WorldWideScience

Sample records for reaction pcr detection

  1. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  2. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  3. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Rajeh Ali

    2014-06-20

    Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.

  4. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  5. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  6. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

    OpenAIRE

    ÖZKUL, Aykut

    2002-01-01

    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  7. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  8. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  9. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  10. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  11. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Science.gov (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  12. Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

    Digital Repository Service at National Institute of Oceanography (India)

    Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

    Journal of Tropical Medicine and Public Health 22 (Suppl.), 174–178. Duenngai, K., Sithithaworn, P., Rudrappa, U.K., Karunasagar, I., Laha, T., Stensvold, C.R., Strandgaard, H., Johansen, M.V., 2008. Improvement of PCR for detection of Opisthrochis... and lecithodendriid trematodes. Southeast Asian Journal of Tropical Medicine and Public Health 22, 623–630. Kobayashi, J., Vannachone, B., Sato, Y., Manivong, K., Nambanya, S., Inthakone, S., 2000. An epidemiological study on Opisthorchis viverrini infection in Lao...

  13. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  14. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

    OpenAIRE

    Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

    2014-01-01

    Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

  16. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    Science.gov (United States)

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  17. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    Science.gov (United States)

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  18. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  19. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Lina, M.; Dadang, S.; Suhadi, F.

    2002-01-01

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  20. FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

    Science.gov (United States)

    Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

    2007-01-01

    We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

  1. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  2. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  3. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  5. Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

    Science.gov (United States)

    Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

    2001-06-01

    A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

  6. Detection of Salmonella Spp., Shigella (Flexneri and Sonnei) and Vibrio Cholerae O1 by Polymerase Chain Reaction (PCR) in Exported Shrimp from the Mexican Northeast Coast

    Energy Technology Data Exchange (ETDEWEB)

    Perez, L.; Nuñez, F.; Rubio, M.; Nicoli, M. [Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia (Mexico)

    2005-01-15

    The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)

  7. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  8. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  9. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.

    2005-01-01

    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  10. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  11. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

    OpenAIRE

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-01-01

    Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

  12. Detection of human papilloma virus (HPV and human immunodeficiency virus (HIV in oral squamous cell carcinoma: A polymerized chain reaction (PCR study

    Directory of Open Access Journals (Sweden)

    Suresh Dirasantchu

    2015-01-01

    Full Text Available Aims and Objectives: Certain strains of human papillomavirus (HPV have been shown to be etiologically related to the development of uterine, cervical, and other genital cancers, but their role in the development of malignancies at other sites is less well established. Previous studies have shown HPV in tumors of the head and neck, but its prevalence has varied depending on the detection methods and the types of tumor and/or tissue examined. This study was undertaken for the detection of high-risk HPV types 16 and 18 and human immunodeficiency virus (HIV in oral squamous cell carcinoma. Materials and Methods: Twenty-five patients histologically diagnosed with oral squamous cell carcinoma and 10 apparently normal persons as controls were selected for the present study. Two biopsy specimens were removed surgically by incision biopsy for histopathological examination and polymerized chain reaction (PCR study. Results: Out of 25 oral squamous cell carcinoma subjects, 8 were found to be HPV positive in PCR. Out of these eight subjects, four had HPV 16 and the other four had other genotypes, and one subject was HIV positive. Conclusion: The conclusion drawn from the present study was that well-defined risk factors like HPV may play a prominent role in the development of oral squamous cell carcinomas, in addition to other risk factors. Further studies with a larger sample size are necessary to arrive at conclusions and to explore the relationship of HPV and HIV in oral squamous cell carcinoma.

  13. Intracellular alkaline proteases produced by thermoacidophiles: detection of protease heterogeneity by gelatin zymography and polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Kocab, S.; Erdem, B. [Middle East Technical University, Ankara (Turkey). Dept. of Biological Sciences

    2002-08-01

    In this study 24 thermoacidophilic archeal and bacterial strains isolated from hot-springs and hot-soils were screened for their ability to produce intracellular alkaline proteases. The protease activities of the strains, based on azocasein hydrolysis, showed a variation from 0.6 to 5.1 U. The cell extracts of three most potent producers were further examined and it was found that their proteases exhibited maximum activity at 60-70{sup o}C and showed a pH optimum over a range of pH 7.0-8.5. Gelatin zymography revealed that two of the selected archeal strains produced multiple active SDS-resistant proteases. On the other hand, PCR amplification of alkaline serine protease gene sequences of total DNA from all isolates yielded four distinct amplification fragments of 650, 450, 400 and 300 bp, which might have been derived from different serine protease genes. (author)

  14. Human herpesvirus 8 (HHV-8 detected by nested polymerase chain reaction (PCR in HIV patients with or without Kaposi's sarcoma. An analytic cross-sectional study

    Directory of Open Access Journals (Sweden)

    Paula Renata Lima Machado

    Full Text Available CONTEXT AND OBJECTIVE: Kaposi's sarcoma (KS is a common neoplastic disease in AIDS patients. The aim of this study was to evaluate the frequency of human herpesvirus 8 (HHV-8 infection in human immunodeficiency virus (HIV-infected patients, with or without KS manifestations and correlate HHV-8 detection with KS staging. DESIGN AND SETTING: Analytic cross-sectional study conducted in a public tertiary-level university hospital in Ribeirão Preto, São Paulo, Brazil. METHODS: Antibodies against HHV-8 lytic-phase antigens were detected by means of the immunofluorescence assay. HHV-8 DNA was detected in the patient samples through a nested polymerase chain reaction (nested PCR that amplified a region of open reading frame (ORF-26 of HHV-8. RESULTS: Anti-HHV-8 antibodies were detected in 30% of non-KS patients and 100% of patients with KS. Furthermore, the HHV-8 DNA detection rates observed in HIV-positive patients with KS were 42.8% in serum, 95.4% in blood samples and 100% in skin biopsies; and in patients without KS, the detection rate was 4% in serum. Out of the 16 serum samples from patients with KS-AIDS who were classified as stage II, two were positive (12.5%; and out of the 33 samples from patients in stage IV, 19 (57.6% were positive. CONCLUSION: We observed an association between HHV-8 detection and disease staging, which was higher in the serum of patients in stage IV. This suggests that detection of HHV-8 DNA in serum could be very useful for clinical assessment of patients with KS and for monitoring disease progression.

  15. Real-Time Fluorogenic Polymerase Chain Reaction (PCR) Assays to Nucleic Acid-Based Detection of Simulants and Biothreat Agents

    National Research Council Canada - National Science Library

    Khan, Akbar S; O'Connell, Kevin P; Bucher, Jennifer R; Anderson, Patricia E; Cao, Cheng J; Gostomski, Mark V; Valdes, James J

    2003-01-01

    .... We describe here assays for the detection of the gene encoding staphylococcal enterotoxin A (SEA), a toxin produced by the bacterium Staphylococcus aureus and an agent responsible for a significant fraction of food poisoning incidents worldwide...

  16. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

    Directory of Open Access Journals (Sweden)

    Carroll Bernie

    2010-03-01

    Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

  17. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  18. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  19. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  20. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

    2011-01-01

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

  1. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  2. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

  3. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  4. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  5. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    Science.gov (United States)

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. [Optimized application of nested PCR method for detection of malaria].

    Science.gov (United States)

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  7. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  8. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  9. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  10. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Directory of Open Access Journals (Sweden)

    Roman Wölfel

    2012-08-01

    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  11. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  12. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  13. Detection of Aspergillus flavus and A. fumigatus in Bronchoalveolar Lavage Specimens of Hematopoietic Stem Cell Transplants and Hematological Malignancies Patients by Real-Time Polymerase Chain Reaction, Nested PCR and Mycological Assays

    Science.gov (United States)

    Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash

    2015-01-01

    Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133

  14. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

    Directory of Open Access Journals (Sweden)

    Amanda de Faveri Pitz

    2013-12-01

    Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  15. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

    Science.gov (United States)

    Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

    2013-01-01

    Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  16. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  17. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    African Journals Online (AJOL)

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  19. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  20. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  1. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  2. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  3. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  4. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  5. The use of nested PCR in the polymerase chain reaction for the detection of Phytophthora fragariae and P. cactorum in strawberry,

    NARCIS (Netherlands)

    Lacourt, I.; Bonants, P.J.M.; Gent-Pelzer, van M.P.; Cooke, D.E.L.; Hagenaar-de Weerdt, M.; Surplus, L.; Duncan, J.M.

    1997-01-01

    Phytophthora fragariae var. fragariae Hickman, which causes red core disease of strawberry, is a quarantine organism on which a nil tolerance is placed. Detection of the fungus is by a root tip bait test which is highly specific and sensitive but time-consuming (5–6 weeks), has to be done at 12°C

  6. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; ARSLAN, Ali

    2014-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  7. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  8. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  9. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  10. Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

    NARCIS (Netherlands)

    Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

    2001-01-01

    A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

  11. Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

    Science.gov (United States)

    Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

    2018-02-01

    Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  13. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

    NARCIS (Netherlands)

    Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

    2005-01-01

    Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

  14. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia

    2011-03-03

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

  15. Fast detection of genetic information by an optimized PCR in an interchangeable chip.

    KAUST Repository

    Wu, Jinbo

    2012-02-01

    In this paper, we report the construction of a polymerase chain reaction (PCR) device for fast amplification and detection of DNA. This device consists of an interchangeable PCR chamber, a temperature control component as well as an optical detection system. The DNA amplification happens on an interchangeable chip with the volumes as low as 1.25 μl, while the heating and cooling rate was as fast as 12.7°C/second ensuring that the total time needed of only 25 min to complete the 35 cycle PCR amplification. An optimized PCR with two-temperature approach for denaturing and annealing (Td and Ta) of DNA was also formulated with the PCR chip, with which the amplification of male-specific sex determining region Y (SRY) gene marker by utilizing raw saliva was successfully achieved and the genetic identification was in-situ detected right after PCR by the optical detection system.

  16. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Science.gov (United States)

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  17. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  18. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Science.gov (United States)

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  20. Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

    International Nuclear Information System (INIS)

    Pavelic, J.

    1996-07-01

    Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

  1. Real-Time PCR for Universal Phytoplasma Detection and Quantification

    DEFF Research Database (Denmark)

    Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens

    2013-01-01

    Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...

  2. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Science.gov (United States)

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  3. Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

    Science.gov (United States)

    Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2011-01-01

    It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

  4. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)

    DR. AMINU

    Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.

  5. The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

    Science.gov (United States)

    Filipiak, Anna; Hasiów-Jaroszewska, Beata

    2016-04-01

    The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

    Science.gov (United States)

    Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

    2015-01-01

    We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

  7. Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

    Science.gov (United States)

    Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

    2018-01-10

    Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

  8. Detection of mRNA by reverse transcription PCR as an indicator of viability in Phytophthora ramorum

    Science.gov (United States)

    Antonio Chimento; Santa Olga Cacciola; Matteo Garbelotto

    2008-01-01

    Real-Time PCR technologies offer increasing opportunities to detect and study phytopathogenic fungi. They combine the sensitivity of conventional PCR with the generation of a specific fluorescent signal providing both real-time analysis of the reaction kinetics and quantification of specific DNA targets. Before the development of Real-Time PCR and...

  9. Immunoliposome-PCR: a generic ultrasensitive quantitative antigen detection system

    Directory of Open Access Journals (Sweden)

    He Junkun

    2012-06-01

    Full Text Available Abstract Background The accurate quantification of antigens at low concentrations over a wide dynamic range is needed for identifying biomarkers associated with disease and detecting protein interactions in high-throughput microarrays used in proteomics. Here we report the development of an ultrasensitive quantitative assay format called immunoliposome polymerase chain reaction (ILPCR that fulfills these requirements. This method uses a liposome, with reporter DNA encapsulated inside and biotin-labeled polyethylene glycol (PEG phospholipid conjugates incorporated into the outer surface of the liposome, as a detection reagent. The antigenic target is immobilized in the well of a microplate by a capture antibody and the liposome detection reagent is then coupled to a biotin-labeled second antibody through a NeutrAvidin bridge. The liposome is ruptured to release the reporter DNA, which serves as a surrogate to quantify the protein target using real-time PCR. Results A liposome detection reagent was prepared, which consisted of a population of liposomes ~120 nm in diameter with each liposome possessing ~800 accessible biotin receptors and ~220 encapsulated reporters. This liposome detection reagent was used in an assay to quantify the concentration of carcinoembryonic antigen (CEA in human serum. This ILPCR assay exhibited a linear dose–response curve from 10-10 M to 10-16 M CEA. Within this range the assay coefficient of variance was Conclusions The ILPCR assay has several advantages over other immuno-PCR methods. The reporter DNA and biotin-labeled PEG phospholipids spontaneously incorporate into the liposomes as they form, simplifying preparation of the detection reagent. Encapsulation of the reporter inside the liposomes allows nonspecific DNA in the assay medium to be degraded with DNase I prior to quantification of the encapsulated reporter by PCR, which reduces false-positive results and improves quantitative accuracy. The ability to

  10. PCR detection of potato cyst nematode.

    Science.gov (United States)

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  11. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  12. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  13. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    Science.gov (United States)

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  14. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  15. Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.

    Science.gov (United States)

    West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D

    1995-01-01

    A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625

  16. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  17. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  18. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  19. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  20. A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

    Science.gov (United States)

    Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

    2016-01-01

    To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

  1. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  2. Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

    Science.gov (United States)

    Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

    2015-07-01

    Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

    Science.gov (United States)

    Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

    2017-08-01

    Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

  4. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  5. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  6. Critical assessment of digital PCR for the detection and quantification of genetically modified organisms.

    Science.gov (United States)

    Demeke, Tigst; Dobnik, David

    2018-07-01

    The number of genetically modified organisms (GMOs) on the market is steadily increasing. Because of regulation of cultivation and trade of GMOs in several countries, there is pressure for their accurate detection and quantification. Today, DNA-based approaches are more popular for this purpose than protein-based methods, and real-time quantitative PCR (qPCR) is still the gold standard in GMO analytics. However, digital PCR (dPCR) offers several advantages over qPCR, making this new technique appealing also for GMO analysis. This critical review focuses on the use of dPCR for the purpose of GMO quantification and addresses parameters which are important for achieving accurate and reliable results, such as the quality and purity of DNA and reaction optimization. Three critical factors are explored and discussed in more depth: correct classification of partitions as positive, correctly determined partition volume, and dilution factor. This review could serve as a guide for all laboratories implementing dPCR. Most of the parameters discussed are applicable to fields other than purely GMO testing. Graphical abstract There are generally three different options for absolute quantification of genetically modified organisms (GMOs) using digital PCR: droplet- or chamber-based and droplets in chambers. All have in common the distribution of reaction mixture into several partitions, which are all subjected to PCR and scored at the end-point as positive or negative. Based on these results GMO content can be calculated.

  7. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    International Nuclear Information System (INIS)

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  8. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  9. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    Science.gov (United States)

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  11. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Directory of Open Access Journals (Sweden)

    Yong Huang

    Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  12. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Science.gov (United States)

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  13. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  14. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  15. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  16. Ureaplasma parvum prosthetic joint infection detected by PCR.

    Science.gov (United States)

    Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

    2014-06-01

    We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Science.gov (United States)

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  18. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  19. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

    2005-01-01

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  1. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  2. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  3. Shape based kinetic outlier detection in real-time PCR

    Directory of Open Access Journals (Sweden)

    D'Atri Mario

    2010-04-01

    Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

  4. Evaluation of conventional PCR for detection of Strongylus vulgaris on horse farms.

    Science.gov (United States)

    Bracken, M K; Wøhlk, C B M; Petersen, S L; Nielsen, M K

    2012-03-23

    Strongyle parasites are ubiquitous in grazing horses. Of these, the bloodworm Strongylus vulgaris is regarded as most pathogenic. Increasing levels of anthelmintic resistance in strongyle parasites has led to recommendations of decreased treatment intensities, and there is now a pronounced need for reliable tools for detection of parasite burdens in general and S. vulgaris in particular. The only method currently available for diagnosing S. vulgaris in practice is the larval culture, which is laborious and time-consuming, so veterinary practitioners most often pool samples from several horses together in one culture to save time. Recently, molecular tools have been developed to detect S. vulgaris in faecal samples. The aim of this study was to compare the performance of a conventional polymerase chain reaction (PCR) assay with the traditional larval culture and furthermore test the performance of pooled versus individual PCR for farm screening purposes. Faecal samples were obtained from 331 horses on 18 different farms. Farm size ranged from 6 to 56 horses, and horses aged between 2 months and 31 years. Larval cultures and PCR were performed individually on all horses. In addition, PCR was performed on 66 faecal pools consisting of 3-5 horses each. Species-specific PCR primers previously developed were used for the PCR. PCR and larval culture detected S. vulgaris in 12.1 and 4.5% of individual horses, respectively. On the farm level, eight farms tested positive with the larval culture, while 13 and 11 farms were positive with the individual and pooled PCRs, respectively. The individual PCR method was statistically superior to the larval culture, while no statistical difference could be detected between pooled and individual PCR for farm screening. In conclusion, pooled PCR appears to be a useful tool for farm screening for S. vulgaris. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  6. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Science.gov (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  7. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  8. PCR detection of Streptococcus mutans and Aggregatibacter actinomycetemcomitans in dental plaque samples from Haitian adolescents.

