differences among the fragment formation processes in GeV-energy light-ion and light heavy-ion induced reactions. We have newly measured inclusive and exclusive energy spectra of intermediate mass fragments (3 ≤ Z ≤ 30; IMFs) for 8-GeV 16 O and 20 Ne and 12-GeV 20 Ne induced target multifragmentations (TMFs) in order to compare them with those previously measured for 8- and 12-GeV proton induced TMFs. We fond noticeable difference in their spectrum shapes and magnitudes but all of them clearly indicate the existence of sideward-peaked components, indicating fragment formations are mainly dictated not by a incident energy per nucleon but by a total energy of the projectile. (author)

  4. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  5. Analysis of production of forward-angle fragments in the 22Ne (40 AMeV + 9Be reaction

    Directory of Open Access Journals (Sweden)

    G. Kaminski

    2008-12-01

    Full Text Available A mechanisms of production of forward-emitted fragments in the 22Ne (40 АMeV + 9Be reaction are investigated. Inclusive velocity and isotopic distributions of products with 3 ≤ Z ≤ 11 were measured on the fragment separator COMBAS. The contribution of direct processes and dissipative ones is presented. Gaussian fitting functions according to Goldhaber formalism has been used to estimate direct components of fragments velocity distributions. Experimental data have been compared to geometric incomplete fusion model predictions. Incomplete fusion model was the first time applied for light nuclei as in the studied reaction system. Overall agreement of simulations with experiment in description of velocity distributions have been achieved for fragments with atomic number close to the projectile mass and for stable isotopes. Discrepancies for other products are the result of transition from incomplete fusion to direct processes with collisions of clusters in the participant zone.

  6. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  7. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Directory of Open Access Journals (Sweden)

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  8. Sources and characteristics of complex fragments in La-induced reactions

    International Nuclear Information System (INIS)

    Roussel-Chomaz, P.; Blumenfeld, Y.; Charity, R.; Colonna, M.; Colonna, N.; Libby, B.; Hanold, K.; Moretto, L.; Peaslee, G.; Wozniak, G.

    1991-01-01

    Complex fragment emission has been studied for a variety of reactions at intermediate energies. Multifragment events are shown to be associated with specific sources characterized by their mass and excitation energy through the incomplete fusion model. Excitation functions for the different multifragment decay channels are found to be almost independent of the system and the incident energy. Preliminary comparisons of the data with dynamical calculations followed by statistical decay calculations are discussed. 11 refs., 7 figs

  9. Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

    Science.gov (United States)

    Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

    2000-01-01

    Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

  10. Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

    1976-01-01

    Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...

  11. Methylation sensitive amplified polymorphism (MSAP) reveals that ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... Key words: Salt stress, alkali stress, Gossypium hirsutum L., DNA methylation, methylation sensitive amplified polymorphism (MSAP). INTRODUCTION. DNA methylation is one of the key epigenetic mecha- nisms among eukaryotes that can modulate gene expression without the changes of DNA sequence.

  12. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  13. Emission of complex fragments in the reaction Ar+Au at 44 and 77 A.MeV

    International Nuclear Information System (INIS)

    Sokolov, A.; Guerreau, D.; Jiang, D.X.; Cramer, B.; Ingold, G.; Gatty, B.; Lott, B.; Piasecki, E.

    1992-01-01

    Complex fragment emission from the 44 and 77 A.MeV 40 Ar + 197 Au reaction was investigated, and complex fragments have been detected, together with the associated neutron multiplicity distributions, and are seen to be preferentially emitted in violent collisions. Equilibrium and non-equilibrium components were identified which are discussed in terms of statistical emission from the hot target-like fragment and of a possible persistence of a deep-inelastic process. (R.P.) 45 refs.; 16 figs.; 1 tab

  14. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  15. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  16. Reporting detection of Chlamydia trachomatis DNA in tissues of neonatal death cases

    Directory of Open Access Journals (Sweden)