    Science.gov (United States)

    Psoter, Walter J; Ge, Yao; Russell, Stefanie L; Chen, Zhou; Katz, Ralph V; Jean-Charles, Germain; Li, Yihong

    2011-08-01

    Streptococcus mutans and Aggregatibacter actinomycetemcomitans are oral pathogens associated with dental caries and periodontitis, respectively. The aim of this study was to determine the colonization of these two microorganisms in the dental plaque of a group of Haitian adolescents using two different polymerase chain reaction (PCR) methods, standard PCR, and quantitative real-time PCR (qPCR) assays. Fifty-four pooled supra-gingival plaque samples and 98 pooled sub-gingival plaque samples were obtained from 104 12- to19-year-old rural-dwelling Haitians. The total genomic DNA of bacteria was isolated from these samples, and all participants also received caries and periodontal examinations. Caries prevalence was 42.2%, and the mean decayed, missing, and filled surface (DMFS) was 2.67 ± 5.3. More than half of the adolescents (53.3%) experienced periodontal pockets (Community Periodontal Index score ≥3). S. mutans was detected in 67.3% by qPCR and 38.8% by PCR of the supra-gingival plaque samples (p plaque samples. Neither age nor gender was significantly correlated to the bacterial colonization. The results demonstrated a moderate-to-high prevalence of S. mutans and A. actinomycetemcomitans in the Haitian adolescent population, and qPCR is more sensitive than standard PCR in field conditions. These findings suggest that qPCR should be considered for field oral epidemiologic studies and may be necessary in investigations having major logistic challenges.

  9. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    Science.gov (United States)

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Simultaneous detection of five different DNA targets by real-time Taqman PCR using the Roche LightCycler480: Application in viral molecular diagnostics

    NARCIS (Netherlands)

    Molenkamp, Richard; van der Ham, Alwin; Schinkel, Janke; Beld, Marcel

    2007-01-01

    One of the most interesting aspects of real-time PCR based on the detection of fluorophoric labeled oligonucleotides is the possibility of being able to detect conveniently multiple targets in the same PCR reaction. Recently, Roche Diagnostics launched a real-time PCR platform, the LightCycler480

  11. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  12. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  13. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    Science.gov (United States)

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    OpenAIRE

    Ram, S.; Vimalin, J.M.; Jambulingam, M.; Tiru, V.; Gopalakrishnan, R.K.; Madhavan, H.N.

    2012-01-01

    Aim: Isolation, dark field detection and microscopic agglutination test (MAT) are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR) - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septi...

  15. polymerase chain reaction (pcr) provides a superior tool

    African Journals Online (AJOL)

    boaz

    Keywords: Streptococcus pneumoniae, meningitis, rt-PCR, standard bacteriological methods ... qualification de techniciens et les matériels pour son application constituent des ... Streptococcus pneumonia (pneumococcus) is a common.

  16. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  17. Reação em Cadeia da Polimerase (PCR baseada no gene cpx para detecção de Actinobacillus pleuropneumoniae em suínos natural e experimentalmente infectados Polymerase Chain Reaction (PCR based on the cpx gene for detection of Actinobacillus pleuropneumoniae in natural and experimentally infected pigs

    Directory of Open Access Journals (Sweden)

    Karina Koerich de Souza

    2008-10-01

    infection with A. pleuropneumoniae serotype 5B was performed and samples were obtained by tonsil swab, tonsil biopsy and blood for PCR, bacterial isolation and ELISA, respectively. These tests were then performed in naturally infected pigs from three herds with different sanitary situations of clinical disease. In each herd, five groups of different ages were analyzed. Tonsil biopsy for bacterial isolation and PCR and blood to determine the herd serological status was collected. The results obtained in the experimental infection confirmed that, even with the infection establishment, proved with bacterial isolation, it was not possible to detect the agent by PCR 45 days after infection. In naturally infected animals, PCR was more sensitive than bacterial isolation. The association between PCR and ELISA is a good alternative to define the herd sanitary status regarding the infection with A. pleuropneumoniae.

  18. PCR detection of Bartonella spp. in the dog

    Directory of Open Access Journals (Sweden)

    Jarmila Konvalinová

    2014-01-01

    Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

  19. The diagnosis of microorganism involved in infective endocarditis (IE by polymerase chain reaction (PCR and real-time PCR: A systematic review

    Directory of Open Access Journals (Sweden)

    Reza Faraji

    2018-02-01

    Full Text Available Broad-range bacterial rDNA polymerase chain reaction (PCR followed by sequencing may be identified as the etiology of infective endocarditis (IE from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery.

  20. The diagnosis of microorganism involved in infective endocarditis (IE) by polymerase chain reaction (PCR) and real-time PCR: A systematic review.

    Science.gov (United States)

    Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi

    2018-02-01

    Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.

  1. Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

    Science.gov (United States)

    da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

    2011-01-01

    The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

  2. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Detection of Mycoplasma hyopneumoniae in Bronchoalveolar Lavage Fluids of Pigs by PCR

    Science.gov (United States)

    Baumeister, A. Katrin; Runge, Martin; Ganter, Martin; Feenstra, Anne A.; Delbeck, Friedrich; Kirchhoff, Helga

    1998-01-01

    In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 102 CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11 other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Friis medium and (ii) with DNA extracted from the BALFs. In addition, PCR was performed with postmortem lung washings from 19 of the 40 pigs, and immunofluorescence tests were carried out with sections of lungs from 18 of the 40 pigs. M. hyopneumoniae could not be detected in 18 of the 40 pigs by any of the five methods tested. The remaining 22 pigs showed a positive reaction by the PCR with DNA extracted from the BALFs and variable positive reactions by the other tests. A complete correspondence could be observed between the immunofluorescence test result and the result of PCR with DNA. The investigation shows that the PCR with DNA extracted from BALFs is a suitable technique for the sensitive and specific in vivo detection of M. hyopneumoniae. PMID:9650949

  4. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  5. FTA card utility for PCR detection of Mycobacterium leprae.

    Science.gov (United States)

    Aye, Khin Saw; Matsuoka, Masanori; Kai, Masanori; Kyaw, Kyaw; Win, Aye Aye; Shwe, Mu Mu; Thein, Min; Htoo, Maung Maung; Htoon, Myo Thet

    2011-01-01

    The suitability of the FTA® elute card for the collection of slit skin smear (SSS) samples for PCR detection of Mycobacterium leprae was evaluated. A total of 192 SSS leprosy samples, of bacillary index (BI) 1 to 5, were collected from patients attending two skin clinics in Myanmar and preserved using both FTA® elute cards and 70% ethanol tubes. To compare the efficacy of PCR detection of DNA from each BI class, PCR was performed to amplify an M. leprae-specific repetitive element. Of the 192 samples, 116 FTA® elute card and 112 70% ethanol samples were PCR positive for M. leprae DNA. When correlated with BI, area under the curve (AUC) values of the respective receiver-operating characteristic curves were similar for the FTA® elute card and ethanol collection methods (AUC=0.6). Taken together, our results indicate that the FTA® elute card, which enables the collection, transport, and archiving of clinical samples, is an attractive alternative to ethanol preservation for the detection of M. leprae DNA.

  6. Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

    Science.gov (United States)

    Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

    2017-02-01

    Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

  7. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. A MIQE-compliant real-time PCR assay for Aspergillus detection.

    Directory of Open Access Journals (Sweden)

    Gemma L Johnson

    Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness

  9. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  11. PCR detection of malaria parasites in desiccated Anopheles mosquitoes is uninhibited by storage time and temperature

    Directory of Open Access Journals (Sweden)

    Rider Mark A

    2012-06-01

    Full Text Available Abstract Background Reliable methods to preserve mosquito vectors for malaria studies are necessary for detecting Plasmodium parasites. In field settings, however, maintaining a cold chain of storage from the time of collection until laboratory processing, or accessing other reliable means of sample preservation is often logistically impractical or cost prohibitive. As the Plasmodium infection rate of Anopheles mosquitoes is a central component of the entomological inoculation rate and other indicators of transmission intensity, storage conditions that affect pathogen detection may bias malaria surveillance indicators. This study investigated the effect of storage time and temperature on the ability to detect Plasmodium parasites in desiccated Anopheles mosquitoes by real-time polymerase chain reaction (PCR. Methods Laboratory-infected Anopheles stephensi mosquitoes were chloroform-killed and stored over desiccant for 0, 1, 3, and 6 months while being held at four different temperatures: 28, 37, -20 and -80°C. The detection of Plasmodium DNA was evaluated by real-time PCR amplification of a 111 base pair region of block 4 of the merozoite surface protein. Results Varying the storage time and temperature of desiccated mosquitoes did not impact the sensitivity of parasite detection. A two-way factorial analysis of variance suggested that storage time and temperature were not associated with a loss in the ability to detect parasites. Storage of samples at 28°C resulted in a significant increase in the ability to detect parasite DNA, though no other positive associations were observed between the experimental storage treatments and PCR amplification. Conclusions Cold chain maintenance of desiccated mosquito samples is not necessary for real-time PCR detection of parasite DNA. Though field-collected mosquitoes may be subjected to variable conditions prior to molecular processing, the storage of samples over an inexpensive and logistically

  12. Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

    2014-01-01

    In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  13. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  14. Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe.

    Science.gov (United States)

    Ahonsi, Monday O; Ling, Yin; Kageyama, Koji

    2010-11-01

    Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.

  15. [Detection of Cryptospordium spp. in environmental water samples by FTA-PCR].

    Science.gov (United States)

    Zhang, Xiao-Ping; Zhu, Qian; He, Yan-Yan; Jiang, Li; Jiang, Shou-Fu

    2011-02-01

    To establish a FTA-polymeras chain reaction (FTA-PCR) method in detection of Cryptospordium spp. in different sources of water. The semi automated immunomagnetic separation (IMS) of Cryptospordium oocysts in environmental water samples was performed firstly, and then genomic DNA of Cryptospordium oocysts was extracted by FTA filters disk. Oligonucleotide primers were designed based on the DNA fragment of the 18 S rRNA gene from C. parvum. Plate DNA was amplified with primers in PCR. The control DNA samples from Toxoplasma gondii,Sarcocystis suihominis, Echinococcus granulosus, and Clonorchis sinensis were amplified simultaneously. All PCR products were detected by agar electrophoresis dyed with ethidium bromide. The 446 bp fragment of DNA was detected in all samples of C. parvum, C. andersoni, and C. baileyi, while it was not detected in control groups in laboratory. No positive samples were found from 10 samples collected from tape water in 5 districts of Shanghai City by FTA-PCR. Nine positive samples were detected totally from 70 different environmental water samples, there were 0 out of 15 samples from the source of tape water, 2 out of 25 from the Huangpu River, 5 out of 15 from rivers around the animal farmers, 1 out of 9 from output water of contaminating water treatment factory, 1 out of 6 from the out gate of living contaminating water. The 446 bp fragment was detected from all the amplified positive water samples. FTA-PCR is an efficient method for gene detection of Cryptospordium oocysts, which could be used in detection of environmental water samples. The contamination degree of Cryptospordium oocysts in the river water around animal farms is high.

  16. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  17. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Rezig, Slim; Sakhri, Saber

    2007-01-01

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  18. Chronic Chagas disease: PCR-xenodiagnosis without previous microscopic observation is a useful tool to detect viable Trypanosoma cruzi

    Directory of Open Access Journals (Sweden)

    Miguel Saavedra

    2013-01-01

    Full Text Available We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD, without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%, whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%. Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. Conclusion: PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.

  19. Chronic Chagas disease: PCR-xenodiagnosis without previous microscopic observation is a useful tool to detect viable Trypanosoma cruzi.

    Science.gov (United States)

    Saavedra, Miguel; Zulantay, Inés; Apt, Werner; Martínez, Gabriela; Rojas, Antonio; Rodríguez, Jorge

    2013-01-01

    We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD) to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS) of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD), without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%), whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%). Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.

  20. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  1. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Real time PCR to detect the environmental faecal contamination by Echinococcus multilocularis from red fox stools.

    Science.gov (United States)

    Knapp, Jenny; Millon, Laurence; Mouzon, Lorane; Umhang, Gérald; Raoul, Francis; Ali, Zeinaba Said; Combes, Benoît; Comte, Sébastien; Gbaguidi-Haore, Houssein; Grenouillet, Frédéric; Giraudoux, Patrick

    2014-03-17

    The oncosphere stage of Echinococcus multilocularis in red fox stools can lead, after ingestion, to the development of alveolar echinococcosis in the intermediate hosts, commonly small mammals and occasionally humans. Monitoring animal infection and environmental contamination is a key issue in public health surveillance. We developed a quantitative real-time PCR technique (qPCR) to detect and quantify E. multilocularis DNA released in fox faeces. A qPCR technique using a hydrolysis probe targeting part of the mitochondrial gene rrnL was assessed on (i) a reference collection of stools from 57 necropsied foxes simultaneously investigated using the segmental sedimentation and counting technique (SSCT) (29 positive for E. multilocularis worms and 28 negative animals for the parasite); (ii) a collection of 114 fox stools sampled in the field: two sets of 50 samples from contrasted endemic regions in France and 14 from an E. multilocularis-free area (Greenland). Of the negative SSCT controls, 26/28 were qPCR-negative and two were weakly positive. Of the positive SSCT foxes, 25/29 samples were found to be positive by qPCR. Of the field samples, qPCR was positive in 21/50 (42%) and 5/48 (10.4%) stools (2 samples inhibited), originating respectively from high and low endemic areas. In faeces, averages of 0.1 pg/μl of DNA in the Jura area and 0.7 pg/μl in the Saône-et-Loire area were detected. All qPCR-positive samples were confirmed by sequencing. The qPCR technique developed here allowed us to quantify environmental E. multilocularis contamination by fox faeces by studying the infectious agent directly. No previous study had performed this test in a one-step reaction. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  4. Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

    Science.gov (United States)

    Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

    2016-01-01

    Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

  5. Human papillomavirus detection using PCR and ATR-FTIR for cervical cancer screening

    Science.gov (United States)

    Rymsza, Taciana; Ribeiro, Eliane Aline; de Carvalho, Luis Felipe das Chagas e. Silva; Bhattacharjee, Tanmoy; de Azevedo Canevari, Renata

    2018-05-01

    The human papillomavirus (HPV) genital infection is considered one of the most common sexually transmitted diseases worldwide, and has been associated with cervical cancer. The objective of this study was to investigate the efficacy of the diagnostic methods: polymerase chain reaction (PCR) and Fourier transform infrared (FTIR) equipped with an ATR (Attenuated Total Reflectance) unit (Pike Tech) spectroscopy, to diagnose HPV infection in women undergoing gynecological examination. Seventeen patients (41.46%) of the 41 patients analyzed were diagnosed with exophytic/condyloma acuminate lesions by clinical analysis, 29 patients (70.7%) (G1 group) of the 41 patients, showed positive result for HPV cell injury by oncotic colpocitology and 12 patients (29.3%) (G2 group), presented negative result for cellular lesion and absence of clinical HPV lesion. Four samples were obtained per patient, which were submitted oncotic colpocitology analysis (Papanicolau staining, two samples), PCR (one sample) and ATR-FTIR analysis (one sample). L1 gene was amplified by PCR technique with specific GP5+/GP6+ and MY09/MY11 primers. PCR results were uniformly positive for presence of HPV in all analyzed samples. Multivariate analysis of ATR-FTIR spectra suggests no significant biochemical changes between groups and no clustering formed, concurring with results of PCR. This study suggests that PCR and ATR-FTIR are highly sensitive technique for HPV detection.

  6. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  7. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  8. Legionella detection by culture and qPCR: Comparing apples and oranges.

    Science.gov (United States)

    Whiley, Harriet; Taylor, Michael

    2016-01-01

    Legionella spp. are the causative agent of Legionnaire's disease and an opportunistic pathogen of significant public health concern. Identification and quantification from environmental sources is crucial for identifying outbreak origins and providing sufficient information for risk assessment and disease prevention. Currently there are a range of methods for Legionella spp. quantification from environmental sources, but the two most widely used and accepted are culture and real-time polymerase chain reaction (qPCR). This paper provides a review of these two methods and outlines their advantages and limitations. Studies from the last 10 years which have concurrently used culture and qPCR to quantify Legionella spp. from environmental sources have been compiled. 26/28 studies detected Legionella at a higher rate using qPCR compared to culture, whilst only one study detected equivalent levels of Legionella spp. using both qPCR and culture. Aggregating the environmental samples from all 28 studies, 2856/3967 (72%) tested positive for the presence of Legionella spp. using qPCR and 1331/3967 (34%) using culture. The lack of correlation between methods highlights the need to develop an acceptable standardized method for quantification that is sufficient for risk assessment and management of this human pathogen.

  9. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  10. DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

    Directory of Open Access Journals (Sweden)

    Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

    2011-11-01

    Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

  11. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  12. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad

    2010-01-01

    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  13. Multiplex polymerase chain reaction (PCR) assay for simultaneous ...

    African Journals Online (AJOL)

    To evaluate the etiology of shiga toxin-producing E. coli (STEC), enteropathogenic E. coli (EPEC) and enteroinvasive E. coli (EIEC) in children with diarrhea in Iran a total 300 stool specimens from children with diarrhea were tested for the detection of E.coli. Out of 300 samples, 39 were identified as E. coli by biochemical ...

  14. Fast detection of deletion breakpoints using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  15. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  16. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  18. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  19. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  20. Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

    Science.gov (United States)

    Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

    2016-07-01

    The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Detection of Mycoplasma genitalium in female cervical samples by Multitarget Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Sabina Mahmutović-Vranić

    2007-05-01

    Full Text Available Mycoplasma genitalum (MG is associated with variety of urogenital infections such as non-gonococcal urethritis (NGU, endometritis and cervicitis. The objective of this study was to demonstrate and evaluate a research polymerase chain reaction (PCR assay, for the detection of MG in cervical samples of a tested population of women attending gynecology clinics in Bosnia and Herzegovina. The Multitarget Real-Time (MTRT PCR, utilizing the ABI 7900HT, the sequence detection system, was performed for the detection of MG. Cervical samples (N=97 from females were divided into three types of patient groups: Group 1: patients who had known abnormal clinical cytology reports (N=34; Group 2: patients who reported a history of genitourinary infections (N=22; and Group 3: patients not in either groups 1 or 2 (N=41. Overall, 14,43% (14/97 of those tested were positive for MG. A positive sample was defined as having a cycle threshold cross point (Ct < 40,0 with a fluorescent detection comparable to the low positive control utilized during the run. This study validated the use of MTRT PCR as a reliable method for the detection of MG in clinical specimens and should facilitate large-scale screening for this organism.

  2. A method for accurate detection of genomic microdeletions using real-time quantitative PCR

    Directory of Open Access Journals (Sweden)

    Bassett Anne S

    2005-12-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive

  3. A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

    Science.gov (United States)

    Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-05-02

    Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

  4. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii

    Directory of Open Access Journals (Sweden)

    Linke Sonja

    2006-01-01

    Full Text Available Abstract Background Coxiella burnetii, the bacterium causing Q fever, is an obligate intracellular biosafety level 3 agent. Detection and quantification of these bacteria with conventional methods is time consuming and dangerous. During the last years, several PCR based diagnostic assays were developed to detect C. burnetii DNA in cell cultures and clinical samples. We developed and evaluated TaqMan-based real-time PCR assays that targeted the singular icd (isocitrate dehydrogenase gene and the transposase of the IS1111a element present in multiple copies in the C. burnetii genome. Results To evaluate the precision of the icd and IS1111 real-time PCR assays, we performed different PCR runs with independent DNA dilutions of the C. burnetii Nine Mile RSA493 strain. The results showed very low variability, indicating efficient reproducibility of both assays. Using probit analysis, we determined that the minimal number of genome equivalents per reaction that could be detected with a 95% probability was 10 for the icd marker and 6.5 for the IS marker. Plasmid standards with cloned icd and IS1111 fragments were used to establish standard curves which were linear over a range from 10 to 107 starting plasmid copy numbers. We were able to quantify cell numbers of a diluted, heat-inactivated Coxiella isolate with a detection limit of 17 C. burnetii particles per reaction. Real-time PCR targeting both markers was performed with DNA of 75 different C. burnetii isolates originating from all over the world. Using this approach, the number of IS1111 elements in the genome of the Nine Mile strain was determined to be 23, close to 20, the number revealed by genome sequencing. In other isolates, the number of IS1111 elements varied widely (between seven and 110 and seemed to be very high in some isolates. Conclusion We validated TaqMan-based real-time PCR assays targeting the icd and IS1111 markers of C. burnetii. The assays were shown to be specific, highly

  5. Increased efficacy for in-house validation of real-time PCR GMO detection methods.

    Science.gov (United States)

    Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H

    2010-03-01

    To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.

  6. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  7. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    Science.gov (United States)

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  8. A Novel PCR Assay for Detecting Brucella abortus and Brucella melitensis.

    Science.gov (United States)

    Alamian, Saeed; Esmaelizad, Majid; Zahraei, Taghi; Etemadi, Afshar; Mohammadi, Mohsen; Afshar, Davoud; Ghaderi, Soheila

    2017-02-01

    Brucellosis is a major zoonotic disease that poses a significant public health threat worldwide. The classical bacteriological detection process used to identify Brucella spp. is difficult and time-consuming. This study aimed to develop a novel molecular assay for detecting brucellosis. All complete sequences of chromosome 1 with 2.1-Mbp lengths were compared among all available Brucella sequences. A unique repeat sequence (URS) locus on chromosome 1 could differentiate Brucella abortus from Brucella melitensis . A primer set was designed to flank the unique locus. A total of 136 lymph nodes and blood samples were evaluated and classified by the URS-polymerase chain reaction (PCR) method in 2013-2014. Biochemical tests and bacteriophage typing as the golden standard indicated that all Brucella spp. isolates were B. melitensis biovar 1 and B. abortus biovar 3. The PCR results were the same as the bacteriological method for detecting Brucella spp. The sensitivity and specificity of the URS-PCR method make it suitable for detecting B. abortus and B. melitensis . Quick detection of B. abortus and B. melitensis can provide the most effective strategies for control of these bacteria. The advantage of this method over other presented methods is that both B. abortus and B. melitensis are detectable in a single test tube. Furthermore, this method covered 100% of all B. melitensis and B. abortus biotypes. The development of this URS-PCR method is the first step toward the development of a novel kit for the molecular identification of B. abortus and B. melitensis .

  9. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  10. Evaluation of a PCR for detection of Actinobacillus pleuropneumoniae in mixed bacterial cultures from tonsils

    DEFF Research Database (Denmark)

    Gram, T.; Ahrens, Peter; Nielsen, J.P.

    1996-01-01

    strains of A. lignieresii. The lower detection limit of the PCR test was 10(3) A. pleuropneumoniae CFU/PCR test tube and was not affected by addition of 10(6) E. coli CFU/PCR test tube. Mixed bacterial cultures from tonsils of 101 pigs from 9 different herds were tested by culture and by PCR using four...

  11. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  12. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  13. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    Science.gov (United States)

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  14. Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

    Science.gov (United States)

    Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

    2013-07-30

    Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

  15. Droplet digital PCR as a novel detection method for quantifying microRNAs in acute myocardial infarction.

    Science.gov (United States)

    Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M

    2018-04-15

    micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    International Nuclear Information System (INIS)

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  17. PCR detection of Burkholderia multivorans in water and soil samples.

    Science.gov (United States)

    Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter

    2016-08-12

    Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).

  18. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    OpenAIRE

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-01-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

  19. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  20. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  1. pcr

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections. INTRODUCTION ... used to amplify a piece of DNA by in-vitro enzymatic replication (David and .... receiving antimicrobial treatment, or when the causative agents are small ...

  2. Standardization of the PCR technique for the detection of delta toxin in Staphylococcus spp.

    Directory of Open Access Journals (Sweden)

    C. Marconi

    2005-06-01

    Full Text Available Coagulase-negative staphylococci (CNS, components of the normal flora of neonates, have emerged as important opportunistic pathogens of nosocomial infections that occur in neonatal intensive care units. Some authors have reported the ability of some CNS strains, particularly Staphylococcus epidermidis, to produce a toxin similar to S. aureus delta toxin. This toxin is an exoprotein that has a detergent action on the membranes of various cell types resulting in rapid cell lysis. The objectives of the present study were to standardize the Polymerase Chain Reaction (PCR technique for the detection of the gene responsible for the production of delta toxin (hld gene in staphylococcal species isolated from catheters and blood cultures obtained from neonates, and to compare the results to those obtained with the phenotypic synergistic hemolysis method. Detection of delta toxin by the phenotypic and genotypic method yielded similar results for the S. aureus isolates. However, in S. epidermidis, a higher positivity was observed for PCR (97.4% compared to the synergistic hemolysis method (86.8%. Among CNS, S. epidermidis was the most frequent isolate and was a delta toxin producer. Staphylococcus simulans and S. warneri tested positive by the phenotypic method, but their positivity was not confirmed by PCR for the hld gene detection. These results indicate that different genes might be responsible for the production of this toxin in different CNS species, requiring highly specific primers for their detection. PCR was found to be a rapid and reliable method for the detection of the hld gene in S. aureus and S. epidermidis.

  3. PCR detection of groundwater bacteria associated with colloidal transport

    International Nuclear Information System (INIS)

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-01-01

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research

  4. PCR detection of groundwater bacteria associated with colloidal transport

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-02-29

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research.

  5. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  6. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  7. The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

    NARCIS (Netherlands)

    de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

    2002-01-01

    Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

  8. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples.

    Science.gov (United States)

    Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-03-18

    Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.

  9. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples

    Directory of Open Access Journals (Sweden)

    Pengyu Zhu

    2016-03-01

    Full Text Available Digital polymerase chain reaction (PCR has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ, sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO genome samples using commercial digital PCR detection systems.

  10. Human minisatellite alleles detectable only after PCR amplification.

    Science.gov (United States)

    Armour, J A; Crosier, M; Jeffreys, A J

    1992-01-01

    We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.

  11. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  12. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR

    DEFF Research Database (Denmark)

    Lund, Marianne; Nordentoft, Steen; Pedersen, Karl

    2004-01-01

    A real-time PCR assay for detecting thermophilic Campylobacter spp. directly in chicken feces has been developed. DNA was isolated from fecal material by using magnetic beads followed by PCR with a prealiquoted PCR mixture, which had been stored at -18degreesC. Campylobacter could be detected...

  13. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Development of a real-time PCR to detect Demodex canis DNA in different tissue samples.

    Science.gov (United States)

    Ravera, Ivan; Altet, Laura; Francino, Olga; Bardagí, Mar; Sánchez, Armand; Ferrer, Lluís

    2011-02-01

    The present study reports the development of a real-time polymerase chain reaction (PCR) to detect Demodex canis DNA on different tissue samples. The technique amplifies a 166 bp of D. canis chitin synthase gene (AB 080667) and it has been successfully tested on hairs extracted with their roots and on formalin-fixed paraffin embedded skin biopsies. The real-time PCR amplified on the hairs of all 14 dogs with a firm diagnosis of demodicosis and consistently failed to amplify on negative controls. Eleven of 12 skin biopsies with a morphologic diagnosis of canine demodicosis were also positive. Sampling hairs on two skin points (lateral face and interdigital skin), D. canis DNA was detected on nine of 51 healthy dogs (17.6%) a much higher percentage than previously reported with microscopic studies. Furthermore, it is foreseen that if the number of samples were increased, the percentage of positive dogs would probably also grow. Moreover, in four of the six dogs with demodicosis, the samples taken from non-lesioned skin were positive. This finding, if confirmed in further studies, suggests that demodicosis is a generalized phenomenon in canine skin, due to proliferation of local mite populations, even though macroscopic lesions only appear in certain areas. The real-time PCR technique to detect D. canis DNA described in this work is a useful tool to advance our understanding of canine demodicosis.

  15. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Directory of Open Access Journals (Sweden)

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  16. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  17. The level of embryonation influences detection of Ostertagia ostertagi eggs by semi-quantitative PCR

    DEFF Research Database (Denmark)

    Drag, Markus; Höglund, Johan; Nejsum, Peter

    2016-01-01

    The Internal Transcribed Spacer 2 (ITS2) is a candidate diagnostic marker of the pathogenic cattle nematode Ostertagia ostertagi. The aims of this study were: (i) to document and quantify how the development of O. ostertagi eggs affects ITS2 copies under different storage conditions, and (ii......) to suggest optimal storage conditions for faecal samples in a diagnostic pipeline that involves detection and semi-quantification by real-time semi-quantitative polymerase chain reaction (qPCR). Eggs of Ostertagia ostertagi were obtained from fresh faeces and stored at 4 °C or 25 °C under aerobic...

  18. Fast real-time PCR for the detection of crustacean allergen in foods.

    Science.gov (United States)

    Herrero, Beatriz; Vieites, Juan M; Espiñeira, Montserrat

    2012-02-29

    Crustaceans are one of the most common allergens causing severe food reaction. These food allergens are a health problem, and they have become very important; there are various regulations that establish that labeling must be present regarding these allergens to warn consumers. In the present work a fast real-time PCR, by a LNA probe, was developed. This allows the detection of crustaceans in all kinds of products, including processed products in which very aggressive treatments of temperature and pressure during the manufacturing process are used. This methodology provides greater sensitivity and specificity and reduces the analysis time of real-time PCR to 40 min. This methodology was further validated by means of simulating products likely to contain this allergen. For this, products present on the market were spiked with crustacean cooking water. The assay is a potential tool in issues related to the labeling of products and food security to protect the allergic consumer.

  19. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  20. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  1. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    Science.gov (United States)

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  2. Simultaneous detection of hepatitis B virus genotypes and mutations associated with resistance to lamivudine, adefovir, and telbivudine by the polymerase chain reaction-ligase detection reaction

    Directory of Open Access Journals (Sweden)

    Yong-Zhong Wang

    Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.

  3. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  4. Detection of four important Eimeria species by multiplex PCR in a single assay.

    Science.gov (United States)

    You, Myung-Jo

    2014-06-01

    The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  6. Detection of methylated CDO1 in plasma of colorectal cancer; a PCR study.

    Directory of Open Access Journals (Sweden)

    Keishi Yamashita

    Full Text Available BACKGROUND: Cysteine biology is important for the chemosensitivity of cancer cells. Our research has focused on the epigenetic silencing of cysteine dioxygenase type 1 (CDO1 in colorectal cancer (CRC. In this study, we describe detection of CDO1 methylation in the plasma of CRC patients using methylation specific PCR (Q-MSP and extensive analysis of the PCR reaction. METHODS: DNA was extracted from plasma, and analysed for methylation of the CDO1 gene using Q-MSP. The detection rate of CDO1 gene methylation was calculated and compared with that of diluted DNA extracted from "positive control" DLD1 cells. CDO1 gene methylation in the plasma of 40 CRC patients that were clinicopathologically analysed was then determined. RESULTS: (1 The cloned sequence analysis detected 93.3% methylation of the promoter CpG islands of the CDO1 gene of positive control DLD1 cells and 4.7% methylation of the negative control HepG2 CDO1 gene. (2 DLD1 CDO1 DNA could not be detected in this assay if the extracted DNA was diluted ∼1000 fold. The more DNA that was used for the PCR reaction, the more effectively it was amplified in Q-MSP. (3 By increasing the amount of DNA used, methylated CDO1 could be clearly detected in the plasma of 8 (20% of the CRC patients. However, the percentage of CRC patients detected by methylated CDO1 in plasma was lower than that detected by CEA (35.9% or CA19-9 (23.1% in preoperative serum. Combination of CEA/CA19-9 plus plasma methylated CDO1 could increase the rate of detection of curable CRC patients (39.3% as compared to CEA/CA19-9 (25%. CONCLUSION: We have described detection of CDO1 methylation in the plasma of CRC patients. Although CDO1 methylation was not detected as frequently as conventional tumor markers, analysis of plasma CDO1 methylation in combination with CEA/CA19-9 levels increases the detection rate of curable CRC patients.

  7. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  8. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  9. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  10. Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

    NARCIS (Netherlands)

    de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

    2013-01-01

    BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

  11. PCR Based Detection of Genetically Modified Soy in Processed Foods Commercially Available in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Ibrahim Abdullah Alaraidh

    2009-06-01

    Full Text Available In this research, PCR (polymerase chain reaction technique was applied to detect the presence of GMO sold in the Saudi Arabian market. This method was applied to detect genetically modified soy (GM-soy in particular the roundup ready soy (RRS. To confirm the presence of soy, samples were first tested for the existence of the soy specific lectin gene.  A total of eighty samples were tested out of which two samples tested positive as GM-soy. Not surprisingly, the findings showed the existence of GM-soy in food products in Saudi. This supports the necessity of developing precise quantitative and qualitative ways for routine analyses and detection of GMO products in the Saudi Arabian market. With the discovery of GM products in the Saudi Arabian market it would be of no surprise that other Middle Eastern nations also knowingly or unknowingly import GM crops.

  12. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

    Science.gov (United States)

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

  14. Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia and Prevotella nigrescens in endodontic lesions detected by culture and by PCR.