    Maria Hernandez Trejo

    2014-04-01

    Full Text Available OBJECTIVE: to determine whether C. trachomatis was present in neonates with infection, but without an isolated pathogen, who died during the first week of life. METHODS: early neonatal death cases whose causes of death had been previously adjudicated by the institutional mortality committee were randomly selected. End-point and real-time polymerase chain reaction of the C. trachomatis omp1 gene was used to blindly identify the presence of chlamydial DNA in the paraffinized samples of five organs (from authorized autopsies of each of the dead neonates. Additionally, differential diagnoses were conducted by amplifying a fragment of the 16S rRNA of Mycoplasma spp. RESULTS: in five cases (35.7%, C. trachomatis DNA was found in one or more organs. Severe neonatal infection was present in three cases; one of them corresponded to genotype D of C. trachomatis. Interestingly, another case fulfilled the same criteria but had a positive polymerase chain reaction for Mycoplasma hominis, a pathogen known to produce sepsis in newborns. CONCLUSION: the use of molecular biology techniques in these cases of early infant mortality demonstrated that C. trachomatis could play a role in the development of severe infection and in early neonatal death, similarly to that observed with Mycoplasma hominis. Further study is required to determine the pathogenesis of this perinatal infection.

  17. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  18. [Impact of sperm DNA and acrosome integrity and acrosome reaction rate on outcomes of rescue intracytoplasmic sperm injection].

    Science.gov (United States)

    He, Yongzhi; Li, Dawen; Cheng, Junping; Huo, Zhongchao; Huang, Hongyi; Xiao, Xin

    2016-01-01

    Objective To explore the effects of sperm DNA integrity rate, acrosome integrity rate and acrosome reaction rate on the outcomes of rescue intracytoplasmic sperm injection (ICSI). This retrospective analysis was conducted among 97 infertile couples receiving rescue ICSI due to failure of in vitro fertilization procedures in our Reproductive Medicine Center. Of these 97 women, 41 had clinical pregnancy and 56 did not, and the effects of sperm DNA integrity rate (estimated by DNA fragmentation index, DFI), acrosome integrity rate and acrosome reaction rate on rescue ICSI outcomes were analyzed. No significant difference was found in paternal age, testosterone value, testicular volume, FSH, female patient' age or the number of eggs retrieved between the two groups (P>0.05), but the infertility years was significantly shorter in the pregnancy group than in the non-pregnancy group (Prate and cleavage rate were similar between the two groups (P>0.05), but the good embryo rate was significantly higher in the pregnancy group (Preaction rate did not differ significantly between the two groups (P>0.05), but the acrosome integrity rate was significantly higher in the pregnancy group (Prate, acrosome integrity or acrosome reaction rate were not correlated with the fertilization rate, cleavage rate or good embryo rate (P>0.05). The pregnancy rate, twin and single fetus rates were 42.3%, 10.3% and 32.0% in this cohort after recue ICSI, respectively. Rescue ICSI is an effective treatment after failed in vitro fertilization procedure, and sperm acrosome integrity rate is associated with the outcome of rescue ICSI.

  19. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

  20. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  1. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  2. Quantum Correlated Multi-Fragment Reaction Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Feagin, James M. [California State Univ., Fullerton, CA (United States)

    2017-06-30

    This grant supported research in basic atomic, molecular and optical physics related to the interactions of atoms with particles and fields. This report will focus on the 12 year period from 2004 to 2017, although the DOE–BES has supported my research every year since 1986. All of the support from the grant was used to pay summer salaries of the PI and students and travel to conferences and meetings. The results were in the form of publications in peer reviewed journals as well as conference invited talks and colloquiums. There were 12 peer reviewed publications in these 12+ years. Innovations in few-body science at molecular and nano levels are a critical component of on- going efforts to establish sustainable environmental and energy resources. The varied research paths taken will require the development of basic science on broad fronts with increasing flexi- bility to crossover technologies. We thus worked to extract understanding and quantum control of few-body microscopic systems based on our long-time experience with more conventional studies of correlated electrons and ions. Given the enormous advances over the past 20 years to our understanding of quantum cor- relations with photon interferometry, AMO collision science generally is ready to move beyond the one-particle, single-port momentum detection that has dominated collision physics since Rutherford. Nevertheless, our familiar theoretical tools for collision theory need to be up- graded to incorporate these more generalized measurement formalisms and ultimately to give incentive for a new generation of experiments. Our interest in these topics remains motivated by the recent surge in and success of exper- iments involving few-body atomic and molecular fragmentation and the detection of all the fragments. The research described here thus involved two parallel efforts with (i) emphasis on reaction imaging while (ii) pursuing longtime work on quantum correlated collective excitations.