    Science.gov (United States)

    Gomes, B P F A; Jacinto, R C; Pinheiro, E T; Sousa, E L R; Zaia, A A; Ferraz, C C R; Souza-Filho, F J

    2005-08-01

    he aim of this study was to investigate the presence of four black-pigmented bacteria, Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia and Prevotella nigrescens, in endodontic infections by culture and polymerase chain reaction (PCR) analyses. Microbial samples were obtained from 50 teeth with untreated necrotic pulps (primary infection) and from 50 teeth with failing endodontic treatment (secondary infection). Microbiological strict anaerobic techniques were used for serial dilution, plating, incubation, and identification. For PCR detection, the samples were analyzed using species-specific primers of 16S rDNA and the downstream intergenic spacer region. Culture and PCR detected the test species in 13/100 and 50/100 of the study teeth, respectively. The organisms were cultured from 11/50 (22%) of primarily infected root canal samples and from 2/50 (4%) of secondary root canal samples. PCR detection identified the target species in 32/50 (64%) and 18/50 (36%) of primary and secondary infections, respectively. P. gingivalis was rarely isolated by culture methods (1%), but was the most frequently identified test species by PCR (38%). Similarly, P. endodontalis was not recovered by culture from any tooth studied, but was detected by PCR in 25% of the sampled teeth. PCR-based identification also showed higher detection rates of P. intermedia (33%) and P. nigrescens (22%) than culture (13%). In conclusion, P. gingivalis, P. endodontalis, P. intermedia, and P. nigrescens were identified more frequently in teeth with necrotic pulp than in teeth with failing endodontic treatment. Also, a higher frequency of black-pigmented species was detected by PCR than by culture.

  15. Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

    Science.gov (United States)

    Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

    2017-04-01

    Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

  16. Detection of human papillomavirus in pterygium and conjunctival papilloma by hybrid capture II and PCR assays.

    Science.gov (United States)

    Takamura, Y; Kubo, E; Tsuzuki, S; Akagi, Y

    2008-11-01

    To elucidate the putative role of human papillomavirus (HPV) infection in pterygium and conjunctival papilloma. Hybrid capture II (HC-II) and polymerase chain reaction (PCR) assays were performed to detect HPV in pterygium (42 samples obtained from 40 patients) and conjunctival papilloma (8 samples from 6 patients). The amount of HPV DNA was evaluated by measurement of relative light units (RLUs) on a luminometer. All papilloma samples were positive for HPV DNA by PCR and HC-II. The RLU values for specimens of recurrent and re-recurrent papilloma were markedly higher than those for specimens of primary lesions. HPV was detected by PCR in 2 of 42 (4.8%) beta-globin-positive pterygium specimens, whereas HC-II showed that HPV was negative in all pterygium samples. Our results support the hypothesis that HPV DNA is associated with the pathogenesis of conjunctival papilloma, but not pterygium. RLU measurement by HC-II may serve as a marker for evaluating the activity of HPV in conjunctival tumours.

  17. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Science.gov (United States)

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

    2003-03-01

    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  18. Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

    International Nuclear Information System (INIS)

    Ramadan, A.; Soukkaria, S.

    2013-01-01

    Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

  19. Quantitative Real-time PCR detection of putrescine-producing Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Kristýna Maršálková

    2017-01-01

    Full Text Available Biogenic amines are indispensable components of living cells; nevertheless these compounds could be toxic for human health in higher concentrations. Putrescine is supposed to be the major biogenic amine associated with microbial food spoilage. Development of reliable, fast and culture-independent molecular methods to detect bacteria producing biogenic amines deserves the attention, especially of the food industry in purpose to protect health. The objective of this study was to verify the newly designed primer sets for detection of two inducible genes adiA and speF together in Salmonella enterica and Escherichia coli genome by Real-time PCR. These forenamed genes encode enzymes in the metabolic pathway which leads to production of putrescine in Gram-negative bacteria. Moreover, relative expression of these genes was studied in E. coli CCM 3954 strain using Real-time PCR. In this study, sets of new primers for the detection two inducible genes (speF and adiA in Salmonella enterica and E. coli by Real-time PCR were designed and tested. Amplification efficiency of a Real-time PCR was calculated from the slope of the standard curves (adiA, speF, gapA. An efficiency in a range from 95 to 105 % for all tested reactions was achieved. The gene expression (R of adiA and speF genes in E. coli was varied depending on culture conditions. The highest gene expression of adiA and speF was observed at 6, 24 and 36 h (RadiA ~ 3, 5, 9; RspeF ~11, 10, 9; respectively after initiation of growth of this bacteria in nutrient broth medium enchired with amino acids. The results show that these primers could be used for relative quantification analysis of E. coli.

  20. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  1. Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

    Science.gov (United States)

    Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

    2017-04-13

    Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those

  2. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  3. Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR

    Directory of Open Access Journals (Sweden)

    N Marziliano

    2009-06-01

    Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.

  4. Comparison between single PCR and nested PCR in detection of human papilloma viruses in paraffin-embedded OSCC and fresh oral mucosa.

    Science.gov (United States)

    Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars

    2015-01-01

    Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (pnested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Optimisation of Forensic Genetics Procedures Used in Disputed Paternity Testing: Adjustment of the PCR Reaction Volume

    Directory of Open Access Journals (Sweden)

    Damir Marjanović

    2006-05-01

    Full Text Available Standard molecular techniques, with only a slight modification, are very useful in obtaining and interpreting the final results in the field of forensic genetic. Data obtained through such analysis are highly reliable and can be used as a very powerful tool that produces valuable results. However, success and swiftness of DNA typing of biological evidence either that found at a crime scene or used in disputed paternity testing, depends on the optimization of numerous factors. One of the most important and critical phases that ensures reliability of the whole procedure is the choice of the most suitable volume for the amplification protocol. Buccal swabs were collected from volunteers. DNA was extracted by Qiagen Dnaeasy Tissue Kit. PowerPlex 16 kit was used to simultaneously amplify 15 STR loci by PCR. Amplification was carried out as described previously. The tested total working reaction volumes were 5, 10 and 25 microl. The PCR amplification was carried out in PE Gene Amp PCR System Thermal Cycler (ABI, Foster City, CA. Amplification products were analyzed on an ABI PRISM 377 instrument (ABI, Foster City, CA in 5% bis-acrilamide gel. Amplification was generally successful for all the tested reaction volumes. Lower partial to complete DNA profiles ratio, the quality of obtained STR profiles, significantly reduced amount of reaction's components give advantage to 5 microl reaction volume over other two tested volumes in this case.

  6. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  7. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

    Science.gov (United States)

    Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

    2017-05-01

    Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Two quantitative real-time PCR assays for the detection of penaeid shrimp and blue crab, crustacean shellfish allergens.

    Science.gov (United States)

    Eischeid, Anne C; Kim, Bang-hyun; Kasko, Sasha M

    2013-06-19

    Food allergen detection methods must be able to specifically detect minute quantities of an allergenic food in a complex food matrix. One technique that can be used is real-time PCR. For the work described here, real-time PCR assays were developed to detect penaeid shrimp and blue crab, crustacean shellfish allergens. The method was tested using shrimp meat and crab meat spiked into several types of foods, including canned soups, deli foods, meat, seafood, and prepared seafood products. Foods were spiked with either shrimp or crab at levels ranging from 0.1 to 10⁶ parts per million (ppm) and analyzed either raw or cooked by a variety of methods. Real-time PCR data were used to generate linear standard curves, and assays were evaluated with respect to linear range and reaction efficiency. Results indicate that both assays performed well in a variety of food types. High reaction efficiencies were achieved across a linear range of 6-8 orders of magnitude. Limits of detection were generally between 0.1 and 1 ppm. Cooking methods used to simulate thermal processing of foods had little effect on assay performance. This work demonstrates that real-time PCR can be a valuable tool in the detection of crustacean shellfish.

  9. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  10. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  11. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  12. Effects of prolonged chlorine exposures upon PCR detection of Helicobacter pylori DNA.

    Science.gov (United States)

    The effect of low doses of free chlorine on the detection by qPCR of Helicobacter pylori (H. pylori) cells by qPCR in tap water was monitored. H. pylori target sequences (within suspended, intact cells at densities of 102 to 103 cells /ml) were rendered undetectable by qPCR an...

  13. Influence of volume of sample processed on detection of Chlamydia trachomatis in urogenital samples by PCR

    NARCIS (Netherlands)

    Goessens, W H; Kluytmans, J A; den Toom, N; van Rijsoort-Vos, T H; Niesters, B G; Stolz, E; Verbrugh, H A; Quint, W G

    In the present study, it was demonstrated that the sensitivity of the PCR for the detection of Chlamydia trachomatis is influenced by the volume of the clinical sample which is processed in the PCR. An adequate sensitivity for PCR was established by processing at least 4%, i.e., 80 microliters, of

  14. Laser spot detection based on reaction diffusion

    Czech Academy of Sciences Publication Activity Database

    Vázquez-Otero, Alejandro; Khikhlukha, Danila; Solano-Altamirano, J. M.; Dormido, R.; Duro, N.

    2016-01-01

    Roč. 16, č. 3 (2016), s. 1-11, č. článku 315. ISSN 1424-8220 R&D Projects: GA MŠk EF15_008/0000162 Grant - others:ELI Beamlines(XE) CZ.02.1.01/0.0/0.0/15_008/0000162 Institutional support: RVO:68378271 Keywords : laser spot detection * laser beam detection * reaction diffusion models * Fitzhugh-Nagumo model * reaction diffusion computation * Turing patterns Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 2.677, year: 2016

  15. Evaluation of PCR and DNA hybridization protocols for detection of viable enterotoxigenic Clostridium perfringens in irradiated beef

    International Nuclear Information System (INIS)

    Baez, L.A.; Juneja, V.K.; Thayer, D.W.; Sackitey, S.

    1997-01-01

    The sensitivity of DNA hybridization and polymerase chain reaction (PCR), was evaluated in irradiated cooked and raw beef samples. A membrane-based colony hybridization assay and a PCR protocol, both with specificity for the enterotoxin A gene of Clostridium perfringens, were compared with viable plate counts. The results of the colony hybridization procedure were in agreement with viable plate counts for detection and enumeration of enterotoxigenic C. perfringens. The PCR procedure combined a 4 h enrichment followed by a nucleic acid extraction step and assessed the amplification of 183 and 750 base pair enterotoxin gene targets. Detection of C. perfringens by PCR did not show a reliable correlation with viable plate counts or the colony hybridization assay. C. perfringens killed by irradiation were not detected by the plate count or colony hybridization methods; however, killed cells were detected with the PCR technique. By relying on the growth of viable cells for detection and/or enumeration, the colony hybridization and plate count methods provided a direct correlation with the presence of viable bacteria

  16. Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

    Science.gov (United States)

    2013-01-01

    Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

  17. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  18. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  19. A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.

    Science.gov (United States)

    Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares

    2017-11-15

    Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format

  20. Polymerase chain reaction (PCR) detection of mixed trypanosome ...

    African Journals Online (AJOL)

    user

    2012-10-02

    Oct 2, 2012 ... trypanosome infection and blood meal origin in field-captured tsetse flies ... species of protozoan parasites of the genus. Trypanosoma. ..... and leopard. .... McNamara J, Dukes P, Snow WF, Gibson WC (1989). Use of DNA.

  1. Polymerase Chain Reaction (PCR) Detection Of The Genome Of ...

    African Journals Online (AJOL)

    ... cycling of virus between argasid soft ticks (Ornithodoros moubata complex) and wild ... The technique consists essentially of the enzymatic synthesis of millions of ... hybridization of specific DNA primers to the template and extension of the ...

  2. Novel methods of cytokine detection: Real-time PCR, ELISPOT, and intracellular cytokine staining

    Directory of Open Access Journals (Sweden)

    Eliza Turlej

    2009-05-01

    Full Text Available Cytokines are small hormone-like proteins that play important roles in immune system control. Cytokines regulate the proliferation and differentiation of cells and hematopoiesis and act as mediators in the inflammatory reaction. Changes in cytokine levels are found in many diseases, such as sepsis, bowel inflammatory disease, autoimmune diseases, as well as graft-versus-host disease. Cytokines levels can be detected using in vivo, in vitro, and ex vivo techniques. The level of cytokine produced can be measured by immunoenzymatic test (ELISA in supernatant after cell culture with the addition of stimulant and in plasma by techniques that measure the level of cytokine secretion in cells (e.g. immunohistochemical staining, ELISPOT, and intracellular cytokine staining, and by molecular biological methods (RPA, real-time PCR, in situ hybridization, and Northern blot. Detection of cytokine mRNA in tissues is useful in the direct determination of heterogenic populations of cytokine-producing cells. Nowadays the most frequently used methods for measuring cytokine level are ELISPOT, intracellular cytokine staining with flow cytometry detection, and real-time PCR. These methods have an important clinical role in vaccine efficacy, in viral, bacterial, and verminous diagnostics, and in determining the efficacy of cancer treatment.

  3. Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

    Science.gov (United States)

    Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

    2018-05-01

    The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.

  4. Detection of wild animals as carriers of Leptospira by PCR in the Pantanal biome, Brazil.

    Science.gov (United States)

    Vieira, Anahi S; Narduche, Lorena; Martins, Gabriel; Schabib Péres, Igor A H F; Zimmermann, Namor P; Juliano, Raquel S; Pellegrin, Aiesca O; Lilenbaum, Walter

    2016-11-01

    Leptospiral infection is widespread in wildlife. In this context, wild ecosystems in tropical countries hold a vast biodiversity, including several species that may act as potential reservoirs of leptospires. The Pantanal biome presents highly favorable environmental conditions for the occurrence of leptospirosis, such as high temperatures, constant flooding, and high biodiversity. The purpose of this study was to detect wild animals as carriers of Leptospira sp. using direct methods (PCR and culture) in the Pantanal biome, Brazil. A total of 35 animals were studied, namely Cerdocyon thous, Nasua nasua, Ozotoceros bezoarticus, and Sus scrofa species. Blood for serology (MAT) and urine for bacteriological culturing and PCR was sampled. The most prevalent serogroups were Javanica and Djasiman. Additionally, 40.6% of these animals presented PCR positive reactions. Seroreactivity associated with the high frequency of leptospiral carriers among the different studied species suggests a high level of exposure of the studied animals to pathogenic Leptospira strains. Our results are still limited and the actual role of the studied animals in the epidemiology of leptospirosis in the Pantanal region remains to be elucidated. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    Science.gov (United States)

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  6. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  7. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA.

    Science.gov (United States)

    Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina

    2014-01-01

    Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.

  8. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  9. The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

    Science.gov (United States)

    Rosner, A; Maslenin, L; Spiegel, S

    1997-09-01

    The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

  10. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Science.gov (United States)

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  12. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  13. A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

    Science.gov (United States)

    Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

    2013-12-27

    Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

  14. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  15. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms

    Directory of Open Access Journals (Sweden)

    Michelle de Campos Soriani Azevedo

    2017-01-01

    Full Text Available Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR, a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV and negative (NPV predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H, the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease.

  16. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms.

    Science.gov (United States)

    Azevedo, Michelle de Campos Soriani; Ramuno, Natália Mortari; Fachin, Luciana Raquel Vincenzi; Tassa, Mônica; Rosa, Patrícia Sammarco; Belone, Andrea de Faria Fernandes; Diório, Suzana Madeira; Soares, Cleverson Teixeira; Garlet, Gustavo Pompermaier; Trombone, Ana Paula Favaro

    Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR), a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy) and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA) and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV) and negative (NPV) predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H), the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    Science.gov (United States)

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  18. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    Science.gov (United States)

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  19. A new PCR assay for the detection and differentiation of Babesia canis and Babesia vogeli.

    Science.gov (United States)

    Annoscia, Giada; Latrofa, Maria Stefania; Cantacessi, Cinzia; Olivieri, Emanuela; Manfredi, Maria Teresa; Dantas-Torres, Filipe; Otranto, Domenico

    2017-10-01

    Babesia spp. are globally distributed tick-borne protozoan parasites that infect the red blood cells of a wide range of vertebrate hosts, including humans. Diagnosis of babesiosis is often impeded by the transient presence of the parasites in peripheral blood, as well as by their pleomorphic nature. Given the reports of an expanding and, in some cases, sympatric geographical distribution of Babesia canis and Babesia vogeli in dogs and associated vectors, in Europe, the development of time-efficient and cost-effective diagnostic tools to detect and differentiate these two species is warranted. In this study, we designed and developed a novel polymerase chain reaction (PCR) assay targeting the parasite cytochrome c oxidase subunit 1 (cox1) gene, for the simultaneous detection and differentiation of B. canis and B. vogeli. The analytical sensitivity of the PCR was evaluated using serial dilutions of genomic DNA extracted from individual and artificially mixed canine blood samples infected by B. canis (3×10 2 infected erythrocytes/ml, ie/ml) and B. vogeli (2.1×10 1 ie/ml). The analytical specificity of the assay was assessed using blood samples positive for Hepatozoon canis, Ehrlichia canis, Anaplasma platys, Babesia microti, Babesia rossi and Theileria annae (syn. Babesia vulpes). The clinical specificity of the PCR assay was evaluated on 147 blood samples from dogs and 128 tick specimens (Dermacentor reticulatus and Rhipicephalus sanguineus sensu lato). Species-specific bands of the expected sizes (i.e., 750bp for B. canis and 450bp for B. vogeli), and two bands in the mixed blood samples were obtained. The PCR assay developed herein detected a low number of infected erythrocytes (i.e., 3×10 -2 B. canis, 2.1×10 -2 B. vogeli ie/ml). Of the 147 blood samples, nine (6.1%) were positive for B. canis and six (4.1%) for B. vogeli, whereas only one tick (D. reticulatus) was positive for B. canis. This PCR assay represents a rapid and reliable tool for the diagnosis of B

  20. Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.

    Science.gov (United States)

    Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta

    2015-12-01

    Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be

  1. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  2. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

    Directory of Open Access Journals (Sweden)

    Adrián Ruiz-Villalba

    2017-12-01

    Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

  3. Simultaneous detection of multiple HPV DNA via bottom-well microfluidic chip within an infra-red PCR platform.

    Science.gov (United States)

    Liu, Wenjia; Warden, Antony; Sun, Jiahui; Shen, Guangxia; Ding, Xianting

    2018-03-01

    Portable Polymerase Chain Reaction (PCR) devices combined with microfluidic chips or lateral flow stripes have shown great potential in the field of point-of-need testing (PoNT) as they only require a small volume of patient sample and are capable of presenting results in a short time. However, the detection for multiple targets in this field leaves much to be desired. Herein, we introduce a novel PCR platform by integrating a bottom-well microfluidic chip with an infra-red (IR) excited temperature control method and fluorescence co-detection of three PCR products. Microfluidic chips are utilized to partition different samples into individual bottom-wells. The oil phase in the main channel contains multi-walled carbon nanotubes which were used as a heat transfer medium that absorbs energy from the IR-light-emitting diode (LED) and transfers heat to the water phase below. Cyclical rapid heating and cooling necessary for PCR are achieved by alternative power switching of the IR-LED and Universal Serial Bus (USB) mini-fan with a pulse width modulation scheme. This design of the IR-LED PCR platform is economic, compact, and fully portable, making it a promising application in the field of PoNT. The bottom-well microfluidic chip and IR-LED PCR platform were combined to fulfill a three-stage thermal cycling PCR for 40 cycles within 90 min for Human Papilloma Virus (HPV) detection. The PCR fluorescent signal was successfully captured at the end of each cycle. The technique introduced here has broad applications in nucleic acid amplification and PoNT devices.

  4. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  5. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  6. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  7. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  8. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Science.gov (United States)

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  9. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  10. PCR Based Detection of Shiga Toxin Producing E. coli in Commercial Poultry and Related Environments

    Directory of Open Access Journals (Sweden)

    Homaira Anzum Himi

    2015-02-01

    Full Text Available Shiga toxin (Stx-producing E. coli (STEC is the most important foodborne pathogen which is the causal agent of mild diarrhea, bloody diarrhea, hemolytic-uremic syndrome (HUS in human. The present study was designed to determine the prevalence and identification of Shiga toxin (Stx-producing E. coli in poultry, detection of its source of infection in poultry and transmission pattern to human. For this purpose a total of 150 samples (cloacal swab-60, feed -15, water-15 and egg -60 were collected and analyzed in bacteriology laboratory by cultured in different bacteriological media followed by gram’s staining, biochemical tests and Polymerase Chain reaction (PCR. The PCR was performed by targeting 16s rRNA gene and shiga toxin producing gene in E. coli. Out of 150 collected samples, E. coli was found in 81 (54% samples. Presence of E. coli was 100% in both feed (n=15 and egg (n=60, whereas 10% in cloacal swab (n=6. Water samples were totally free of E. coli. The stx2 gene was detected in all samples whether all samples were negative for stx1 gene. The study revealed that, poultry feed acts as a source of E. coli infection in poultry, which may be transmitted to environment and human via meat or eggs. Antibiotic sensitivity test revealed that isolated bacteria were highly sensitive to Ciprofloxacin.

  11. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  12. Detection of Flavobacterium psychrophilum from fish tissue and water samples by PCR amplification

    DEFF Research Database (Denmark)

    Wiklund, T.; Madsen, Lone; Bruun, Morten Sichlau

    2000-01-01

    investigation, the possible detection of Fl. psychrophilum from fish tissue and water samples was examined using nested PCR with DNA probes against a sequence of the 16S rRNA genes. The DNA was extracted using Chelex(R) 100 chelating resin. The primers, which were tested against strains isolated from diseased...... fish, healthy fish, fish farm environments and reference strains, proved to be specific for Fl. psychrophilum. The obtained detection limit of Fl. psychrophilum seeded into rainbow trout brain tissue was 0.4 cfu in the PCR tube, corresponding to 17 cfu mg(-1) brain tissue. The PCR-assay proved...... to be more sensitive than agar cultivation of tissue samples from the brain of rainbow trout injected with Fl. psychrophilum. In non-sterile fresh water seeded with Fl. psychrophilum the detection limit of the PCR- assay was 1.7 cfu in the PCR tube, corresponding to 110 cfu ml(-1) water. The PCR...

  13. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System.

    Science.gov (United States)

    DeShields, Joseph B; Bomberger, Rachel A; Woodhall, James W; Wheeler, David L; Moroz, Natalia; Johnson, Dennis A; Tanaka, Kiwamu

    2018-02-23

    On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management strategies that reduce the impact of the disease. Presently in many diagnostic laboratories, the polymerase chain reaction (PCR), particularly real-time PCR, is considered the most sensitive and accurate method for plant pathogen detection. However, laboratory-based PCRs typically require expensive laboratory equipment and skilled personnel. In this study, soil-borne pathogens of potato are used to demonstrate the potential for on-site molecular detection. This was achieved using a rapid and simple protocol comprising of magnetic bead-based nucleic acid extraction, portable real-time PCR (fluorogenic probe-based assay). The portable real-time PCR approach compared favorably with a laboratory-based system, detecting as few as 100 copies of DNA from Spongospora subterranea. The portable real-time PCR method developed here can serve as an alternative to laboratory-based approaches and a useful on-site tool for pathogen diagnosis.

  15. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  16. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  17. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  18. An optimized pentaplex PCR for detecting DNA mismatch repair-deficient colorectal cancers.

    Directory of Open Access Journals (Sweden)

    Ajay Goel

    2010-02-01

    Full Text Available Microsatellite instability (MSI is used to screen colorectal cancers (CRC for Lynch Syndrome, and to predict outcome and response to treatment. The current technique for measuring MSI requires DNA from normal and neoplastic tissues, and fails to identify tumors with specific DNA mismatch repair (MMR defects. We tested a panel of five quasi-monomorphic mononucleotide repeat markers amplified in a single multiplex PCR reaction (pentaplex PCR to detect MSI.We investigated a cohort of 213 CRC patients, comprised of 114 MMR-deficient and 99 MMR-proficient tumors. Immunohistochemical (IHC analysis evaluated the expression of MLH1, MSH2, PMS2 and MSH6. MSI status was defined by differences in the quasi-monomorphic variation range (QMVR from a pool of normal DNA samples, and measuring differences in allele lengths in tumor DNA.Amplification of 426 normal alleles allowed optimization of the QMVR at each marker, and eliminated the requirement for matched reference DNA to define MSI in each sample. Using > or = 2/5 unstable markers as the criteria for MSI resulted in a sensitivity of 95.6% (95% CI = 90.1-98.1% and a positive predictive value of 100% (95% CI = 96.6%-100%. Detection of MSH6-deficiency was limited using all techniques. Data analysis with a three-marker panel (BAT26, NR21 and NR27 was comparable in sensitivity (97.4% and positive predictive value (96.5% to the five marker panel. Both approaches were superior to the standard approach to measuring MSI.An optimized pentaplex (or triplex PCR offers a facile, robust, very inexpensive, highly sensitive, and specific assay for the identification of MSI in CRC.

  19. Detection of human papillomavirus by hybrid capture and real time PCR methods in patients with chronic cervicitis and cervical intraepithelial

    Directory of Open Access Journals (Sweden)

    Elisha Khandker

    2016-07-01

    Full Text Available Background and objectives:Cervical cancer due to Human papillomavirus (HPV is one of the leading causes of morbidity and mortality in women. Testing of HPV can identify women who are at risk of cervical cancer. Nowadays, molecular methods like real time polymerase chain reaction (PCR and hybrid capture technique are applied for detecting HPV in cervical specimens. The objective of the present study was to determine the rate of HPV infection in women with chronic cervicitis and cervical intraepithelial neoplasia (CIN by a commercial real time polymerase chain reaction test kit and by a hybrid capture HPV DNA test. Methods:Women aged between 20 to 55 years with chronic cervicitis and CIN were enrolled in the study after obtaining informed consent. Cervical specimen was collected by using cervical brush and stored in transport medium until used. HPV was detected by High Risk Screen Real-TM Quant 2x (Sacace, Biotechnologies SrI, Italy real time PCR kit (HR RT-PCR and by Hybrid Capture-2 High-Risk HPV DNA (Hc-2; Digene Corporation, USA test. Results: Total 72 women with chronic cervicitis and CIN of different grades were included in the study. Out of this, HPV infection detected by HR RT-PCR was 31 (43% and by Hc-2 was 14 (19.4%. Both the tests were able to detect HPV infection in all the CIN 3 cases and in most of the CIN 2 cases. However, HR RT-PCR detected higher number of HPV in chronic cervicitis and CIN1 cases. Conclusion:The study has shown that HR RT-PCR and Hc-2 tests are equally effective in detecting HPV infection in patients with CIN 2 and CIN 3 lesions. However, HR RT-PCR is more sensitive test for detecting HPV in chronic cervicitis and early CIN lesions and, therefore can be used in epidemiological study to detect presence of HPV in general population. IMC J Med Sci 2016; 10(2: 45-48

  20. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  1. Specific PCR-based detection of Alternaria helianthi

    DEFF Research Database (Denmark)

    Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

    2012-01-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

  2. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  3. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Science.gov (United States)

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  5. Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples

    DEFF Research Database (Denmark)

    Malorny, B.; Cook, N.; D'Agostino, M.

    2004-01-01

    As part of a standardization project, an interlaboratory trial including 15 laboratories from 13 European countries was conducted to evaluate the performance of a noproprietary polymerase chain reaction (PCR)-based method for the detection of Salmonella on artificially contaminated chicken rinse...... or positive. Outlier results caused, for example, by gross departures from the experimental protocol, were omitted from the analysis. For both the chicken rinse and the pig swab samples, the diagnostic sensitivity was 100%, with 100% accordance (repeatability) and concordance (reproducibility). The diagnostic...... specificity was 80.1% (with 85.7% accordance and 67.5% concordance) for chicken rinse, and 91.7% (with 100% accordance and 83.3% concordance) for pig swab. Thus, the interlaboratory variation due to personnel, reagents, thermal cyclers, etc., did not affect the performance of the method, which...

  6. Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

    OpenAIRE

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-01-01

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

  7. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  8. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A miniaturized and integrated gel post platform for multiparameter PCR detection of herpes simplex viruses from raw genital swabs.

    Science.gov (United States)

    Manage, Dammika P; Lauzon, Jana; Atrazhev, Alexey; Morrissey, Yuen C; Edwards, Ann L; Stickel, Alexander J; Crabtree, H John; Pabbaraju, Kanti; Zahariadis, George; Yanow, Stephanie K; Pilarski, Linda M

    2012-05-07

    Herpes simplex virus (HSV) is one of the most prevalent viruses, with acute and recurrent infections in humans. The current gold standard for the diagnosis of HSV is viral culture which takes 2-14 days and has low sensitivity. In contrast, DNA amplification by polymerase chain reaction (PCR) can be performed within 1-2 h. We here describe a multiparameter PCR assay to simultaneously detect HSV-1 and HSV-2 DNA templates, together with integrated positive and negative controls, with product detection by melting curve analysis (MCA), in an array of semi-solid polyacrylamide gel posts. Each gel post is 0.67 μL in volume, and polymerized with all the components required for PCR. Both PCR and MCA can currently be performed in one hour and 20 min. Unprocessed genital swabs collected in universal transport medium were directly added to the reagents before or after polymerization, diffusing from atop the gel posts. The gel post platform detects HSV templates in as little as 2.5 nL of raw sample. In this study, 45 genital swab specimens were tested blindly as a preliminary validation of this platform. The concordance of PCR on gel posts with conventional PCR was 91%. The primer sequestration method introduced here (wherein different primers are placed in different sets of posts) enables the simultaneous detection of multiple pathogens for the same sample, together with positive and negative controls, on a single chip. This platform accepts unprocessed samples and is readily adaptable to detection of multiple different pathogens or biomarkers for point-of-care diagnostics.

  10. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  11. Evaluation of the AGCU Expressmarker 16 and 22 PCR Amplification Kits Using Biological Samples Applied to FTA Micro Cards in Reduced Volume Direct PCR Amplification Reactions

    Directory of Open Access Journals (Sweden)

    Samantha J Ogden

    2015-01-01

    Full Text Available This study evaluated the performance of the  Wuxi AGCU ScienTech Incorporation (HuiShan, Wuxi, China AGCU Expressmarker 16 (EX 16 and 22 (EX22 short tandem repeat (STR amplification kits in reduced reaction volumes using direct polymerase chain reaction (PCR amplification workflows. The commercially available PowerPlex® 21 (PP21 System (Promega, Wisconsin, USA, which follows similar direct workflows, was used as a reference. Anticoagulate blood applied to chemically impregnated  FTA TM Micro Cards (GE Healthcare UK Limited, Amersham Place, Little Chalfont, Buckinghamshire, HP7 9NA, UK was used to represent a complex biological sample. Allelic concordance, first-pass success rate, average peak heights, heterozygous peak height ratios (HPHRs, and intracolor and intercolor peak height balance were determined. In reduced volume PCR reactions, the performances of both the EX16 and EX22 STR amplification kits were comparable to that of the PP21 System. The level of performance was maintained at PCR reaction volumes, which are 40% of that recommended. The EX22 and PP21 System kits possess comparable overlapping genome coverage. This study evaluated the performance of the AGCU EX16 and EX22 STR amplification kits in reduced PCR reaction volumes using direct workflows in combination with whole blood applied to FTA TM Micro Cards. Allelic concordance, first-pass success rate, average peak heights, HPHRs, and intracolor and intercolor peak height balance were determined. A concordance analysis was completed that compared the performance of the EX16 and EX22 kits using human blood applied to FTA Micro Cards in combination with full, half, and reduced PCR reaction volumes. The PP21 System (Promega was used as a reference kit. Where appropriate, the distributions of data were assessed using the Shapiro-Wilk test. For normally-distributed data, statistics were calculated using analysis of variance (ANOVA and for nonparametric data the Wilcoxon

  12. Detection of tumor markers in prostate cancer and comparison of sensitivity between real time and nested PCR.

    Science.gov (United States)

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-06-27

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.

  13. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  15. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  16. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  17. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Directory of Open Access Journals (Sweden)

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  18. Análisis in silico de la capacidad de dos técnicas de PCR para la detección del gen stx In silico analysis of the capability of two polimerase chain reaction techniques for stx gene detection.

    Directory of Open Access Journals (Sweden)

    L. Galli

    2008-03-01

    Full Text Available Escherichia coli productor de toxina Shiga es un patógeno emergente cuyo principal factor de virulencia son las toxinas Shiga (Stx, codificadas por los genes stx. Estas toxinas se clasifican en 6 tipos (1, 2, 2c, 2d, 2e y 2f que agrupan a 22 variantes. En Argentina se validaron dos técnicas de PCR para la detección de los genes stx, PCR-MK y PCR múltiple. Los objetivos del trabajo fueron analizar mediante el uso de herramientas bioinformáticas la capacidad de dichas técnicas para detectar las variantes del gen stx y demostrar experimentalmente la amplificación de 8 variantes stx. Se recopilaron 25 secuencias nucleotídicas de la base de datos GenBank correspondientes a 21 variantes de stx. Se utilizó el programa BLAST 2 sequences para analizar la complementariedad de las bases nucleotídicas entre las secuencias de las variantes y las secuencias de los cebadores utilizados en las PCR estudiadas. La técnica de PCR-MK permite detectar los tipos stx1, stx2, stx2c, stx2d y stx2f, aunque no permite detectar el tipo stx2e y tres variantes del tipo stx2c. La PCR múltiple permite detectar los tipos stx1, stx2, stx2c, stx2d, pero no los tipos stx2e y stx2f. Se demostró experimentalmente que ambas técnicas de PCR son apropiadas para la detección de las variantes que están asociadas a enfermedad grave en el hombre.Shiga toxin-producing Escherichia coli is an emergent pathogen, being the Shiga toxin (Stx the main virulence factor. These toxins are classified into 6 types (1, 2, 2c, 2d, 2e and 2f and 22 variants. In Argentina, two PCR for stx gene detection, PCR-MK and multiplex-PCR, were validated. The aim of this work was to analyze, by using bioinformatic tools, the stx variants that could be amplified by these PCRs, and to experimentally show the amplification of 8 stx variants. Twentyfive nucleotide sequences were collected from GenBank corresponding to 21 stx variants. The BLAST 2 sequences program was used to analyze the

  19. Evaluation of a PCR and comparison with RLB for detection and differentiation of Theileria sp. MK and other Theileria and Babesia species of small ruminants.