  3. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.

    1990-01-01

    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  4. Effect of pyrimido[1,6-a]benzimidazoles, quinolones, and Ca2+ on the DNA gyrase-mediated cleavage reaction.

    Science.gov (United States)

    Gmünder, H; Kuratli, K; Keck, W

    1995-01-01

    The quinolones inhibit the A subunit of DNA gyrase in the presence of Mg2+ by interrupting the DNA breakage and resealing steps, and the latter step is also retarded without quinolones if Mg2+ is replaced by Ca2+. Pyrimido[1,6-a]benzimidazoles have been found to represent a new class of potent DNA gyrase inhibitors which also act at the A subunit. To determine alterations in the DNA sequence specificity of DNA gyrase for cleavage sites in the presence of inhibitors of both classes or in the presence of Ca2+, we used DNA restriction fragments of 164, 85, and 71 bp from the pBR322 plasmid as model substrates. Each contained, at a different position, the 20-bp pBR322 sequence around position 990, where DNA gyrase preferentially cleaves in the presence of quinolones. Our results show that pyrimido[1,6-a]benzimidazoles have a mode of action similar to that of quinolones; they inhibit the resealing step and influence the DNA sequence specificity of DNA gyrase in the same way. Differences between inhibitors of both classes could be observed only in the preferences of DNA gyrase for these cleavage sites. The 20-bp sequence appeared to have some properties that induced DNA gyrase to cleave all three DNA fragments in the presence of inhibitors within this sequence, whereas cleavage in the presence of Ca2+ was in addition dependent on the length of the DNA fragments. PMID:7695300

  5. DNA methylation changes detected by methylation-sensitive amplified polymorphism in two contrasting rice genotypes under salt stress.

    Science.gov (United States)

    Wang, Wensheng; Zhao, Xiuqin; Pan, Yajiao; Zhu, Linghua; Fu, Binying; Li, Zhikang

    2011-09-20

    DNA methylation, one of the most important epigenetic phenomena, plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli. In the present study, a methylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress. Consistent with visibly different phenotypes in response to salt stress, epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salt-tolerant FL478 and salt-sensitive IR29. In addition, most tissue-specific DNA methylation loci were conserved, while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes. Strikingly, salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478. This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage, and helps to further elucidate the implications of DNA methylation in crop growth and development. Copyright © 2011. Published by Elsevier Ltd.

  6. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  7. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  8. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  9. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    Science.gov (United States)

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  10. Random amplified polymorphic DNA analysis of Anopheles nuneztovari (Diptera: Culicidae from Western and Northeastern Colombia

    Directory of Open Access Journals (Sweden)

    Carmen Elisa Posso

    2003-06-01

    Full Text Available Random amplified polymorphic DNA (RAPD markers were used to analyze 119 DNA samples of three Colombian Anopheles nuneztovari populations to study genetic variation and structure. Genetic diversity, estimated from heterozygosity, averaged 0.34. Genetic flow was greater between the two populations located in Western Colombia (F ST: 0.035; Nm: 6.8 but lower between these two and the northeastern population (F ST: 0.08; Nm: 2.8. According to molecular variance analysis, the genetic distance between populations was significant (phiST 0.1131, P < 0.001. The variation among individuals within populations (phiST 0.8869, P < 0.001was also significant, suggesting a greater degree of population subdivision, not considered in this study. Both the parameters evaluated and the genetic flow suggest that Colombian An. nuneztovari populations are co-specific.

  11. Composting oily sludges: Characterizing microflora using randomly amplified polymorphic DNA

    International Nuclear Information System (INIS)

    Persson, A.; Quednau, M.; Ahrne, S.

    1995-01-01

    Laboratory-scale composts in which oily sludge was composted under mesophilic conditions with amendments such as peat, bark, and fresh or decomposed horse manure, were studied with respect to basic parameters such as oil degradation, respirometry, and bacterial numbers. Further, an attempt was made to characterize a part of the bacterial flora using randomly amplified polymorphic DNA (RAPD). The compost based on decomposed horse manure showed the greatest reduction of oil (85%). Comparison with a killed control indicated that microbial degradation actually had occurred. However, a substantial part of the oil was stabilized rather than totally broken down. Volatiles, on the contrary, accounted for a rather small percentage (5%) of the observed reduction. RAPD indicated that a selection had taken place and that the dominating microbial flora during the active degradation of oil were not the same as the ones dominating the different basic materials. The stabilized compost, on the other hand, had bacterial flora with similarities to the ones found in peat and bark

  12. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  13. Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

    OpenAIRE

    Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

    2001-01-01

    Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

  14. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  15. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Charity, R.J.; Sobotka, L.G.

    1992-01-01

    Our work involves the study of intermediate energy heavy-ion nuclear reactions. This work has two foci. On the one hand, we desire to learn about the properties of nuclear matter under abnormal conditions, in this energy domain, predominately low densities. This purpose runs abreast of the second, which is the study of the relevant reaction mechanisms. The two objectives are inexorably linked because our experimental laboratory for studying nuclear matter properties is a dynamic one. We are forced to ask how nuclear matter properties, such as phase transitions, are reflected in the dynamics of the reactions. It may be that irrefutable information about nuclear matter will not be extracted from the reaction work. Nevertheless, we are compelled to undertake this effort not only because it is the only game in town and as yet we do not know that information cannot be extracted, but also because of our second objective. The process leads to an understanding of the reaction mechanism themselves and therefore to the response characteristics of finite, perhaps non-equilibrium, strongly interacting systems. Our program has been: To study energy, mass, and angular momentum deposition by studying incomplete fusion reactions. To gain confidence that we understand how highly excited systems decompose by studying all emissions from the highly excited systems. To push these kinds of studies into the intermediate energy domain, with excitation function studies. And attempt to learn about the dynamics of the decays using particle-particle correlations. In the last effort, we have decided to focus on simple systems, where we believe, definitive statements are possible. These avenues of research share a common theme, large complex fragment production

  16. Coincidence measurements of intermediate mass fragments produced in /sup 32/S-induced reactions on Ag at E/A = 22.5 MeV

    International Nuclear Information System (INIS)

    Fields, D.J.; Lynch, W.G.; Nayak, T.K.

    1986-01-01

    Single- and two-particle inclusive cross sections for the production of light nuclei and intermediate mass fragments, 3< or =Z< or =24, were measured at angles well beyond the grazing angle for /sup 32/S-induced reactions on Ag at 720 MeV. Information about fragment multiplicities and reaction dynamics was extracted from measurements of light particles, intermediate mass fragments, and targetlike residues in coincidence with intermediate mass fragments. Incomplete linear momentum transfer and non-compound-particle emission are important features of collisions producing intermediate mass fragments. About half of the incident kinetic energy in these collisions is converted into internal excitation. The mean multiplicity of intermediate mass fragments is of the order of 1. Particle correlations are strongly enhanced in the plane which contains the intermediate mass fragment and the beam axis

  17. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  18. DNA cards: determinants of DNA yield and quality in collecting genetic samples for pharmacogenetic studies.

    Science.gov (United States)

    Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia

    2007-08-01

    As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.

  19. Tagging genes for drought resistance by DNA markers in wheat (abstract)

    International Nuclear Information System (INIS)

    Malik, T.A.; Rahman, S.; Zafar, Y.

    2005-01-01

    Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

  20. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  1. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  2. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  3. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Directory of Open Access Journals (Sweden)

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  4. MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

    Science.gov (United States)

    Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

    2012-05-01

    MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

  5. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H

    2013-12-03

    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  6. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  7. Research on critical behaviour during fragmentation of the projectile in the Xe+Sn (at 50 MeV/A) reaction; Recherche d`un comportement critique dans la fragmentation du projectile dans la reaction Xe+Sn a 50 MeV/A

    Energy Technology Data Exchange (ETDEWEB)