    Science.gov (United States)

    Altay, Kursat; Aktas, Munir; Dumanli, Nazir; Aydin, Mehmet Fatih

    2008-07-01

    Theileria sp. MK in sheep and goats were detected first time by polymerase chain reaction (PCR) and detection limit of PCR and reverse line blotting (RLB) were compared. A part of 18S ssu rRNA gene was amplified from blood samples that were taken from sheep and goats naturally infected with Theileria sp. MK by PCR. Detection limit of both PCR and RLB methods was one infected cell in 10(7) sheep erythrocytes. Nine hundred twenty field samples that had been tested previously by RLB were evaluated by the PCR assay. As found by RLB previously, 12 of 920 (1.30%) samples were detected as positive by PCR. Two positive PCR products, one of which was from sheep and the other from goat, were sequenced. These sequences were identical to the reported nucleotide sequence of Theileria sp. MK. It is concluded that the PCR described in this study will be useful for epidemiological studies and for discrimination between Theileria sp. MK and other Theileria species. In addition, PCR has superiority over RLB because of its ease of use and time period required.

  20. Fluorescence quantitative PCR in detection of HBV DNA

    International Nuclear Information System (INIS)

    Shen Zheng; Li Ming; Shen Xia

    2003-01-01

    Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease

  1. Development of a primer–probe energy transfer based real-time PCR for the detection of Swine influenza virus

    DEFF Research Database (Denmark)

    Kowalczyk, Andrzej; Markowska-Daniel, Iwona; Rasmussen, Thomas Bruun

    2013-01-01

    Swine influenza virus (SIV) causes a contagious and requiring official notification disease of pigs and humans. In this study, a real-time reverse transcription-polymerase chain reaction (RT-PCR) assay based on primer–probe energy transfer (PriProET) for the detection of SIV RNA was developed...... of the specific product amplification. The assay is specific for influenza virus with a sensitivity of detection limit of approximately 10 copies of RNA by PCR. Based on serial dilutions of SIV, the detection limit of the assay was approximately 0.003 TCID50/ml for H1N1 A/Swine/Poland/KPR9/2004 virus. The Pri...

  2. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  3. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  4. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  5. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  6. Current PCR Methods for the Detection, Identification and Quantification of Genetically Modified Organisms(GMOs: a Brief Review

    Directory of Open Access Journals (Sweden)

    Gadani F

    2014-12-01

    Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.

  7. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  8. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Science.gov (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  9. Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

    Science.gov (United States)

    Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

    2009-07-01

    The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

  10. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    Directory of Open Access Journals (Sweden)

    Zhouli Wang

    Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  11. Universal ligation-detection-reaction microarray applied for compost microbes

    Directory of Open Access Journals (Sweden)

    Romantschuk Martin

    2008-12-01

    Full Text Available Abstract Background Composting is one of the methods utilised in recycling organic communal waste. The composting process is dependent on aerobic microbial activity and proceeds through a succession of different phases each dominated by certain microorganisms. In this study, a ligation-detection-reaction (LDR based microarray method was adapted for species-level detection of compost microbes characteristic of each stage of the composting process. LDR utilises the specificity of the ligase enzyme to covalently join two adjacently hybridised probes. A zip-oligo is attached to the 3'-end of one probe and fluorescent label to the 5'-end of the other probe. Upon ligation, the probes are combined in the same molecule and can be detected in a specific location on a universal microarray with complementary zip-oligos enabling equivalent hybridisation conditions for all probes. The method was applied to samples from Nordic composting facilities after testing and optimisation with fungal pure cultures and environmental clones. Results Probes targeted for fungi were able to detect 0.1 fmol of target ribosomal PCR product in an artificial reaction mixture containing 100 ng competing fungal ribosomal internal transcribed spacer (ITS area or herring sperm DNA. The detection level was therefore approximately 0.04% of total DNA. Clone libraries were constructed from eight compost samples. The LDR microarray results were in concordance with the clone library sequencing results. In addition a control probe was used to monitor the per-spot hybridisation efficiency on the array. Conclusion This study demonstrates that the LDR microarray method is capable of sensitive and accurate species-level detection from a complex microbial community. The method can detect key species from compost samples, making it a basis for a tool for compost process monitoring in industrial facilities.

  12. Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

    Science.gov (United States)

    Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

    2002-01-01

    Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

  13. Multiple displacement amplification as an adjunct to PCR-based detection of Staphylococcus aureus in synovial fluid

    Directory of Open Access Journals (Sweden)

    Johnson Sandra

    2010-10-01

    Full Text Available Abstract Background Detection of bacterial nucleic acids in synovial fluid following total joint arthroplasty with suspected infection can be difficult; among other technical challenges, inhibitors in the specimens require extensive sample preparation and can diminish assay sensitivity even using polymerase chain reaction (PCR-based methods. To address this problem a simple protocol for prior use of multiple displacement amplification (MDA as an adjunct to PCR was established and tested on both purified S. aureus DNA as well as on clinical samples known to contain S. aureus nucleic acids. Findings A single round of MDA on purified nucleic acids resulted in a > 300 thousand-fold increase in template DNA on subsequent quantitative PCR (qPCR analysis. MDA use on clinical samples resulted in at least a 100-fold increase in sensitivity on subsequent qPCR and required no sample preparation other than a simple alkali/heat lysis step. Mixed samples of S. aureus DNA with a 103 - 104-fold excess of human genomic DNA still allowed for MDA amplification of the minor bacterial component to the threshold of detectability. Conclusion MDA is a promising technique that may serve to significantly enhance the sensitivity of molecular assays in cases of suspected joint infection while simultaneously reducing the specimen handling required.

  14. A PCR method targeting internal transcribed spacers: the simultaneous detection of Babesia bigemina and Babesia bovis in cattle.

    Science.gov (United States)

    Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun

    2014-03-01

    In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.

  15. A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.

    Science.gov (United States)

    Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P

    2015-06-01

    Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.

  16. How to evaluate PCR assays for the detection of low-level DNA

    DEFF Research Database (Denmark)

    Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus

    2015-01-01

    distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...

  17. Detection and differentiation of Entamoeba histolytica and Entamoeba dispar isolates in clinical samples by PCR.

    Science.gov (United States)

    Helmy, Moshira M F; Rashed, Laila A; Abdel-Fattah, Hisham S

    2007-04-01

    A total of 140 out of 180 outpatients attended MISR University for Science and Technology Hospital complained of abdominal pain, diarrhoea and/or dysentery. Stool examination showed 47 (33.6%) had Entamoeba sp., 36 (25.7%) had cysts and 11 (7.9%) had trophozoites. Of 40 asymptomatic ones, 4 (10%) had cysts. A total of 51 positive stool samples for Entamoeba sp. (40 cysts & 11 trophozoites) were tested by Ne-sted Polymerase Chain Reaction (N-PCR) and Restriction Enzyme Digestion (RED) to clarify true E. histolytica from E. dispar. The results showed that 9/51 (17.6%) had E. dispar, while 31 (60.8%) had E. histolytica and 11 (21.6%) had dual infection with both E. histolytica and E. dispar. All E. histolytica PCR proved cases were from the symptomatic group, 11 had trophozoites and 34 had cysts. Thus, the result showed the potential use of molecular tools in detection of E. histolytica and E. dispar, and is a promising tool for epidemiology, particularly to differentiate pathogenic and non pathogenic Entamoeba sp.

  18. Detection of Mycobacterium avium subspecies paratuberculosis in formula milk from Bogor using PCR IS 900

    Directory of Open Access Journals (Sweden)

    Widagdo S. Nugroho

    2008-09-01

    Full Text Available Crohn’s disease (CD that becomes a public health concern in developed countries shows similarities in clinical signs and pathological features with Johne’s disease (JD in ruminants infected by Mycobacterium avium subspecies paratuberculosis (MAP. Few researches conducted in Europe, the USA, and Australia showed relationships between MAP, CD, JD and dairy products. Indonesians consume milk and diary products from domestic and imported source. Adji in 2004 found some domestic dairy cows that were seropositive for MAP, and this could be a serious problem in dairy farm animals and human health in the future. The aim of this study was to detect MAP in the growing up formula milk. Fifty samples from five established factories were taken from supermarkets in Bogor. Polymerase chain reaction method (PCR with insertion sequence (IS 900 as primer and culture in Herrold’s egg yolk media with mycobactin J (HEYM J as a gold standard were used in this study. Neither MAP grew up in HEYM J medium after 20 weeks of culture period nor positive samples by PCR IS 900 were found. Although there were no positive samples found in this study, further extensive and comprehensive studies on MAP should be done with more and varied samples, as well as in human to provide data on MAP in Indonesia. (Med J Indones 2008; 17: 183-7Keywords: Crohn’s disease, dairy cow, growing up formula milk

  19. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  20. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  1. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  2. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  3. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    NARCIS (Netherlands)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  4. Real-time PCR for detection of Theileria equi and Babesia caballi ...

    African Journals Online (AJOL)

    Real-time PCR for detection of Theileria equi and Babesia caballi parasites in ticks. ... This study aimed to develop a real-time PCR screening test for Babesia caballi and Theileria equi in ticks. Adult D. reticulatus were ... This test is suitable for application in epidemiological surveillance of equine babesiosis and theileriosis.

  5. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  6. Establishment of a minor groove binder-probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by ospA-specific conventional PCR

    Directory of Open Access Journals (Sweden)

    Strube Christina

    2010-08-01

    Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from

  7. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  8. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.

    2007-01-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

  9. Real-time PCR-based detection of Bordetella pertussis and Bordetella parapertussis in an Irish paediatric population.

    LENUS (Irish Health Repository)

    Grogan, Juanita A

    2011-06-01

    Novel real-time PCR assays targeting the Bordetella pertussis insertion sequence IS481, the toxin promoter region and Bordetella parapertussis insertion sequence IS1001 were designed. PCR assays were capable of detecting ≤10 copies of target DNA per reaction, with an amplification efficiency of ≥90 %. From September 2003 to December 2009, per-nasal swabs and nasopharyngeal aspirates submitted for B. pertussis culture from patients ≤1 month to >15 years of age were examined by real-time PCR. Among 1324 patients, 76 (5.7 %) were B. pertussis culture positive and 145 (10.95 %) were B. pertussis PCR positive. Of the B. pertussis PCR-positive patients, 117 (81 %) were aged 6 months or less. A total of 1548 samples were examined, of which 87 (5.6 %) were culture positive for B. pertussis and 169 (10.92 %) were B. pertussis PCR positive. All culture-positive samples were PCR positive. Seven specimens (0.5 %) were B. parapertussis culture positive and 10 (0.8 %) were B. parapertussis PCR positive, with all culture-positive samples yielding PCR-positive results. A review of patient laboratory records showed that of the 1324 patients tested for pertussis 555 (42 %) had samples referred for respiratory syncytial virus (RSV) testing and 165 (30 %) were positive, as compared to 19.4 % of the total 5719 patients tested for RSV in this period. Analysis of the age distribution of RSV-positive patients identified that 129 (78 %) were aged 6 months or less, similar to the incidence observed for pertussis in that patient age group. In conclusion, the introduction of the real-time PCR assays for the routine detection of B. pertussis resulted in a 91 % increase in the detection of the organism as compared to microbiological culture. The incidence of infection with B. parapertussis is low while the incidence of RSV infection in infants suspected of having pertussis is high, with a similar age distribution to B. pertussis infection.

  10. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  11. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  13. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  14. Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

    Science.gov (United States)

    Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

    2014-12-15

    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Development of a novel single tube nested PCR for enhanced detection of cytomegalovirus DNA from dried blood spots.

    Science.gov (United States)

    Atkinson, C; Emery, V C; Griffiths, P D

    2014-02-01

    Newborn screening for congenital cytomegalovirus (CCMV) using dried blood spots (DBS) has been proposed because many developed countries have DBS screening programmes in place for other diseases. The aim of this study was to develop a rapid, single tube nested polymerase chain reaction (PCR) method for enhanced detection of CMV from DBS compared to existing (single target) real time PCRs. The new method was compared with existing real time PCRs for sensitivity and specificity. Overall sensitivity of the single target PCR assays in both asymptomatic and symptomatic infants with laboratory confirmed congenital CMV was 69% (CMV PCR or culture positive before day 21 of life). In contrast, the single tube nested assay had an increased sensitivity of 81% with100% specificity. Overall the assay detected CMV from a DBS equivalent to an original blood sample which contained 500IU/ml. In conclusion this single tube nested methodology allows simultaneous amplification and detection of CMV DNA in 1.5h removing the associated contamination risk of a two step nested PCR. Owing to its increased sensitivity, it has the potential to be used as a screening assay and ultimately allow early identification and intervention for children with congenital CMV. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A Multiplex PCR for Simultaneous Detection of Three Zoonotic Parasites Ancylostoma ceylanicum, A. caninum, and Giardia lamblia Assemblage A

    Directory of Open Access Journals (Sweden)

    Wei Hu

    2015-01-01

    Full Text Available Ancylostoma ceylanicum, A. caninum, and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats; they can also infect humans, causing parasitic zoonoses. In this study, a multiplex PCR method was developed for simultaneous identification and detection of those three zoonotic parasites. Three pairs of specific primers were designed based on ITS sequence of A. ceylanicum and A. caninum and TPI gene of G. lamblia available in the GenBank. The multiplex PCR reaction system was established by optimizing the reaction condition, and a series of tests on the sensitivity, specificity, and clinical application were also conducted. Results showed that three target fragments were amplified specifically; the detection limit was 10 eggs for both A. ceylanicum and A. caninum, 72 pg DNA for G. lamblia. Of 112 clinical fecal samples, 34.8% and 17.8% samples were positive for A. caninum and A. ceylanicum, respectively, while only 2.7% samples were positive for G. lamblia assemblage A. It is concluded that the established multiplex PCR assay is a convenient, rapid, cost-effective, and high-efficiency method for molecular detection and epidemiological investigation of three zoonotic parasites.

  17. A real-time PCR approach to detect predation on anchovy and sardine early life stages

    Science.gov (United States)

    Cuende, Elsa; Mendibil, Iñaki; Bachiller, Eneko; Álvarez, Paula; Cotano, Unai; Rodriguez-Ezpeleta, Naiara

    2017-12-01

    Recruitment of sardine (Sardina pilchardus Walbaum, 1792) and anchovy (Engraulis encrasicolus Linnaeus, 1758) is thought to be regulated by predation of their eggs and larvae. Predators of sardine and anchovy can be identified by visual taxonomic identification of stomach contents, but this method is time consuming, tedious and may underestimate predation, especially in small predators such as fish larvae. Alternatively, genetic tools may offer a more cost-effective and accurate alternative. Here, we have developed a multiplex real-time polymerase chain reaction (RT-PCR) assay based on TaqMan probes to simultaneously detect sardine and anchovy remains in gut contents of potential predators. The assay combines previously described and newly generated species-specific primers and probes for anchovy and sardine detection respectively, and allows the detection of 0,001 ng of target DNA (which corresponds to about one hundredth of the total DNA present in a single egg). We applied the method to candidate anchovy and sardine egg predators in the Bay of Biscay, Atlantic Mackerel (Scomber scombrus) larvae. Egg predation observed was limited primarily to those stations where sardine and/or anchovy eggs were present. Our developed assay offers a suitable tool to understand the effects of predation on the survival of anchovy and sardine early life stages.