    Benlliure, J

    1995-03-01

    The study of moments of fragments charge distributions produced in heavy ions collisions can give us evidence of a critical behavior of nuclear matter which could explain the multifragmentation pattern. From an experimental point of view, in order to perform this capabilities of the INDRA detector has made it possible to identify all these particles and to reconstruct the initial projectile-like fragment coming from binary collisions in the reaction Xe+Sn at 50 MeV/A. We have selected events where the initial projectile-like fragments keep their entire charge in a large range of excitation energy. The study of these fragment`s characteristics show clearly a change in the deexcitation pattern. The evolution of moments of the fragment charge distributions has been reproduced within a percolation model, in this sense we can interpreter this change in the deexcitation pattern as a function of the initial projectile-like fragment`s size shows the existence of finite-size effects. However, the signature of a phase transition remains independent on the projectile-like fragment`s size. (author). 74 refs., 58 figs., 9 tabs.

  8. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  9. Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

    Science.gov (United States)

    Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

    2012-04-01

    To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  10. Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance

    Directory of Open Access Journals (Sweden)

    Haque Kashif A

    2005-09-01

    Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of

  11. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  12. Yeast two-hybrid screening of proteins interacting with plasmin receptor subunit: C-terminal fragment of annexin A2.

    Science.gov (United States)

    Li, Qun; Laumonnier, Yves; Syrovets, Tatiana; Simmet, Thomas

    2011-11-01

    To identify proteins that interact with the C-terminal fragment of annexin A2 (A2IC), generated by plasmin cleavage of the plasmin receptor, a heterotetramer (AA2t) containing annexin A2. The gene that encodes the A2IC fragment was obtained from PCR-amplified cDNA isolated from human monocytes, and was ligated into the pBTM116 vector using a DNA ligation kit. The resultant plasmid (pBTM116-A2IC) was sequenced with an ABI PRISM 310 Genetic Analyzer. The expression of an A2IC bait protein fused with a LexA-DNA binding domain (BD) was determined using Western blot analysis. The identification of proteins that interact with A2IC and are encoded in a human monocyte cDNA library was performed using yeast two-hybrid screening. The DNA sequences of the relevant cDNAs were determined using an ABI PRISM BigDye terminator cycle sequencing ready reaction kit. Nucleotide sequence databases were searched for homologous sequences using BLAST search analysis (http://www.ncbi.nlm.nih.gov). Confirmation of the interaction between the protein LexA-A2IC and each of cathepsin S and SNX17 was conducted using a small-scale yeast transformation and X-gal assay. The yeast transformed with plasmids encoding the bait proteins were screened with a human monocyte cDNA library by reconstituting full-length transcription factors containing the GAL4-active domain (GAL4-AD) as the prey in a yeast two-hybrid approach. After screening 1×10(7) clones, 23 independent β-Gal-positive clones were identified. Sequence analysis and a database search revealed that 15 of these positive clones matched eight different proteins (SNX17, ProCathepsin S, RPS2, ZBTB4, OGDH, CCDC32, PAPD4, and actin which was already known to interact with annexin A2). A2IC A2IC interacts with various proteins to form protein complexes, which may contribute to the molecular mechanism of monocyte activation induced by plasmin. The yeast two-hybrid system is an efficient approach for investigating protein interactions.

  13. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  14. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  15. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    Science.gov (United States)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  16. Coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16O on 27Al

    International Nuclear Information System (INIS)

    Shen Wenqing; Zhan Wenlong; Zhu Yongtai

    1988-01-01

    In a coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16 O on 27 Al, the contour plot of Galilean-invariant cross section of the coincidence between C-fragments and α-particles in the velocity plane, and the coincident angular correlation have been obtained. The correlated α-particles measured at positive angles (on the same side of the beam as the projectile-like fragments) were emitted mainly from the projectile-like fragments;the α-particles at large negative angles were emitted from the target-like fragments;the α-particles at small negative angles came from the fragmentation of the 16 O projectile. A possible reaction mechanism in which the residue produced in the fragmentation of the projectile continues the dissipation process during the interaction with the target has been discussed. It is also pointed out that in the large yield of C-fragments observed in the inclusive experiment, the contribution of C-fragments produced by the excited 16 O of DIC product via α-emission is quite small

  17. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  18. Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

  19. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  20. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

    Science.gov (United States)

    Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

    2014-06-01

    The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.