  18. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

    Science.gov (United States)

    Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

    2015-06-15

    Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

    Science.gov (United States)

    del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

    2007-02-01

    Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

  20. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  2. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  3. Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Kang Feng-feng

    2012-03-01

    Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

  4. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  5. Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Natividad-Sancho Angels

    2005-08-01

    Full Text Available Abstract Background Herpes Simplex Virus (HSV Genital Ulcer Disease (GUD is an important public health problem, whose interaction with HIV results in mutually enhancing epidemics. Conventional methods for detecting HSV tend to be slow and insensitive. We designed a rapid PCR-based assay to quantify and type HSV in cervicovaginal lavage (CVL fluid of subjects attending a Genito-Urinary Medicine (GUM clinic. Vaginal swabs, CVL fluid and venous blood were collected. Quantitative detection of HSV was conducted using real time PCR with HSV specific primers and SYBR Green I. Fluorogenic TaqMan Minor Groove Binder (MGB probes designed around a single base mismatch in the HSV DNA polymerase I gene were used to type HSV in a separate reaction. The Kalon test was used to detect anti-HSV-2 IgG antibodies in serum. Testing for HIV, other Sexually Transmitted Infections (STI and related infections was based on standard clinical and laboratory methods. Results Seventy consecutive GUM clinic attendees were studied. Twenty-seven subjects (39% had detectable HSV DNA in CVL fluid; HSV-2 alone was detected in 19 (70% subjects, HSV-1 alone was detected in 4 (15% subjects and both HSV types were detected in 4 (15% subjects. Eleven out of 27 subjects (41% with anti-HSV-2 IgG had detectable HSV-2 DNA in CVL fluid. Seven subjects (10% were HIV-positive. Three of seven (43% HIV-infected subjects and two of five subjects with GUD (40% were secreting HSV-2. None of the subjects in whom HSV-1 was detected had GUD. Conclusion Quantitative real-time PCR and Taqman MGB probes specific for HSV-1 or -2 were used to develop an assay for quantification and typing of HSV. The majority of subjects in which HSV was detected had low levels of CVL fluid HSV, with no detectable HSV-2 antibodies and were asymptomatic.

  6. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  7. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  8. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    Directory of Open Access Journals (Sweden)

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  9. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  10. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  11. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Science.gov (United States)

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  12. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Science.gov (United States)

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  13. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  14. In silico and in vitro evaluation of PCR-based assays for the detection of Bacillus anthracis chromosomal signature sequences

    DEFF Research Database (Denmark)

    Ågren, Joakim; Hamidjaja, Raditijo A.; Hansen, Trine

    2013-01-01

    Bacillus anthracis, the causative agent of anthrax, is a zoonotic pathogen that is relatively common throughout the world and may cause life threatening diseases in animals and humans. There are many PCR-based assays in use for the detection of B. anthracis. While most of the developed assays rely...... on unique markers present on virulence plasmids pXO1 and pXO2, relatively few assays incorporate chromosomal DNA markers due to the close relatedness of B. anthracis to the B. cereus group strains. For the detection of chromosomal DNA, different genes have been used, such as BA813, rpoB, gyrA, plcR, S...... targets evaluated are claimed to be specific to B. anthracis, cross-reactions with closely related B. cereus and B. thuringiensis strains were often observed. Of the 35 investigated PCR assays, only 4 were 100% specific for the B. anthracis chromosome. An interlaboratory ring trial among five European...

  15. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  16. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  17. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    Science.gov (United States)

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag

    2018-03-05

    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  18. Detection and differentiation of Mycobacterium tuberculosis and nontuberculous mycobacterial isolates by real-time PCR.

    Science.gov (United States)

    Shrestha, Nabin K; Tuohy, Marion J; Hall, Gerri S; Reischl, Udo; Gordon, Steven M; Procop, Gary W

    2003-11-01

    Mycobacteria cause a variety of illnesses that differ in severity and public health implications. The differentiation of Mycobacterium tuberculosis from nontuberculous mycobacteria (NTM) is of primary importance for infection control and choice of antimicrobial therapy. Despite advances in molecular diagnostics, the ability to rapidly diagnose M. tuberculosis infections by PCR is still inadequate, largely because of the possibility of false-negative reactions. We designed and validated a real-time PCR for mycobacteria by using the LightCycler system with 18 reference strains and 168 clinical mycobacterial isolates. All clinically significant mycobacteria were detected; the mean melting temperatures (with 99.9% confidence intervals [99.9% CI] in parentheses) for the different mycobacteria were as follows: M. tuberculosis, 64.35 degrees C (63.27 to 65.42 degrees C); M. kansasii, 59.20 degrees C (58.07 to 60.33 degrees C); M. avium, 57.82 degrees C (57.05 to 58.60 degrees C); M. intracellulare, 54.46 degrees C (53.69 to 55.23 degrees C); M. marinum, 58.91 degrees C (58.28 to 59.55 degrees C); rapidly growing mycobacteria, 53.09 degrees C (50.97 to 55.20 degrees C) or 43.19 degrees C (42.19 to 44.49 degrees C). This real-time PCR assay with melting curve analysis consistently accurately detected and differentiated M. tuberculosis from NTM. Detection of an NTM helps ensure that the negative result for M. tuberculosis is a true negative. The specific melting temperature also provides a suggestion of the identity of the NTM present, when the most commonly encountered mycobacterial species are considered. In a parallel comparison, both the LightCycler assay and the COBAS Amplicor M. tuberculosis assay correctly categorized 48 of 50 specimens that were proven by culture to contain M. tuberculosis, and the LightCycler assay correctly characterized 3 of 3 specimens that contained NTM.

  19. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  20. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

    Science.gov (United States)

    Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

    2016-05-01

    Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the virus remains latent. However, the virus may be transmitted to human recipients receiving pig transplants. Recently, it was shown that pig-to-non-human-primate xenotransplantations showed 2 to 3 times lower transplant survival when the donor pig was infected with PCMV. Therefore, highly sensitive methods are required to select virus-free pigs and to examine xenotransplants. Seven previously established PCR detection systems targeting the DNA polymerase gene of PCMV were examined by comparison of thermodynamic parameters of oligonucleotides, and new diagnostic nested PCR and real-time PCR systems with improved parameters and high sensitivity were established. The detection limit of conventional PCR was estimated to be 15 copies, and that of the nested PCR was 5 copies. The sensitivity of the real-time PCR with a TaqMan probe was two copies. An equal efficiency of the newly established detection systems was shown by parallel testing of DNA from sera and blood of six pigs, identifying the same animals as PCMV infected. These new diagnostic PCR systems will improve the detection of PCMV and therefore increase the safety of porcine xenotransplants.

  1. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  2. Development of a PCR/LDR/capillary electrophoresis assay with potential for the detection of a beta-thalassemia fetal mutation in maternal plasma.

    Science.gov (United States)

    Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li

    2010-08-01

    Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.

  3. Fast Real-Time PCR for the Detection of Crustacean Allergens in Foods.

    Science.gov (United States)

    Santaclara, Francisco J; Espiñeira, Montserrat

    2017-01-01

    Crustaceans are one of the most common allergens causing severe food reaction. Hypersensitivity reactions associated with seafood intake are one of the most common food allergies in adults. Crustaceans including shrimps, prawns, crabs, lobster, and crayfish are a common cause of anaphylaxis or hypersensitivity, with shrimps and crabs being the most common causes of allergy. Symptoms occur most often when food or cooking water are ingested.These food allergens are a health problem, and they have become very important; as evidenced by the existence of several regulations that establish that labeling must be present regarding these allergens to warn consumers.The methodology herein exposed allows the detection of crustaceans in any type of product, including those where very aggressive treatments of temperature and pressure are used during the manufacturing process.The main features of this method are its high sensitivity and specificity, and reduced analysis time of real-time PCR (40 min). This assay is a potential tool in issues related to the labeling of products and food security to protect the allergic consumer.

  4. Leishmania parasite detection and quantification using PCR-ELISA

    Czech Academy of Sciences Publication Activity Database

    Kobets, Tetyana; Badalová, Jana; Grekov, Igor; Havelková, Helena; Lipoldová, Marie

    2010-01-01

    Roč. 5, č. 6 (2010), s. 1074-1080 ISSN 1754-2189 R&D Projects: GA ČR GA310/08/1697; GA MŠk(CZ) LC06009 Institutional research plan: CEZ:AV0Z50520514 Keywords : polymerase chain reaction * Leishmania major infection * parasite quantification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.362, year: 2010

  5. Development and utility of an internal threshold control (ITC real-time PCR assay for exogenous DNA detection.

    Directory of Open Access Journals (Sweden)

    Weiyi Ni

    Full Text Available Sensitive and specific tests for detecting exogenous DNA molecules are useful for infectious disease diagnosis, gene therapy clinical trial safety, and gene doping surveillance. Taqman real-time PCR using specific sequence probes provides an effective approach to accurately and quantitatively detect exogenous DNA. However, one of the major challenges in these analyses is to eliminate false positive signals caused by either non-targeted exogenous or endogenous DNA sequences, or false negative signals caused by impurities that inhibit PCR. Although multiplex Taqman PCR assays have been applied to address these problems by adding extra primer-probe sets targeted to endogenous DNA sequences, the differences between targets can lead to different detection efficiencies. To avoid these complications, a Taqman PCR-based approach that incorporates an internal threshold control (ITC has been developed. In this single reaction format, the target sequence and ITC template are co-amplified by the same primers, but are detected by different probes each with a unique fluorescent dye. Sample DNA, a prescribed number of ITC template molecules set near the limit of sensitivity, a single pair of primers, target probe and ITC probe are added to one reaction. Fluorescence emission signals are obtained simultaneously to determine the cycle thresholds (Ct for amplification of the target and ITC sequences. The comparison of the target Ct with the ITC Ct indicates if a sample is a true positive for the target (i.e. Ct less than or equal to the ITC Ct or negative (i.e. Ct greater than the ITC Ct. The utility of this approach was demonstrated in a nonhuman primate model of rAAV vector mediated gene doping in vivo and in human genomic DNA spiked with plasmid DNA.

  6. Nested-PCR real time as alternative molecular tool for detection of Borrelia burgdorferi compared to the classical serological diagnosis of the blood.

    Science.gov (United States)

    Sroka-Oleksiak, Agnieszka; Ufir, Krzysztof; Salamon, Dominika; Bulanda, Malgorzata; Gosiewski, Tomasz

    Lyme disease, caused by Borrelia burgdorferi, is a multisystem disease that often makes difficulties to recognize caused by their genetic heterogenity. Currently, the gold standard for the detection of Lyme disease (LD) is serologic diagnostics based mainly on tests: ELISA and Western blot (WB). These methods, however, are subject to consider- able defect, especially in the initial phase of infection due to the occurrence of so-called serological window period and low specificity. For this reason, they might be replaced by molecular methods, for example polymerase chain reaction (PCR), which should be more sensitivity and specificity. In the present study we attempt to optimize the PCR reaction conditions and enhance existing test sensitivity by applying the equivalent of real time PCR - nested PCR for detection B. burgdorferi DNA in the patient's blood. The study involved 94 blood samples of patients with suspected LD. From each sample, 1.5 ml of blood was used for the isolation of bacterial DNA and PCR real time am- plification and its equivalent, in nested version. The remaining part earmarked for serologi- cal testing. Optimization of the reaction conditions made experimentally, using gradient of the temperature and gradient of the magnesium ions concentration for reaction real time in nested-PCR and PCR version. The results show that the nested-PCR real time, has a much higher sensitivity 45 (47.8%) of positive results for the detection of B. burgdorferi compared to the single- variety, without a preceding pre-amplification 2 (2.1%). Serological methods allowed the detection of infection in 41 (43.6%) samples. These results support of the nested PCR method as a better molecular tool for the detection of B. burgdorferi infection than classical PCR real time reaction. The nested-PCR real time method may be considered as a complement to ELISA and WB mainly in the early stages of infection, when in the blood circulating B. burgdorferi cells. By contrast, the

  7. Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

    Science.gov (United States)

    Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

    2011-01-01

    In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

  8. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    Science.gov (United States)

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  9. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT-PCR

  10. A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

    Science.gov (United States)

    Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

    2003-01-01

    Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

  11. Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

    Science.gov (United States)

    Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

    2013-12-01

    Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

    Science.gov (United States)

    Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

    2018-01-01

    The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  14. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    Science.gov (United States)

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  15. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    Science.gov (United States)

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Science.gov (United States)

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  17. Use of Competitive PCR to Detect and Quantify Haplosporidium nelsoni Infection (MSX disease) in the Eastern Oyster (Crassostrea virginica).

    Science.gov (United States)

    Day, J Michael; Franklin, Dean E.; Brown, Bonnie L.

    2000-09-01

    This study was undertaken to develop a quantitative polymerase chain reaction assay that would improve the utility of PCR for detecting Haplosporidium nelsoni (MSX), a serious parasite of the eastern oyster Crassostrea virginica. A competitive PCR sequence was generated from the H. nelsoni small subunit ribosomal DNA fragment, originally described by Stokes and colleagues, that was amplified by the same PCR primers and had similar amplification performance. Assays performed using competitor dilutions ranging from 0.05 to 500 pg/µl DNA were used to test oyster samples designated using histological techniques as having "light" or "heavy" MSX infections. Visual diagnoses were confirmed equally well with three methods: densitometry of ethidium-bromide-stained agarose, densitometry of SYBRGreen-stained polyacrylamide gels, and analysis by GeneScan 3.0 of fluorescent products detected in ultrathin gels. Oysters diagnosed as negative for MSX tested as negative or light by PCR. Oysters with light MSX infections generally had less than 5 pg/µl infectious DNA. Oysters with heavy infections generally corresponded to 5 pg/µl or greater competitor dilutions.

  18. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  19. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  20. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

    Science.gov (United States)

    Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

    2008-05-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

  1. A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

    2014-06-01

    Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

  2. Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

    Science.gov (United States)

    Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

    2018-03-01

    Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  3. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  4. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral

  5. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    Science.gov (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  6. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  7. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

    2007-01-01

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  8. Real-Time PCR Assay To Detect Smallpox Virus

    Science.gov (United States)

    Sofi Ibrahim, M.; Kulesh, David A.; Saleh, Sharron S.; Damon, Inger K.; Esposito, Joseph J.; Schmaljohn, Alan L.; Jahrling, Peter B.

    2003-01-01

    We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/μl to 1 ng/μl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/μl to 1 ng/μl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/μl to 1 ng/μl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/μl to 1 ng/μl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler

  9. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Directory of Open Access Journals (Sweden)

    Henrich Birgit

    2008-04-01

    Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

  10. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Science.gov (United States)

    Schaeffer, Anke; Henrich, Birgit

    2008-01-01

    Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

  11. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  12. Optimization of Quantitative PCR Methods for Enteropathogen Detection

    Science.gov (United States)

    Liu, Jie; Gratz, Jean; Amour, Caroline; Nshama, Rosemary; Walongo, Thomas; Maro, Athanasia; Mduma, Esto; Platts-Mills, James; Boisen, Nadia; Nataro, James; Haverstick, Doris M.; Kabir, Furqan; Lertsethtakarn, Paphavee; Silapong, Sasikorn; Jeamwattanalert, Pimmada; Bodhidatta, Ladaporn; Mason, Carl; Begum, Sharmin; Haque, Rashidul; Praharaj, Ira; Kang, Gagandeep; Houpt, Eric R.

    2016-01-01

    Detection and quantification of enteropathogens in stool specimens is useful for diagnosing the cause of diarrhea but is technically challenging. Here we evaluate several important determinants of quantification: specimen collection, nucleic acid extraction, and extraction and amplification efficiency. First, we evaluate the molecular detection and quantification of pathogens in rectal swabs versus stool, using paired flocked rectal swabs and whole stool collected from 129 children hospitalized with diarrhea in Tanzania. Swabs generally yielded a higher quantification cycle (Cq) (average 29.7, standard deviation 3.5 vs. 25.3 ± 2.9 from stool, P<0.001) but were still able to detect 80% of pathogens with a Cq < 30 in stool. Second, a simplified total nucleic acid (TNA) extraction procedure was compared to separate DNA and RNA extractions and showed 92% (318/344) sensitivity and 98% (951/968) specificity, with no difference in Cq value for the positive results (ΔCq(DNA+RNA-TNA) = -0.01 ± 1.17, P = 0.972, N = 318). Third, we devised a quantification scheme that adjusts pathogen quantity to the specimen’s extraction and amplification efficiency, and show that this better estimates the quantity of spiked specimens than the raw target Cq. In sum, these methods for enteropathogen quantification, stool sample collection, and nucleic acid extraction will be useful for laboratories studying enteric disease. PMID:27336160

  13. [Development and application of real-time PCR for identification and detection of horse meat in animal-origin products].

    Science.gov (United States)

    Li, Nan; Wang, Jiahui; Shen, Qing; Han, Chunhui; Zhang, Jing; Li, Fengqin; Xu, Jin; Jiang, Tao

    2013-11-01

    To develop a real-time PCR method for identification and detection of domestic horse meat (Equus caballus) in animal-origin products. The primer and TaqMan-probe was designed and synthesized according to the EU reference laboratory and 87 bp fragments was amplified for horse ingredients. The specificity and sensitivity was tested by artificially spiked horse meat into other domestic meat, such as cattle, sheep, pork, chicken, duck and rabbit. 122 samples of cattle and sheep products were random collected in Beijing market and the detection of horse meat was carried out. The real-time PCR in this study has high specificity and sensitivity for horse meat. No cross-reaction was observed between the horse and sheep, pork, chicken, duck and rabbit meat. There was little cross reaction between horse and cattle when the CT value reach 33. 81. The method can detect 0.1% of horse meat mixed with other domestic animal-origin products. No horse meat ingredients were detected in 122 samples in this survey. There was no horse meat mixed into cattle and sheep products in Beijing marked.

  14. Development of Nested-PCR Assay to Detect Acidovorax citrulli, a Causal Agent of Bacterial Fruit Blotch at Cucurbitaceae

    Directory of Open Access Journals (Sweden)

    Young-Tak Kim

    2015-06-01

    Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.

  15. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  16. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  17. A TaqMan-based real-time PCR assay for porcine parvovirus 4 detection and quantification in reproductive tissues of sows

    Science.gov (United States)

    Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...

  18. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

    DEFF Research Database (Denmark)

    Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

    2018-01-01

    Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

  19. Use of Nested and Real-Time PCR for the Detection of Ceratocystis fagacearum in the Sapwood of Diseased Oak Species in Minnesota

    Science.gov (United States)

    A. Yang; J. Juzwik

    2017-01-01

    Oak wilt caused by Ceratocystis fagacearum is a significant disease of Quercus spp. in the eastern United States. Early and accurate detection of the pathogen is particularly important when disease control is planned. Nested and real-time polymerase chain reaction (PCR) methods utilizing fungal DNA extracted from sapwood drill...

  20. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  1. Detection of Mycobacterium avium subsp. paratuberculosis in Milk from Clinically Affected Cows by PCR and culture

    DEFF Research Database (Denmark)

    Giese, Steen Bjørck; Ahrens, Peter

    1999-01-01

    Milk and faecal samples from cows with clinical symptoms of paratuberculosis were examined for the presence of Mycobacterium avium subsp.paratuberculosis (M. a. paratuberculosis) by culture and PCR. M. a. paratuberculosis was isolated in varied numbers from faeces or intestinal mucosa in 8 of 11...... animals. In milk from 5 cows (all faecal culture-positive) we cultivated a few colonies of M. a. paratuberculosis (less than 100 CFU per mi). Milk samples from 2 cows were PCR-positive (both animals were faecal culture-positive, and 1 cow was milk culture positive). One cow was culture......-negative on intestinal mucosa, but culture-positive in milk, and both faeces and milk were negative in culture and PCR from 2 cows. In conclusion the presence of M. a. paratuberculosis could be detected in raw milk by PCR but cultivation of milk was more sensitive in detecting the organism....

  2. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    Science.gov (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  3. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  4. A real-time PCR assay for detection and quantification of Verticillium dahliae in spinach seed.

    Science.gov (United States)

    Duressa, Dechassa; Rauscher, Gilda; Koike, Steven T; Mou, Beiquan; Hayes, Ryan J; Maruthachalam, Karunakaran; Subbarao, Krishna V; Klosterman, Steven J

    2012-04-01

    Verticillium dahliae is a soilborne fungus that causes Verticillium wilt on multiple crops in central coastal California. Although spinach crops grown in this region for fresh and processing commercial production do not display Verticillium wilt symptoms, spinach seeds produced in the United States or Europe are commonly infected with V. dahliae. Planting of the infected seed increases the soil inoculum density and may introduce exotic strains that contribute to Verticillium wilt epidemics on lettuce and other crops grown in rotation with spinach. A sensitive, rapid, and reliable method for quantification of V. dahliae in spinach seed may help identify highly infected lots, curtail their planting, and minimize the spread of exotic strains via spinach seed. In this study, a quantitative real-time polymerase chain reaction (qPCR) assay was optimized and employed for detection and quantification of V. dahliae in spinach germplasm and 15 commercial spinach seed lots. The assay used a previously reported V. dahliae-specific primer pair (VertBt-F and VertBt-R) and an analytical mill for grinding tough spinach seed for DNA extraction. The assay enabled reliable quantification of V. dahliae in spinach seed, with a sensitivity limit of ≈1 infected seed per 100 (1.3% infection in a seed lot). The quantification was highly reproducible between replicate samples of a seed lot and in different real-time PCR instruments. When tested on commercial seed lots, a pathogen DNA content corresponding to a quantification cycle value of ≥31 corresponded with a percent seed infection of ≤1.3%. The assay is useful in qualitatively assessing seed lots for V. dahliae infection levels, and the results of the assay can be helpful to guide decisions on whether to apply seed treatments.

  5. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  6. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  7. Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

    NARCIS (Netherlands)

    Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  8. Strategies for the inclusion of an internal amplification control in conventional and real time PCR detection of Campylobacter spp. in chicken fecal samples

    DEFF Research Database (Denmark)

    Lund, Marianne; Madsen, Mogens

    2006-01-01

    To illustrate important issues in optimization of a PCR assay with an internal control four different primer combinations for conventional PCR, two non-competitive and two competitive set-ups for real time PCR were used for detection of Campylobacter spp. in chicken faecal samples....... In the conventional PCR assays the internal control was genomic DNA from Yersinia ruckeri, which is not found in chicken faeces. This internal control was also used in one of the set LIPS in real time PCR. In the three other set-ups different DNA fragments of 109 bp length prepared from two oligos of each 66 bp...... by a simple extension reaction was used. All assays were optimized to avoid loss of target sensitivity due to the presence of the internal control by adjusting the amount of internal control primers in the duplex assays and the amount of internal control in all assays. Furthermore. the assays were tested...

  9. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  10. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Science.gov (United States)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  11. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR

    OpenAIRE

    Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

    2017-01-01

    Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos t...

  12. PCR (Polymerase Chain Reaction) Assay On Antibiotics Resistant Clinical Isolates Of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    R, Maria Lina; S, Dadang; Suhadi, F.

    2000-01-01

    To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively

  13. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

    Science.gov (United States)

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

    2003-09-01

    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  14. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Directory of Open Access Journals (Sweden)

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  15. Real-Time PCR using a PCR Microchip with Integrated Thermal System and Polymer Waveguides for the Detection of Campylobacter jejuni

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Sekulovic, Andrea; Kutter, Jörg Peter

    2006-01-01

    A novel real-time PCR microchip platform with integrated thermal system and polymer waveguides has been developed. By using the integrated optical system of the real-time PCR chip, cadF – a virulence gene of Campylobacter jejuni, could specifically be detected. Two different DNA binding dyes, SYTOX...

  16. Detection of Brucella abortus DNA in aborted goats and sheep in Egypt by real-time PCR.

    Science.gov (United States)

    Wareth, Gamal; Melzer, Falk; Tomaso, Herbert; Roesler, Uwe; Neubauer, Heinrich

    2015-06-03

    Brucellosis is a major zoonoses affects wide range of domesticated as well as wild animals. Despite the eradication program of brucellosis in Egypt, the disease is still endemic among cattle, buffaloes, sheep, goats, and camels. In the present study, abortion occurred naturally among 25 animals (10 cows, 5 buffaloes, 9 Egyptian Baladi goats and 1 ewe) shared the same pasture were investigated by real-time polymerase chain reaction (RT-PCR). DNA of Brucella (B.) abortus was detected in serum of goats and sheep which has aborted recently by species-specific RT-PCR. The results suggest cross-species infection of B. abortus from cattle to non-preferred hosts raised in close contact. This article will renew our knowledge about the Brucella agent causing abortion in small ruminants in Egypt. Information provided in this study is important for surveillance program, because eradication programs and vaccination strategies may have to be adapted accordingly.

  17. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    Science.gov (United States)

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  18. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    Science.gov (United States)

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047

  19. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    OpenAIRE

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.

  20. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  1. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  2. Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

    Science.gov (United States)

    Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

    2017-10-01

    Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

  3. Improved detection of canine Angiostrongylus vasorum infection using real-time PCR and indirect ELISA.

    Science.gov (United States)

    Jefferies, Ryan; Morgan, Eric R; Helm, Jenny; Robinson, Matthew; Shaw, Susan E

    2011-12-01

    This study reports the development of a real-time PCR assay and an indirect ELISA to improve on current detection of canine Angiostrongylus vasorum infection. A highly specific fluorescent probe-based, real-time PCR assay was developed to target the A. vasorum second internal transcribed spacer region and detected DNA in EDTA blood, lung tissue, broncho-alveolar larvage fluid, endotracheal mucus, pharyngeal swabs and faecal samples. PCR was fast (∼1 h), highly efficient when using EDTA blood samples, consistently detected a single molecule of parasite DNA and did not amplify DNA from other parasitic nematodes or definitive host species. An indirect ELISA was also developed using the soluble protein fraction from adult A. vasorum worms. Some cross-reactive antigen recognition was observed when tested against sera from dogs infected with Crenosoma vulpis (n = 8), Toxocara canis (n = 5) and Dirofilaria immitis (n = 5). This was largely overcome by setting the cut-off for a positive result at an appropriately high level. Field evaluation of the real-time PCR and ELISA was conducted by testing sera and EDTA blood from dogs with suspected A. vasorum infection (n = 148) and compared with the Baermann's larval migration test in faeces. Thirty-one dogs were positive by at least one test. Of these, 20 (65%) were detected by the Baermann method, 18 (58%) by blood PCR, 24 (77%) by ELISA and 28 (90%) by blood PCR and ELISA together. Combined testing using real-time PCR and ELISA therefore improved the detection rate of A. vasorum infection and holds promise for improved clinical diagnosis and epidemiological investigation.

  4. Mycobacterium paratuberculosis detection in cow's milk in Argentina by immunomagnetic separation-PCR.

    Science.gov (United States)

    Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2016-01-01

    The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  5. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  6. Comparison of culture-based, vital stain and PMA-qPCR methods for the quantitative detection of viable hookworm ova.

    Science.gov (United States)

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2017-06-01

    Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.

  7. Virus reactivations after autologous hematopoietic stem cell transplantation detected by multiplex PCR assay.

    Science.gov (United States)

    Inazawa, Natsuko; Hori, Tsukasa; Nojima, Masanori; Saito, Makoto; Igarashi, Keita; Yamamoto, Masaki; Shimizu, Norio; Yoto, Yuko; Tsutsumi, Hiroyuki

    2017-02-01

    Several studies have indicated that viral reactivations following allogeneic hematopoietic stem cell transplantation (allo-HSCT) are frequent, but viral reactivations after autologous HSCT (auto-HSCT) have not been investigated in detail. We performed multiplex polymerase chain reaction (PCR) assay to examine multiple viral reactivations simultaneously in 24 patients undergoing auto-HSCT between September 2010 and December 2012. Weekly whole blood samples were collected from pre- to 42 days post-HSCT, and tested for the following 13 viruses; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, adeno virus (ADV), BK virus (BKV), JC virus (JCV), parvovirus B19 (B19V), and hepatitis B virus (HBV).  Fifteen (63%) patients had at least one type of viral reactivation. HHV6 (n = 10; 41.7%) was most frequently detected followed by EBV (n = 7; 29.2%). HHV-6 peaked on day 21 after HSCT and promptly declined. In addition, HBV, CMV, HHV7, and B19V were each detected in one patient. HHV6 reactivation was detected in almost half the auto-HSCT patients, which was similar to the incidence in allo-HSCT patients. The incidence of EBV was unexpectedly high. Viral infections in patients undergoing auto-HSCT were higher than previously reported in other studies. Although there were no particular complications of viral infection, we should pay attention to possible viral reactivations in auto-HSCT patients. J. Med. Virol. 89:358-362, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

    Science.gov (United States)

    Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

    2006-01-01

    A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

  9. Citrus huanglongbing in São Paulo State, Brazil: PCR detection of the 'Candidatus' Liberibacter species associated with the disease.

    Science.gov (United States)

    do Carmo Teixeira, Diva; Luc Danet, Jean; Eveillard, Sandrine; Cristina Martins, Elaine; de Jesus Junior, Waldir Cintra; Takao Yamamoto, Pedro; Aparecido Lopes, Silvio; Beozzo Bassanezi, Renato; Juliano Ayres, Antonio; Saillard, Colette; Bové, Joseph Marie

    2005-06-01

    Symptoms of huanglongbing (HLB), one of the most serious diseases of citrus in Asia and Africa, have been noticed in March 2004 in the Araraquara region of São Paulo State, Brazil. HLB has not been reported previously from America. The causal HLB bacteria, Candidatus Liberibacter africanus in Africa and Candidatus Liberibacter asiaticus in Asia, can be detected in symptomatic citrus leaves by PCR amplification of their 16S rDNA with previously described primers. When this technique was applied to 43 symptomatic leaf samples from the Araraquara region, all PCR reactions were negative. This suggested that a new pathogen, not detected by the above primers, could be involved in HLB in the State of São Paulo. Indeed, by using universal primers for amplification of bacterial 16S rDNA, a new liberibacter species, Candidatus Liberibacter americanus, has recently been identified. Specific primers for PCR amplification of the 16S rDNA of Ca. L. americanus have been selected. Using these primers, the new liberibacter could be detected in 214 symptomatic leaf samples tested. The leaves of two additional samples were infected with Candidatus Liberibacter asiaticus, and two further samples contained both Ca. L. americanus and Ca. L. asiaticus. The samples came from 47 farms in 35 municipalities. The psyllid vector of Ca. L. asiaticus, Diaphorina citri, is established in South, Central, and North America (Florida and Texas). Ca. L. americanus could be detected by PCR in several batches of D. citri psyllids collected on symptomatic sweet orange trees infected with Ca. L. americanus, strongly suggesting that D. citri is the vector of Ca. L. americanus. The results reported here confirm the presence of HLB in the State of São Paulo. Ca. L. americanus is the most widely distributed pathogen.

  10. Real-time PCR to supplement gold-standard culture-based detection of Legionella in environmental samples.

    Science.gov (United States)

    Collins, S; Jorgensen, F; Willis, C; Walker, J

    2015-10-01

    Culture remains the gold-standard for the enumeration of environmental Legionella. However, it has several drawbacks including long incubation and poor sensitivity, causing delays in response times to outbreaks of Legionnaires' disease. This study aimed to validate real-time PCR assays to quantify Legionella species (ssrA gene), Legionella pneumophila (mip gene) and Leg. pneumophila serogroup-1 (wzm gene) to support culture-based detection in a frontline public health laboratory. Each qPCR assay had 100% specificity, excellent sensitivity (5 GU/reaction) and reproducibility. Comparison of the assays to culture-based enumeration of Legionella from 200 environmental samples showed that they had a negative predictive value of 100%. Thirty eight samples were positive for Legionella species by culture and qPCR. One hundred samples were negative by both methods, whereas 62 samples were negative by culture but positive by qPCR. The average log10 increase between culture and qPCR for Legionella spp. and Leg. pneumophila was 0·72 (P = 0·0002) and 0·51 (P = 0·006), respectively. The qPCR assays can be conducted on the same 1 l water sample as culture thus can be used as a supplementary technique to screen out negative samples and allow more rapid indication of positive samples. The assay could prove informative in public health investigations to identify or rule out sources of Legionella as well as to specifically identify Leg. pneumophila serogroup 1 in a timely manner not possible with culture. © 2015 The Society for Applied Microbiology.

  11. Detecting beef meatball contamination with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hoda A.

    2017-10-01

    Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

  12. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  13. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  14. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  15. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

    Science.gov (United States)

    Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

    Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  17. Post-PCR detection of nucleic acids using metalloporphyrin labels and time-resolved fluorescence

    International Nuclear Information System (INIS)

    O'Shea, Desmond J.; O'Sullivan, Paul J.; Ponomarev, Gelii V.; Papkovsky, Dmitri B.

    2005-01-01

    Phosphorescent platinum(II)-coproporphyrin label (PtCP) was evaluated in post-PCR detection of nucleic acids by time-resolved fluorescence (TR-F) using three common formats. PtCP-labelled oligonucleotide primers and PtCP-dUTP were incorporated in a PCR to produce labelled amplified target -173 or 305 bp DNA. Alternatively, aminoallyl-dUTP was incorporated in a PCR and the product was subsequently labelled with PtCP. The resulting PCR mixtures containing labelled dsDNA were separated on 1.5% agarose gels and then analysed by ethidium bromide staining and by direct detection of PtCP label on a commercial TR-F plate reader Victor 2 (Perkin Elmer Life Sciences) used in scanning mode. In all cases label incorporation and high yields of amplified DNA were observed. Direct TR-F detection of PtCP-labelled DNA from a gel provided high sensitivity and signal to noise ratio, with limits of detection in the range of 9-22 pg for all three formats. The sensitivity achieved with PtCP label was considerably better than that achieved with ethidium bromide staining (∼1 ng of dsDNA) or with conventional fluorescent label FITC. Neither the FITC label nor ethidium bromide staining interfered with PtCP detection, thus allowing multiplexed detection

  18. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Science.gov (United States)

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR