Sample records for reacting cfd modeling

  1. A Two-Temperature Open-Source CFD Model for Hypersonic Reacting Flows, Part One: Zero-Dimensional Analysis

    Vincent Casseau


    Full Text Available A two-temperature CFD (computational fluid dynamics solver is a prerequisite to any spacecraft re-entry numerical study that aims at producing results with a satisfactory level of accuracy within realistic timescales. In this respect, a new two-temperature CFD solver, hy2Foam, has been developed within the framework of the open-source CFD platform OpenFOAM for the prediction of hypersonic reacting flows. This solver makes the distinct juncture between the trans-rotational and multiple vibrational-electronic temperatures. hy2Foam has the capability to model vibrational-translational and vibrational-vibrational energy exchanges in an eleven-species air mixture. It makes use of either the Park TTv model or the coupled vibration-dissociation-vibration (CVDV model to handle chemistry-vibration coupling and it can simulate flows with or without electronic energy. Verification of the code for various zero-dimensional adiabatic heat baths of progressive complexity has been carried out. hy2Foam has been shown to produce results in good agreement with those given by the CFD code LeMANS (The Michigan Aerothermodynamic Navier-Stokes solver and previously published data. A comparison is also performed with the open-source DSMC (direct simulation Monte Carlo code dsmcFoam. It has been demonstrated that the use of the CVDV model and rates derived from Quantum-Kinetic theory promote a satisfactory consistency between the CFD and DSMC chemistry modules.

  2. A Two-Temperature Open-Source CFD Model for Hypersonic Reacting Flows, Part Two: Multi-Dimensional Analysis †

    Vincent Casseau


    Full Text Available hy2Foam is a newly-coded open-source two-temperature computational fluid dynamics (CFD solver that has previously been validated for zero-dimensional test cases. It aims at (1 giving open-source access to a state-of-the-art hypersonic CFD solver to students and researchers; and (2 providing a foundation for a future hybrid CFD-DSMC (direct simulation Monte Carlo code within the OpenFOAM framework. This paper focuses on the multi-dimensional verification of hy2Foam and firstly describes the different models implemented. In conjunction with employing the coupled vibration-dissociation-vibration (CVDV chemistry–vibration model, novel use is made of the quantum-kinetic (QK rates in a CFD solver. hy2Foam has been shown to produce results in good agreement with previously published data for a Mach 11 nitrogen flow over a blunted cone and with the dsmcFoam code for a Mach 20 cylinder flow for a binary reacting mixture. This latter case scenario provides a useful basis for other codes to compare against.

  3. From Detailed Description of Chemical Reacting Carbon Particles to Subgrid Models for CFD

    Schulze S.; Kestel M.; Nikrityuk P. A.; Safronov D.


    This work is devoted to the development and validation of a sub-model for the partial oxidation of a spherical char particle moving in an air/steam atmosphere. The particle diameter is 2 mm. The coal particle is represented by moisture- and ash-free nonporous carbon while the coal rank is implemented using semi-global reaction rate expressions taken from the literature. The submodel includes six gaseous chemical species (O2, C...

  4. Species Source Term Mapping for Reacting Flow CFD Project

    National Aeronautics and Space Administration — Simulations of reacting flow in applications such as scramjet engines are currently limited in their utility or accuracy by the chemistry sub-models employed....

  5. CFD prediction of the reacting flow field inside a subscale scramjet combustor

    Chitsomboon, T.; Northam, G. B.; Rogers, R. C.; Diskin, G. S.


    A three-dimensional, Reynolds-averaged Navier-Stokes CFD code has been used to calculate the reacting flowfield inside a hydrogen-fueled, subscale scramjet combustor. Pilot fuel was injected transversely upstream of the combustor and the primary fuel was injected transversely downstream of a backward facing step. A finite rate combustion model with two-step kinetics was used. The CFD code used the explicit MacCormack algorithm with point-implicit treatment of the chemistry source terms. Turbulent mixing of the jets with the airstream was simulated by a simple mixing length scheme, whereas near wall turbulence was accounted for by the Baldwin-Lomax model. Computed results were compared with experimental wall pressure measurements.

  6. CFD Model Data

    U.S. Environmental Protection Agency — Data associated with the development of the CFD model for spore deposition in respiratory systems of rabbits and humans. This dataset is associated with the...


    Lee, S.


    The Savannah River Remediation (SRR) Organization requested that Savannah River National Laboratory (SRNL) develop a Computational Fluid Dynamics (CFD) method to mix and blend the miscible contents of the blend tanks to ensure the contents are properly blended before they are transferred from the blend tank; such as, Tank 50H, to the Salt Waste Processing Facility (SWPF) feed tank. The work described here consists of two modeling areas. They are the mixing modeling analysis during miscible liquid blending operation, and the flow pattern analysis during transfer operation of the blended liquid. The transient CFD governing equations consisting of three momentum equations, one mass balance, two turbulence transport equations for kinetic energy and dissipation rate, and one species transport were solved by an iterative technique until the species concentrations of tank fluid were in equilibrium. The steady-state flow solutions for the entire tank fluid were used for flow pattern analysis, for velocity scaling analysis, and the initial conditions for transient blending calculations. A series of the modeling calculations were performed to estimate the blending times for various jet flow conditions, and to investigate the impact of the cooling coils on the blending time of the tank contents. The modeling results were benchmarked against the pilot scale test results. All of the flow and mixing models were performed with the nozzles installed at the mid-elevation, and parallel to the tank wall. From the CFD modeling calculations, the main results are summarized as follows: (1) The benchmark analyses for the CFD flow velocity and blending models demonstrate their consistency with Engineering Development Laboratory (EDL) and literature test results in terms of local velocity measurements and experimental observations. Thus, an application of the established criterion to SRS full scale tank will provide a better, physically-based estimate of the required mixing time, and

  8. Stochastic models for turbulent reacting flows

    Kerstein, A. [Sandia National Laboratories, Livermore, CA (United States)


    The goal of this program is to develop and apply stochastic models of various processes occurring within turbulent reacting flows in order to identify the fundamental mechanisms governing these flows, to support experimental studies of these flows, and to further the development of comprehensive turbulent reacting flow models.

  9. CFD modeling of an arc-heated jet

    Rostand, Phillipe; Mac Cormack, Robert W.


    On the basis of state-of-the-art numerical techniques and physical models, a new CFD program is developed for the simulation of a high-enthalpy reacting ionized thermally relaxing nitrogen plasma in a cylindrical plenum chamber. A preliminary validation by comparison with experimental results was obtained. The algorithm is shown to be very efficient, and the empirical modeling gave results of practical use for the configuration studied.


    Lee, S.


    The process of recovering the waste in storage tanks at the Savannah River Site (SRS) typically requires mixing the contents of the tank to ensure uniformity of the discharge stream. Mixing is accomplished with one to four dual-nozzle slurry pumps located within the tank liquid. For the work, a Tank 48 simulation model with a maximum of four slurry pumps in operation has been developed to estimate flow patterns for efficient solid mixing. The modeling calculations were performed by using two modeling approaches. One approach is a single-phase Computational Fluid Dynamics (CFD) model to evaluate the flow patterns and qualitative mixing behaviors for a range of different modeling conditions since the model was previously benchmarked against the test results. The other is a two-phase CFD model to estimate solid concentrations in a quantitative way by solving the Eulerian governing equations for the continuous fluid and discrete solid phases over the entire fluid domain of Tank 48. The two-phase results should be considered as the preliminary scoping calculations since the model was not validated against the test results yet. A series of sensitivity calculations for different numbers of pumps and operating conditions has been performed to provide operational guidance for solids suspension and mixing in the tank. In the analysis, the pump was assumed to be stationary. Major solid obstructions including the pump housing, the pump columns, and the 82 inch central support column were included. The steady state and three-dimensional analyses with a two-equation turbulence model were performed with FLUENT{trademark} for the single-phase approach and CFX for the two-phase approach. Recommended operational guidance was developed assuming that local fluid velocity can be used as a measure of sludge suspension and spatial mixing under single-phase tank model. For quantitative analysis, a two-phase fluid-solid model was developed for the same modeling conditions as the single

  11. CFD Modeling of Particle Resuspension

    Degraw, Jason; Cimbala, John; Freihaut, James


    The phenomenon of resuspension plays a role in everyday life and is an important factor in indoor air quality. There are several models available for particle detachment, but the mechanisms by which particles are induced to lift off of a surface are not well explained in the literature. The lifting forces on a particle are generally too small to resuspend it, especially in the air flows generated by human activity (e.g., walking). We model the interaction of the aerodynamic disturbances and a thin layer of particles deposited on the surface. A standard CFD solver is used to compute the flow, and the particle transport model is one-way-coupled with the flow solution. Several time-dependent flows are considered, including an idealized footstep. The foot is represented using an immersed boundary technique, and is modeled as a disk that moves up and down with a trajectory patterned after experimental gait data. A jet and a radially moving vortex are generated as the foot approaches the floor. The strength of the jet is determined by the details of the foot movement near the surface. If the foot is slowed as it nears the floor, we find maximum velocities around 3 m/s, while the maximum velocity is more than doubled by a sudden stop. We have also computed a ``vacuum cleaner'' case to model the airflow generated by cleaning activities. In either case, the wall shear along the floor and the near-wall flow structure are used to examine the resuspension of particles.

  12. Multiphase reacting flows modelling and simulation

    Marchisio, Daniele L


    The papers in this book describe the most widely applicable modeling approaches and are organized in six groups covering from fundamentals to relevant applications. In the first part, some fundamentals of multiphase turbulent reacting flows are covered. In particular the introduction focuses on basic notions of turbulence theory in single-phase and multi-phase systems as well as on the interaction between turbulence and chemistry. In the second part, models for the physical and chemical processes involved are discussed. Among other things, particular emphasis is given to turbulence modeling strategies for multiphase flows based on the kinetic theory for granular flows. Next, the different numerical methods based on Lagrangian and/or Eulerian schemes are presented. In particular the most popular numerical approaches of computational fluid dynamics codes are described (i.e., Direct Numerical Simulation, Large Eddy Simulation, and Reynolds-Averaged Navier-Stokes approach). The book will cover particle-based meth...

  13. Gas explosion prediction using CFD models

    Niemann-Delius, C.; Okafor, E. [RWTH Aachen Univ. (Germany); Buhrow, C. [TU Bergakademie Freiberg Univ. (Germany)


    A number of CFD models are currently available to model gaseous explosions in complex geometries. Some of these tools allow the representation of complex environments within hydrocarbon production plants. In certain explosion scenarios, a correction is usually made for the presence of buildings and other complexities by using crude approximations to obtain realistic estimates of explosion behaviour as can be found when predicting the strength of blast waves resulting from initial explosions. With the advance of computational technology, and greater availability of computing power, computational fluid dynamics (CFD) tools are becoming increasingly available for solving such a wide range of explosion problems. A CFD-based explosion code - FLACS can, for instance, be confidently used to understand the impact of blast overpressures in a plant environment consisting of obstacles such as buildings, structures, and pipes. With its porosity concept representing geometry details smaller than the grid, FLACS can represent geometry well, even when using coarse grid resolutions. The performance of FLACS has been evaluated using a wide range of field data. In the present paper, the concept of computational fluid dynamics (CFD) and its application to gas explosion prediction is presented. Furthermore, the predictive capabilities of CFD-based gaseous explosion simulators are demonstrated using FLACS. Details about the FLACS-code, some extensions made to FLACS, model validation exercises, application, and some results from blast load prediction within an industrial facility are presented. (orig.)

  14. Tip studies using CFD and comparison with tip loss models

    Hansen, Martin Otto Laver; Johansen, J.


    The flow past a rotating LM8.2 blade equipped with two different tips are computed using CFD. The different tip flows are analysed and a comparison with two different tip loss models is made. Keywords: tip flow, aerodynamics, CFD......The flow past a rotating LM8.2 blade equipped with two different tips are computed using CFD. The different tip flows are analysed and a comparison with two different tip loss models is made. Keywords: tip flow, aerodynamics, CFD...

  15. CFD modeling of pharmaceutical isolators with experimental verification of airflow.

    Nayan, N; Akay, H U; Walsh, M R; Bell, W V; Troyer, G L; Dukes, R E; Mohan, P


    Computational fluid dynamics (CFD) models have been developed to predict the airflow in a transfer isolator using a commercial CFD code. In order to assess the ability of the CFD approach in predicting the flow inside an isolator, hot wire anemometry measurements and a novel experimental flow visualization technique consisting of helium-filled glycerin bubbles were used. The results obtained have been shown to agree well with the experiments and show that CFD can be used to model barrier systems and isolators with practical fidelity. This indicates that CFD can and should be used to support the design, testing, and operation of barrier systems and isolators.

  16. A Framework for the Modelling of Biphasic Reacting Systems

    Anantpinijwatna, Amata; Sin, Gürkan; O’Connell, John P.


    Biphasic reacting systems have a broad application range from organic reactions in pharmaceutical and agro-bio industries to CO 2 capture. However, mathematical modelling of biphasic reacting systems is a formidable challenge due to many phenomena underlying the process such as chemical equilibri...... systems: a PTC-based reaction system and pseudo-PTC system....

  17. Linearised CFD Models for Wakes

    Ott, Søren; Berg, Jacob; Nielsen, Morten

    This report describes the development of a fast and reasonably accurate model for the prediction of energy production in oshore wind farms taking wake eects into account. The model has been implemented as a windows application called Fuga which can run in batch mode or as a graphical user interface....... Fuga is brie y described. The model is based on alinearization technique which is described in some detail, and linearized, governing equations are derived and written in a standard form based on a mixed{spectral formulation. A new solution method is used to solve the equations which involves intensive...... use of look{up tables for storage of intermediate results. Due to the linearity of the model, multiple wakes from many turbines can be constructed from the wake of a single, solitary turbine. These are in turn constructed from Fourier components by a fast Fourier integral transform of results derived...

  18. Linearised CFD models for wakes

    Ott, S.; Berg, J.; Nielsen, Morten


    This report describes the development of a fast and reasonably accurate model for the prediction of energy production in offshore wind farms taking wake effects into account. The model has been implemented as a windows application called Fuga which can run in batch mode or as a graphical user interface. Fuga is briefly described. The model is based on a linearization technique which is described in some detail, and linearized, governing equations are derived and written in a standard form based on a mixed-spectral formulation. A new solution method is used to solve the equations which involves intensive use of look-up tables for storage of intermediate results. Due to the linearity of the model, multiple wakes from many turbines can be constructed from the wake of a single, solitary turbine. These are in turn constructed from Fourier components by a fast Fourier integral transform of results derived from generic look-up tables. Three different models, based on three different closures, are examined: 1) the 'simple closure' using an unperturbed eddy viscosity kucentre dotz. 2) the mixing length closure. 3) the E-epsilon closure. Model results are evaluated against offshore wind farm production data from Horns Rev I and the Nysted wind farm, and a comparison with direct wake measurements in an onshore turbine (Nibe B) is also made. A very satisfactory agreement with data is found for the simple closure. The exception is the near wake, just behind the rotor, where all three linearized models fail. The mixing length closure underestimates wake effects in all cases. The E-epsilon closure overestimates wake losses in the offshore farms while it predicts a too shallow and too wide the wake in the onshore case. The simple closure performs distinctly better than the other two. Wind speed data from the the Horns rev met masts are used to further validate Fuga results with the 'simple' closure. Finally, Roedsand 1 and 2 are used as an example to illustrate

  19. Application of Simple CFD Models in Smoke Ventilation Design

    Brohus, Henrik; Nielsen, Peter Vilhelm; la Cour-Harbo, Hans


    The paper examines the possibilities of using simple CFD models in practical smoke ventilation design. The aim is to assess if it is possible with a reasonable accuracy to predict the behaviour of smoke transport in case of a fire. A CFD code mainly applicable for “ordinary” ventilation design...... is used for the examination. The CFD model is compared with benchmark tests and results from a special application fire simulation CFD code. Apart from benchmark tests two practical applications are examined in shape of modelling a fire in a theatre and a double façade, respectively. The simple CFD model...... uses a standard k-ε turbulence model. Simulations comprise both steady-state and dynamic approaches. Several boundary conditions are tested. Finally, the paper discusses the prospects of simple CFD models in smoke ventilation design including the inherent limitations....

  20. CFD modeling of the IRIS pressurizer dynamic

    Sanz, Ronny R.; Montesinos, Maria E.; Garcia, Carlos; Bueno, Elizabeth D.; Mazaira, Leorlen R., E-mail:, E-mail:, E-mail:, E-mail: [Instituto Superior de Tecnologias y Ciencias Aplicadas (InSTEC), La Habana (Cuba); Bezerra, Jair L.; Lira, Carlos A.B. Oliveira, E-mail:, E-mail: [Universida Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear


    Integral layout of nuclear reactor IRIS makes possible the elimination of the spray system, which is usually used to mitigate in-surge transient and also help to Boron homogenization. The study of transients with deficiencies in the Boron homogenization in this technology is very important, because they can cause disturbances in the reactor power and insert a strong reactivity in the core. The detailed knowledge of the behavior of multiphase multicomponent flows is challenging due to the complex phenomena and interactions at the interface. In this context, the CFD modeling is employed in the design of equipment in the nuclear industry as it allows predicting accidents or predicting their performance in dissimilar applications. The aim of the present research is to model the IRIS pressurizer's dynamic using the commercial CFD code CFX. A symmetric tri dimensional model equivalent to 1/8 of the total geometry was adopted to reduce mesh size and minimize processing time. The model considers the coexistence of four phases and also takes into account the heat losses. The relationships for interfacial mass, energy, and momentum transport are programmed and incorporated into CFX. Moreover, two subdomains and several additional variables are defined to monitoring the boron dilution sequences and condensation-evaporation rates in different control volumes. For transient states a non - equilibrium stratification in the pressurizer is considered. This paper discusses the model developed and the behavior of the system for representative transients sequences. The results of analyzed transients of IRIS can be applied to the design of pressurizer internal structures and components. (author)

  1. Modelling of Air Flow trough a Slatted Floor by CFD

    Svidt, Kjeld; Bjerg, Bjarne; Morsing, Svend;

    In this paper two different CFD-approaches are investigated to model the airflow through a slatted floor. Experiments are carried out in a full-scale test room. The computer simulations are carried out with the CFD-code FLOVENT, which solves the time-averaged Navier-Stokes equations by use of the k...

  2. Qualification of CFD-models for multiphase flows

    Lucas, Dirk [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany)


    While Computational Fluid Dynamics (CFD) is already an accepted industrial tool for single phase flows it is not yet mature for two-phase flows. For this reason the qualification of CFD for reactor safety relevant applications which involve multiphase flows is a present topic of research. At the CFD division of Helmholtz-Zentrum Dresden-Rossendorf (HZDR) hereby beside an application-oriented model development and validation also more generic investigations are done. Thus, the baseline model strategy aims on the consolidation of the CFD-modelling for multiphase to enable reliable predictions for well-defined flow pattern in future. In addition the recently developed GENTOP-concept broadens the range of applicability of CFD. Different flow morphologies including transitions between them can be considered in frame of this concept.


    Shah, Louise Jivan; Morrison, G.L.; Behnia, Masud


    Characteristics of vertical mantle heat exchanger tanks for SDHW systems have been investigated experimentally and theoretically using particle image velocimetry (PIV) and CFD modelling. A glass model of a mantle heat exchanger tank was constructed so that the flow distribution in the mantle could...... be studied using the PIV test facility. Two transient three-dimensional CFD-models of the glass model mantle tank were developed using the CFD-programmes CFX and FLUENT.The experimental results illustrate that the mantle flow structure in the mantle is complicated and the distribution of flow in the mantle...

  4. CFD Modeling for Mercury Control Technology

    Madsen, J.I.


    Compliance with the Clean Air Mercury Rule will require implementation of dedicated mercury control solutions at a significant portion of the U.S. coal-fired utility fleet. Activated Carbon Injection (ACI) upstream of a particulate control device (ESP or baghouse) remains one of the most promising near-term mercury control technologies. The DOE/NETL field testing program has advanced the understanding of mercury control by ACI, but a persistent need remains to develop predictive models that may improve the understanding and practical implementation of this technology. This presentation describes the development of an advanced model of in-flight mercury capture based on Computational Fluid Dynamics (CFD). The model makes detailed predictions of the induct spatial distribution and residence time of sorbent, as well as predictions of mercury capture efficiency for particular sorbent flow rates and injection grid configurations. Hence, CFD enables cost efficient optimization of sorbent injection systems for mercury control to a degree that would otherwise be impractical both for new and existing plants. In this way, modeling tools may directly address the main cost component of operating an ACI system – the sorbent expense. A typical 300 MW system is expected to require between $1 and $2 million of sorbent per year, and so even modest reductions (say 10-20%) in necessary sorbent feed injection rates will quickly make any optimization effort very worthwhile. There are few existing models of mercury capture, and these typically make gross assumptions of plug gas flow, zero velocity slip between particle and gas phase, and uniform sorbent dispersion. All of these assumptions are overcome with the current model, which is based on first principles and includes mass transfer processes occurring at multiple scales, ranging from the large-scale transport in the duct to transport within the porous structure of a sorbent particle. In principle any single one of these processes

  5. CFD and FEM modeling of PPOOLEX experiments

    Paettikangas, T.; Niemi, J.; Timperi, A. (VTT Technical Research Centre of Finland (Finland))


    Large-break LOCA experiment performed with the PPOOLEX experimental facility is analysed with CFD calculations. Simulation of the first 100 seconds of the experiment is performed by using the Euler-Euler two-phase model of FLUENT 6.3. In wall condensation, the condensing water forms a film layer on the wall surface, which is modelled by mass transfer from the gas phase to the liquid water phase in the near-wall grid cell. The direct-contact condensation in the wetwell is modelled with simple correlations. The wall condensation and direct-contact condensation models are implemented with user-defined functions in FLUENT. Fluid-Structure Interaction (FSI) calculations of the PPOOLEX experiments and of a realistic BWR containment are also presented. Two-way coupled FSI calculations of the experiments have been numerically unstable with explicit coupling. A linear perturbation method is therefore used for preventing the numerical instability. The method is first validated against numerical data and against the PPOOLEX experiments. Preliminary FSI calculations are then performed for a realistic BWR containment by modeling a sector of the containment and one blowdown pipe. For the BWR containment, one- and two-way coupled calculations as well as calculations with LPM are carried out. (Author)

  6. Application of Simple CFD Models in Smoke Ventilation Design

    Brohus, Henrik; Nielsen, Peter Vilhelm; la Cour-Harbo, Hans


    The paper examines the possibilities of using simple CFD models in practical smoke ventilation design. The aim is to assess if it is possible with a reasonable accuracy to predict the behaviour of smoke transport in case of a fire. A CFD code mainly applicable for “ordinary” ventilation design...... uses a standard k-ε turbulence model. Simulations comprise both steady-state and dynamic approaches. Several boundary conditions are tested. Finally, the paper discusses the prospects of simple CFD models in smoke ventilation design including the inherent limitations....

  7. Chemically reacting supersonic flow calculation using an assumed PDF model

    Farshchi, M.


    This work is motivated by the need to develop accurate models for chemically reacting compressible turbulent flow fields that are present in a typical supersonic combustion ramjet (SCRAMJET) engine. In this paper the development of a new assumed probability density function (PDF) reaction model for supersonic turbulent diffusion flames and its implementation into an efficient Navier-Stokes solver are discussed. The application of this model to a supersonic hydrogen-air flame will be considered.

  8. Hybrid CFD/CAA Modeling for Liftoff Acoustic Predictions

    Strutzenberg, Louise L.; Liever, Peter A.


    This paper presents development efforts at the NASA Marshall Space flight Center to establish a hybrid Computational Fluid Dynamics and Computational Aero-Acoustics (CFD/CAA) simulation system for launch vehicle liftoff acoustics environment analysis. Acoustic prediction engineering tools based on empirical jet acoustic strength and directivity models or scaled historical measurements are of limited value in efforts to proactively design and optimize launch vehicles and launch facility configurations for liftoff acoustics. CFD based modeling approaches are now able to capture the important details of vehicle specific plume flow environment, identifY the noise generation sources, and allow assessment of the influence of launch pad geometric details and sound mitigation measures such as water injection. However, CFD methodologies are numerically too dissipative to accurately capture the propagation of the acoustic waves in the large CFD models. The hybrid CFD/CAA approach combines the high-fidelity CFD analysis capable of identifYing the acoustic sources with a fast and efficient Boundary Element Method (BEM) that accurately propagates the acoustic field from the source locations. The BEM approach was chosen for its ability to properly account for reflections and scattering of acoustic waves from launch pad structures. The paper will present an overview of the technology components of the CFD/CAA framework and discuss plans for demonstration and validation against test data.

  9. CFD model of an aerating hydrofoil

    Scott, D.; Sabourin, M.; Beaulieu, S.; Papillon, B.; Ellis, C.


    Improving water quality in the tailrace below hydroelectric dams has become a priority in many river systems. In warm climates, water drawn by the turbine from deep in a reservoir can be deficient in dissolved oxygen (DO), a critical element in maintaining a healthy aquatic ecosystem. Many different solutions have been proposed in order to increase the DO levels in turbine discharge, including: turbine aeration systems (adding air to the water through either the turbine hub, the periphery or through distributed aeration in the runner blades); bubble diffusers in the reservoir or in the tailrace; aerating weirs downstream of the dams; and surface water pumps in the reservoir near the dam. There is a significant potential to increase the effectiveness of these solutions by improving the way that oxygen is introduced into the water; better distributions of bubbles will result in better oxygen transfer. In the present study, a two-phase Computational Fluid Dynamics model has been formulated using a commercial code to study the distribution of air downstream of a simple aerating hydrofoil. The two-phase model uses the Eulerian-Eulerian approach. Appropriate relations are used to model the interphase forces, including the Grace drag force model, the Favre averaged drag force and the Sato enhanced eddy viscosity. The model is validated using experimental results obtained in the water tunnel at the University of Minnesota's Saint Anthony Falls Laboratory. Results are obtained for water velocities between 5 and 10 m/s, air flow rates between 0.5 and 1.5 sL/min and for angles of attack between 0° and -8°. The results of this study show that the CFD model provides a good qualitative comparison to the experimental results by well predicting the wake location at the different flow rates and angles of attack used.

  10. The Ranque-Hilsch effect: CFD modeling

    Bezprozvannykh, V.; Mottl, H. [DYCOR Technologies, Edmonton, Alberta (Canada)]. E-mail:;


    The phenomenon of noticeable temperature distribution in confined steady rotating gas flows is referred as Ranque-Hilsch effect. The simple counter-flow Ranque-Hilsch tube consists of a long hollow cylinder with tangential nozzles at one end for injecting compressed gas. Rotating gas escapes the tube through two outlets - a central orifice diaphragm placed near the injection nozzle plane (cold stream) and a ring-shaped peripheral outlet placed at the opposite end of the tube (hot stream). The flow is essentially three-dimensional, turbulent, compressible, and spinning such that any theoretical simplifications are questionable, if at all possible. Fluent suite of software was applied at Dycor Technologies, Canada to the task of numerical simulation of the Ranque-Hilsch effect that is part of Dycor's program of fundamental and applied research. The behavior of two types of fluids in the Ranque-Hilsch tube was investigated - air and water. Three-dimensional continuity, momentum, and energy equations were solved for incompressible and compressible flows for water and air cases correspondingly. The Reynolds stress turbulence model was originally applied to close the Reynolds-averaged Navier-Stokes equations. The visualization of the velocity and temperature fields inside the vortex tube helped to understand the details of fluid flow. It was shown that CFD approach is applicable for simulating Ranque-Hilsch effect. It was found that various levels of complexity in turbulence modeling are suitable for vortex tube analysis. No vortex effect was observed for incompressible flow. The dependence of vortex tube cooling ability on initial gas pressure was investigated. Numerical simulation data are consistent with available experimental results. (author)

  11. Modeling chemical reactions in the indoor environment by CFD

    Sørensen, Dan Nørtoft; Weschler, Charles J.


    The concentrations of ozone and a terpene that react in the gas-phase to produce a hypothetical product were investigated by computational fluid dynamics (CFD) for two different air exchange rates. Ozone entered the room with the ventilation air. The terpenes were introduced as a localized source...... with an emission pattern similar to an air freshener; this was in contrast to an otherwise identical earlier study in which the terpene was introduced as a floor source with an emission pattern similar to a floor care product (Sørensen and Weschler, 2002). The results show that there are large concentration...

  12. Facilities GIS Modeling for the REACT System Project

    National Aeronautics and Space Administration — The Real-Time Emergency Action Coordination Tool (REACT) was developed under contract to NASA and deployed for use by the entire agency.  NASA REACT is a...

  13. A new CFD modeling method for flow blockage accident investigations

    Fan, Wenyuan, E-mail:; Peng, Changhong, E-mail:; Chen, Yangli, E-mail:; Guo, Yun, E-mail:


    Highlights: • Porous-jump treatment is applied to CFD simulation on flow blockages. • Porous-jump treatment predicts consistent results with direct CFD treatment. • Relap5 predicts abnormal flow rate profiles in MTR SFA blockage scenario. • Relap5 fails to simulate annular heat flux in blockage case of annular assembly. • Porous-jump treatment provides reasonable and generalized CFD results. - Abstract: Inlet flow blockages in both flat and annular plate-type fuel assemblies are simulated by (Computational Fluid Dynamics) CFD and system analysis methods, with blockage ratio ranging from 60 to 90%. For all the blockage scenarios, mass flow rate of the blocked channel drops dramatically as blockage ratio increases, while mass flow rates of non-blocked channels are almost steady. As a result of over-simplifications, the system code fails to capture details of mass flow rate profiles of non-blocked channels and power redistribution of fuel plates. In order to acquire generalized CFD results, a new blockage modeling method is developed by using the porous-jump condition. For comparisons, direct CFD simulations are conducted toward postulated blockages. For the porous-jump treatment, conservative flow and heat transfer conditions are predicted for the blocked channel, while consistent predictions are obtained for non-blocked channels. Besides, flow fields in the blocked channel, asymmetric power redistributions of fuel plates, and complex heat transfer phenomena in annular fuel assembly are obtained and discussed. The present study indicates that the porous-jump condition is a reasonable blockage modeling method, which predicts generalized CFD results for flow blockages.

  14. CFD modelling of moisture interactions between air and constructions

    Mortensen, Lone Hedegaard; Woloszyn, Monika; Hohota, Raluca;


    There is a strong demand for accurate moisture modelling since moisture poses a risk for both the constructions and the indoor climate. Thus, in this investigation there is special focus on moisture modelling. The paper describes a new model based on a CFD tool that is enhanced to include both de...

  15. Development of CFD-based icing model for wind turbines

    Pedersen, Marie Cecilie; Martinez, Benjamin; Yin, Chungen


    Operation of wind turbines in cold climate areas is challenged by icing-induced problems, such as loss of production, safety issues and blade fatique. Production losses are especially a big issue in Sweden, and due to difficulties with on-site measurements, simulations are often used to get...... an understanding and to predict icing events. In this paper a case study of modeling icing using Computational Fluid Dynamics (CFD) is proposed. The case study aims to form the basic of a general CFD model for icing on wind turbine blade sections....

  16. CFD Modeling of a Multiphase Gravity Separator Vessel

    Narayan, Gautham


    The poster highlights a CFD study that incorporates a combined Eulerian multi-fluid multiphase and a Population Balance Model (PBM) to study the flow inside a typical multiphase gravity separator vessel (GSV) found in oil and gas industry. The simulations were performed using Ansys Fluent CFD package running on KAUST supercomputer, Shaheen. Also, a highlight of a scalability study is presented. The effect of I/O bottlenecks and using Hierarchical Data Format (HDF5) for collective and independent parallel reading of case file is presented. This work is an outcome of a research collaboration on an Aramco project on Shaheen.

  17. Study of indoor radon distribution using measurements and CFD modeling.

    Chauhan, Neetika; Chauhan, R P; Joshi, M; Agarwal, T K; Aggarwal, Praveen; Sahoo, B K


    Measurement and/or prediction of indoor radon ((222)Rn) concentration are important due to the impact of radon on indoor air quality and consequent inhalation hazard. In recent times, computational fluid dynamics (CFD) based modeling has become the cost effective replacement of experimental methods for the prediction and visualization of indoor pollutant distribution. The aim of this study is to implement CFD based modeling for studying indoor radon gas distribution. This study focuses on comparison of experimentally measured and CFD modeling predicted spatial distribution of radon concentration for a model test room. The key inputs for simulation viz. radon exhalation rate and ventilation rate were measured as a part of this study. Validation experiments were performed by measuring radon concentration at different locations of test room using active (continuous radon monitor) and passive (pin-hole dosimeters) techniques. Modeling predictions have been found to be reasonably matching with the measurement results. The validated model can be used to understand and study factors affecting indoor radon distribution for more realistic indoor environment.

  18. Gasification CFD Modeling for Advanced Power Plant Simulations

    Zitney, S.E.; Guenther, C.P.


    In this paper we have described recent progress on developing CFD models for two commercial-scale gasifiers, including a two-stage, coal slurry-fed, oxygen-blown, pressurized, entrained-flow gasifier and a scaled-up design of the PSDF transport gasifier. Also highlighted was NETL’s Advanced Process Engineering Co-Simulator for coupling high-fidelity equipment models with process simulation for the design, analysis, and optimization of advanced power plants. Using APECS, we have coupled the entrained-flow gasifier CFD model into a coal-fired, gasification-based FutureGen power and hydrogen production plant. The results for the FutureGen co-simulation illustrate how the APECS technology can help engineers better understand and optimize gasifier fluid dynamics and related phenomena that impact overall power plant performance.

  19. Aeroelastic Calculations Using CFD for a Typical Business Jet Model

    Gibbons, Michael D.


    Two time-accurate Computational Fluid Dynamics (CFD) codes were used to compute several flutter points for a typical business jet model. The model consisted of a rigid fuselage with a flexible semispan wing and was tested in the Transonic Dynamics Tunnel at NASA Langley Research Center where experimental flutter data were obtained from M(sub infinity) = 0.628 to M(sub infinity) = 0.888. The computational results were computed using CFD codes based on the inviscid TSD equation (CAP-TSD) and the Euler/Navier-Stokes equations (CFL3D-AE). Comparisons are made between analytical results and with experiment where appropriate. The results presented here show that the Navier-Stokes method is required near the transonic dip due to the strong viscous effects while the TSD and Euler methods used here provide good results at the lower Mach numbers.

  20. CFD DPAL modeling for various schemes of flow configurations

    Waichman, Karol; Barmashenko, Boris D.; Rosenwaks, Salman


    Comprehensive analysis of kinetic and fluid dynamic processes in flowing-gas diode pumped alkali lasers (DPALs) using two- and three-dimensional computational fluid dynamics (2D and 3D CFD) models is reported for Cs DPALs. The models take into account effects of temperature rise and losses of alkali atoms due to ionization. Various gas flow regimes and transverse and parallel flow-optics directions configurations are studied. Optimization of the Cs DPAL parameters, using 3D CFD modeling, shows that applying high flow velocity and narrowband pumping, maximum lasing power as high as 40 kW can be obtained at pump power of 80 kW for transverse flow configuration in a pumped volume of ~ 0.7 cm3. At high pump power the calculated laser power is higher for the transverse scheme than for the parallel scheme because of a more efficient heat convection from the beam volume in the transverse configuration. The CFD models are applied to experimental devices and the calculated results are in good agreement with the measurements.

  1. A CFD model for pollutant dispersion in rivers

    Modenesi K.


    Full Text Available Studies have shown that humankind will experience a water shortage in the coming decades. It is therefore paramount to develop new techniques and models with a view to minimizing the impact of pollution. It is important to predict the environmental impact of new emissions in rivers, especially during periods of drought. Computational fluid dynamics (CFD has proved to be an invaluable tool to develop models able to analyze in detail particle dispersion in rivers. However, since these models generate grids with thousands (even millions of points to evaluate velocities and concentrations, they still require powerful machines. In this context, this work contributes by presenting a new three-dimensional model based on CFD techniques specifically developed to be fast, providing a significant improvement in performance. It is able to generate predictions in a couple of hours for a one-thousand-meter long section of river using Pentium IV computers. Commercial CFD packages would require weeks to solve the same problem. Another innovation inb this work is that a half channel with a constant elliptical cross section represents the river, so the Navier Stokes equations were derived for the elliptical system. Experimental data were obtained from REPLAN (PETROBRAS refining unit on the Atibaia River in São Paulo, Brazil. The results show good agreement with experimental data.

  2. CFD and FEM Model of an Underwater Vehicle Propeller

    Chruściel Tadeusz


    Full Text Available Within the framework of the project for design and optimization of the Remotely Operated Vehicle (ROV, research on its propulsion has been carried out. Te entire project was supported by CFD and FEM calculations taking into account the characteristics of the underwater vehicle. One of the tasks was to optimize the semi-open duct for horizontal propellers, which provided propulsion and controllability in horizontal plane. In order to create a measurable model of this task it was necessary to analyze numerical methodology of propeller design, along with the structure of a propellers with nozzles and contra-rotating propellers. It was confronted with theoretical solutions which included running of the analyzed propeller near an underwater vehicle. Also preliminary qualitative analyses of a simplified system with contra-rotating propellers and a semi-open duct were carried out. Te obtained results enabled to make a decision about the ROVs duct form. Te rapid prototyping SLS (Selective Laser Sintering method was used to fabricate a physical model of the propeller. As a consequence of this, it was necessary to verify the FEM model of the propeller, which based on the load obtained from the CFD model. Te article contains characteristics of the examined ROV, a theoretical basis of propeller design for the analyzed cases, and the results of CFD and FEM simulations.

  3. A PDF closure model for compressible turbulent chemically reacting flows

    Kollmann, W.


    The objective of the proposed research project was the analysis of single point closures based on probability density function (pdf) and characteristic functions and the development of a prediction method for the joint velocity-scalar pdf in turbulent reacting flows. Turbulent flows of boundary layer type and stagnation point flows with and without chemical reactions were be calculated as principal applications. Pdf methods for compressible reacting flows were developed and tested in comparison with available experimental data. The research work carried in this project was concentrated on the closure of pdf equations for incompressible and compressible turbulent flows with and without chemical reactions.

  4. CFD Modeling in Development of Renewable Energy Applications

    Maher A.R. Sadiq Al-Baghdadi


    Full Text Available Chapter 1: A Multi-fluid Model to Simulate Heat and Mass Transfer in a PEM Fuel Cell. Torsten Berning, Madeleine Odgaard, Søren K. Kær Chapter 2: CFD Modeling of a Planar Solid Oxide Fuel Cell (SOFC for Clean Power Generation. Meng Ni Chapter 3: Hydrodynamics and Hydropower in the New Paradigm for a Sustainable Engineering. Helena M. Ramos, Petra A. López-Jiménez Chapter 4: Opportunities for CFD in Ejector Solar Cooling. M. Dennis Chapter 5: Three Dimensional Modelling of Flow Field Around a Horizontal Axis Wind Turbine (HAWT. Chaouki Ghenai, Armen Sargsyan, Isam Janajreh Chapter 6: Scaling Rules for Hydrodynamics and Heat Transfer in Jetting Fluidized-Bed Biomass Gasifiers. K. Zhang, J. Chang, P. Pei, H. Chen, Y. Yang Chapter 7: Investigation of Low Reynolds Number Unsteady Flow around Airfoils in Pitching, Plunging and Flapping Motions. M.R. Amiralaei, H. Alighanbari, S.M. Hashemi Chapter 8: Justification of Computational Fluid Dynamics Simulation for Flat Plate Solar Energy Collector. Mohamed Selmi, Mohammed J. Al-Khawaja, Abdulhamid Marafia Chapter 9: Comparative Performance of a 3-Bladed Airfoil Chord H-Darrieus and a 3-Bladed Straight Chord H-Darrieus Turbines using CFD. R. Gupta, Agnimitra Biswas Chapter 10: Computational Fluid Dynamics for PEM Fuel Cell Modelling. A. Iranzo, F. Rosa Chapter 11: Analysis of the Performance of PEM Fuel Cells: Tutorial of Major Functional and Constructive Characteristics using CFD Analysis. P.J. Costa Branco, J.A. Dente Chapter 12: Application of Techniques of Computational Fluid Dynamics in the Design of Bipolar Plates for PEM Fuel Cells. A.P. Manso, F.F. Marzo, J. Barranco, M. Garmendia Mujika.

  5. Linear models for sound from supersonic reacting mixing layers

    Chary, P. Shivakanth; Samanta, Arnab


    We perform a linearized reduced-order modeling of the aeroacoustic sound sources in supersonic reacting mixing layers to explore their sensitivities to some of the flow parameters in radiating sound. Specifically, we investigate the role of outer modes as the effective flow compressibility is raised, when some of these are expected to dominate over the traditional Kelvin-Helmholtz (K-H) -type central mode. Although the outer modes are known to be of lesser importance in the near-field mixing, how these radiate to the far-field is uncertain, on which we focus. On keeping the flow compressibility fixed, the outer modes are realized via biasing the respective mean densities of the fast (oxidizer) or slow (fuel) side. Here the mean flows are laminar solutions of two-dimensional compressible boundary layers with an imposed composite (turbulent) spreading rate, which we show to significantly alter the growth of instability waves by saturating them earlier, similar to in nonlinear calculations, achieved here via solving the linear parabolized stability equations. As the flow parameters are varied, instability of the slow modes is shown to be more sensitive to heat release, potentially exceeding equivalent central modes, as these modes yield relatively compact sound sources with lesser spreading of the mixing layer, when compared to the corresponding fast modes. In contrast, the radiated sound seems to be relatively unaffected when the mixture equivalence ratio is varied, except for a lean mixture which is shown to yield a pronounced effect on the slow mode radiation by reducing its modal growth.

  6. Modeling and design of reacting systems with phase transfer catalysis

    Piccolo, Chiara; Hodges, George; Piccione, Patrick M.;


    , some of the design issues related to improved reaction operation are analyzed. Since the solubility of the different forms of the PTC in the organic solvent affects ultimately the catalyst partition coefficients, therefore, the organic solvent plays an important role in the design of PTC-based reacting...

  7. Modeling and verification of hemispherical solar still using ANSYS CFD

    Panchal, Hitesh N. [KSV University, Gujarat Power Engineering and Research Institute, Mehsana (India); Shah, P.K. [Silver Oak College of Engineering and Technology, Ahmedabad, Gujarat (India)


    In every efficient solar still design, water temperature, vapor temperature and distillate output, and difference between water temperature and inner glass cover temperatures are very important. Here, two dimensional three phase model of hemispherical solar still is made for evaporation as well as condensation process in ANSYS CFD. Simulation results like water temperature, vapor temperature, distillate output compared with actual experimental results of climate conditions of Mehsana (latitude of 23° 59’ and longitude of 72° 38) of hemispherical solar still. Water temperature and distillate output were good agreement with actual experimental results. Study shows that ANSYS-CFD is very powerful as well as efficient tool for design, comparison purpose of hemispherical solar still.

  8. LSST camera heat requirements using CFD and thermal seeing modeling

    Sebag, Jacques; Vogiatzis, Konstantinos


    The LSST camera is located above the LSST primary/tertiary mirror and in front of the secondary mirror in the shadow of its central obscuration. Due to this position within the optical path, heat released from the camera has a potential impact on the seeing degradation that is larger than traditionally estimated for Cassegrain or Nasmyth telescope configurations. This paper presents the results of thermal seeing modeling combined with Computational Fluid Dynamics (CFD) analyzes to define the thermal requirements on the LSST camera. Camera power output fluxes are applied to the CFD model as boundary conditions to calculate the steady-state temperature distribution on the camera and the air inside the enclosure. Using a previously presented post-processing analysis to calculate the optical seeing based on the mechanical turbulence and temperature variations along the optical path, the optical performance resulting from the seeing is determined. The CFD simulations are repeated for different wind speeds and orientations to identify the worst case scenario and generate an estimate of seeing contribution as a function of camera-air temperature difference. Finally, after comparing with the corresponding error budget term, a maximum allowable temperature for the camera is selected.

  9. CFD modelling of moisture interactions between air and constructions

    Mortensen, Lone Hedegaard; Woloszyn, Monika; Hohota, Raluca


    There is a strong demand for accurate moisture modelling since moisture poses a risk for both the constructions and the indoor climate. Thus, in this investigation there is special focus on moisture modelling. The paper describes a new model based on a CFD tool that is enhanced to include both...... detailed modelling of airflows in rooms and heat and moisture transfer in walls by applying them as fluid walls. In a 3D configuration the impact of different boundary conditions are investigated and the results are discussed. The changes of boundary conditions that are studied are velocity, moisture...

  10. A Multi-Model Approach for Uncertainty Propagation and Model Calibration in CFD Applications

    Wang, Jian-xun; Xiao, Heng


    Proper quantification and propagation of uncertainties in computational simulations are of critical importance. This issue is especially challenging for CFD applications. A particular obstacle for uncertainty quantifications in CFD problems is the large model discrepancies associated with the CFD models used for uncertainty propagation. Neglecting or improperly representing the model discrepancies leads to inaccurate and distorted uncertainty distribution for the Quantities of Interest. High-fidelity models, being accurate yet expensive, can accommodate only a small ensemble of simulations and thus lead to large interpolation errors and/or sampling errors; low-fidelity models can propagate a large ensemble, but can introduce large modeling errors. In this work, we propose a multi-model strategy to account for the influences of model discrepancies in uncertainty propagation and to reduce their impact on the predictions. Specifically, we take advantage of CFD models of multiple fidelities to estimate the model ...

  11. Efficient Turbulence Modeling for CFD Wake Simulations

    van der Laan, Paul

    , that can accurately and efficiently simulate wind turbine wakes. The linear k-ε eddy viscosity model (EVM) is a popular turbulence model in RANS; however, it underpredicts the velocity wake deficit and cannot predict the anisotropic Reynolds-stresses in the wake. In the current work, nonlinear eddy...... viscosity models (NLEVM) are applied to wind turbine wakes. NLEVMs can model anisotropic turbulence through a nonlinear stress-strain relation, and they can improve the velocity deficit by the use of a variable eddy viscosity coefficient, that delays the wake recovery. Unfortunately, all tested NLEVMs show...... numerically unstable behavior for fine grids, which inhibits a grid dependency study for numerical verification. Therefore, a simpler EVM is proposed, labeled as the k-ε - fp EVM, that has a linear stress-strain relation, but still has a variable eddy viscosity coefficient. The k-ε - fp EVM is numerically...

  12. CFD modelling of solid propellant ignition

    Lowe, C


    Solid propellant is the highly energetic fuel burnt in the combustion chamber of ballistic weapons. It is manufactured, for this purpose, in either granular or stick form. Internal ballistics describes the behavior within the combustion chamber throughout the ballistic cycle upto projectile exit from the muzzle of the gun barrel. Over the last twenty years this has been achieved by modelling the process using two-phase flow equations. The solid granules or sticks constitute ...

  13. CFD Modeling of Mixed-Phase Icing

    Zhang, Lifen; Liu, Zhenxia; Zhang, Fei


    Ice crystal ingestion at high altitude has been reported to be a threat for safe operation of aero-engine in recently. Ice crystals do not accrete on external surface because of cold environment. But when they enter the core flow of aero-engine, ice crystals melt partially into droplets due to higher temperature. Air-droplets-ice crystal is the mixed-phase, which will give rise to ice accretion on static and rotating components in compressor. Subsequently, compressor surge and engine shutdowns may occur. To provide a numerical tool to analyze this in detail, a numerical method was developed in this study. The mixed phase flow was solved using Eulerian-Lagrangian method. The dispersed phase was represented by one-way coupling. A thermodynamic model that considers mass and energy balance with ice crystals and droplets was presented as well. The icing code was implemented by the user-defined function of Fluent. The method of ice accretion under mixed-phase conditions was validated by comparing the results simulated on a cylinder with experimental data derived from literature. The predicted ice shape and mass agree with these data, thereby confirming the validity of the numerical method developed in this research for mixed-phase conditions.

  14. CFD modeling of dust dispersion through Najaf historic city centre

    Maher A.R. Sadiq Al-Baghdadi


    Full Text Available The aim of this project is to study the influences of the wind flow and dust particles dispersion through Najaf historic city centre. Two phase Computational Fluid Dynamics (CFD model using a Reynolds Average Navier Stokes (RANS equations has been used to simulate the wind flow and the transport and dispersion of the dust particles through the historic city centre. This work may provide useful insight to urban designers and planners interested in examining the variation of city breathability as a local dynamic morphological parameter with the local building packing density.

  15. CFD Modeling of Particulate Matter Dispersion from Kerman Cement Plant

    M. Panahandeh


    Full Text Available "n "n "nBackgrounds and Objectives: The dispersion of particulate matter has been known as the most serious environmental pollution of cement plants. In the present work, dispersion of the particulate matter from stack of Kerman Cement Plant was investigated using Computational Fluid Dynamics (CFD modeling."nMaterials and Methods: In order to study the dispersion of particulate matter from the stack, a calculation domain with dimensions of 8000m × 800m × 400m was considered. The domain was divided to 936781 tetrahedral control volumes. The mixture two-phase model was employed to model the interaction of the particulate matter (dispersed phase and air (continuous phase. The Large Eddy Simulation (LES method was used for turbulence modeling."nResults: The concentration of particulate matter in the whole calculation domain was computed. The predicted concentrations were compared to the measured values from the literature and a good agreement was observed. The predicted concentration profiles at different cross sections were analyzed."nConclusion:The results of the present work showed that CFD is a useful tool for understanding the dispersion of particulate matter in air. Although the obtained results were promising, more investigations on the properties of the dispersed phase, turbulent parameters and the boundary layer effect is needed to obtain more accurate results.

  16. Cavitation modeling for steady-state CFD simulations

    Hanimann, L.; Mangani, L.; Casartelli, E.; Widmer, M.


    Cavitation in hydraulic turbomachines is an important phenomenon to be considered for performance predictions. Correct analysis of the cavitation onset and its effect on the flow field while diminishing the pressure level need therefore to be investigated. Even if cavitation often appears as an unsteady phenomenon, the capability to compute it in a steady state formulation for the design and assessment phase in the product development process is very useful for the engineer. In the present paper the development and corresponding application of a steady state CFD solver is presented, based on the open source toolbox OpenFOAM®. In the first part a review of different cavitation models is presented. Adopting the mixture-type cavitation approach, various models are investigated and developed in a steady state CFD RANS solver. Particular attention is given to the coupling between cavitation and turbulence models as well as on the underlying numerical procedure, especially the integration in the pressure- correction step of pressure-based solvers, which plays an important role in the stability of the procedure. The performance of the proposed model is initially assessed on simple cases available in the open literature. In a second step results for different applications are presented, ranging from airfoils to pumps.

  17. CFD model simulation of LPG dispersion in urban areas

    Pontiggia, Marco; Landucci, Gabriele; Busini, Valentina; Derudi, Marco; Alba, Mario; Scaioni, Marco; Bonvicini, Sarah; Cozzani, Valerio; Rota, Renato


    There is an increasing concern related to the releases of industrial hazardous materials (either toxic or flammable) due to terrorist attacks or accidental events in congested industrial or urban areas. In particular, a reliable estimation of the hazardous cloud footprint as a function of time is required to assist emergency response decision and planning as a primary element of any Decision Support System. Among the various hazardous materials, the hazard due to the road and rail transportation of liquefied petroleum gas (LPG) is well known since large quantities of LPG are commercialized and the rail or road transportation patterns are often close to downtown areas. Since it is well known that the widely-used dispersion models do not account for the effects of any obstacle like buildings, tanks, railcars, or trees, in this paper a CFD model has been applied to simulate the reported consequences of a recent major accident involving an LPG railcar rupture in a congested urban area (Viareggio town, in Italy), showing both the large influence of the obstacles on LPG dispersion as well as the potentials of CFD models to foresee such an influence.

  18. RSRM Chamber Pressure Oscillations: Transit Time Models and Unsteady CFD

    Nesman, Tom; Stewart, Eric


    Space Shuttle solid rocket motor low frequency internal pressure oscillations have been observed since early testing. The same type of oscillations also are present in the redesigned solid rocket motor (RSRM). The oscillations, which occur during RSRM burn, are predominantly at the first three motor cavity longitudinal acoustic mode frequencies. Broadband flow and combustion noise provide the energy to excite these modes at low levels throughout motor burn, however, at certain times during burn the fluctuating pressure amplitude increases significantly. The increased fluctuations at these times suggests an additional excitation mechanism. The RSRM has inhibitors on the propellant forward facing surface of each motor segment. The inhibitors are in a slot at the segment field joints to prevent burning at that surface. The aft facing segment surface at a field joint slot burns and forms a cavity of time varying size. Initially the inhibitor is recessed in the field joint cavity. As propellant burns away the inhibitor begins to protrude into the bore flow. Two mechanisms (transit time models) that are considered potential pressure oscillation excitations are cavity-edge tones, and inhibitor hole-tones. Estimates of frequency variation with time of longitudinal acoustic modes, cavity edge-tones, and hole-tones compare favorably with frequencies measured during motor hot firing. It is believed that the highest oscillation amplitudes occur when vortex shedding frequencies coincide with motor longitudinal acoustic modes. A time accurate computational fluid dynamic (CFD) analysis was made to replicate the observations from motor firings and to observe the transit time mechanisms in detail. FDNS is the flow solver used to detail the time varying aspects of the flow. The fluid is approximated as a single-phase ideal gas. The CFD model was an axisymmetric representation of the RSRM at 80 seconds into burn.Deformation of the inhibitors by the internal flow was determined

  19. Two Phase Flow Models and Numerical Methods of the Commercial CFD Codes

    Bae, Sung Won; Jeong, Jae Jun; Chang, Seok Kyu; Cho, Hyung Kyu


    The use of commercial CFD codes extend to various field of engineering. The thermal hydraulic analysis is one of the promising engineering field of application of the CFD codes. Up to now, the main application of the commercial CFD code is focused within the single phase, single composition fluid dynamics. Nuclear thermal hydraulics, however, deals with abrupt pressure changes, high heat fluxes, and phase change heat transfer. In order to overcome the CFD limitation and to extend the capability of the nuclear thermal hydraulics analysis, the research efforts are made to collaborate the CFD and nuclear thermal hydraulics. To achieve the final goal, the current useful model and correlations used in commercial CFD codes should be reviewed and investigated. This report gives the summary information about the constitutive relationships that are used in the FLUENT, STAR-CD, and CFX. The brief information of the solution technologies are also enveloped.

  20. Reacting to "Reacting"

    Houle, Amanda


    This article describes the author's experiences as a student participating in a general education program called "Reacting to the Past," in which college students play elaborate games set at pivotal moments in the past, their roles informed by great texts. She found that the experience of reenacting pivotal historical moments produced an intensely…

  1. PDF approach for compressible turbulent reacting flows

    Hsu, A. T.; Tsai, Y.-L. P.; Raju, M. S.


    The objective of the present work is to develop a probability density function (pdf) turbulence model for compressible reacting flows for use with a CFD flow solver. The probability density function of the species mass fraction and enthalpy are obtained by solving a pdf evolution equation using a Monte Carlo scheme. The pdf solution procedure is coupled with a compressible CFD flow solver which provides the velocity and pressure fields. A modeled pdf equation for compressible flows, capable of capturing shock waves and suitable to the present coupling scheme, is proposed and tested. Convergence of the combined finite-volume Monte Carlo solution procedure is discussed, and an averaging procedure is developed to provide smooth Monte-Carlo solutions to ensure convergence. Two supersonic diffusion flames are studied using the proposed pdf model and the results are compared with experimental data; marked improvements over CFD solutions without pdf are observed. Preliminary applications of pdf to 3D flows are also reported.

  2. CFD modelling of condensers for freeze-drying processes

    Miriam Petitti; Antonello A Barresi; Daniele L Marchisio


    The aim of the present research is the development of a computational tool for investigating condensation processes and equipment with particular attention to freeze-dryers. These condensers in fact are usually operated at very low pressures, making it difficult to experimentally acquire quantitative knowledge of all the variables involved. Mathematical modelling and CFD (Computational Fluid Dynamics) simulations are used here to achieve a better comprehension of the flow dynamics and of the process of ice condensation and deposition in the condenser, in order to evaluate condenser efficiency and gain deeper insights of the process to be used for the improvement of its design. Both a complete laboratory-scale freeze-drying apparatus and an industrial-scale condenser have been investigated in this work, modelling the process of water vapour deposition. Different operating conditions have been considered and the influence exerted by the inert gas as well as other parameters has been investigated.

  3. Model test and CFD calculation of a cavitating bulb turbine

    Necker, J; Aschenbrenner, T, E-mail: [Voith Hydro Holding GmbH and Co. KG Alexanderstrasse 11, 89522 Heidenheim (Germany)


    The flow in a horizontal shaft bulb turbine is calculated as a two-phase flow with a commercial Computational Fluid Dynamics (CFD-)-code including cavitation model. The results are compared with experimental results achieved at a closed loop test rig for model turbines. On the model test rig, for a certain operating point (i.e. volume flow, net head, blade angle, guide vane opening) the pressure behind the turbine is lowered (i.e. the Thoma-coefficient {sigma} is lowered) and the efficiency of the turbine is recorded. The measured values can be depicted in a so-called {sigma}-break curve or {eta}- {sigma}-diagram. Usually, the efficiency is independent of the Thoma-coefficient up to a certain value. When lowering the Thoma-coefficient below this value the efficiency will drop rapidly. Visual observations of the different cavitation conditions complete the experiment. In analogy, several calculations are done for different Thoma-coefficients {sigma}and the corresponding hydraulic losses of the runner are evaluated quantitatively. For a low {sigma}-value showing in the experiment significant efficiency loss, the the change of volume flow in the experiment was simulated. Besides, the fraction of water vapour as an indication of the size of the cavitation cavity is analyzed qualitatively. The experimentally and the numerically obtained results are compared and show a good agreement. Especially the drop in efficiency can be calculated with satisfying accuracy. This drop in efficiency is of high practical importance since it is one criterion to determine the admissible cavitation in a bulb-turbine. The visual impression of the cavitation in the CFD-analysis is well in accordance with the observed cavitation bubbles recorded on sketches and/or photographs.

  4. Inertisation options for BG method and optimisation using CFD modelling

    Morla Ramakrishna; Balusu Rao; Tanguturi Krishna; Ting Ren


    Spontaneous combustion (sponcom) is one of the issues of concern with the blasting gallery (BG) method of coal mining and has the potential to cause fires, and impact on production and safety, greenhouse gas (GHG) emissions and huge costs involved in controlling the aftermath situations. Some of the research attempts made to prevent and control coal mine fires and spontaneous combustion in thick seams worked with bord and pillar mining methods are presented in this paper. In the study, computational fluid dynamics (CFD) modelling techniques were used to simulate and assess the effects of various mining methods, layouts, designs, and different operational and ventilation parameters on the flow of goaf gases in BG panels. A wide range of parametric studies were conducted to develop proactive strategies to control and prevent ingress of oxygen into the goaf area preventing spontaneous combustion and mine fires.

  5. CFD modeling and experience of waste-to-energy plant burning waste wood

    Rajh, B.; Yin, Chungen; Samec, N.


    Computational Fluid Dynamics (CFD) is being increasingly used in industry for in-depth understanding of the fundamental mixing, combustion, heat transfer and pollutant formation in combustion processes and for design and optimization of Waste-to-Energy (WtE) plants. In this paper, CFD modeling...... of waste wood combustion in a 13 MW grate-fired boiler in a WtE plant is presented. As a validation effort, the temperature profiles at a number of ports in the furnace are measured and the experimental results are compared with the CFD predictions. In the simulation, a 1D model is developed to simulate...... the conversion of the waste wood in the fuel bed on the grate, which provides the appropriate inlet boundary condition for the freeboard 3D CFD simulation. The CFD analysis reveals the detailed mixing and combustion characteristics in the waste wood-fired furnace, pinpointing how to improve the design...

  6. A coupled DEM-CFD method for impulse wave modelling

    Zhao, Tao; Utili, Stefano; Crosta, GiovanBattista


    Rockslides can be characterized by a rapid evolution, up to a possible transition into a rock avalanche, which can be associated with an almost instantaneous collapse and spreading. Different examples are available in the literature, but the Vajont rockslide is quite unique for its morphological and geological characteristics, as well as for the type of evolution and the availability of long term monitoring data. This study advocates the use of a DEM-CFD framework for the modelling of the generation of hydrodynamic waves due to the impact of a rapid moving rockslide or rock-debris avalanche. 3D DEM analyses in plane strain by a coupled DEM-CFD code were performed to simulate the rockslide from its onset to the impact with still water and the subsequent wave generation (Zhao et al., 2014). The physical response predicted is in broad agreement with the available observations. The numerical results are compared to those published in the literature and especially to Crosta et al. (2014). According to our results, the maximum computed run up amounts to ca. 120 m and 170 m for the eastern and western lobe cross sections, respectively. These values are reasonably similar to those recorded during the event (i.e. ca. 130 m and 190 m respectively). In these simulations, the slope mass is considered permeable, such that the toe region of the slope can move submerged in the reservoir and the impulse water wave can also flow back into the slope mass. However, the upscaling of the grains size in the DEM model leads to an unrealistically high hydraulic conductivity of the model, such that only a small amount of water is splashed onto the northern bank of the Vajont valley. The use of high fluid viscosity and coarse grain model has shown the possibility to model more realistically both the slope and wave motions. However, more detailed slope and fluid properties, and the need for computational efficiency should be considered in future research work. This aspect has also been

  7. Some Remarks on CFD Drag Prediction of an Aircraft Model

    Peng, S. H.; Eliasson, P.

    Observed in CFD drag predictions for the DLR-F6 aircraft model with various configurations, some issues are addressed. The emphasis is placed on the effect of turbulence modeling and grid resolution. With several different turbulence models, the predicted flow feature around the aircraft is highlighted. It is shown that the prediction of the separation bubble in the wing-body junction is closely related to the inherent modeling mechanism of turbulence production. For the configuration with an additional fairing, which has effectively removed the separation bubble, it is illustrated that the drag prediction may be altered even for attached turbulent boundary layer when different turbulence models are used. Grid sensitivity studies are performed with two groups of subsequently refined grids. It is observed that, in contrast to the lift, the drag prediction is rather sensitive to the grid refinement, as well as to the artificial diffusion added for solving the turbulence transport equation. It is demonstrated that an effective grid refinement should drive the predicted drag components monotonically and linearly converged to a finite value.

  8. Assessment of Computational Fluid Dynamics (CFD) Models for Shock Boundary-Layer Interaction

    DeBonis, James R.; Oberkampf, William L.; Wolf, Richard T.; Orkwis, Paul D.; Turner, Mark G.; Babinsky, Holger


    A workshop on the computational fluid dynamics (CFD) prediction of shock boundary-layer interactions (SBLIs) was held at the 48th AIAA Aerospace Sciences Meeting. As part of the workshop numerous CFD analysts submitted solutions to four experimentally measured SBLIs. This paper describes the assessment of the CFD predictions. The assessment includes an uncertainty analysis of the experimental data, the definition of an error metric and the application of that metric to the CFD solutions. The CFD solutions provided very similar levels of error and in general it was difficult to discern clear trends in the data. For the Reynolds Averaged Navier-Stokes methods the choice of turbulence model appeared to be the largest factor in solution accuracy. Large-eddy simulation methods produced error levels similar to RANS methods but provided superior predictions of normal stresses.

  9. CFD modeling of thermoelectric generators in automotive EGR-coolers

    Högblom, Olle; Andersson, Ronnie


    A large amount of the waste heat in the exhaust gases from diesel engines is removed in the exhaust gas recirculation (EGR) cooler. Introducing a thermoelectric generator (TEG) in an EGR cooler requires a completely new design of the heat exchanger. To accomplish that a model of the TEG-EGR system is required. In this work, a transient 3D CFD model for simulation of gas flow, heat transfer and power generation has been developed. This model allows critical design parameters in the TEG-EGR to be identified and design requirements for the systems to be specified. Besides the prediction of Seebeck, Peltier, Thomson and Joule effects, the simulations also give detailed insight to the temperature gradients in the gas-phase and inside the thermoelectric (TE) elements. The model is a very valuable tool to identify bottlenecks, improve design, select optimal TE materials and operating conditions. The results show that the greatest heat transfer resistance is located in the gas phase and it is critical to reduce this in order to achieve a large temperature difference over the thermoelectric elements without compromising on the maximum allowable pressure drop in the system. Further results from an investigation of the thermoelectric performance during a vehicle test cycle is presented.

  10. Modelling of a CFD Microscale Model and Its Application in Wind Energy Resource Assessment

    Yue Jie-shun


    Full Text Available The prediction of a wind farm near the wind turbines has a significant effect on the safety as well as economy of wind power generation. To assess the wind resource distribution within a complex terrain, a computational fluid dynamics (CFD based wind farm forecast microscale model is developed. The model uses the Reynolds Averaged Navier-Stokes (RANS model to characterize the turbulence. By using the results of Weather Research and Forecasting (WRF mesoscale weather forecast model as the input of the CFD model, a coupled model of CFD-WRF is established. A special method is used for the treatment of the information interchange on the lateral boundary between two models. This established coupled model is applied in predicting the wind farm near a wind turbine in Hong Gang-zi, Jilin, China. The results from this simulation are compared to real measured data. On this basis, the accuracy and efficiency of turbulence characterization schemes are discussed. It indicates that this coupling system is easy to implement and can make these two separate models work in parallel. The CFD model coupled with WRF has the advantage of high accuracy and fast speed, which makes it valid for the wind power generation.

  11. Validation of NEPTUNE-CFD Two-Phase Flow Models Using Experimental Data

    Jorge Pérez Mañes


    Full Text Available This paper deals with the validation of the two-phase flow models of the CFD code NEPTUNEC-CFD using experimental data provided by the OECD BWR BFBT and PSBT Benchmark. Since the two-phase models of CFD codes are extensively being improved, the validation is a key step for the acceptability of such codes. The validation work is performed in the frame of the European NURISP Project and it was focused on the steady state and transient void fraction tests. The influence of different NEPTUNE-CFD model parameters on the void fraction prediction is investigated and discussed in detail. Due to the coupling of heat conduction solver SYRTHES with NEPTUNE-CFD, the description of the coupled fluid dynamics and heat transfer between the fuel rod and the fluid is improved significantly. The averaged void fraction predicted by NEPTUNE-CFD for selected PSBT and BFBT tests is in good agreement with the experimental data. Finally, areas for future improvements of the NEPTUNE-CFD code were identified, too.

  12. Optimization of pulverised coal combustion by means of CFD/CTA modeling

    Filkoski Risto V.


    Full Text Available The objective of the work presented in this paper was to apply a method for handling two-phase reacting flow for prediction of pulverized coal combustion in large-scale boiler furnace and to assess the ability of the model to predict existing power plant data. The paper presents the principal steps and results of the numerical modeling of power boiler furnace with tangential disposition of the burners. The computational fluid dynamics/computational thermal analysis (CFD/CTA approach is utilized for creation of a three-dimensional model of the boiler furnace, including the platen superheater in the upper part of the furnace. Standard k-e model is employed for description of the turbulent flow. Coal combustion is modeled by the mixture fraction/probability density function approach for the reaction chemistry, with equilibrium assumption applied for description of the system chemistry. Radiation heat transfer is computed by means of the simplified P-N model, based on the expansion of the radiation intensity into an orthogonal series of spherical harmonics. Some distinctive results regarding the examined boiler performance in capacity range between 65 and 95% are presented graphically. Comparing the simulation predictions and available site measurements concerning temperature, heat flux and combustion efficiency, a conclusion can be drawn that the model produces realistic insight into the furnace processes. Qualitative agreement indicates reasonability of the calculations and validates the employed sub-models. After the validation and verification of the model it was used to check the combustion efficiency as a function of coal dust sieve characteristics, as well as the impact of burners modification with introduction of over fire air ports to the appearance of incomplete combustion, including CO concentration, as well as to the NOx concentration. The described case and other experiences with CFD/CTA stress the advantages of numerical modeling and

  13. Summary of best guidelines and validation of CFD modeling in livestock buildings to ensure prediction quality

    Rong, Li; Nielsen, Peter V.; Bjerg, Bjarne


    scale pig barns was simulated to show the procedures of validating a CFD simulation in livestock buildings. After summarizing the guideline and/or best practice for CFD modeling, the authors addressed the issues related to numerical methods and the governing equations, which were limited to RANS models....... Although it is not necessary to maintain the same format of reporting the CFD modeling as presented in this paper, the authors would suggest including all the information related to the selection of turbulence models, difference schemes, convergence criteria, boundary conditions, geometry simplification......Computational Fluid Dynamics (CFD) is increasingly used to study airflow around and in livestock buildings, to develop technologies to mitigate emissions and to predict the contaminant dispersion from livestock buildings. In this paper, an example of air flow distribution in a room with two full...

  14. Development of CFD Approaches for Modeling Advanced Concepts of Nuclear Thermal Propulsion Test Facilities Project

    National Aeronautics and Space Administration — The project will be developing a CFD approach that can handle the additional complexities needed in a NTP testing facility when modeling the combustion processes in...

  15. Towards a generic, reliable CFD modelling methodology for waste-fired grate boilers

    Rajh, Boštjan; Yin, Chungen; Samec, Niko

    Computational Fluid Dynamics (CFD) is increasingly used in industry for detailed understanding of the combustion process and for appropriate design and optimization of Waste–to–Energy (WtE) plants. In this paper, CFD modelling of waste wood combustion in a 13 MW grate-fired boiler in a WtE plant...... the appropriate inlet boundary condition for the freeboard 3D CFD simulation. Additionally, a refined WSGGM (weighted sum of gray gases model) of greater accuracy, completeness and applicability is proposed and implemented into the CFD model via user defined functions (UDF) to better address the impacts...... is presented. To reduce the risk of slagging, optimize the temperature control and enhance turbulent mixing, part of the flue gas is recycled into the grate boiler. In the simulation, a 1D in–house bed model is developed to simulate the conversion of the waste wood in the fuel bed on the grate, which provides...


    Lee, S; Alfred Garrett, A; James02 Bollinger, J; Larry Koffman, L


    Industrial processes use mechanical draft cooling towers (MDCT's) to dissipate waste heat by transferring heat from water to air via evaporative cooling, which causes air humidification. The Savannah River Site (SRS) has a MDCT consisting of four independent compartments called cells. Each cell has its own fan to help maximize heat transfer between ambient air and circulated water. The primary objective of the work is to conduct a parametric study for cooling tower performance under different fan speeds and ambient air conditions. The Savannah River National Laboratory (SRNL) developed a computational fluid dynamics (CFD) model to achieve the objective. The model uses three-dimensional steady-state momentum, continuity equations, air-vapor species balance equation, and two-equation turbulence as the basic governing equations. It was assumed that vapor phase is always transported by the continuous air phase with no slip velocity. In this case, water droplet component was considered as discrete phase for the interfacial heat and mass transfer via Lagrangian approach. Thus, the air-vapor mixture model with discrete water droplet phase is used for the analysis. A series of the modeling calculations was performed to investigate the impact of ambient and operating conditions on the thermal performance of the cooling tower when fans were operating and when they were turned off. The model was benchmarked against the literature data and the SRS test results for key parameters such as air temperature and humidity at the tower exit and water temperature for given ambient conditions. Detailed results will be presented here.

  17. CFD Modeling of LNG Spill: Humidity Effect on Vapor Dispersion

    Giannissi, S. G.; Venetsanos, A. G.; Markatos, N.


    The risks entailed by an accidental spill of Liquefied Natural Gas (LNG) should be indentified and evaluated, in order to design measures for prevention and mitigation in LNG terminals. For this purpose, simulations are considered a useful tool to study LNG spills and to understand the mechanisms that influence the vapor dispersion. In the present study, the ADREA-HF CFD code is employed to simulate the TEEX1 experiment. The experiment was carried out at the Brayton Fire Training Field, which is affiliated with the Texas A&M University system and involves LNG release and dispersion over water surface in open- obstructed environment. In the simulation the source was modeled as a two-phase jet enabling the prediction of both the vapor dispersion and the liquid pool spreading. The conservation equations for the mixture are solved along with the mass fraction for natural gas. Due to the low prevailing temperatures during the spill ambient humidity condenses and this might affect the vapor dispersion. This effect was examined in this work by solving an additional conservation equation for the water mass fraction. Two different models were tested: the hydrodynamic equilibrium model which assumes kinetic equilibrium between the phases and the non hydrodynamic equilibrium model, in order to assess the effect of slip velocity on the prediction. The slip velocity is defined as the difference between the liquid phase and the vapor phase and is calculated using the algebraic slip model. Constant droplet diameter of three different sizes and a lognormal distribution of the droplet diameter were applied and the results are discussed and compared with the measurements.

  18. A Quasi-One-Dimensional CFD Model for Multistage Turbomachines

    Olivier Léonard; Olivier Adam


    The objective of this paper is to present a fast and reliable CFD model that is able to simulate stationary and transient operations of multistage compressors and turbines. This analysis tool is based on an adapted version of the Euler equations solved by a time-marching, finite-volume method. The Euler equations have been extended by including source terms expressing the blade-flow interactions. These source terms are determined using the velocity triangles and a row-by-row representation of the blading at mid-span. The losses and deviations undergone by the fluid across each blade row are supplied by correlations. The resulting flow solver is a performance prediction tool based only on the machine geometry, offering the possibility of exploring the entire characteristic map of a multistage compressor or turbine. Its efficiency in terms of CPU time makes it possible to couple it to an optimization algorithm or to a gas turbine performance tool. Different test-cases are presented for which the calculated characteristic maps are compared to experimental ones.

  19. Mathematical modeling of turbulent reacting plumes - I. General theory and model formulation

    Georgopoulos, P.G.; Seinfeld, J.H.


    A new, comprehensive model for a chemically reacting plume is presented that accounts for the effects of incomplete turbulent macro- and micromixing on chemical reactions between plume and atmospheric constituents. The model is modular in nature, allowing for the use of different levels of approximation of the phenomena involved. The core of the model consists of the evolution equations for reaction progress variables appropriate for evolving spatially varying systems. These equations estimate the interaction of mixing and chemical reaction and require input parameters characterizing internal plume behavior, such as relative dispersion and fine scale plume segregation. The model addresses deficiencies in previous reactive plume models. Part II is devoted to atmospheric application of the model. (authors).

  20. CFD Modeling of Sodium-Oxide Deposition in Sodium-Cooled Fast Reactor Compact Heat Exchangers

    Tatli, Emre; Ferroni, Paolo; Mazzoccoli, Jason


    The possible use of compact heat exchangers (HXs) in sodium-cooled fast reactors (SFR) employing a Brayton cycle is promising due to their high power density and resulting small volume in comparison with conventional shell-and-tube HXs. However, the small diameter of their channels makes them more susceptible to plugging due to Na2O deposition during accident conditions. Although cold traps are designed to reduce oxygen impurity levels in the sodium coolant, their failure, in conjunction with accidental air ingress into the sodium boundary, could result in coolant oxygen levels that are above the saturation limit in the cooler parts of the HX channels. This can result in Na2O crystallization and the formation of solid deposits on cooled channel surfaces, limiting or even blocking coolant flow. The development of analysis tools capable of modeling the formation of these deposits in the presence of sodium flow will allow designers of SFRs to properly size the HX channels so that, in the scenario mentioned above, the reactor operator has sufficient time to detect and react to the affected HX. Until now, analytical methodologies to predict the formation of these deposits have been developed, but never implemented in a high-fidelity computational tool suited to modern reactor design techniques. This paper summarizes the challenges and the current status in the development of a Computational Fluid Dynamics (CFD) methodology to predict deposit formation, with particular emphasis on sensitivity studies on some parameters affecting deposition.

  1. Simulation and Scale-up of Barium Sulphate Precipitation Process Using CFD Modeling

    龚俊波; 卫宏远; 王静康; JohnGarsideb


    Some empirical mixing models were used to describe the imperfect mixing in precipitation process.However, the models can not, in general, reflect the details of interactions between mixing and crystallization in a vessel. In this study, CFD (computational fluid dynamics) technique were developed by simulating the precipitation of barium sulphate in stirred tanks by integration of population balance equations with a CFD solver. Two typical impellers, Rushton and pitched blade turbines, were employed for agitation. The influence of feed concentration and position on crystal product properties was investigated by CFD simulation. The scale-up of these precipitators was systematically studied. Significant effect on the crystal properties was found for the scale-up under some conditions.Keywords simulation, scale up, precipitation, CFD(computational fluid dynamics)

  2. Modeling near-road air quality using a computational fluid dynamics model, CFD-VIT-RIT.

    Wang, Y Jason; Zhang, K Max


    It is well recognized that dilution is an important mechanism governing the near-road air pollutant concentrations. In this paper, we aim to advance our understanding of turbulent mixing mechanisms on and near roadways using computation fluid dynamics. Turbulent mixing mechanisms can be classified into three categories according to their origins: vehicle-induced turbulence (VIT), road-induced turbulence (RIT), and atmospheric boundary layer turbulence. RIT includes the turbulence generated by road embankment, road surface thermal effects, and roadside structures. Both VIT and RIT are affected by the roadway designs. We incorporate the detailed treatment of VIT and RIT into the CFD (namely CFD-VIT-RIT) and apply the model in simulating the spatial gradients of carbon monoxide near two major highways with different traffic mix and roadway configurations. The modeling results are compared to the field measurements and those from CALINE4 and CFD without considering VIT and RIT. We demonstrate that the incorporation of VIT and RIT considerably improves the modeling predictions, especially on vertical gradients and seasonal variations of carbon monoxide. Our study implies that roadway design can significantly influence the near-road air pollution. Thus we recommend that mitigating near-road air pollution through roadway designs be considered in the air quality and transportation management In addition, thanks to the rigorous representation of turbulent mixing mechanisms, CFD-VIT-RIT can become valuable tools in the roadway designs process.

  3. Lime Kiln Modeling. CFD and One-dimensional simulations

    Svedin, Kristoffer; Ivarsson, Christofer; Lundborg, Rickard


    The incentives for burning alternative fuels in lime kilns are growing. An increasing demand on thorough investigations of alternative fuel impact on lime kiln performance have been recognized, and the purpose of this project has been to develop a lime kiln CFD model with the possibility to fire fuel oil and lignin. The second part of the project consists of three technical studies. Simulated data from a one-dimensional steady state program has been used to support theories on the impact of biofuels and lime mud dryness. The CFD simulations was carried out in the commercial code FLUENT. Due to difficulties with the convergence of the model the calcination reaction is not included. The model shows essential differences between the two fuels. Lignin gives a different flame shape and a longer flame length compared to fuel oil. Mainly this depends on how the fuel is fed into the combustion chamber and how much combustion air that is added as primary and secondary air. In the case of lignin combustion the required amount of air is more than in the fuel oil case. This generates more combustion gas and a different flow pattern is created. Based on the values from turbulent reaction rate for the different fuels an estimated flame length can be obtained. For fuel oil the combustion is very intense with a sharp peak in the beginning and a rapid decrease. For lignin the combustion starts not as intense as for the fuel oil case and has a smoother shape. The flame length appears to be approximately 2-3 meter longer for lignin than for fuel oil based on turbulent reaction rate in the computational simulations. The first technical study showed that there are many benefits of increasing dry solids content in the lime mud going into a kiln such as increased energy efficiency, reduced TRS, and reduced sodium in the kiln. However, data from operating kilns indicates that these benefits can be offset by increasing exit gas temperature that can limit kiln production capacity. Simulated

  4. CFD modelling of hydrogen stratification in enclosures: Model validation and application to PAR performance

    Hoyes, J.R., E-mail:; Ivings, M.J.


    Highlights: • The ability of CFD to predict hydrogen stratification phenomena is investigated. • Contrary to expectation, simulations on tetrahedral meshes under-predict mixing. • Simulations on structured meshes give good agreement with experimental data. • CFD model used to investigate the effects of stratification on PAR performance. • Results show stratification can have a significant effect on PAR performance. - Abstract: Computational Fluid Dynamics (CFD) models are maturing into useful tools for supporting safety analyses. This paper investigates the capabilities of CFD models for predicting hydrogen stratification in a containment vessel using data from the NEA/OECD SETH2 MISTRA experiments. Further simulations are then carried out to illustrate the qualitative effects of hydrogen stratification on the performance of Passive Autocatalytic Recombiner (PAR) units. The MISTRA experiments have well-defined initial and boundary conditions which makes them well suited for use in a validation study. Results are presented for the sensitivity to mesh resolution and mesh type. Whilst the predictions are shown to be largely insensitive to the mesh resolution they are surprisingly sensitive to the mesh type. In particular, tetrahedral meshes are found to induce small unphysical convection currents that result in molecular diffusion and turbulent mixing being under-predicted. This behaviour is not unique to the CFD model used here (ANSYS CFX) and furthermore, it may affect simulations run on other non-aligned meshes (meshes that are not aligned perpendicular to gravity), including non-aligned structured meshes. Following existing best practice guidelines can help to identify potential unphysical predictions, but as an additional precaution consideration should be given to using gravity-aligned meshes for modelling stratified flows. CFD simulations of hydrogen recombination in the Becker Technologies THAI facility are presented with high and low PAR positions

  5. iCFD: Interpreted Computational Fluid Dynamics - Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design - The secondary clarifier.

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat; Plósz, Benedek Gy


    The present study aims at using statistically designed computational fluid dynamics (CFD) simulations as numerical experiments for the identification of one-dimensional (1-D) advection-dispersion models - computationally light tools, used e.g., as sub-models in systems analysis. The objective is to develop a new 1-D framework, referred to as interpreted CFD (iCFD) models, in which statistical meta-models are used to calculate the pseudo-dispersion coefficient (D) as a function of design and flow boundary conditions. The method - presented in a straightforward and transparent way - is illustrated using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor screening study and system understanding, 50 different sets of design and flow conditions are selected using Latin Hypercube Sampling (LHS). The boundary condition sets are imposed on a 2-D axi-symmetrical CFD simulation model of the SST. In the framework, to degenerate the 2-D model structure, CFD model outputs are approximated by the 1-D model through the calibration of three different model structures for D. Correlation equations for the D parameter then are identified as a function of the selected design and flow boundary conditions (meta-models), and their accuracy is evaluated against D values estimated in each numerical experiment. The evaluation and validation of the iCFD model structure is carried out using scenario simulation results obtained with parameters sampled from the corners of the LHS experimental region. For the studied SST, additional iCFD model development was carried out in terms of (i) assessing different density current sub-models; (ii) implementation of a combined flocculation, hindered, transient and compression settling velocity function; and (iii

  6. Lime Kiln Modeling. CFD and One-dimensional simulations

    Svedin, Kristoffer; Ivarsson, Christofer; Lundborg, Rickard


    The incentives for burning alternative fuels in lime kilns are growing. An increasing demand on thorough investigations of alternative fuel impact on lime kiln performance have been recognized, and the purpose of this project has been to develop a lime kiln CFD model with the possibility to fire fuel oil and lignin. The second part of the project consists of three technical studies. Simulated data from a one-dimensional steady state program has been used to support theories on the impact of biofuels and lime mud dryness. The CFD simulations was carried out in the commercial code FLUENT. Due to difficulties with the convergence of the model the calcination reaction is not included. The model shows essential differences between the two fuels. Lignin gives a different flame shape and a longer flame length compared to fuel oil. Mainly this depends on how the fuel is fed into the combustion chamber and how much combustion air that is added as primary and secondary air. In the case of lignin combustion the required amount of air is more than in the fuel oil case. This generates more combustion gas and a different flow pattern is created. Based on the values from turbulent reaction rate for the different fuels an estimated flame length can be obtained. For fuel oil the combustion is very intense with a sharp peak in the beginning and a rapid decrease. For lignin the combustion starts not as intense as for the fuel oil case and has a smoother shape. The flame length appears to be approximately 2-3 meter longer for lignin than for fuel oil based on turbulent reaction rate in the computational simulations. The first technical study showed that there are many benefits of increasing dry solids content in the lime mud going into a kiln such as increased energy efficiency, reduced TRS, and reduced sodium in the kiln. However, data from operating kilns indicates that these benefits can be offset by increasing exit gas temperature that can limit kiln production capacity. Simulated

  7. Development of a compartment model based on CFD simulations for description of mixing in bioreactors

    Crine, M.


    Full Text Available Understanding and modeling the complex interactions between biological reaction and hydrodynamics are a key problem when dealing with bioprocesses. It is fundamental to be able to accurately predict the hydrodynamics behavior of bioreactors of different size and its interaction with the biological reaction. CFD can provide detailed modeling about hydrodynamics and mixing. However, it is computationally intensive, especially when reactions are taken into account. Another way to predict hydrodynamics is the use of "Compartment" or "Multi-zone" models which are much less demanding in computation time than CFD. However, compartments and fluxes between them are often defined by considering global quantities not representative of the flow. To overcome the limitations of these two methods, a solution is to combine compartment modeling and CFD simulations. Therefore, the aim of this study is to develop a methodology in order to propose a compartment model based on CFD simulations of a bioreactor. The flow rate between two compartments can be easily computed from the velocity fields obtained by CFD. The difficulty lies in the definition of the zones in such a way they can be considered as perfectly mixed. The creation of the model compartments from CFD cells can be achieved manually or automatically. The manual zoning consists in aggregating CFD cells according to the user's wish. The automatic zoning defines compartments as regions within which the value of one or several properties are uniform with respect to a given tolerance. Both manual and automatic zoning methods have been developed and compared by simulating the mixing of an inert scalar. For the automatic zoning, several algorithms and different flow properties have been tested as criteria for the compartment creation.

  8. Prediction of subcooled flow boiling characteristics using two-fluid Eulerian CFD model

    Braz Filho, Francisco A.; Ribeiro, Guilherme B., E-mail:; Caldeira, Alexandre D.


    Highlights: • CFD multiphase model is used to predict subcooled flow boiling characteristics. • Better agreement is achieved for higher saturation pressures. • Onset of nucleate boiling and saturated boiling are well predicted. • CFD multiphase model tends to underestimate the void fraction. • Factors were adjusted in order to improve the void fraction results. - Abstract: The present study concerns a detailed analysis of flow boiling phenomena under high pressure systems using a two-fluid Eulerian approach provided by a Computational Fluid Dynamics (CFD) solver. For this purpose, a vertical heated pipe made of stainless steel with an internal diameter of 15.4 mm was considered as the modeled domain. Two different uniform heat fluxes and three saturation pressures were applied to the channel wall, whereas water mass flux of 900 kg/m{sup 2} s was considered for all simulation cases. The model was validated against a set of experimental data and results have indicated a promising use of the CFD technique for estimation of the wall temperature, the liquid bulk temperature and the location of the departure of nucleate boiling. Changes in factors applied in the modeling of the interfacial heat transfer coefficient and bubble departure frequency were suggested, allowing a better prediction of the void fraction along the heated channel. The commercial CFD solver FLUENT 14.5 was used for the model implementation.

  9. PIV-measured versus CFD-predicted flow dynamics in anatomically realistic cerebral aneurysm models.

    Ford, Matthew D; Nikolov, Hristo N; Milner, Jaques S; Lownie, Stephen P; Demont, Edwin M; Kalata, Wojciech; Loth, Francis; Holdsworth, David W; Steinman, David A


    Computational fluid dynamics (CFD) modeling of nominally patient-specific cerebral aneurysms is increasingly being used as a research tool to further understand the development, prognosis, and treatment of brain aneurysms. We have previously developed virtual angiography to indirectly validate CFD-predicted gross flow dynamics against the routinely acquired digital subtraction angiograms. Toward a more direct validation, here we compare detailed, CFD-predicted velocity fields against those measured using particle imaging velocimetry (PIV). Two anatomically realistic flow-through phantoms, one a giant internal carotid artery (ICA) aneurysm and the other a basilar artery (BA) tip aneurysm, were constructed of a clear silicone elastomer. The phantoms were placed within a computer-controlled flow loop, programed with representative flow rate waveforms. PIV images were collected on several anterior-posterior (AP) and lateral (LAT) planes. CFD simulations were then carried out using a well-validated, in-house solver, based on micro-CT reconstructions of the geometries of the flow-through phantoms and inlet/outlet boundary conditions derived from flow rates measured during the PIV experiments. PIV and CFD results from the central AP plane of the ICA aneurysm showed a large stable vortex throughout the cardiac cycle. Complex vortex dynamics, captured by PIV and CFD, persisted throughout the cardiac cycle on the central LAT plane. Velocity vector fields showed good overall agreement. For the BA, aneurysm agreement was more compelling, with both PIV and CFD similarly resolving the dynamics of counter-rotating vortices on both AP and LAT planes. Despite the imposition of periodic flow boundary conditions for the CFD simulations, cycle-to-cycle fluctuations were evident in the BA aneurysm simulations, which agreed well, in terms of both amplitudes and spatial distributions, with cycle-to-cycle fluctuations measured by PIV in the same geometry. The overall good agreement

  10. Validation of vortex code viscous models using lidar wake measurements and CFD

    Branlard, Emmanuel; Machefaux, Ewan; Gaunaa, Mac;


    The newly implemented vortex code Omnivor coupled to the aero-servo-elastic tool hawc2 is described in this paper. Vortex wake improvements by the implementation of viscous effects are considered. Different viscous models are implemented and compared with each other. Turbulent flow fields...... with sheared inflow are used to compare the vortex code performance with CFD and lidar measurements. Laminar CFD computations are used to evaluate the performance of the viscous models. Consistent results between the vortex code and CFD tool are obtained up to three diameters downstream. The modelling...... of viscous boundaries appear more important than the modelling of viscosity in the wake. External turbulence and shear appear sufficient but their full potential flow modelling would be preferred....

  11. Investigation of Microclimate by CFD Modeling of Moisture Interactions between Air and Constructions

    Mortensen, Lone Hedegaard; Woloszyn, Monika; Rode, Carsten;


    There is a strong demand for accurate moisture modeling since moisture poses a risk for both the constructions and the indoor climate. This investigation has special focus on moisture modeling. The paper describes a new model based on a CFD tool enhanced to include both detailed modeling of airfl...

  12. Application of Scaling-Law and CFD Modeling to Hydrodynamics of Circulating Biomass Fluidized Bed Gasifier

    Mazda Biglari


    Full Text Available Two modeling approaches, the scaling-law and CFD (Computational Fluid Dynamics approaches, are presented in this paper. To save on experimental cost of the pilot plant, the scaling-law approach as a low-computational-cost method was adopted and a small scale column operating under ambient temperature and pressure was built. A series of laboratory tests and computer simulations were carried out to evaluate the hydrodynamic characteristics of a pilot fluidized-bed biomass gasifier. In the small scale column solids were fluidized. The pressure and other hydrodynamic properties were monitored for the validation of the scaling-law application. In addition to the scaling-law modeling method, the CFD approach was presented to simulate the gas-particle system in the small column. 2D CFD models were developed to simulate the hydrodynamic regime. The simulation results were validated with the experimental data from the small column. It was proved that the CFD model was able to accurately predict the hydrodynamics of the small column. The outcomes of this research present both the scaling law with the lower computational cost and the CFD modeling as a more robust method to suit various needs for the design of fluidized-bed gasifiers.

  13. Towards CFD modeling of turbulent pipeline material transportation

    Shahirpour, Amir; Herzog, Nicoleta; Egbers, Cristoph


    Safe and financially efficient pipeline transportation of carbon dioxide is a critical issue in the developing field of the CCS Technology. In this part of the process, carbon dioxide is transported via pipes with diameter of 1.5 m and entry pressure of 150 bar, with Reynolds number of 107 and viscosity of 8×10(-5) Pa.s as dense fluid [1]. Presence of large and small scale structures in the pipeline, high Reynolds numbers at which CO2 should be transferred, and 3 dimensional turbulence caused by local geometrical modifications, increase the importance of simulation of turbulent material transport through the individual components of the CO2 chain process. In this study, incompressible turbulent channel flow and pipe flow have been modeled using OpenFoam, an open source CFD software. In the first step, simulation of a turbulent channel flow has been considered using LES for shear Reynolds number of 395. A simple geometry has been chosen with cyclic fluid inlet and outlet boundary conditions to simulate a fully developed flow. The mesh is gradually refined towards the wall to provide values close enough to the wall for the wall coordinate (y+). Grid resolution study has been conducted for One-Equation model. The accuracy of the results is analyzed with respect to the grid smoothness in order to reach an optimized resolution for carrying out the next simulations. Furthermore, three LES models, One-Equation, Smagorinsky and Dynamic Smagorinsky are applied for the grid resolution of (60 × 100 × 80) in (x, y, z) directions. The results are then validated with reference to the DNS carried out by Moser et al.[2] for the similar geometry using logarithmic velocity profile (U+) and Reynolds stress tensor components. In the second step the similar flow is modeled using Reynolds averaged method. Several RANS models, like K-epsilon and Launder-Reece-Rodi are applied and validated against DNS and LES results in a similar fashion. In the most recent step, it has been intended

  14. Towards a CFD-based mechanistic deposit formation model for straw-fired boilers

    Kær, Søren Knudsen; Rosendahl, Lasse Aistrup; Baxter, L.L.


    in the reminder of the paper. The growth of deposits on furnace walls and super heater tubes is treated including the impact on heat transfer rates determined by the CFD code. Based on the commercial CFD code FLUENTe, the overall model is fully implemented through the User Defined Functions. The model...... is configured entirely through a graphical user interface integrated in the standard FLUENTe interface. The model considers fine and coarse mode ash deposition and sticking mechanisms for the complete deposit growth, as well as an influence on the local boundary conditions for heat transfer due to thermal...

  15. A three-demensional CFD model for gas-liquid bubble columns.

    Delnoij, E.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria


    This paper discusses the development of a three-dimensional Euler¿Lagrange CFD model for a gas¿liquid bubble column. The model resolves the time-dependent, three-dimensional motion of small, spherical gas bubbles in a liquid. Our model incorporates all relevant forces acting on a bubble rising in a

  16. Computational Fluid Dynamics (CFD) Modeling for High Rate Pulverized Coal Injection (PCI) into the Blast Furnace

    Dr. Chenn Zhou


    Pulverized coal injection (PCI) into the blast furnace (BF) has been recognized as an effective way to decrease the coke and total energy consumption along with minimization of environmental impacts. However, increasing the amount of coal injected into the BF is currently limited by the lack of knowledge of some issues related to the process. It is therefore important to understand the complex physical and chemical phenomena in the PCI process. Due to the difficulty in attaining trus BF measurements, Computational fluid dynamics (CFD) modeling has been identified as a useful technology to provide such knowledge. CFD simulation is powerful for providing detailed information on flow properties and performing parametric studies for process design and optimization. In this project, comprehensive 3-D CFD models have been developed to simulate the PCI process under actual furnace conditions. These models provide raceway size and flow property distributions. The results have provided guidance for optimizing the PCI process.

  17. Towards a CFD Model for Prediction of Wind Turbine Power Losses due to Icing in Cold Climate

    Pedersen, Marie Cecilie; Sørensen, Henrik

    Icing induced power losses is an important issue when operating wind turbines in cold climate. This paper presents a concept of modelling ice accretion on wind turbines using Computational Fluid Dynamics (CFD). The modelling concept works towards unifying the processes of modelling ice accretion...... and the aerodynamic analysis of the iced object into one CFD-based icing model. Modelling of icing and obtaining ice shapes in combination with mesh update by surface boundary displacement was demonstrated in the paper. It has been done by expressing in-cloud icing in CFD by an Eulerian multiphase model, implementing...... an icing module into the CFD solution and finally by surface boundary displacement also included in the CFD solution. The model has been developed using ANSYS-FLUENT and user-defined functions. The naca profile, NACA64618, has been used to illustrate the functionality of the model. Running ice accretion...

  18. CFD Wake Modelling with a BEM Wind Turbine Sub-Model

    Anders Hallanger


    Full Text Available Modelling of wind farms using computational fluid dynamics (CFD resolving the flow field around each wind turbine's blades on a moving computational grid is still too costly and time consuming in terms of computational capacity and effort. One strategy is to use sub-models for the wind turbines, and sub-grid models for turbulence production and dissipation to model the turbulent viscosity accurately enough to handle interaction of wakes in wind farms. A wind turbine sub-model, based on the Blade Momentum Theory, see Hansen (2008, has been implemented in an in-house CFD code, see Hallanger et al. (2002. The tangential and normal reaction forces from the wind turbine blades are distributed on the control volumes (CVs at the wind turbine rotor location as sources in the conservation equations of momentum. The classical k-epsilon turbulence model of Launder and Spalding (1972 is implemented with sub-grid turbulence (SGT model, see Sha and Launder (1979 and Sand and Salvesen (1994. Steady state CFD simulations were compared with flow and turbulence measurements in the wake of a model scale wind turbine, see Krogstad and Eriksen (2011. The simulated results compared best with experiments when stalling (boundary layer separation on the wind turbine blades did not occur. The SGT model did improve turbulence level in the wake but seems to smear the wake flow structure. It should be noted that the simulations are carried out steady state not including flow oscillations caused by vortex shedding from tower and blades as they were in the experiments. Further improvement of the simulated velocity defect and turbulence level seems to rely on better parameter estimation to the SGT model, improvements to the SGT model, and possibly transient- instead of steady state simulations.

  19. Wind flow conditions in offshore wind farms. Validation and application of a CFD wake model

    Westerhellweg, Annette; Canadillas, Beatriz; Kinder, Friederike; Neumann, Thomas [Deutsches Windenergie-Institut GmbH (DEWI), Wilhelmshaven (Germany)


    Since August 2009, the first German offshore wind farm 'alpha ventus' is operating close to the wind measurement platform FINO1. Within the research project RAVE-OWEA the wind flow conditions in 'alpha ventus' were assessed in detail, simulated with a CFD wake model and compared with the measurements. Wind data measured at FINO1 have been evaluated for wind speed reduction and turbulence increase in the wake. Additionally operational data were evaluated for the farm efficiency. The atmospheric stability has been evaluated by temperature measurements of air and water and the impact of atmospheric stability on the wind conditions in the wake has been assessed. As an application of CFD models the generation of power matrices is introduced. Power matrices can be used for the continual monitoring of the single wind turbines in the wind farm. A power matrix based on CFD simulations has been created for 'alpha ventus' and tested against the measured data. (orig.)

  20. Development and Implementation of CFD-Informed Models for the Advanced Subchannel Code CTF

    Blyth, Taylor S. [Pennsylvania State Univ., University Park, PA (United States); Avramova, Maria [North Carolina State Univ., Raleigh, NC (United States)


    The research described in this PhD thesis contributes to the development of efficient methods for utilization of high-fidelity models and codes to inform low-fidelity models and codes in the area of nuclear reactor core thermal-hydraulics. The objective is to increase the accuracy of predictions of quantities of interests using high-fidelity CFD models while preserving the efficiency of low-fidelity subchannel core calculations. An original methodology named Physics- based Approach for High-to-Low Model Information has been further developed and tested. The overall physical phenomena and corresponding localized effects, which are introduced by the presence of spacer grids in light water reactor (LWR) cores, are dissected in corresponding four building basic processes, and corresponding models are informed using high-fidelity CFD codes. These models are a spacer grid-directed cross-flow model, a grid-enhanced turbulent mixing model, a heat transfer enhancement model, and a spacer grid pressure loss model. The localized CFD-models are developed and tested using the CFD code STAR-CCM+, and the corresponding global model development and testing in sub-channel formulation is performed in the thermal- hydraulic subchannel code CTF. The improved CTF simulations utilize data-files derived from CFD STAR-CCM+ simulation results covering the spacer grid design desired for inclusion in the CTF calculation. The current implementation of these models is examined and possibilities for improvement and further development are suggested. The validation experimental database is extended by including the OECD/NRC PSBT benchmark data. The outcome is an enhanced accuracy of CTF predictions while preserving the computational efficiency of a low-fidelity subchannel code.

  1. Investigation of Airflow in a Room with displacement ventilation by means of a CFD-model

    Jacobsen, T. V.; Nielsen, Peter Vilhelm

    The airflow in front of an inlet device in a room with displacement ventilation is investigated in this study. In continuation of the full-scale measurements and the development of a CFD-model, described in /1/, this report aims at testing the model and conducting numerical experiments to provide...

  2. Turbulence modeling needs of commercial CFD codes: Complex flows in the aerospace and automotive industries

    Befrui, Bizhan A.


    This viewgraph presentation discusses the following: STAR-CD computational features; STAR-CD turbulence models; common features of industrial complex flows; industry-specific CFD development requirements; applications and experiences of industrial complex flows, including flow in rotating disc cavities, diffusion hole film cooling, internal blade cooling, and external car aerodynamics; and conclusions on turbulence modeling needs.

  3. Natural ventilation of a generic cask under a transport hood - CFD and analytical modelling

    Powell, D.; Davies, G.; Tso, C.F. [Arup, London (United Kingdom)


    In comparison with finite element simulation for structural and thermal behaviour, the use of computational fluid dynamics technique (hereafter CFD) to analyse, predict and design air and heat flow in package design is relatively novel. Arup has been using CFD techniques to investigate fluid and heat flow, and to use it as a tool to design fluid and heat flow across a broad spectrum of industries for over fifteen years. In order demonstrate the power of the technique and its benefits, the airflow and heat flow characteristics around a transport package during transit under a transport hood has been evaluated using the CFD technique. This paper presents the scenario, the model, the analysis technique and the results of this analysis. Comparison with test results is probably the best way to validate a CFD analysis. In the absence of test results, the analysis was verified by comparison with hand calculation solutions. The scenario as it stands is too complex and hand calculation solution cannot describe the scenario sufficiently. However, hand calculation solutions could be derived for simplified version of the scenario against which CFD analysis of the simplified scenario can be compared. The second half of this paper describes the verification out.

  4. Multi-Phase CFD Modeling of Solid Sorbent Carbon Capture System

    Ryan, Emily M.; DeCroix, David; Breault, Ronald W.; Xu, Wei; Huckaby, E. D.; Saha, Kringan; Darteville, Sebastien; Sun, Xin


    Computational fluid dynamics (CFD) simulations are used to investigate a low temperature post-combustion carbon capture reactor. The CFD models are based on a small scale solid sorbent carbon capture reactor design from ADA-ES and Southern Company. The reactor is a fluidized bed design based on a silica-supported amine sorbent. CFD models using both Eulerian-Eulerian and Eulerian-Lagrangian multi-phase modeling methods are developed to investigate the hydrodynamics and adsorption of carbon dioxide in the reactor. Models developed in both FLUENT® and BARRACUDA are presented to explore the strengths and weaknesses of state of the art CFD codes for modeling multi-phase carbon capture reactors. The results of the simulations show that the FLUENT® Eulerian-Lagrangian simulations (DDPM) are unstable for the given reactor design; while the BARRACUDA Eulerian-Lagrangian model is able to simulate the system given appropriate simplifying assumptions. FLUENT® Eulerian-Eulerian simulations also provide a stable solution for the carbon capture reactor given the appropriate simplifying assumptions.

  5. Multi-phase CFD modeling of solid sorbent carbon capture system

    Ryan, E. M.; DeCroix, D.; Breault, Ronald W. [U.S. DOE; Xu, W.; Huckaby, E. David [U.S. DOE


    Computational fluid dynamics (CFD) simulations are used to investigate a low temperature post-combustion carbon capture reactor. The CFD models are based on a small scale solid sorbent carbon capture reactor design from ADA-ES and Southern Company. The reactor is a fluidized bed design based on a silica-supported amine sorbent. CFD models using both Eulerian–Eulerian and Eulerian–Lagrangian multi-phase modeling methods are developed to investigate the hydrodynamics and adsorption of carbon dioxide in the reactor. Models developed in both FLUENT® and BARRACUDA are presented to explore the strengths and weaknesses of state of the art CFD codes for modeling multi-phase carbon capture reactors. The results of the simulations show that the FLUENT® Eulerian–Lagrangian simulations (DDPM) are unstable for the given reactor design; while the BARRACUDA Eulerian–Lagrangian model is able to simulate the system given appropriate simplifying assumptions. FLUENT® Eulerian–Eulerian simulations also provide a stable solution for the carbon capture reactor given the appropriate simplifying assumptions.

  6. CFD modeling and experience of waste-to-energy plant burning waste wood

    Rajh, B.; Yin, Chungen; Samec, N.; M. HRIBERSEK; Kokalj, F.


    Computational Fluid Dynamics (CFD) is being increasingly used in industry for in-depth understanding of the fundamental mixing, combustion, heat transfer and pollutant formation in combustion processes and for design and optimization of Waste-to-Energy (WtE) plants. In this paper, CFD modeling of waste wood combustion in a 13 MW grate-fired boiler in a WtE plant is presented. As a validation effort, the temperature profiles at a number of ports in the furnace are measured and the experimental...

  7. Modeling flow inside an anaerobic digester by CFD techniques

    Mendoza, Alexandra Martinez; Jimenez, P. Amparo Lopez [Departmento do Ingenieria Hidralica y Medio Ambiente, Universitat Politecnica de Valencia, Camino de Vera S/N 46022 (Spain); Martinez, Tatiana Montoya; Monanana, Vincente Fajardo [Grupo Aquas de Valencia. Avenida Marques del Turia 19 46005 Valencia (Spain)


    Anaerobic processes are used to treat high strength organic wastewater as well as for the treatment of primary and secondary sludge from conventional wastewater treatment plants. In these processes, heterotrophic microorganisms convert biodegradable organic matter to methane and carbon dioxide in the absence of dissolved oxygen and nitrate. Some of the most important aspects of the design of anaerobic digesters are related to hydraulic considerations. In spite of its important role in performance, hydraulics of flow inside digesters has not been quantified or adequately characterized. In this contribution a three-dimensional steady-state computational fluid dynamics (CFD) simulation has been performed for a particular anaerobic digester, in order to visualize the flow patterns. Flow and velocities profiles have been represented inside the digester to identify possible dead zones or stratifications. The geometry of a real digester installed in Valencia Waste Water Treatment Plant (located in Quart-Benager, Valencia, Spain) has been used in order to consider the proposed methodology.

  8. Implementation and Development of an Eulerian Spray Model for CFD simulations of diesel Sprays


    [EN] The main objective of this work is the modeling of diesel sprays under engine conditions, including the atomization, transport and evaporation processes pivotal in the diesel spray formation and its development. For this purpose, an Eulerian single fluid model, embedded in a RANS environment, is implemented in the CFD platform OpenFOAM. The modeling approach implemented here is based on the ⅀-Y model. The model is founded on the assumption of flow scales separation. In actual i...

  9. Simulation of a MW rotor equipped with vortex generators using CFD and an actuator shape model

    Troldborg, Niels; Zahle, Frederik; Sørensen, Niels N.


    This article presents a comparison of CFD simulations of the DTU 10 MW reference wind turbine with and without vortex generators installed on the inboard part of the blades. The vortex generators are modelled by introducing body forces determined using a modified version of the so-called BAY mode...

  10. Development of a three-dimensional CFD model for rotary lime kilns

    Lixin Tao; Blom, Roger (FS Dynamics Sweden AB, Goeteborg (Sweden)); Nordgren, Daniel (Innventia, Stockholm (Sweden))


    In the calcium loop of the recovery cycle in a Kraft process of pulp and paper production, rotary lime kilns are used to convert the lime mud, mainly CaCO3, back to quick lime, CaO, for re-use in the causticizing process. The lime kilns are one of the major energy consumption devices for paper and pulp industry. Because of the rising oil price and new emission limits, the pulp mills have been forced to look for alternative fuels for their lime kilns. One interesting alternative to oil, often easily available at pulp mills, is biofuels such as sawdust and bark. However the practical kiln operation often encounters some difficulties because of the uncertainties around the biofuel impact on the lime kiln performance. A deeper understanding of the flame characteristics is required when shifting from oil to biofuels. Fortunately recent advances in modern Computational Fluid Dynamics, CFD, have provided the possibility to study and predict the detailed flame characteristics regarding the lime kiln performance. In this project a three-dimensional CFD model for rotary lime kilns has been developed. To simulate a rotary lime kiln the developed CFD model integrates the three essential sub-models, i.e. the freeboard hot flow model, the lime bed model and the rotating refractory wall model and it is developed based on the modern CFD package: FLUENT which is commercially available on the market. The numerical simulations using the developed CFD model have been performed for three selected kiln operations fired with three different fuel mixtures. The predicted results from the CFD modelling are presented and discussed in order to compare the impacts on the kiln performance due to the different firing conditions. During the development, the lime kiln at the Soedra Cell Moensteraas mill has been used as reference kiln. To validate the CFD model, in-plant measurements were carried out in the Moensteraas lime kiln during an experiment campaign. The results obtained from the

  11. Comparison of CFD Simulation of a Hyundai I20 Model with Four Different Turbulence Models



    Full Text Available This article describes the CFD analysis of a Hyundai i20 car Model. The focus of this study is to investigate the aerodynamics characteristics of Hyundai i20 car model and the flow obtained by solving the steady-state governing continuity equations as well as the momentum conservation equations combined with one of four turbulence models (1.Spalart-Allmaras 2.k-ε Standard 3.Transition k-kl-ω 4.Transition Shear Stress Transport (SST and the solutions obtained using these different models were compared. Except transition k-kl-ω model, other three models show nearly similar velocity variations plot. Pressure variation plot are almost similar with K-ε and transition-SST models. Eddy viscosity plot are almost similar with K-ε and transition k-kl-ω models

  12. Euler-Lagrange CFD modelling of unconfined gas mixing in anaerobic digestion.

    Dapelo, Davide; Alberini, Federico; Bridgeman, John


    A novel Euler-Lagrangian (EL) computational fluid dynamics (CFD) finite volume-based model to simulate the gas mixing of sludge for anaerobic digestion is developed and described. Fluid motion is driven by momentum transfer from bubbles to liquid. Model validation is undertaken by assessing the flow field in a labscale model with particle image velocimetry (PIV). Conclusions are drawn about the upscaling and applicability of the model to full-scale problems, and recommendations are given for optimum application.

  13. Numerical modeling of immiscible two-phase flow in micro-models using a commercial CFD code

    Crandall, Dustin; Ahmadia, Goodarz; Smith, Duane H.


    Off-the-shelf CFD software is being used to analyze everything from flow over airplanes to lab-on-a-chip designs. So, how accurately can two-phase immiscible flow be modeled flowing through some small-scale models of porous media? We evaluate the capability of the CFD code FLUENT{trademark} to model immiscible flow in micro-scale, bench-top stereolithography models. By comparing the flow results to experimental models we show that accurate 3D modeling is possible.




    The primary purpose of the tank mixing and sampling demonstration program is to mitigate the technical risks associated with the ability of the Hanford tank farm delivery and celtification systems to measure and deliver a uniformly mixed high-level waste (HLW) feed to the Waste Treatment and Immobilization Plant (WTP) Uniform feed to the WTP is a requirement of 24590-WTP-ICD-MG-01-019, ICD-19 - Interface Control Document for Waste Feed, although the exact definition of uniform is evolving in this context. Computational Fluid Dynamics (CFD) modeling has been used to assist in evaluating scaleup issues, study operational parameters, and predict mixing performance at full-scale.

  15. Numerical Predictions of Cavitating Flow around Model Scale Propellers by CFD and Advanced Model Calibration

    Mitja Morgut


    Full Text Available The numerical predictions of the cavitating flow around two model scale propellers in uniform inflow are presented and discussed. The simulations are carried out using a commercial CFD solver. The homogeneous model is used and the influence of three widespread mass transfer models, on the accuracy of the numerical predictions, is evaluated. The mass transfer models in question share the common feature of employing empirical coefficients to adjust mass transfer rate from water to vapour and back, which can affect the stability and accuracy of the predictions. Thus, for a fair and congruent comparison, the empirical coefficients of the different mass transfer models are first properly calibrated using an optimization strategy. The numerical results obtained, with the three different calibrated mass transfer models, are very similar to each other for two selected model scale propellers. Nevertheless, a tendency to overestimate the cavity extension is observed, and consequently the thrust, in the most severe operational conditions, is not properly predicted.

  16. CFD modeling of methane distribution at a continuous miner face with various curtain setback distances

    Zhou Lihong; Pritchard Christopher; Zheng Yi


    Knowledge of the airflow patterns and methane distributions at a continuous miner face under different ventilation conditions can minimize the risks of explosion and injury to miners by accurately forecasting potentially hazardous face methane levels. This study focused on validating a series of computational fluid dynamics (CFD) models using full-scale ventilation gallery data that assessed how curtain setback distance impacted airflow patterns and methane distributions at an empty mining face (no continuous miner present). Three CFD models of face ventilation with 4.6, 7.6 and 10.7 m (15, 25, and 35 ft) blowing curtain setback distances were constructed and validated with experimental data collected in a full-scale ventilation test facility. Good agreement was obtained between the CFD simulation results and this data. Detailed airflow and methane distribution information are provided. Elevated methane zones at the working faces were identified with the three curtain setback distances. Visualization of the setback dis-tance impact on the face methane distribution was performed by utilizing the post-processing capability of the CFD software.

  17. Validation of CFD-models for non-stoichiometric oxycoal combustion

    Bohn, Jan-Peter; Goanta, Adrian; Baumgartner, Andreas; Blume, Maximilian; Spliethoff, Hartmut [Technische Univ. Muenchen, Garching (Germany). Inst. of Energy Systems


    To compensate the drawback of high flue gas recirculation rates specific for oxyfuel processes, a new concept based on staged combustion, called controlled staging with non-stoichiometric burners (CSNB) was investigated. A combination of over- and sub-stoichiometric burners avoids inadmissible high flame temperatures even with oxygen concentrations up to 40 vol.-% in the oxidant. The non-stoichiometric burners are arranged in such a way that the overall stoichiometry at the combustion chamber outlet is slightly over-stoichiometric similar to conventional combustion processes, so that full burn out is secured. This concept aims at a more efficient oxyfuel process due to the decreasing effort in the recirculation loop and a new designed, more cost effective, steam generator. For further process optimization of the CSNB concept and the adjacent steam generator layout are validated CFD simulations urgently required. This paper shows first steps in validation of the CSNB combustion concept against state of the art CFD codes. The CFD code was optimized for oxyfuel combustion including a new char combustion and gas radiation model. Experimental investigations and CFD modelling are showing good agreement in concerns of temperature, CO and CO{sub 2} profiles. However the prediction of the oxygen concentration differs significantly between experiment and simulation.

  18. CFD Modelling of Abdominal Aortic Aneurysm on Hemodynamic Loads Using a Realistic Geometry with CT

    Eduardo Soudah


    Full Text Available The objective of this study is to find a correlation between the abdominal aortic aneurysm (AAA geometric parameters, wall stress shear (WSS, abdominal flow patterns, intraluminal thrombus (ILT, and AAA arterial wall rupture using computational fluid dynamics (CFD. Real AAA 3D models were created by three-dimensional (3D reconstruction of in vivo acquired computed tomography (CT images from 5 patients. Based on 3D AAA models, high quality volume meshes were created using an optimal tetrahedral aspect ratio for the whole domain. In order to quantify the WSS and the recirculation inside the AAA, a 3D CFD using finite elements analysis was used. The CFD computation was performed assuming that the arterial wall is rigid and the blood is considered a homogeneous Newtonian fluid with a density of 1050 kg/m3 and a kinematic viscosity of 4×10-3 Pa·s. Parallelization procedures were used in order to increase the performance of the CFD calculations. A relation between AAA geometric parameters (asymmetry index (β, saccular index (γ, deformation diameter ratio (χ, and tortuosity index (ε and hemodynamic loads was observed, and it could be used as a potential predictor of AAA arterial wall rupture and potential ILT formation.

  19. CFD Model of Water Droplet Transport for ISS Hygiene Activity

    Son, Chang H.


    The goal of the study is to assess the impacts of free water propagation in the Waste and Hygiene Compartment (WHC). Free water can be generated inside the WHC in small quantities due to crew hygiene activity. To mitigate potential impact of free water in Node 3 cabin the WHC doorway is enclosed by a waterproof bump-out, Kabin, with openings at the top and bottom. At the overhead side of the rack, there is a screen that prevents large drops of water from exiting. However, as the avionics fan in the WHC causes airflow toward the deck side of the rack, small quantities of free water may exit at the bottom of the Kabin. A Computational Fluid Dynamics (CFD) analysis of Node 3 cabin airflow made possible to identify the paths of water transport. The Node 3 airflow was computed for several ventilation scenarios. To simulate the droplet transport the Lagrangian discrete phase approach was used. Various initial droplet distributions were considered in the study. The droplet diameter was varied in the range of 2-20 mm. The results of the computations showed that most of the drops fall to the rack surface not far from the WHC curtain. The probability of the droplet transport to the adjacent rack surface with electronic equipment was predicted.

  20. Modelling die filling with charged particles using DEM/CFD

    Emmanuel Nkem Nwose; Chunlei Pei; Chuan-Yu Wu


    The effects of electrostatic charge on powder flow behaviour during die filling in a vacuum and in air were analysed using a coupled discrete element method and computational fluid dynamics (DEM/CFD) code,in which long range electrostatic interactions were implemented.The present 2D simulations revealed that both electrostatic charge and the presence of air can affect the powder flow behaviour during die filling.It was found that the electrostatic charge inhibited the flow of powders into the die and induced a loose packing structure.At the same filling speed,increasing the electrostatic charge led to a decrease in the fill ratio which quantifies the volumetric occupancy of powder in the die.In addition,increasing the shoe speed caused a further decrease in the fill ratio,which was characterised using the concept of critical filling speed.When the electrostatic charge was low,the air/particle interaction was strong so that a lower critical filling speed was obtained for die filling in air than in a vacuum.With high electrostatic charge,the electrostatic interactions became dominant.Consequently,similar fill ratio and critical filling speed were obtained for die filling in air and in a vacuum.


    Zbigniew Czyż


    Full Text Available The paper presents CFD analysis of fuel flow in the CNG injector. The issues such a pressure drop along an injector channel, mass flow through the key sections of the injector geometry, flow rates, the impact of the needle shape on the deflection of the sprayed gas cone and the impact of the wall head are analyzed in the article. The simulation was made in the transient states conditions for full injection process, including the opening and closing of the injector. An injection time of 6 ms, velocity of 0.33 mm/ms and a lift of 0.5 mm were selected for opening and closing of injector based on experimental test. The simulation shows that the volume inside the injector is a kind of fuel accumulator, and the opening process of the needle influence the flow parameters in an inlet cross-section after a certain time, depending on a channel cross section. The calculations allowed to select the ratio of an injector duct cross sectional area to the aperture area of the injection capable of the reducing pressure loss. The unusual location of the injector in the socket of a glow plug in the Andoria ADCR engine makes a stream be impaired by a part of the head. This research result would be useful in developing an injector construction which will be used for an investigation of CNG addition into diesel engine.

  2. An Initial Non-Equilibrium Porous-Media Model for CFD Simulation of Stirling Regenerators

    Tew, Roy C.; Simon, Terry; Gedeon, David; Ibrahim, Mounir; Rong, Wei


    The objective of this paper is to define empirical parameters for an initial thermal non-equilibrium porous-media model for use in Computational Fluid Dynamics (CFD) codes for simulation of Stirling regenerators. The two codes currently used at Glenn Research Center for Stirling modeling are Fluent and CFD-ACE. The codes porous-media models are equilibrium models, which assume solid matrix and fluid are in thermal equilibrium. This is believed to be a poor assumption for Stirling regenerators; Stirling 1-D regenerator models, used in Stirling design, use non-equilibrium regenerator models and suggest regenerator matrix and gas average temperatures can differ by several degrees at a given axial location and time during the cycle. Experimentally based information was used to define: hydrodynamic dispersion, permeability, inertial coefficient, fluid effective thermal conductivity, and fluid-solid heat transfer coefficient. Solid effective thermal conductivity was also estimated. Determination of model parameters was based on planned use in a CFD model of Infinia's Stirling Technology Demonstration Converter (TDC), which uses a random-fiber regenerator matrix. Emphasis is on use of available data to define empirical parameters needed in a thermal non-equilibrium porous media model for Stirling regenerator simulation. Such a model has not yet been implemented by the authors or their associates.

  3. Improved similarity criterion for seepage erosion using mesoscopic coupled PFC-CFD model

    倪小东; 王媛; 陈珂; 赵帅龙


    Conventional model tests and centrifuge tests are frequently used to investigate seepage erosion. However, the centrifugal test method may not be efficient according to the results of hydraulic conductivity tests and piping erosion tests. The reason why seepage deformation in model tests may deviate from similarity was first discussed in this work. Then, the similarity criterion for seepage deformation in porous media was improved based on the extended Darcy-Brinkman-Forchheimer equation. Finally, the coupled particle flow code–computational fluid dynamics (PFC−CFD) model at the mesoscopic level was proposed to verify the derived similarity criterion. The proposed model maximizes its potential to simulate seepage erosion via the discrete element method and satisfy the similarity criterion by adjusting particle size. The numerical simulations achieved identical results with the prototype, thus indicating that the PFC−CFD model that satisfies the improved similarity criterion can accurately reproduce the processes of seepage erosion at the mesoscopic level.

  4. CFD modelling and experimental investigation of an ejector refrigeration system using methanol as the working fluid

    Riffat, S.B.; Omer, S.A. [Nottingham Univ., School of the Built Environment, Nottingham (United Kingdom)


    This paper presents results of computational fluid dynamic (CFD) analysis and experimental investigation of an ejector refrigeration system using methanol as the working fluid. The CFD modelling was used to investigate the effect of the relative position of the primary nozzle exit within the mixing chamber on the performance of the ejector. The results of the CFD were used to obtain the optimum geometry of the ejector, which was then used to design, construct and test a small-scale experimental ejector refrigeration system. Methanol was used as the working fluid, as it has the advantage of being an 'environmentally friendly' refrigerant that does not contribute to global warming and ozone layer depletion. In addition, use of methanol allows the ejector refrigeration system to produce cooling at temperatures below the freezing point of the water, which of course would not be possible with a water ejector refrigeration system. CFD results showed that positioning the nozzle exit at least 0.21 length of the mixing chamber throat's diameter upstream of the entrance of the mixing chamber gave better performance than pushing it into the mixing chamber. Experimental values of coefficient of performance (COP) between 0.2 and 0.4 were obtained at operating conditions achievable using low-grade heat such as solar energy and waste heat. (Author)

  5. A Reacting-Shrinking Core Model for Pyrolysis and Combustion of a Single Biomass Particle

    Gordon, Alfredo L.; Avila, Claudio R.; Garcia, Ximena A. (Dept. of Chemical Engineering, Univ. of Concepcion (Chile)). e-mail:


    Consecutive heating and pyrolysis of the solid due to incident heat flow represented by a shrinking reacting core approximation and combustion, described by a shrinking unreacting core description, allow modeling the combustion of a cylindrical biomass particle. A bi-dimensional approach (radial and axial) describes mass and heat balances and first order kinetics characterizes the reaction rates. A finite differences algorithm numerically solved the model. Results showed good agreement with available experimental data. The parameter analysis for the pyrolysis step shows high sensibility to the kinetic constants, the incident heat flow, the initial moisture and particle size. Parameters with a significant effect on combustion are the concentration and effective diffusivity of the oxidizing agent in the atmosphere around the reaction surface

  6. CFD modelling and validation of wall condensation in the presence of non-condensable gases

    Zschaeck, G., E-mail: [ANSYS Germany GmbH, Staudenfeldweg 12, Otterfing 83624 (Germany); Frank, T. [ANSYS Germany GmbH, Staudenfeldweg 12, Otterfing 83624 (Germany); Burns, A.D. [ANSYS UK Ltd, 97 Milton Park, Abingdon, Oxfordshire OX14 4RY (United Kingdom)


    Highlights: • A wall condensation model was implemented and validated in ANSYS CFX. • Condensation rate is assumed to be controlled by the concentration boundary layer. • Validation was done using two laboratory scale experiments. • CFD calculations show good agreement with experimental data. - Abstract: The aim of this paper is to present and validate a mathematical model implemented in ANSYS CFD for the simulation of wall condensation in the presence of non-condensable substances. The model employs a mass sink at isothermal walls or conjugate heat transfer (CHT) domain interfaces where condensation takes place. The model was validated using the data reported by Ambrosini et al. (2008) and Kuhn et al. (1997)

  7. CFD modeling of a headbox with injecting dilution water in a central step diffusion tube☆

    Xu Yang; Jinsong Zeng; Kefu Chen; Yucheng Feng


    For engineering applications of water dilution controlling system, the fluid dynamics of a mixed flow was studied with computational fluid dynamics (CFD) simulations and self-designed experimental set-up. In order to exam-ine the predictability of CFD model for the headbox in industrial scale, two pulp suspensions before mixing were treated as homogeneous flows separately. Standard k-εturbulence models with the mass diffusion in turbulent flows-species transport approach were applied in the simulations. A numerical simulation of this headbox model was analyzed with semi-implicit method for pressure linked equations scheme with pressure–velocity coupling. Results show that the model can predict hydrodynamic characteristics of headbox with injecting dilu-tion water in a central diffusion tube, and the distribution of water content at the outlet of the slice lip is ideally normal at different speeds.

  8. iCFD: Interpreted Computational Fluid Dynamics – Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design – The secondary clarifier

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat


    The present study aims at using statistically designed computational fluid dynamics (CFD) simulations as numerical experiments for the identification of one-dimensional (1-D) advection-dispersion models – computationally light tools, used e.g., as sub-models in systems analysis. The objective...... using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor...... both in 2-D and 1-D was undertaken. Results suggest that the iCFD model developed for the SST through the proposed methodology is able to predict solid distribution with high accuracy – taking a reasonable computational effort – when compared to multi-dimensional numerical experiments, under a wide...

  9. Integration of CFD codes and advanced combustion models for quantitative burnout determination

    Javier Pallares; Inmaculada Arauzo; Alan Williams [University of Zaragoza, Zaragoza (Spain). Centre of Research for Energy Resources and Consumption (CIRCE)


    CFD codes and advanced kinetics combustion models are extensively used to predict coal burnout in large utility boilers. Modelling approaches based on CFD codes can accurately solve the fluid dynamics equations involved in the problem but this is usually achieved by including simple combustion models. On the other hand, advanced kinetics combustion models can give a detailed description of the coal combustion behaviour by using a simplified description of the flow field, this usually being obtained from a zone-method approach. Both approximations describe correctly general trends on coal burnout, but fail to predict quantitative values. In this paper a new methodology which takes advantage of both approximations is described. In the first instance CFD solutions were obtained of the combustion conditions in the furnace in the Lamarmora power plant (ASM Brescia, Italy) for a number of different conditions and for three coals. Then, these furnace conditions were used as inputs for a more detailed chemical combustion model to predict coal burnout. In this, devolatilization was modelled using a commercial macromolecular network pyrolysis model (FG-DVC). For char oxidation an intrinsic reactivity approach including thermal annealing, ash inhibition and maceral effects, was used. Results from the simulations were compared against plant experimental values, showing a reasonable agreement in trends and quantitative values. 28 refs., 4 figs., 4 tabs.

  10. Local CFD kinetic model of cadmium vaporization during fluid bed incineration of municipal solid waste

    Soria, J. [Instituto Multidisciplinario de Investigación y Desarrollo de la Patagonia Norte (IDEPA, CONICET-UNCo) y Facultad de Ingeniería, Universidad Nacional del Comahue, Buenos Aires 1400, 8300 Neuquén (Argentina); Laboratoire Procédés, Matériaux et Energie Solaire (CNRS-PROMES), 7 Rue du Four Solaire, Odeillo, 66120 Font-Romeu (France); Gauthier, D., E-mail: [Laboratoire Procédés, Matériaux et Energie Solaire (CNRS-PROMES), 7 Rue du Four Solaire, Odeillo, 66120 Font-Romeu (France); Falcoz, Q.; Flamant, G. [Laboratoire Procédés, Matériaux et Energie Solaire (CNRS-PROMES), 7 Rue du Four Solaire, Odeillo, 66120 Font-Romeu (France); Mazza, G. [Instituto Multidisciplinario de Investigación y Desarrollo de la Patagonia Norte (IDEPA, CONICET-UNCo) y Facultad de Ingeniería, Universidad Nacional del Comahue, Buenos Aires 1400, 8300 Neuquén (Argentina)


    Highlights: ► A 2-D local CFD model for simulating the Cd vaporization process is presented. ► It includes a kinetic expression of Cd vaporization into the incineration process. ► Pyrolysis, volatiles’ combustion and residual carbon combustion are also taken into account. ► It fits very well the experimental results obtained on a lab-scale fluidized bed reported in literature. ► It also compares favorably with a model developed previously by the group. -- Abstract: The emissions of heavy metals during incineration of Municipal Solid Waste (MSW) are a major issue to health and the environment. It is then necessary to well quantify these emissions in order to accomplish an adequate control and prevent the heavy metals from leaving the stacks. In this study the kinetic behavior of Cadmium during Fluidized Bed Incineration (FBI) of artificial MSW pellets, for bed temperatures ranging from 923 to 1073 K, was modeled. FLUENT 12.1.4 was used as the modeling framework for the simulations and implemented together with a complete set of user-defined functions (UDFs). The CFD model combines the combustion of a single solid waste particle with heavy metal (HM) vaporization from the burning particle, and it takes also into account both pyrolysis and volatiles’ combustion. A kinetic rate law for the Cd release, derived from the CFD thermal analysis of the combusting particle, is proposed. The simulation results are compared with experimental data obtained in a lab-scale fluidized bed incinerator reported in literature, and with the predicted values from a particulate non-isothermal model, formerly developed by the authors. The comparison shows that the proposed CFD model represents very well the evolution of the HM release for the considered range of bed temperature.

  11. Comparison of PDF and Moment Closure Methods in the Modeling of Turbulent Reacting Flows

    Norris, Andrew T.; Hsu, Andrew T.


    In modeling turbulent reactive flows, Probability Density Function (PDF) methods have an advantage over the more traditional moment closure schemes in that the PDF formulation treats the chemical reaction source terms exactly, while moment closure methods are required to model the mean reaction rate. The common model used is the laminar chemistry approximation, where the effects of turbulence on the reaction are assumed negligible. For flows with low turbulence levels and fast chemistry, the difference between the two methods can be expected to be small. However for flows with finite rate chemistry and high turbulence levels, significant errors can be expected in the moment closure method. In this paper, the ability of the PDF method and the moment closure scheme to accurately model a turbulent reacting flow is tested. To accomplish this, both schemes were used to model a CO/H2/N2- air piloted diffusion flame near extinction. Identical thermochemistry, turbulence models, initial conditions and boundary conditions are employed to ensure a consistent comparison can be made. The results of the two methods are compared to experimental data as well as to each other. The comparison reveals that the PDF method provides good agreement with the experimental data, while the moment closure scheme incorrectly shows a broad, laminar-like flame structure.

  12. A CFD model for biomass combustion in a packed bed furnace

    Karim, Md. Rezwanul [Faculty of Science, Engineering and Technology, Swinburne University of Technology, VIC 3122 (Australia); Department of Mechanical & Chemical Engineering, Islamic University of Technology, Gazipur 1704 (Bangladesh); Ovi, Ifat Rabbil Qudrat [Department of Mechanical & Chemical Engineering, Islamic University of Technology, Gazipur 1704 (Bangladesh); Naser, Jamal, E-mail: [Faculty of Science, Engineering and Technology, Swinburne University of Technology, VIC 3122 (Australia)


    Climate change has now become an important issue which is affecting environment and people around the world. Global warming is the main reason of climate change which is increasing day by day due to the growing demand of energy in developed countries. Use of renewable energy is now an established technique to decrease the adverse effect of global warming. Biomass is a widely accessible renewable energy source which reduces CO{sub 2} emissions for producing thermal energy or electricity. But the combustion of biomass is complex due its large variations and physical structures. Packed bed or fixed bed combustion is the most common method for the energy conversion of biomass. Experimental investigation of packed bed biomass combustion is difficult as the data collection inside the bed is challenging. CFD simulation of these combustion systems can be helpful to investigate different operational conditions and to evaluate the local values inside the investigation area. Available CFD codes can model the gas phase combustion but it can’t model the solid phase of biomass conversion. In this work, a complete three-dimensional CFD model is presented for numerical investigation of packed bed biomass combustion. The model describes the solid phase along with the interface between solid and gas phase. It also includes the bed shrinkage due to the continuous movement of the bed during solid fuel combustion. Several variables are employed to represent different parameters of solid mass. Packed bed is considered as a porous bed and User Defined Functions (UDFs) platform is used to introduce solid phase user defined variables in the CFD. Modified standard discrete transfer radiation method (DTRM) is applied to model the radiation heat transfer. Preliminary results of gas phase velocity and pressure drop over packed bed have been shown. The model can be useful for investigation of movement of the packed bed during solid fuel combustion.

  13. A CFD model for biomass combustion in a packed bed furnace

    Karim, Md. Rezwanul; Ovi, Ifat Rabbil Qudrat; Naser, Jamal


    Climate change has now become an important issue which is affecting environment and people around the world. Global warming is the main reason of climate change which is increasing day by day due to the growing demand of energy in developed countries. Use of renewable energy is now an established technique to decrease the adverse effect of global warming. Biomass is a widely accessible renewable energy source which reduces CO2 emissions for producing thermal energy or electricity. But the combustion of biomass is complex due its large variations and physical structures. Packed bed or fixed bed combustion is the most common method for the energy conversion of biomass. Experimental investigation of packed bed biomass combustion is difficult as the data collection inside the bed is challenging. CFD simulation of these combustion systems can be helpful to investigate different operational conditions and to evaluate the local values inside the investigation area. Available CFD codes can model the gas phase combustion but it can't model the solid phase of biomass conversion. In this work, a complete three-dimensional CFD model is presented for numerical investigation of packed bed biomass combustion. The model describes the solid phase along with the interface between solid and gas phase. It also includes the bed shrinkage due to the continuous movement of the bed during solid fuel combustion. Several variables are employed to represent different parameters of solid mass. Packed bed is considered as a porous bed and User Defined Functions (UDFs) platform is used to introduce solid phase user defined variables in the CFD. Modified standard discrete transfer radiation method (DTRM) is applied to model the radiation heat transfer. Preliminary results of gas phase velocity and pressure drop over packed bed have been shown. The model can be useful for investigation of movement of the packed bed during solid fuel combustion.

  14. Semi-analytical and 3D CFD DPAL modeling: feasibility of supersonic operation

    Rosenwaks, Salman; Barmashenko, Boris D.; Waichman, Karol


    The feasibility of operating diode pumped alkali lasers (DPALs) with supersonic expansion of the gaseous laser mixture, consisting of alkali atoms, He atoms and (frequently) hydrocarbon molecules, is explored. Taking into account fluid dynamics and kinetic processes, both semi-analytical and three-dimensional (3D) computational fluid dynamics (CFD) modeling of supersonic DPALs is reported. Using the semi-analytical model, the operation of supersonic DPALs is compared with that measured and modeled in subsonic lasers for both Cs and K. The maximum power of supersonic Cs and K lasers is found to be higher than that of subsonic lasers with the same resonator and alkali density at the laser inlet by 25% and 70%, respectively. Using the 3D CFD model, the flow pattern and spatial distributions of the pump and laser intensities in the resonator are calculated for Cs DPALs. Comparison between the semi-analytical and 3D CFD models for Cs shows that the latter predicts much larger maximum achievable laser power than the former. These results indicate that for scaling-up the power of DPALs, supersonic expansion should be considered.

  15. Numerical modelling of pressure suppression pools with CFD and FEM codes

    Paettikangas, T.; Niemi, J.; Timperi, A. (VTT Technical Research Centre of Finland (Finland))


    Experiments on large-break loss-of-coolant accident for BWR is modeled with computational fluid (CFD) dynamics and finite element calculations. In the CFD calculations, the direct-contact condensation in the pressure suppression pool is studied. The heat transfer in the liquid phase is modeled with the Hughes-Duffey correlation based on the surface renewal model. The heat transfer is proportional to the square root of the turbulence kinetic energy. The condensation models are implemented with user-defined functions in the Euler-Euler two-phase model of the Fluent 12.1 CFD code. The rapid collapse of a large steam bubble and the resulting pressure source is studied analytically and numerically. Pressure source obtained from simplified calculations is used for studying the structural effects and FSI in a realistic BWR containment. The collapse results in volume acceleration, which induces pressure loads on the pool walls. In the case of a spherical bubble, the velocity term of the volume acceleration is responsible of the largest pressure load. As the amount of air in the bubble is decreased, the peak pressure increases. However, when the water compressibility is accounted for, the finite speed of sound becomes a limiting factor. (Author)

  16. CFD and Ventilation Research

    Li, Y.; Nielsen, Peter V.


    There has been a rapid growth of scientific literature on the application of computational fluid dynamics (CFD) in the research of ventilation and indoor air science. With a 1000–10,000 times increase in computer hardware capability in the past 20 years, CFD has become an integral part...... of scientific research and engineering development of complex air distribution and ventilation systems in buildings. This review discusses the major and specific challenges of CFD in terms of turbulence modelling, numerical approximation, and boundary conditions relevant to building ventilation. We emphasize...... the growing need for CFD verification and validation, suggest on-going needs for analytical and experimental methods to support the numerical solutions, and discuss the growing capacity of CFD in opening up new research areas. We suggest that CFD has not become a replacement for experiment and theoretical...

  17. Development of Unsteady Aerodynamic State-Space Models from CFD-Based Pulse Responses

    Silva, Walter A.; Raveh, Daniella E.


    A method for computing discrete-time state-space models of linearized unsteady aerodynamic behavior directly from aeroelastic CFD codes is presented. The method involves the treatment of CFD-based pulse responses as Markov parameters for use in a system identification /realization algorithm. Results are presented for the AGARD 445.6 Aeroelastic Wing with four aeroelastic modes at a Mach number of 0.96 using the EZNSS Euler/Navier-Stokes flow solver with aeroelastic capability. The System/Observer/Controller Identification Toolbox (SOCIT) algorithm, based on the Ho-Kalman realization algorithm, is used to generate 15th- and 32nd-order discrete-time state-space models of the unsteady aerodynamic response of the wing over the entire frequency range of interest.

  18. Clearance Analysis and Leakage Flow CFD Model of a Two-Lobe Multi-Recompression Heater

    Ashish M. Joshi


    Full Text Available This paper reports the results of a study on multi-recompression heating. This process employs a Roots-type mechanism to heat gases to very high temperatures by compressive gas heating. A CFD model predicting the leakage flows in the machine was developed, and an excellent comparison with experimental data taken on a two-lobe Roots blower was obtained. A “clearance analysis” was performed to show that the clearance between the impellers remains constant for 96% of the angles of rotation. Assuming a quasi-steady state, the CFD simulation was performed for a single angle of rotation. A three-dimensional analysis showed that the flow field is identical along the rotor length, except for the leakage through the end plates. Hence, the model was further simplified to a two-dimensional analysis. This research may provide guidance in predicting the leakage flows in other blowers of the same kind with a different geometry.

  19. Developing an Accurate CFD Based Gust Model for the Truss Braced Wing Aircraft

    Bartels, Robert E.


    The increased flexibility of long endurance aircraft having high aspect ratio wings necessitates attention to gust response and perhaps the incorporation of gust load alleviation. The design of civil transport aircraft with a strut or truss-braced high aspect ratio wing furthermore requires gust response analysis in the transonic cruise range. This requirement motivates the use of high fidelity nonlinear computational fluid dynamics (CFD) for gust response analysis. This paper presents the development of a CFD based gust model for the truss braced wing aircraft. A sharp-edged gust provides the gust system identification. The result of the system identification is several thousand time steps of instantaneous pressure coefficients over the entire vehicle. This data is filtered and downsampled to provide the snapshot data set from which a reduced order model is developed. A stochastic singular value decomposition algorithm is used to obtain a proper orthogonal decomposition (POD). The POD model is combined with a convolution integral to predict the time varying pressure coefficient distribution due to a novel gust profile. Finally the unsteady surface pressure response of the truss braced wing vehicle to a one-minus-cosine gust, simulated using the reduced order model, is compared with the full CFD.

  20. Modeling and Simulation of Hamburger Cooking Process Using Finite Difference and CFD Methods

    J. Sargolzaei


    Full Text Available Unsteady-state heat transfer in hamburger cooking process was modeled using one dimensional finite difference (FD and three dimensional computational fluid dynamic (CFD models. A double-sided cooking system was designed to study the effect of pressure and oven temperature on the cooking process. Three different oven temperatures (114, 152, 204°C and three different pressures (20, 332, 570 pa were selected and 9 experiments were performed. Applying pressure to hamburger increases the contact area of hamburger with heating plate and hence the heat transfer rate to the hamburger was increased and caused the weight loss due to water evaporation and decreasing cooking time, while increasing oven temperature led to increasing weight loss and decreasing cooking time. CFD predicted results were in good agreement with the experimental results than the finite difference (FD ones. But considering the long time needed for CFD model to simulate the cooking process (about 1 hour, using the finite difference model would be more economic.

  1. Auxiliary ventilation in mining roadways driven with roadheaders: Validated CFD modelling of dust behaviour

    Torano, J.; Torno, S.; Menendez, M.; Gent, M. [University of Oviedo, Asturias (Spain)


    The production of dust when driving mining roadways can affect workers health. In addition, there is a decrease in productivity since Mine Safety regulations establish a reduction in the working time depending on the quartz content and dust concentration in the atmosphere. One of the gate roadways of the longwall named E4-S, belonging to the underground coal mine Carbonar SA located in Northern Spain, is being driven by an AM50 roadheader machine. The mined coal has a high coal dust content. This paper presents a study of dust behaviour in two auxiliary ventilation systems by Computational Fluid Dynamics (CFD) models, taking into account the influence of time. The accuracy of these CFD models was assessed by airflow velocity and respirable dust concentration measurements taken in six points of six roadway cross-sections of the mentioned operating coal mine. It is concluded that these models predicted the airflow and dust behaviour at the working face, where the dust source is located, and in different roadways cross-sections behind the working face. As a result, CFD models allow optimization of the auxiliary ventilation system used, avoiding the important deficiencies when it is calculated by conventional methods.

  2. Validation and Analysis of Forward Osmosis CFD Model in Complex 3D Geometries

    Lars Yde


    Full Text Available In forward osmosis (FO, an osmotic pressure gradient generated across a semi-permeable membrane is used to generate water transport from a dilute feed solution into a concentrated draw solution. This principle has shown great promise in the areas of water purification, wastewater treatment, seawater desalination and power generation. To ease optimization and increase understanding of membrane systems, it is desirable to have a comprehensive model that allows for easy investigation of all the major parameters in the separation process. Here we present experimental validation of a computational fluid dynamics (CFD model developed to simulate FO experiments with asymmetric membranes. Simulations are compared with experimental results obtained from using two distinctly different complex three-dimensional membrane chambers. It is found that the CFD model accurately describes the solute separation process and water permeation through membranes under various flow conditions. It is furthermore demonstrated how the CFD model can be used to optimize membrane geometry in such as way as to promote the mass transfer.

  3. CFD Modeling of Water Flow through Sudden Contraction and Expansion in a Horizontal Pipe

    Kaushik, V. V. R.; Ghosh, S.; Das, G.; Das, P. K.


    This paper deals with the use of commercial CFD software in teaching graduate level computational fluid dynamics. FLUENT 6.3.26 was chosen as the CFD software to teach students the entire CFD process in a single course. The course objective is to help students to learn CFD, use it in some practical problems and analyze as well as validate the…

  4. CFD modeling of heat transfer in a rectangular channel with dimplepin finning

    Spokoiny M. Yu.


    Full Text Available Using the CFD modeling method, the authors have investigated conjugate heat transfer in a rectangular channel with dimple-pin finning with hight of pins, depth of cavities and Reynolds number values varying in the range, characteristic for heat exchangers designed for liquid cooling of microelectronic devices, such as microprocessors. Criterion dependencies for calculation of heat transfer under these conditions have been obtained.

  5. Aspects of Using CFD for Wind Comfort Modeling Around Tall Buildings

    Rasmussen, Michael R.; Andersen, Lars


    The Light*House complex is investigated for uncomfortable wind climate and dangerous winds at pedestrian level. A CFD model is used for simulating the wind effect for 12 different directions and correlated to the wind statistics of a nearby meteorological station. Comparing to practical standards...... for safety and comfort, the results indicates that the building is safe for pedestrians. However, when designing surrounding builds, care shall be taken to avoid interaction between buildings....

  6. A CFD-based wind solver for a fast response transport and dispersion model

    Gowardhan, Akshay A [Los Alamos National Laboratory; Brown, Michael J [Los Alamos National Laboratory; Pardyjak, Eric R [UNIV OF UTAH; Senocak, Inanc [BOISE STATE UNIV


    In many cities, ambient air quality is deteriorating leading to concerns about the health of city inhabitants. In urban areas with narrow streets surrounded by clusters of tall buildings, called street canyons, air pollution from traffic emissions and other sources is difficult to disperse and may accumulate resulting in high pollutant concentrations. For various situations, including the evacuation of populated areas in the event of an accidental or deliberate release of chemical, biological and radiological agents, it is important that models should be developed that produce urban flow fields quickly. For these reasons it has become important to predict the flow field in urban street canyons. Various computational techniques have been used to calculate these flow fields, but these techniques are often computationally intensive. Most fast response models currently in use are at a disadvantage in these cases as they are unable to correlate highly heterogeneous urban structures with the diagnostic parameterizations on which they are based. In this paper, a fast and reasonably accurate computational fluid dynamics (CFD) technique that solves the Navier-Stokes equations for complex urban areas has been developed called QUIC-CFD (Q-CFD). This technique represents an intermediate balance between fast (on the order of minutes for a several block problem) and reasonably accurate solutions. The paper details the solution procedure and validates this model for various simple and complex urban geometries.

  7. A review of Computational Fluid Dynamics (CFD) airflow modelling over aeolian landforms

    Smyth, Thomas A. G.


    Aeolian landforms occur on all earths' continents as well as on Mars, Titan and Venus and are typically formed where sediment is eroded and/or deposited by near surface wind flow. As wind flow approaches an aeolian landform, secondary flow patterns are created that cause wind to deviate in both speed and direction, producing complex patterns of sediment erosion, deposition and transportation. Computational Fluid Dynamics (CFD) modelling of wind flow has become a common tool to predict and understand secondary wind flow and resulting sediment transport. Its use has progressed from simulating wind flow over simple two dimensional dune shapes, to calculating a multitude of flow parameters over a range of increasingly complex landforms. Analysis of 25 peer reviewed journal articles, found that CFD has been crucial to providing additional insight to flow dynamics on the stoss slope of dunes, the structure and nature of wind flow separation in the lee of landforms and information on localised wind flow variations in large-scale dune fields. The findings of this assay demonstrate that further research is required regarding the parameterisation and modelling of surface roughness, the incorporation of accurate sediment transport to wind flow models, and the prediction of topographic surface changes. CFD is anticipated to be increasingly utilised in aeolian geomorphology and this work aims to be a starting point for aeolian geomorphologists wishing to better understand and review the utilisation of the technique to date.

  8. Numerical modelling in building thermo-aeraulics: from CFD modelling to an hybrid finite volume / zonal approach; Modelisation numerique de la thermoaeraulique du batiment: des modeles CFD a une approche hybride volumes finis / zonale

    Bellivier, A.


    For 3D modelling of thermo-aeraulics in building using field codes, it is necessary to reduce the computing time in order to model increasingly larger volumes. The solution suggested in this study is to couple two modelling: a zonal approach and a CFD approach. The first part of the work that was carried out is the setting of a simplified CFD modelling. We propose rules for use of coarse grids, a constant effective viscosity law and adapted coefficients for heat exchange in the framework of building thermo-aeraulics. The second part of this work concerns the creation of fluid Macro-Elements and their coupling with a calculation of CFD finite volume type. Depending on the boundary conditions of the problem, a local description of the driving flow is proposed via the installation and use of semi-empirical evolution laws. The Macro-Elements is then inserted in CFD computation: the values of velocity calculated by the evolution laws are imposed on the CFD cells corresponding to the Macro-Element. We use these two approaches on five cases representative of thermo-aeraulics in buildings. The results are compared with experimental data and with traditional RANS simulations. We highlight the significant gain of time that our approach allows while preserving a good quality of numerical results. (author)

  9. A three-dimensional fully coupled thermo-mechanical model for Self-reacting Friction Stir Welding of Aluminium AA6061 sheets

    Singh, Piyush; Biswas, Pankaj; Kore, Sachin D.


    In the present work a three dimensional model of self-reacting friction stir welding in aluminium alloy AA6061 has been developed based on the Computational Fluid Dynamics (CFD) approach using COMSOL Multiphysics software. The temperature dependent material properties have been incorporated in the model from available literature. A slip-stick contact between the workpiece and tool surface has been considered with the slip factor varying linearly with distance. The methodology adopted has been validated with experimental results available in the literature. The temperature distribution observed has been found to be asymmetric about the weld centre line. The maximum temperature has been observed on the advancing side of the weld. However, the temperature distribution across the thickness has been found to be almost symmetric about the mid thickness plane. An hourglass shaped temperature distribution has been observed across the cross-section of the weld. The material flow velocity distribution shows that the deformation zone is limited to a very small region around the tool.

  10. CFD analysis and flow model reduction for surfactant production in helix reactor

    Nikačević N.M.


    Full Text Available Flow pattern analysis in a spiral Helix reactor is conducted, for the application in the commercial surfactant production. Step change response curves (SCR were obtained from numerical tracer experiments by three-dimensional computational fluid dynamics (CFD simulations. Non-reactive flow is simulated, though viscosity is treated as variable in the direction of flow, as it increases during the reaction. The design and operating parameters (reactor diameter, number of coils and inlet velocity are varied in CFD simulations, in order to examine the effects on the flow pattern. Given that 3D simulations are not practical for fast computations needed for optimization, scale-up and control, CFD flow model is reduced to one-dimensional axial dispersion (AD model with spatially variable dispersion coefficient. Dimensionless dispersion coefficient (Pe is estimated under different conditions and results are analyzed. Finally, correlation which relates Pe number with Reynolds number and number of coils from the reactor entrance is proposed for the particular reactor application and conditions.

  11. Multicompartment/CFD modelling of transport and reaction processes in Couette-Taylor photobioreactor

    Papáček Š.


    Full Text Available A hybrid multicompartment/CFD modelling approach, introduced by Bezzo et al. (2003, describing processes with much faster fluid dynamics time-scale than the reaction rate, is used to characterise microalgal growth in a photobioreactor. Our system of interest, the Couette-Taylor bioreactor (CTBR, is divided into a network of wellmixed compartments. Photosynthetic reactions and other related phenomena are described in each compartment by an ordinary differential equation (ODE. The flow of neutrally-buoyant particles, representing a continuous mass flow of microalgal cells inside CTBR, is simulated by a steady-state computational fluid dynamics (CFD computations. The flow rates between adjacent compartments are derived from several thousand predicted trajectories, post-processed using MATLAB, accordingly to our original method. The resulting governing equations are formed as a system of n_c (total number of compartments ODE’s, which are easier to handle than the large system of equations rising from a reaction phenomena incorporated in CFD models.

  12. Rockslide and Impulse Wave Modelling in the Vajont Reservoir by DEM-CFD Analyses

    Zhao, T.; Utili, S.; Crosta, G. B.


    This paper investigates the generation of hydrodynamic water waves due to rockslides plunging into a water reservoir. Quasi-3D DEM analyses in plane strain by a coupled DEM-CFD code are adopted to simulate the rockslide from its onset to the impact with the still water and the subsequent generation of the wave. The employed numerical tools and upscaling of hydraulic properties allow predicting a physical response in broad agreement with the observations notwithstanding the assumptions and characteristics of the adopted methods. The results obtained by the DEM-CFD coupled approach are compared to those published in the literature and those presented by Crosta et al. (Landslide spreading, impulse waves and modelling of the Vajont rockslide. Rock mechanics, 2014) in a companion paper obtained through an ALE-FEM method. Analyses performed along two cross sections are representative of the limit conditions of the eastern and western slope sectors. The max rockslide average velocity and the water wave velocity reach ca. 22 and 20 m/s, respectively. The maximum computed run up amounts to ca. 120 and 170 m for the eastern and western lobe cross sections, respectively. These values are reasonably similar to those recorded during the event (i.e. ca. 130 and 190 m, respectively). Therefore, the overall study lays out a possible DEM-CFD framework for the modelling of the generation of the hydrodynamic wave due to the impact of a rapid moving rockslide or rock-debris avalanche.

  13. Data-Driven CFD Modeling of Turbulent Flows Through Complex Structures

    Wang, Jian-Xun


    The growth of computational resources in the past decades has expanded the application of Computational Fluid Dynamics (CFD) from the traditional fields of aerodynamics and hydrodynamics to a number of new areas. Examples range from the heat and fluid flows in nuclear reactor vessels and in data centers to the turbulence flows through wind turbine farms and coastal vegetation plants. However, in these new applications complex structures are often exist (e.g., rod bundles in reactor vessels and turbines in wind farms), which makes fully resolved, first-principle based CFD modeling prohibitively expensive. This obstacle seriously impairs the predictive capability of CFD models in these applications. On the other hand, a limited amount of measurement data is often available in the systems in the above-mentioned applications. In this work we propose a data-driven, physics-based approach to perform full field inversion on the effects of the complex structures on the flow. This is achieved by assimilating observati...

  14. CFD Approaches for Modelling Bubble Entrainment by an Impinging Jet

    Martin Schmidtke


    Full Text Available This contribution presents different approaches for the modeling of gas entrainment under water by a plunging jet. Since the generation of bubbles happens on a scale which is smaller than the bubbles, this process cannot be resolved in meso-scale simulations, which include the full length of the jet and its environment. This is why the gas entrainment has to be modeled in meso-scale simulations. In the frame of a Euler-Euler simulation, the local morphology of the phases has to be considered in the drag model. For example, the gas is a continuous phase above the water level but bubbly below the water level. Various drag models are tested and their influence on the gas void fraction below the water level is discussed. The algebraic interface area density (AIAD model applies a drag coefficient for bubbles and a different drag coefficient for the free surface. If the AIAD model is used for the simulation of impinging jets, the gas entrainment depends on the free parameters included in this model. The calculated gas entrainment can be adapted via these parameters. Therefore, an advanced AIAD approach could be used in future for the implementation of models (e.g., correlations for the gas entrainment.

  15. CFD Modeling of Non-Neutral Atmospheric Boundary Layer Conditions

    Koblitz, Tilman

    to the atmospheric boundary-layer, are mostly ignored so far. In order to decrease the uncertainty of wind resource assessment, the present work focuses on atmospheric flows that include atmospheric stability and the Coriolis effect. Within the present work a RANS model framework is developed and implemented......For wind resource assessment, the wind industry is increasingly relying on Computational Fluid Dynamics models that focus on modeling the airflow in a neutrally stratified surface-layer. Physical processes like the Coriolis force, buoyancy forces and heat transport, that are important...

  16. Application Of CFD To Modeling Of Squeeze Mode Magnetorheological Dampers

    Gołdasz Janusz


    Full Text Available The so-called squeeze flow involves a magnetorheological (MR fluid sandwiched between two planar surfaces setting up a flow channel. The height of the channel varies according to a prescribed displacement or force profile. When exposed to a magnetic field of sufficient strength MR fluids develop a yield stress. In squeeze-mode devices the yield stress varies with both the magnetic field magnitude and the channel height. In this paper an unsteady flow model of an MR fluid in squeeze mode is proposed. The model is developed in Ansys Fluent R16. The MR material flow model is based on the apparent viscosity approach. In order to investigate the material's behaviour the authors prepared a model of an idealized squeeze-mode damper in which the fluid flow is enforced by varying the height of the channel. Using mesh animation, the model plate is excited, and as the mesh moves, the fluid is squeezed out of the gap. In the simulations the model is subjected to a range of displacement inputs of frequencies from 10 to 20 Hz, and local yield stress levels up to 30 kPa. The results are presented in the form of time histories of the normal force on the squeezing plate and loops of force vs. displacement (velocity.

  17. A numerical scheme for modelling reacting flow with detailed chemistry and transport.

    Knio, Omar M. (The Johns Hopkins University, Baltimore, MD); Najm, Habib N.; Paul, Phillip H. (Eksigent Technologies LLC, Livermore, CA)


    An efficient projection scheme is developed for the simulation of reacting flow with detailed kinetics and transport. The scheme is based on a zero-Mach-number formulation of the compressible conservation equations for an ideal gas mixture. It is a modified version of the stiff operator-split scheme developed by Knio, Najm & Wyckoff (1999, J. Comput. Phys. 154, 428). Similar to its predecessor, the new scheme relies on Strang splitting of the discrete evolution equations, where diffusion is integrated in two half steps that are symmetrically distributed around a single stiff step for the reaction source terms. The diffusive half-step is integrated using an explicit single-step, multistage, Runge-Kutta-Chebyshev (RKC) method, which replaces the explicit, multi-step, fractional sub-step approach used in the previous formulation. This modification maintains the overall second-order convergence properties of the scheme and enhances the efficiency of the computations by taking advantage of the extended real-stability region of the RKC scheme. Two additional efficiency-enhancements are also explored, based on an extrapolation procedure for the transport coefficients and on the use of approximate Jacobian data evaluated on a coarse mesh. By including these enhancement schemes, performance tests using 2D computations with a detailed C{sub 1}C{sub 2} methane-air mechanism and a detailed mixture-averaged transport model indicate that speedup factors of about 15 are achieved over the previous split-stiff scheme.

  18. CFD modeling of pulsatile hemodynamics in the total cavopulmonary connection

    Zobaer, S. M. Tareq; Hasan, A. B. M. Toufique


    Total cavopulmonary connection is a blood flow pathway which is created surgically by an operation known as Fontan procedure, performed on children with single ventricle heart defects. Recent studies have shown that the hemodynamics in the connection can be strongly influenced by the presence of pulsatile flow. The aim of this paper is model the pulsatile flow patterns, and to calculate the vorticity field and power losses in an idealized 1.5D offset model of Total Cavopulmonary Connection. A three-dimensional polyhedral mesh was constructed for the numerical simulation. The rheological properties of blood were considered as Newtonian, and flow in the connection was assumed to be laminar. The results demonstrated complex flow patterns in the connection. The outcomes of the simulation showed reasonable agreement with the results available in the literature for a similar model.

  19. Detailed CFD Modelling of Open Refrigerated Display Cabinets

    Pedro Dinis Gaspar


    Full Text Available A comprehensive and detailed computational fluid dynamics (CFDs modelling of air flow and heat transfer in an open refrigerated display cabinet (ORDC is performed in this study. The physical-mathematical model considers the flow through the internal ducts, across fans and evaporator, and includes the thermal response of food products. The air humidity effect and thermal radiation heat transfer between surfaces are taken into account. Experimental tests were performed to characterize the phenomena near physical extremities and to validate the numerical predictions of air temperature, relative humidity, and velocity. Numerical and experimental results comparison reveals the predictive capabilities of the computational model for the optimized conception and development of this type of equipments. Numerical predictions are used to propose geometrical and functional parametric studies that improve thermal performance of the ORDC and consequently food safety.

  20. Predicting optimum vortex tube performance using a simplified CFD model

    Karimi-Esfahani, M; Fartaj, A.; Rankin, G.W. [Univ. of Windsor, Dept. of Mechanical, Automotive and Materials Engineering, Windsor, Ontario (Canada)]. E-mail:


    The Ranque-Hilsch tube is a particular type of vortex tube device. The flow enters the device tangentially near one end and exits from the open ends of the tube. The inlet air is of a uniform temperature throughout while the outputs are of different temperatures. One outlet is hotter and the other is colder than the inlet air. This device has no moving parts and does not require any additional power for its operation other than that supplied to the device to compress the inlet air. It has, however, not been widely used, mainly because of its low efficiency. In this paper, a simplified 2-dimensional computational fluid dynamics model for the flow in the vortex tube is developed using FLUENT. This model makes use of the assumption of axial symmetry throughout the entire flow domain. Compared to a three-dimensional computational solution, the simplified model requires significantly less computational time. This is important because the model is to be used for an optimization study. A user-defined function is generated to implement a modified version of the k-epsilon model to account for turbulence. This model is validated by comparing a particular solution with available experimental data. The variation of cold temperature drop and efficiency of the device with orifice diameter, inlet pressure and cold mass flow ratio qualitatively agree with experimental results. Variation of these performance indices with tube length did not agree with the experiments for small values of tube length. However, it did agree qualitatively for large values. (author)

  1. Development of Comprehensive Reduced Kinetic Models for Supersonic Reacting Shear Layer Simulations

    Zambon, A. C.; Chelliah, H. K.; Drummond, J. P.


    Large-scale simulations of multi-dimensional unsteady turbulent reacting flows with detailed chemistry and transport can be computationally extremely intensive even on distributed computing architectures. With the development of suitable reduced chemical kinetic models, the number of scalar variables to be integrated can be decreased, leading to a significant reduction in the computational time required for the simulation with limited loss of accuracy in the results. A general MATLAB-based automated mechanism reduction procedure is presented to reduce any complex starting mechanism (detailed or skeletal) with minimal human intervention. Based on the application of the quasi steady-state (QSS) approximation for certain chemical species and on the elimination of the fast reaction rates in the mechanism, several comprehensive reduced models, capable of handling different fuels such as C2H4, CH4 and H2, have been developed and thoroughly tested for several combustion problems (ignition, propagation and extinction) and physical conditions (reactant compositions, temperatures, and pressures). A key feature of the present reduction procedure is the explicit solution of the concentrations of the QSS species, needed for the evaluation of the elementary reaction rates. In contrast, previous approaches relied on an implicit solution due to the strong coupling between QSS species, requiring computationally expensive inner iterations. A novel algorithm, based on the definition of a QSS species coupling matrix, is presented to (i) introduce appropriate truncations to the QSS algebraic relations and (ii) identify the optimal sequence for the explicit solution of the concentration of the QSS species. With the automatic generation of the relevant source code, the resulting reduced models can be readily implemented into numerical codes.

  2. Comparison of Engineering Wake Models with CFD Simulations

    Andersen, Søren Juhl; Sørensen, Jens Nørkær; Ivanell, S.;


    The engineering wake models by Jensen [1] and Frandsen et al. [2] are assessed for different scenarios simulated using Large Eddy Simulation and the Actuator Line method implemented in the Navier-Stokes equations. The scenarios include the far wake behind a single wind turbine, a long row...... of turbines in an atmospheric boundary layer, idealised cases of an infinitely long row of wind turbines and infinite wind farms with three different spacings. Both models include a wake expansion factor, which is calibrated to fit the simulated wake velocities. The analysis highlights physical deficiencies...

  3. Tip Studies using CFD and Comparison with Tip Loss Models

    Hansen, Martin Otto Laver


    of the averaged axial induction factor and the normal and tangential loads are compared with those of a standard blade element momentum code using 2D calibrated airfoil data for a wind speed of 9 m s(-1), where the agreement in computed power is good. Further, a comparison with a new tip loss model proposed...

  4. Applications of computational fluid dynamics (CFD) in the modelling and design of ventilation systems in the agricultural industry: a review.

    Norton, Tomás; Sun, Da-Wen; Grant, Jim; Fallon, Richard; Dodd, Vincent


    The application of computational fluid dynamics (CFD) in the agricultural industry is becoming ever more important. Over the years, the versatility, accuracy and user-friendliness offered by CFD has led to its increased take-up by the agricultural engineering community. Now CFD is regularly employed to solve environmental problems of greenhouses and animal production facilities. However, due to a combination of increased computer efficacy and advanced numerical techniques, the realism of these simulations has only been enhanced in recent years. This study provides a state-of-the-art review of CFD, its current applications in the design of ventilation systems for agricultural production systems, and the outstanding challenging issues that confront CFD modellers. The current status of greenhouse CFD modelling was found to be at a higher standard than that of animal housing, owing to the incorporation of user-defined routines that simulate crop biological responses as a function of local environmental conditions. Nevertheless, the most recent animal housing simulations have addressed this issue and in turn have become more physically realistic.

  5. The difficult challenge of a two-phase CFD modelling for all flow regimes

    Bestion, D., E-mail:


    Highlights: • The theoretical difficulties for modelling all flow regimes at CFD scale are identified. • The choice of the number of fields and of the time and space averaging or filtering are discussed and clarified. • Closure issues related to an all flow regime CFD model are listed and the main difficulties are identified. - Abstract: System thermalhydraulic codes model all two-phase flow regimes but they are limited to a macroscopic description. Two-phase CFD tools predict two-phase flow with a much finer space resolution but the current modelling capabilities are limited to dispersed bubbly or droplet flow and separate-phase flow. Much less experience exists on more complex flow regimes which combine the existence of dispersed fields with the presence of large interfaces such as a free surface or a film surface. A list of possible reactor issues which might benefit from an “all flow regime CFD model” is given. The first difficulty is to identify the various types of local flow configuration. It is shown that a 4-field model has much better capabilities than a two-fluid approach to identify most complex regimes. Then the choice between time averaging, space averaging, or even ensemble averaging is discussed. It is shown that only the RANS-2-fluid and a space-filtered 4-field model may be reasonably envisaged. The latter has the capabilities to identify all types of interfaces and should be privileged if a good accuracy is expected or if time fluctuations in intermittent flow have to be predicted while the former may be used when a high accuracy is not necessary and if time fluctuations in intermittent flow are not of interest. Finally the closure issue is presented including wall transfers, interfacial transfers, mass transfers between dispersed and continuous fields, and turbulent transfers. An important effort is required to model all interactions between sub-filter phenomena and the transfers from the sub-filter domain to the simulated domain. The

  6. CFD analysis of PWR core top and reactor vessel upper plenum internal subdomain models

    Kao, Min-Tsung; Wu, Chung-Yun [National Tsing Hua University, Hsinchu 30043, Taiwan (China); Chieng, Ching-Chang, E-mail: [National Tsing Hua University, Hsinchu 30043, Taiwan (China); Xu Yiban; Yuan Kun; Dzodzo, Milorad; Conner, Michael; Beltz, Steven; Ray, Sumit; Bissett, Teresa [Westinghouse Electric Company, Cranberry Township, PA 16066 (United States)


    Highlights: > The paper develops a CFD flow model for upper portion of AP1000 and determines how lateral flow in the top core and upper plenum. > Mesh sensitivities and geometrical modification strategies give the guidelines to reduce the size of overall computation mesh. > Pressure drop measurement data act as a guideline for the mesh selection. > Lateral flows are mainly exiting through upper and lower windows of guide tubes ({approx}81%) and 18% flow through small side gaps. > The interactions between guide tubes and neighboring support column as well as flow characteristic are revealed. - Abstract: One aspect of the Westinghouse AP1000{sup TM} reactor design is the reduction in the number of major components and simplification in manufacturing. One design change relative to current Westinghouse reactors of similar size is that AP1000 reactor vessel has two nozzles/hot legs instead of three. With regard to fuel performance, this design difference creates a different flow field in the reactor vessel upper plenum. The flow exiting from the core and entering the upper plenum must turn toward one of the two outlet nozzles and flow laterally around numerous control rod guide tubes and support columns. Also, below the upper plenum are the upper core plate and the top core region of the 157 fuel assemblies and 69 guidetube assemblies. To determine how the lateral flow in the top of the core and upper plenum compares to the current reactors a CFD model of the flow in the upper portion of the AP1000 reactor vessel was created. Before detailed CFD simulations of the flow in the entire upper plenum and top core regions were performed, conducting local simulations for smaller sections of the domain provided crucial and detailed physical aspects of the flow. These sub-domain models were used to perform mesh sensitivities and to assess what geometrical details may be eliminated from the larger model in order to reduce mesh size and computational requirements. In this paper

  7. CFD Modeling of Melt Spreading on the Reactor Cavity Floor

    Yeon, Wan Sik; Bang, Kwang Hyun [Korea Maritime University, Busan (Korea, Republic of); Cho, Young Jo; Lee, Jae Gon [Korea Hydro and Nuclear Power Co., Daejeon (Korea, Republic of)


    In the very unlikely event of a severe reactor accident involving core melt and reactor pressure vessel failure, it is important to provide an accident management strategy that would allow the molten core material to cool down, resolidify and bring the core debris to a stable coolable state for Light Water Reactors (LWRs). One approach to achieve a stable coolable state is to quench the core melt after its relocation from the reactor pressure vessel into the reactor cavity. This approach typically requires a large cavity floor area on which a large amount of core melt spreads well and forms a shallow melt thickness for small thermal resistance across the melt pool. Spreading of high temperature (approx3000 K), low superheat (approx200 K) core melt over a wide cavity floor has been a key question to the success of the ex-vessel core coolability and it has brought a number of experimental work (CORINE, ECOKATS, VULCANO) and analytical work (CORFLOW, MELTSPREAD, THEMA). These computational models are currently able to predict well the spreading of stimulant materials but yet have shown a limitation for prototypic core melt of UO{sub 2}+ZrO{sub 2} mixture. A computational model for the melt spreading requires a multiphase treatment of liquid melt, solidified melt, and air. Also solidification and thermal radiation physics should be included. The present work uses ANSYS-CFX code to simulate core melt spreading on the reactor cavity. The CFX code is a general-purpose multiphase code and the present work is focused on exploring the code's capability to model melt spreading problem in a step by step approach

  8. Multiphase CFD modeling of nearfield fate of sediment plumes

    Saremi, Sina; Hjelmager Jensen, Jacob


    Disposal of dredged material and the overflow discharge during the dredging activities is a matter of concern due to the potential risks imposed by the plumes on surrounding marine environment. This gives rise to accurately prediction of the fate of the sediment plumes released in ambient waters....... The two-phase mixture solution based on the drift-flux method is evaluated for 3D simulation of material disposal and overflow discharge from the hoppers. The model takes into account the hindrance and resistance mechanisms in the mixture and is capable of describing the flow details within the plumes...... and gives excellent results when compared to experimental data....

  9. QM-400 CFD 自然对流模型研究及验证%Research and Validation on CFD Natural Convection Model of QM-400

    左巧林; 干富军; 朱丽兵


    The spent fuel dry storage facility named QM-400 module for Third Qinshan Nuclear Power Co.Ltd.(TQNPC)is the first commercial dry storage facility in opera-tion in China.The heat transfer in QM-400 mainly consists of natural convention,con-duction,conjugate heat transfer and radiation,etc.The decay heat of each fuel basket was calculated accurately at typical surrounding temperature.Mesh sensitivity analysis was performed using commercial computational fluid dynamics (CFD)code FLUENT 14.0. A set of CFD simulation models on natural convection of QM-400 were developed.The results show that the distributions of the pressure and temperature on the cylinder sur-face meet the rules of natural convection.Good agreements are achieved between the simulated temperature and the measured temperature at the measured points and the simulated temperature trend varying with surrounding temperature agree well with the measured trend,which demonstrates the correctness of the calculation method of natural convection in this paper.This work can be the reference of the further CFD simulation on temperature distributions of dry storage facility without thermal insulation panels.%秦山第三核电厂乏燃料干式贮存模块 QM-400是我国第一座投入商业运行的干式贮存设施,模块内的热量交换主要包括自然对流、热传导、耦合传热和辐射换热等。本文精确计算了典型环境温度下每个燃料篮的衰变热,运用商用计算流体动力学(CFD)软件 FLUENT 14.0开展了网格敏感性分析,并建立了 QM-400存储模块的自然对流 CFD 分析模型。结果表明,模块顶面、侧面以及贮存筒表面压力和温度分布符合自然对流规律,计算的测点温度与现场的实测温度符合良好,测点温度随环境温度的变化趋势也与实测趋势符合良好,证明了建立的 CFD 自然对流计算方法的正确性。本文结果为后续采用CFD 方法进行取消绝热板后的温度场计算奠定了基础。

  10. CFD and Ventilation Research

    Li, Y.; Nielsen, Peter V.


    There has been a rapid growth of scientific literature on the application of computational fluid dynamics (CFD) in the research of ventilation and indoor air science. With a 1000–10,000 times increase in computer hardware capability in the past 20 years, CFD has become an integral part of scienti......There has been a rapid growth of scientific literature on the application of computational fluid dynamics (CFD) in the research of ventilation and indoor air science. With a 1000–10,000 times increase in computer hardware capability in the past 20 years, CFD has become an integral part...... of scientific research and engineering development of complex air distribution and ventilation systems in buildings. This review discusses the major and specific challenges of CFD in terms of turbulence modelling, numerical approximation, and boundary conditions relevant to building ventilation. We emphasize...... analysis in ventilation research, rather it has become an increasingly important partner....

  11. CFD modelling of the aerodynamic effect of trees on urban air pollution dispersion.

    Amorim, J H; Rodrigues, V; Tavares, R; Valente, J; Borrego, C


    The current work evaluates the impact of urban trees over the dispersion of carbon monoxide (CO) emitted by road traffic, due to the induced modification of the wind flow characteristics. With this purpose, the standard flow equations with a kε closure for turbulence were extended with the capability to account for the aerodynamic effect of trees over the wind field. Two CFD models were used for testing this numerical approach. Air quality simulations were conducted for two periods of 31h in selected areas of Lisbon and Aveiro, in Portugal, for distinct relative wind directions: approximately 45° and nearly parallel to the main avenue, respectively. The statistical evaluation of modelling performance and uncertainty revealed a significant improvement of results with trees, as shown by the reduction of the NMSE from 0.14 to 0.10 in Lisbon, and from 0.14 to 0.04 in Aveiro, which is independent from the CFD model applied. The consideration of the plant canopy allowed to fulfil the data quality objectives for ambient air quality modelling established by the Directive 2008/50/EC, with an important decrease of the maximum deviation between site measurements and CFD results. In the non-aligned wind situation an average 12% increase of the CO concentrations in the domain was observed as a response to the aerodynamic action of trees over the vertical exchange rates of polluted air with the above roof-level atmosphere; while for the aligned configuration an average 16% decrease was registered due to the enhanced ventilation of the street canyon. These results show that urban air quality can be optimised based on knowledge-based planning of green spaces.


    Leishear, R.


    Research has been completed in a pilot scale, eight foot diameter tank to investigate blending, using a pump with dual opposing jets. The jets re-circulate fluids in the tank to promote blending when fluids are added to the tank. Different jet diameters and different horizontal and vertical orientations of the jets were investigated. In all, eighty five tests were performed both in a tank without internal obstructions and a tank with vertical obstructions similar to a tube bank in a heat exchanger. These obstructions provided scale models of several miles of two inch diameter, serpentine, vertical cooling coils below the liquid surface for a full scale, 1.3 million gallon, liquid radioactive waste storage tank. Two types of tests were performed. One type of test used a tracer fluid, which was homogeneously blended into solution. Data were statistically evaluated to determine blending times for solutions of different density and viscosity, and the blending times were successfully compared to computational fluid dynamics (CFD) models. The other type of test blended solutions of different viscosity. For example, in one test a half tank of water was added to a half tank of a more viscous, concentrated salt solution. In this case, the fluid mechanics of the blending process was noted to significantly change due to stratification of fluids. CFD models for stratification were not investigated. This paper is the fourth in a series of papers resulting from this research (Leishear, [1- 4]), and this paper documents final test results, statistical analysis of the data, a comparison of experimental results to CFD models, and scale-up of the results to a full scale tank.

  13. CFD modeling of particle dispersion and deposition coupled with particle dynamical models in a ventilated room

    Xu, Guangping; Wang, Jiasong


    Two dynamical models, the traditional method of moments coupled model (MCM) and Taylor-series expansion method of moments coupled model (TECM) for particle dispersion distribution and gravitation deposition are developed in three-dimensional ventilated environments. The turbulent airflow field is modeled with the renormalization group (RNG) k-ε turbulence model. The particle number concentration distribution in a ventilated room is obtained by solving the population balance equation coupled with the airflow field. The coupled dynamical models are validated using experimental data. A good agreement between the numerical and experimental results can be achieved. Both models have a similar characteristic for the spatial distribution of particle concentration. Relative to the MCM model, the TECM model presents a more close result to the experimental data. The vortex structure existed in the air flow makes a relative large concentration difference at the center region and results in a spatial non-uniformity of concentration field. With larger inlet velocity, the mixing level of particles in the room is more uniform. In general, the new dynamical models coupled with computational fluid dynamics (CFD) in the current study provide a reasonable and accurate method for the temporal and spatial evolution of particles effected by the deposition and dispersion behaviors. In addition, two ventilation modes with different inlet velocities are proceeded to study the effect on the particle evolution. The results show that with the ceiling ventilation mode (CVM), the particles can be better mixed and the concentration level is also higher. On the contrast, with the side ceiling ventilation mode (SVM), the particle concentration has an obvious stratified distribution with a relative lower level and it makes a much better environment condition to the human exposure.

  14. Modeling of annular two-phase flow using a unified CFD approach

    Li, Haipeng, E-mail:; Anglart, Henryk, E-mail:


    Highlights: • Annular two-phase flow has been modeled using a unified CFD approach. • Liquid film was modeled based on a two-dimensional thin film assumption. • Both Eulerian and Lagrangian methods were employed for the gas core flow modeling. - Abstract: A mechanistic model of annular flow with evaporating liquid film has been developed using computational fluid dynamics (CFD). The model is employing a separate solver with two-dimensional conservation equations to predict propagation of a thin boiling liquid film on solid walls. The liquid film model is coupled to a solver of three-dimensional conservation equations describing the gas core, which is assumed to contain a saturated mixture of vapor and liquid droplets. Both the Eulerian–Eulerian and the Eulerian–Lagrangian approach are used to describe the droplet and vapor motion in the gas core. All the major interaction phenomena between the liquid film and the gas core flow have been accounted for, including the liquid film evaporation as well as the droplet deposition and entrainment. The resultant unified framework for annular flow has been applied to the steam-water flow with conditions typical for a Boiling Water Reactor (BWR). The simulation results for the liquid film flow rate show good agreement with the experimental data, with the potential to predict the dryout occurrence based on criteria of critical film thickness or critical film flow rate.

  15. Modeling Multiphase Chemical Kinetics of OH Radical Reacting with Biomass Burning Organic Aerosol

    Arangio, Andrea; Slade, Jonathan H.; Berkemeier, Thomas; Knopf, Daniel A.; Shiraiwa, Manabu


    Levoglucosan, abietic acid and nitroguaiacol are commonly used as molecular tracers of biomass burning in source apportionment. Recent studies have demonstrated the decay of levoglucosan when the particles were exposed to atmospherically relevant concentration of OH radicals [1-3]. However, multiphase chemical kinetics of OH radical reacting with such compounds has not fully understood. Here we apply the kinetic multi-layer model for gas-particle interactions (KM-GAP) [4] to experimental data of OH exposure to levoglucosan, abietic acid and nitroguaiacol [1]. KM-GAP resolves the following mass transport and chemical reactions explicitly: gas-phase diffusion, reversible surface adsorption, surface reaction, surface-bulk transport, bulk diffusion and reaction. The particle shrink due to the evaporation of volatile reaction products is also considered. The time- and concentration-dependence of reactive uptake coefficient of OH radicals were simulated by KM-GAP. The measured OH uptake coefficients were fitted by a Monte Carlo (MC) filtering coupled with a genetic algorithm (GA) to derive physicochemical parameters such as bulk diffusion coefficient, Henry's law coefficient and desorption lifetime of OH radicals. We assessed the relative contribution of surface and bulk reactions to the overall uptake of OH radicals. Chemical half-life and the evaporation time scale of these compounds are estimated in different scenarios (dry, humid and cloud processing conditions) and at different OH concentrations. REFERENCES [1] J. H. Slade, D. A. Knopf, Phys. Chem. Chem. Phys., 2013, 15, 5898. [2] S. H. Kessler, J. D. Smith, D.L. Che, D.R. Worsnop, K. R. Wilson, J. H. Kroll, Environ. Sci. Technol., 2010, 44, 7005. [3] C. J. Hennigan, A. P. Sullivan, J. L. Collett Jr, A. L. Robinson, Geophys. Res. Lett., 2010, 37, L09806. [4] M. Shiraiwa, C. Pfrang, T. Koop, U. Pöschl, Atmos. Chem. Phys, 2012, 12, 2777.

  16. Bonneville Powerhouse 2 Fish Guidance Efficiency Studies: CFD Model of the Forebay

    Rakowski, Cynthia L.; Serkowski, John A.; Richmond, Marshall C.


    In ongoing work, U.S. Army Corps of Engineers, Portland District (CENWP) is seeking to better understand and improve the conditions within the Bonneville Powerhouse 2 (B2) turbine intakes to improve survival of downstream migrant salmonid smolt. In this study, the existing B2 forebay computational fluid dynamics (CFD) model was modified to include a more detailed representation of all B2 turbine intakes. The modified model was validated to existing field-measured forebay ADCP velocities. The initial CFD model scenarios tested a single project operation and the impact of adding the Behavior Guidance System (BGS) or Corner Collector. These structures had impacts on forebay flows. Most notable was that the addition of the BGS and Corner Collector reduced the lateral extent of the recirculation areas on the Washington shore and Cascade Island and reduced the flow velocity parallel to the powerhouse in front of Units 11 and 12. For these same cases, at the turbine intakes across the powerhouse, there was very little difference in the flow volume into the gatewell for the clean forebay, and the forebay with the BGS in place and/or the Corner Collector operating. The largest differences were at Units 11 to 13. The CFD model cases testing the impact of the gatewell slot fillers showed no impact to the forebay flows, but large differences within the gatewells. With the slot fillers, the flow above the standard traveling screen and into the gatewell increased (about 100 cfs at each turbine intake) and the gap flow decreased across the powerhouse for all cases. The increased flow up the gatewell was further enhanced with only half the units operating. The flow into the gatewell slot was increased about 35 cfs for each bay of each intake across the powerhouse; this change was uniform across the powerhouse. The flows in the gatewell of Unit 12, the most impacted unit for the scenarios, was evaluated. In front of the vertical barrier screen, the CFD model with slot fillers

  17. A two-dimensional CFD model of a refrigerated display case

    Stribling, D.; Tassou, S.A. [Brunel Univ., Uxbridge (United Kingdom). Dept. of Mechanical Engineering; Marriott, D. [Safeway Stores plc, Middlesex (United Kingdom)


    The discomfort caused by the cold air overspill from vertical refrigerated display cases in supermarkets is widely accepted as being a problem to customers. This, together with the adverse effect on case performance caused by heat and moisture transfer across the air curtain, suggests that there may be room for improvement in the design and fundamental operation of these display fixtures. This paper presents a two-dimensional computational fluid dynamics (CFD) model of a vertical dairy display case that could be used in the design and optimization of such equipment. Comparisons are also made with experimentally obtained values of velocity and temperature measured around the case in order to assess the accuracy and viability of such a model. Parameters of the computer model, such as the size of the calculation grid, the turbulence model, and the discretization scheme, were also varied to determine their effect on the converged solution, and these results are presented. The CFD model showed good qualitative agreement with measured values and requires only fine tuning to make it quantitatively accurate.

  18. A comparison of measurements and CFD model predictions for pollutant dispersion in cities.

    Pospisil, J; Katolicky, J; Jicha, M


    An accurate description of car movements in an urban area is required for accurate prediction of the air pollution concentration field. A 3-D Eulerian-Lagrangian approach to moving vehicles that takes into account the traffic-induced flow field and turbulence is presented. The approach is based on Computational Fluid Dynamics (CFD) calculations using Eulerian approach to the continuous phase and Lagrangian approach to the discrete phase of moving objects-vehicles. In the first part of the present contribution, the method is applied to pollutants dispersion in a city tunnel outlet in Brno and to a street structure in Hannover, Germany. In the second part, a model of traffic dynamics inside a street intersection in the centre of Brno is presented. This model accounts for the dynamics of traffic lights and a corresponding traffic-generated flow field and emissions in different time intervals during the traffic light sequence. All results of numerical modelling are compared with field measurements with very good agreement. A commercial CFD code StarCD was used into which the Lagrangian model and traffic dynamics model were integrated.

  19. How to bridge the gap between "unresolved" model and "resolved" model in CFD-DEM coupled method for sediment transport?

    Liu, D.; Fu, X.; Liu, X.


    In nature, granular materials exist widely in water bodies. Understanding the fundamentals of solid-liquid two-phase flow, such as turbulent sediment-laden flow, is of importance for a wide range of applications. A coupling method combining computational fluid dynamics (CFD) and discrete element method (DEM) is now widely used for modeling such flows. In this method, when particles are significantly larger than the CFD cells, the fluid field around each particle should be fully resolved. On the other hand, the "unresolved" model is designed for the situation where particles are significantly smaller than the mesh cells. Using "unresolved" model, large amount of particles can be simulated simultaneously. However, there is a gap between these two situations when the size of DEM particles and CFD cell is in the same order of magnitude. In this work, the most commonly used void fraction models are tested with numerical sedimentation experiments. The range of applicability for each model is presented. Based on this, a new void fraction model, i.e., a modified version of "tri-linear" model, is proposed. Particular attention is paid to the smooth function of void fraction in order to avoid numerical instability. The results show good agreement with the experimental data and analytical solution for both single-particle motion and also group-particle motion, indicating great potential of the new void fraction model.

  20. Validation and analysis of forward osmosis CFD model in complex 3D geometries

    Gruber, Mathias F.; Johnson, Carl J.; Tang, Chuyang


    In forward osmosis (FO), an osmotic pressure gradient generated across a semi-permeable membrane is used to generate water transport from a dilute feed solution into a concentrated draw solution. This principle has shown great promise in the areas of water purification, wastewater treatment...... separation process and water permeation through membranes under various flow conditions. It is furthermore demonstrated how the CFD model can be used to optimize membrane geometry in such as way as to promote the mass transfer. © 2012 by the authors; licensee MDPI, Basel, Switzerland....

  1. A hydrodynamics-reaction kinetics coupled model for evaluating bioreactors derived from CFD simulation.

    Wang, Xu; Ding, Jie; Guo, Wan-Qian; Ren, Nan-Qi


    Investigating how a bioreactor functions is a necessary precursor for successful reactor design and operation. Traditional methods used to investigate flow-field cannot meet this challenge accurately and economically. Hydrodynamics model can solve this problem, but to understand a bioreactor in sufficient depth, it is often insufficient. In this paper, a coupled hydrodynamics-reaction kinetics model was formulated from computational fluid dynamics (CFD) code to simulate a gas-liquid-solid three-phase biotreatment system for the first time. The hydrodynamics model is used to formulate prediction of the flow field and the reaction kinetics model then portrays the reaction conversion process. The coupled model is verified and used to simulate the behavior of an expanded granular sludge bed (EGSB) reactor for biohydrogen production. The flow patterns were visualized and analyzed. The coupled model also demonstrates a qualitative relationship between hydrodynamics and biohydrogen production. The advantages and limitations of applying this coupled model are discussed.

  2. CFD modeling using PDF approach for investigating the flame length in rotary kilns

    Elattar, H. F.; Specht, E.; Fouda, A.; Bin-Mahfouz, Abdullah S.


    Numerical simulations using computational fluid dynamics (CFD) are performed to investigate the flame length characteristics in rotary kilns using probability density function (PDF) approach. A commercial CFD package (ANSYS-Fluent) is employed for this objective. A 2-D axisymmetric model is applied to study the effect of both operating and geometric parameters of rotary kiln on the characteristics of the flame length. Three types of gaseous fuel are used in the present work; methane (CH4), carbon monoxide (CO) and biogas (50 % CH4 + 50 % CO2). Preliminary comparison study of 2-D modeling outputs of free jet flames with available experimental data is carried out to choose and validate the proper turbulence model for the present numerical simulations. The results showed that the excess air number, diameter of kiln air entrance, radiation modeling consideration and fuel type have remarkable effects on the flame length characteristics. Numerical correlations for the rotary kiln flame length are presented in terms of the studied kiln operating and geometric parameters within acceptable error.

  3. CFD modeling using PDF approach for investigating the flame length in rotary kilns

    Elattar, H. F.; Specht, E.; Fouda, A.; Bin-Mahfouz, Abdullah S.


    Numerical simulations using computational fluid dynamics (CFD) are performed to investigate the flame length characteristics in rotary kilns using probability density function (PDF) approach. A commercial CFD package (ANSYS-Fluent) is employed for this objective. A 2-D axisymmetric model is applied to study the effect of both operating and geometric parameters of rotary kiln on the characteristics of the flame length. Three types of gaseous fuel are used in the present work; methane (CH4), carbon monoxide (CO) and biogas (50 % CH4 + 50 % CO2). Preliminary comparison study of 2-D modeling outputs of free jet flames with available experimental data is carried out to choose and validate the proper turbulence model for the present numerical simulations. The results showed that the excess air number, diameter of kiln air entrance, radiation modeling consideration and fuel type have remarkable effects on the flame length characteristics. Numerical correlations for the rotary kiln flame length are presented in terms of the studied kiln operating and geometric parameters within acceptable error.

  4. CFD modelling of buoyancy-driven natural ventilation opposed by wind

    Cook, M.; Ji, Y. [De Montfort Univ., Leceister (United Kingdom). Inst. of Energy and Sustainable Development; Hunt, G. [Imperial College of London, London (United Kingdom). Dept. of Civil and Environmental Engineering


    This study formed the basis for generating guidelines on how to use computational fluid dynamics (CFD) to model natural ventilation in low-energy building designs. Previous studies have investigated steady natural displacement ventilation in a single space driven by buoyancy alone. The simulations used an external flow domain which allowed airflow through inlets and outlets to be modelled without the need for boundary conditions at these locations. CFD methods were used successfully to model buoyancy-driven displacement ventilation in which wind forces oppose the flow. Simulations were then conducted for a wind assisted buoyancy-driven displacement ventilation flow. The use of boundary conditions was the basic differences in the way these simulations were modelled. It was emphasized that the simulations are for natural displacement ventilation in which wind forces oppose buoyancy. Results of analytical predictions and experimental measurements were found to be in good agreement. The small discrepancies in the interface height separating the warm stratified air from the cooler ambient layer below can be attributed to differences in the plume behaviour and performance of the gauze used for inhibiting horizontal momentum. The under-prediction in the reduced gravity of the upper layer may also be due to the small differences in plume structure. 12 refs., 1 tab., 11 figs.

  5. CFD model simulation of dispersion from chlorine railcar releases in industrial and urban areas

    Hanna, Steven R.; Hansen, Olav R.; Ichard, Mathieu; Strimaitis, David

    To assist in emergency response decisions and planning in case of releases of pressurized liquefied chlorine from railroad tank cars in industrial sites and cities, the FLACS Computational Fluid Dynamics (CFD) model has been used to simulate the transport and dispersion of the dense chlorine cloud. Two accident locations are studied: an actual railcar accident at an industrial site in Festus, MO, and a hypothetical railcar accident at a rail junction in the Chicago urban area. The results show that transport of a large dense gas release at ground level in an industrial site or large city could initially extend a hundred meters or more in the upwind and crosswind directions. The dense cloud may follow terrain drainage, such as river channels. Near the source, the obstacles tend to slow down the dense gas cloud and may constrain it and cause increased concentrations. Farther downwind, the obstacles may cause enhanced mixing and dilution once the cloud has grown larger. In some cases, significant amounts of cloud mass may become "trapped" in obstacle wakes for many minutes after the main cloud has passed. Although the CFD model can account for the details of the flow and dispersion much better than standard widely-used simple dense gas models, many similarities are found among the various models in their simulated variations with downwind distance of the maximum cloud centerline concentration.

  6. CFD Modeling of Wall Steam Condensation: Two-Phase Flow Approach versus Homogeneous Flow Approach

    S. Mimouni


    Full Text Available The present work is focused on the condensation heat transfer that plays a dominant role in many accident scenarios postulated to occur in the containment of nuclear reactors. The study compares a general multiphase approach implemented in NEPTUNE_CFD with a homogeneous model, of widespread use for engineering studies, implemented in Code_Saturne. The model implemented in NEPTUNE_CFD assumes that liquid droplets form along the wall within nucleation sites. Vapor condensation on droplets makes them grow. Once the droplet diameter reaches a critical value, gravitational forces compensate surface tension force and then droplets slide over the wall and form a liquid film. This approach allows taking into account simultaneously the mechanical drift between the droplet and the gas, the heat and mass transfer on droplets in the core of the flow and the condensation/evaporation phenomena on the walls. As concern the homogeneous approach, the motion of the liquid film due to the gravitational forces is neglected, as well as the volume occupied by the liquid. Both condensation models and compressible procedures are validated and compared to experimental data provided by the TOSQAN ISP47 experiment (IRSN Saclay. Computational results compare favorably with experimental data, particularly for the Helium and steam volume fractions.

  7. Comparison of CFD and operational dispersion models in an urban-like environment

    Antonioni, G.; Burkhart, S.; Burman, J.; Dejoan, A.; Fusco, A.; Gaasbeek, R.; Gjesdal, T.; Jäppinen, A.; Riikonen, K.; Morra, P.; Parmhed, O.; Santiago, J. L.


    Chemical plants, refineries, transportation of hazardous materials are some of the most attractive facilities for external attacks aimed at the release of toxic substances. Dispersion of these substances into the atmosphere forms a concentration distribution of airborne pollutants with severe consequences for exposed individuals. For emergency preparedness and management, the availability of assessed/validated dispersion models, which can be able to predict concentration distribution and thus dangerous zones for exposed individuals, is of primary importance. Air quality models, integral models and analytical models predict the transport and the turbulent dispersion of gases or aerosols after their release without taking into account in detail the presence of obstacles. Obstacles can modify the velocity field and in turn the concentration field. The Computational Fluid Dynamics (CFD) models on the other hand are able to describe such phenomena, but they need to be correctly set up, tested and validated in order to obtain reliable results. Within the project Europa-ERG1 TA 113.034 "NBC Modelling and Simulation" several different approaches in CFD modelling of turbulent dispersion in closed, semi-confined and urban-like environment were adopted and compared with experimental data and with operational models. In this paper the results of a comparison between models describing the dispersion of a neutral gas in an idealized urban-like environment are presented and discussed. Experimental data available in the literature have been used as a benchmark for assessing statistical performance for each model. Selected experimental trials include some water channel tests, that were performed by Coanda at 1:205 scale, and one full-scale case that was tested in the fall of 2001 at the Dugway Proving Grounds in Utah, using an array of shipping containers. The paper also suggests the adoption of improved statistical parameters in order to better address differences between models

  8. Validation of a loss of vacuum accident (LOVA) Computational Fluid Dynamics (CFD) model

    Bellecci, C.; Gaudio, P. [EURATOM-Faculty of Engineering, University of Rome ' Tor Vergata' Via del Politecnico 1, 00133 Rome (Italy); Lupelli, I., E-mail: [EURATOM-Faculty of Engineering, University of Rome ' Tor Vergata' Via del Politecnico 1, 00133 Rome (Italy); Malizia, A. [EURATOM-Faculty of Engineering, University of Rome ' Tor Vergata' Via del Politecnico 1, 00133 Rome (Italy); Porfiri, M.T. [ENEA Nuclear Fusion Tecnologies, Via Enrico Fermi, 45 I-00044 Frascati (Italy); Quaranta, R.; Richetta, M. [EURATOM-Faculty of Engineering, University of Rome ' Tor Vergata' Via del Politecnico 1, 00133 Rome (Italy)


    Intense thermal loads in fusion devices occur during plasma disruptions, Edge Localized Modes (ELM) and Vertical Displacement Events (VDE). They will result in macroscopic erosion of the plasma facing materials and consequent accumulation of activated dust into the ITER Vacuum Vessel (VV). A recognized safety issue for future fusion reactors fueled with deuterium and tritium is the generation of sizeable quantities of dust. In case of LOVA, air inlet occurs due to the pressure difference between the atmospheric condition and the internal condition. It causes mobilization of the dust that can exit the VV threatening public safety because it may contain tritium, may be radioactive from activation products, and may be chemically reactive and/or toxic (Sharpe et al.; Sharpe and Humrickhouse). Several experiments have been conducted with STARDUST facility in order to reproduce a low pressurization rate (300 Pa/s) LOVA event in ITER due to a small air leakage for two different positions of the leak, at the equatorial port level and at the divertor port level, in order to evaluate the velocity magnitude in case of a LOVA that is strictly connected with dust mobilization phenomena. A two-dimensional (2D) modelling of STARDUST, made with the CFD commercial code FLUENT, has been carried out. The results of these simulations were compared against the experimental data for CFD code validation. For validation purposes, the CFD simulation data were extracted at the same locations as the experimental data were collected. In this paper, the authors present and discuss the computer-simulation data and compare them with data collected during the laboratory studies at the University of Rome 'Tor Vergata' Quantum Electronics and Plasmas lab.

  9. CFD-ACE+: a CAD system for simulation and modeling of MEMS

    Stout, Phillip J.; Yang, H. Q.; Dionne, Paul; Leonard, Andy; Tan, Zhiqiang; Przekwas, Andrzej J.; Krishnan, Anantha


    Computer aided design (CAD) systems are a key to designing and manufacturing MEMS with higher performance/reliability, reduced costs, shorter prototyping cycles and improved time- to-market. One such system is CFD-ACE+MEMS, a modeling and simulation environment for MEMS which includes grid generation, data visualization, graphical problem setup, and coupled fluidic, thermal, mechanical, electrostatic, and magnetic physical models. The fluid model is a 3D multi- block, structured/unstructured/hybrid, pressure-based, implicit Navier-Stokes code with capabilities for multi- component diffusion, multi-species transport, multi-step gas phase chemical reactions, surface reactions, and multi-media conjugate heat transfer. The thermal model solves the total enthalpy from of the energy equation. The energy equation includes unsteady, convective, conductive, species energy, viscous dissipation, work, and radiation terms. The electrostatic model solves Poisson's equation. Both the finite volume method and the boundary element method (BEM) are available for solving Poisson's equation. The BEM method is useful for unbounded problems. The magnetic model solves for the vector magnetic potential from Maxwell's equations including eddy currents but neglecting displacement currents. The mechanical model is a finite element stress/deformation solver which has been coupled to the flow, heat, electrostatic, and magnetic calculations to study flow, thermal electrostatically, and magnetically included deformations of structures. The mechanical or structural model can accommodate elastic and plastic materials, can handle large non-linear displacements, and can model isotropic and anisotropic materials. The thermal- mechanical coupling involves the solution of the steady state Navier equation with thermoelastic deformation. The electrostatic-mechanical coupling is a calculation of the pressure force due to surface charge on the mechanical structure. Results of CFD-ACE+MEMS modeling of MEMS

  10. CFD Recombiner Modelling and Validation on the H2-Par and Kali-H2 Experiments

    Stéphane Mimouni


    Full Text Available A large amount of Hydrogen gas is expected to be released within the dry containment of a pressurized water reactor (PWR, shortly after the hypothetical beginning of a severe accident leading to the melting of the core. According to local gas concentrations, the gaseous mixture of hydrogen, air and steam can reach the flammability limit, threatening the containment integrity. In order to prevent mechanical loads resulting from a possible conflagration of the gas mixture, French and German reactor containments are equipped with passive autocatalytic recombiners (PARs which preventively oxidize hydrogen for concentrations lower than that of the flammability limit. The objective of the paper is to present numerical assessments of the recombiner models implemented in CFD solvers NEPTUNE_CFD and Code_Saturne. Under the EDF/EPRI agreement, CEA has been committed to perform 42 tests of PARs. The experimental program named KALI-H2, consists checking the performance and behaviour of PAR. Unrealistic values for the gas temperature are calculated if the conjugate heat transfer and the wall steam condensation are not taken into account. The combined effects of these models give a good agreement between computational results and experimental data.

  11. CFD Modelling of Biomass Combustion in Small-Scale Boilers. Final Report

    Xue-Song Bai; Griselin, Niklas; Klason, Torbern; Nilsson, Johan [Lund Inst. of Tech. (Sweden). Dept. of Heat and Power Engineering


    This project deals with CFD modeling of combustion of wood in fixed bed boilers. A flamelet model for the interaction between turbulence and chemical reactions is developed and applied to study small-scale boiler. The flamelet chemistry employs 43 reactive species and 174 elementary reactions. It gives detailed distributions of important species such as CO and NO{sub x} in the flow field and flue gas. Simulation of a small-scale wood fired boiler measured at SP Boraas (50 KW) shows that the current flamelet model yields results agreeable to the available experimental data. A detailed chemical kinetic model is developed to study the bed combustion process. This model gives boundary conditions for the CFD analysis of gas phase volatile oxidation in the combustion chambers. The model combines a Functional Group submodel with a Depolymerisation, Vaporisation and Crosslinking submodel. The FG submodel simulates how functional groups decompose and form light gas species. The DVC submodell predicts depolymerisation and vaporisation of the macromolecular network and this includes bridge breaking and crosslinking processes, where the wood structure breaks down to fragments. The light fragments form tar and the heavy ones form metaplast. Two boilers firing wood log/chips are studied using the FG-DVC model, one is the SP Boraas small-scale boiler (50 KW) and the other is the Sydkraft Malmoe Vaerme AB's Flintraennan large-scale boiler (55 MW). The fix bed is assumed to be two zones, a partial equilibrium drying/devolatilisation zone and an equilibrium zone. Three typical biomass conversion modes are simulated, a lean fuel combustion mode, a near-stoichiometric combustion and a fuel rich gasification mode. Detailed chemical species and temperatures at different modes are obtained. Physical interpretation is provided. Comparison of the computational results with experimental data shows that the model can reasonably simulate the fixed bed biomass conversion process. CFD

  12. CFD modeling of a spouted bed with a porous draft tube

    Salar Azizi; Seyyed Hossein Hosseini; M. Moraveji; Goodarz Ahmadi


    Spouted bed with a porous draft tube is used for drying of grains and chemical products and thermal disinfestations process. This work provides a computational fluid dynamics (CFD) simulation of binary mixtures of glass particles in a spouted bed with a porous draft tube. The simulation used the multi-fluid Eulerian-Eulerian approach based on kinetic theory of granular flows, incorporating a kinetic-frictional constitutive model for dense assemblies of particulate solids and Gidaspow's drag model for the inter-action between gas and particles. Influences of solids mass fraction and inlet gas flow rate on pressure distribution, gas and particle velocities were studied. The modeling results were compared with the exper-imental work of Ishikura, Nagashima, and lde (2003) for the flow condition along the axis of the spouted bed. Good agreement between the modeling results and experimental data was observed.

  13. Development of sump model for containment hydrogen distribution calculations using CFD code

    Ravva, Srinivasa Rao, E-mail: [Indian Institute of Technology-Bombay, Mumbai (India); Nuclear Safety Analysis Division, Atomic Energy Regulatory Board, Mumbai (India); Iyer, Kannan N. [Indian Institute of Technology-Bombay, Mumbai (India); Gaikwad, A.J. [Nuclear Safety Analysis Division, Atomic Energy Regulatory Board, Mumbai (India)


    Highlights: • Sump evaporation model was implemented in FLUENT using three different approaches. • Validated the implemented sump evaporation models against TOSQAN facility. • It was found that predictions are in good agreement with the data. • Diffusion based model would be able to predict both condensation and evaporation. - Abstract: Computational Fluid Dynamics (CFD) simulations are necessary for obtaining accurate predictions and local behaviour for carrying out containment hydrogen distribution studies. However, commercially available CFD codes do not have all necessary models for carrying out hydrogen distribution analysis. One such model is sump or suppression pool evaporation model. The water in the sump may evaporate during the accident progression and affect the mixture concentrations in the containment. Hence, it is imperative to study the sump evaporation and its effect. Sump evaporation is modelled using three different approaches in the present work. The first approach deals with the calculation of evaporation flow rate and sump liquid temperature and supplying these quantities through user defined functions as boundary conditions. In this approach, the mean values of the domain are used. In the second approach, the mass, momentum, energy and species sources arise due to the sump evaporation are added to the domain through user defined functions. Cell values adjacent to the sump interface are used in this. Heat transfer between gas and liquid is calculated automatically by the code itself. However, in these two approaches, the evaporation rate was computed using an experimental correlation. In the third approach, the evaporation rate is directly estimated using diffusion approximation. The performance of these three models is compared with the sump behaviour experiment conducted in TOSQAN facility.Classification: K. Thermal hydraulics.


    Bin Wan; Terry A.Ring


    For many processes of industrial significance, due to the strong coupling between particle interactions and fluid dynamics, the population balance must be solved as part of a computational fluid dynamics (CFD) simulation. In this work, a CFD based population balance model is tested using a batch crystallization reactor. In this CFD model, the population balance is solved by the standard method of moments (SMOM) and the quadrature method of moments (QMOM). The results of these simulations are compared to analytical solutions for the population balance in a batch tank where 1) nucleation, 2) growth, 3) aggregation, and 4) breakage are taking place separately. The results of these comparisons show that the first 6 moments of the population balance are accurately predicted for nucleation, growth, aggregation and breakage at all times.

  15. CFD Analysis of a Slug Mixing Experiment Conducted on a VVER-1000 Model

    F. Moretti


    Full Text Available A commercial CFD code was applied, for validation purposes, to the simulation of a slug mixing experiment carried out at OKB “Gidropress” scaled facility in the framework of EC TACIS project R2.02/02: “Development of safety analysis capabilities for VVER-1000 transients involving spatial variations of coolant properties (temperature or boron concentration at core inlet.” Such experimental model reproduces a VVER-1000 nuclear reactor and is aimed at investigating the in-vessel mixing phenomena. The addressed experiment involves the start-up of one of the four reactor coolant pumps (the other three remaining idle, and the presence of a tracer slug on the starting loop, which is thus transported to the reactor pressure vessel where it mixes with the clear water. Such conditions may occur in a boron dilution scenario, hence the relevance of the addressed phenomena for nuclear reactor safety. Both a pretest and a posttest CFD simulations of the mentioned experiment were performed, which differ in the definition of the boundary conditions (based either on nominal quantities or on measured quantities, resp.. The numerical results are qualitatively and quantitatively analyzed and compared against the measured data in terms of space and time tracer distribution at the core inlet. The improvement of the results due to the optimization of the boundary conditions is evidenced, and a quantification of the simulation accuracy is proposed.

  16. Explosion characteristics of methane for CFD modeling and simulation of turbulent gas flow behavior during explosion

    Skřínský, Jan; Vereš, Ján; Peer, Václav; Friedel, Pavel


    The effect of initial concentration on the explosion behavior of a stoichiometric CH4/O2/N2 mixture under air-combustion conditions was studied. Two mathematical models were used with the aim at simulating the gas explosion in the middle scale explosion vessel, and the associated effects of the temperature for different gas/air concentrations. Peak pressure, maximum rate of pressure rise and laminar burning velocity were measured from pressure time records of explosions occurring in a 1 m3 closed cylindrical vessel. The results of the models were validated considering a set of data (pressure time histories and root mean square velocity). The obtained results are relevant to the practice of gas explosion testing and the interpretation of test results and, they should be taken as the input data for CFD simulation to improve the conditions for standard tests.

  17. CFD model of thermal and velocity conditions in a particular indoor environment

    Mora Perez, Miguel; Lopez Patino, Gonzalo; Lopez Jimenez, P. Amparo [Hydraulic and Environmental Engineering Department, Universitat Politecnica de Valencia (Spain); Guillen Guillamon, Ignacio [Applied Physics Department, Universitat Politecnica de Valencia (Spain)


    The demand for maintaining high indoor environmental quality (IEQ) with the minimum energy consumption is rapidly increasing. In the recent years, several studies have been completed to investigate the impact of indoor environment factors on human comfort, health and energy efficiency. Therefore, the design of the thermal environment in any sort of room, specially offices, has huge economic consequences. In this paper, a particular analysis on the air temperature in a multi-task room environment is modeled, in order to represent the velocities and temperatures inside the room by using Computational Fluid Dynamics (CFD) techniques. This model will help to designers to analyze the thermal comfort regions inside the studied air volume and to visualize the whole temperatures inside the room, determining the effect of the fresh external incoming air in the internal air temperature.

  18. Temperature Field-Wind Velocity Field Optimum Control of Greenhouse Environment Based on CFD Model

    Yongbo Li


    Full Text Available The computational fluid dynamics technology is applied as the environmental control model, which can include the greenhouse space. Basic environmental factors are set to be the control objects, the field information is achieved via the division of layers by height, and numerical characteristics of each layer are used to describe the field information. Under the natural ventilation condition, real-time requirements, energy consumption, and distribution difference are selected as index functions. The optimization algorithm of adaptive simulated annealing is used to obtain optimal control outputs. A comparison with full-open ventilation shows that the whole index can be reduced at 44.21% and found that a certain mutual exclusiveness exists between the temperature and velocity field in the optimal course. All the results indicate that the application of CFD model has great advantages to improve the control accuracy of greenhouse.

  19. Finite element model for beef chilling using CFD-generated heat transfer coefficients

    Pham, Q.T. [University of New South Wales, Sydney, NSW 2052 (Australia); Trujillo, F.J. [Food Science Australia, 11 Julius Avenue, North Ryde, NSW 2113 (Australia); McPhail, N. [Food Science Australia, P.O. Box 3312, Tingalpa DC, Brisbane, QLD 4173 (Australia)


    A combined model of the beef chilling process is presented, in which computational fluid dynamics (CFD) was used to estimate the local heat and mass transfer coefficients, assuming uniform surface temperatures, and a set of 2-D finite element grids was used to solve the heat transfer equation in the product, which has an elongated shape. Another set of 1-D grids was used to solve the water transport equation near the surface of the meat. The surface transfer coefficients were calculated for various combinations of air orientations and speeds, and summarised in a set of regression equations. The model was verified by existing and new data on heat load, temperatures, weight loss and surface water activity. (author)

  20. Well-posedness and convergence of cfd two-fluid model for bubbly flows

    Vaidheeswaran, Avinash

    The current research is focused on developing a well-posed multidimensional CFD two-fluid model (TFM) for bubbly flows. Two-phase flows exhibit a wide range of local flow instabilities such as Kelvin-Helmholtz, Rayleigh-Taylor, plume and jet instabilities. They arise due to the density difference and/or the relative velocity between the two phases. A physically correct TFM is essential to model these instabilities. However, this is not the case with the TFMs in numerical codes, which can be shown to have complex eigenvalues due to incompleteness and hence are ill-posed as initial value problems. A common approach to regularize an incomplete TFM is to add artificial physics or numerically by using a coarse grid or first order methods. However, it eliminates the local physical instabilities along with the undesired high frequency oscillations resulting from the ill-posedness. Thus, the TFM loses the capability to predict the inherent local dynamics of the two-phase flow. The alternative approach followed in the current study is to introduce appropriate physical mechanisms that make the TFM well-posed. First a well-posed 1-D TFM for vertical bubbly flows is analyzed with characteristics, and dispersion analysis. When an incomplete TFM is used, it results in high frequency oscillations in the solution. It is demonstrated through the travelling void wave problem that, by adding the missing short wavelength physics to the numerical TFM, this can be removed by making the model well-posed. To extend the limit of well-posedness beyond the well-known TFM of Pauchon and Banerjee [1], the mechanism of collision is considered, and it is shown by characteristics analysis that the TFM then becomes well-posed for all void fractions of practical interest. The aforementioned ideas are then extended to CFD TFM. The travelling void wave problem is again used to demonstrate that by adding appropriate physics, the problem of ill-posedness is resolved. Furthermore, issues pertaining to

  1. Coupling scales for modelling heavy metal vaporization from municipal solid waste incineration in a fluid bed by CFD

    Soria, José, E-mail: [Institute for Research and Development in Process Engineering, Biotechnology and Alternative Energies (PROBIEN, CONICET – UNCo), 1400 Buenos Aires St., 8300 Neuquén (Argentina); Gauthier, Daniel; Flamant, Gilles [Processes, Materials and Solar Energy Laboratory (PROMES-CNRS, UPR 8521), 7 Four Solaire Street, Odeillo, 66120 Font-Romeu (France); Rodriguez, Rosa [Chemical Engineering Institute, National University of San Juan, 1109 Libertador (O) Avenue, 5400 San Juan (Argentina); Mazza, Germán [Institute for Research and Development in Process Engineering, Biotechnology and Alternative Energies (PROBIEN, CONICET – UNCo), 1400 Buenos Aires St., 8300 Neuquén (Argentina)


    Highlights: • A CFD two-scale model is formulated to simulate heavy metal vaporization from waste incineration in fluidized beds. • MSW particle is modelled with the macroscopic particle model. • Influence of bed dynamics on HM vaporization is included. • CFD predicted results agree well with experimental data reported in literature. • This approach may be helpful for fluidized bed reactor modelling purposes. - Abstract: Municipal Solid Waste Incineration (MSWI) in fluidized bed is a very interesting technology mainly due to high combustion efficiency, great flexibility for treating several types of waste fuels and reduction in pollutants emitted with the flue gas. However, there is a great concern with respect to the fate of heavy metals (HM) contained in MSW and their environmental impact. In this study, a coupled two-scale CFD model was developed for MSWI in a bubbling fluidized bed. It presents an original scheme that combines a single particle model and a global fluidized bed model in order to represent the HM vaporization during MSW combustion. Two of the most representative HM (Cd and Pb) with bed temperatures ranging between 923 and 1073 K have been considered. This new approach uses ANSYS FLUENT 14.0 as the modelling platform for the simulations along with a complete set of self-developed user-defined functions (UDFs). The simulation results are compared to the experimental data obtained previously by the research group in a lab-scale fluid bed incinerator. The comparison indicates that the proposed CFD model predicts well the evolution of the HM release for the bed temperatures analyzed. It shows that both bed temperature and bed dynamics have influence on the HM vaporization rate. It can be concluded that CFD is a rigorous tool that provides valuable information about HM vaporization and that the original two-scale simulation scheme adopted allows to better represent the actual particle behavior in a fluid bed incinerator.

  2. CFD modelling of supercritical water flow and heat transfer in a 2 × 2 fuel rod bundle

    Podila, Krishna, E-mail:; Rao, Yanfei, E-mail:


    Highlights: • Bare and wire wrapped 2 × 2 fuel rod bundles were modelled with CFD. • Sensitivity of predictions to SST k–ω, v{sup 2}–f and turbulent Prandtl number was tested. • CFD predictions were assessed with experimentally reported fuel wall temperatures. - Abstract: In the present assessment of the CFD code, two heat transfer experiments using water at supercritical pressures were selected: a 2 × 2 rod bare bundle; and a 2 × 2 rod wire-wrapped bundle. A systematic 3D CFD study of the fluid flow and heat transfer at supercritical pressures for the rod bundle geometries was performed with the key parameter being the fuel rod wall temperature. The sensitivity of the prediction to the steady RANS turbulence models of SST k–ω, v{sup 2}–f and turbulent Prandtl number (Pr{sub t}) was tested to ensure the reliability of the predicted wall temperature obtained for the current analysis. Using the appropriate turbulence model based on the sensitivity analysis, the mesh refinement, or the grid convergence, was performed for the two geometries. Following the above sensitivity analyses and mesh refinements, the recommended CFD model was then assessed against the measurements from the two experiments. It was found that the CFD model adopted in the current work was able to qualitatively capture the trends reported by the experiments but the degree of temperature rise along the heated length was underpredicted. Moreover, the applicability of turbulence models varied case-by-case and the performance evaluation of the turbulence models was primarily based on its ability to predict the experimentally reported fuel wall temperatures. Of the two turbulence models tested, the SST k–ω was found to be better at capturing the measurements at pseudo-critical and supercritical test conditions, whereas the v{sup 2}–f performed better at sub-critical test conditions. Along with the appropriate turbulence model, CFD results were found to be particularly sensitive to

  3. Modelling of massive particulates for breakwater engineering using coupled FEMDEM and CFD


    The seaward slope of many breakwaters consists of thousands of interlocking units of rock or concrete comprising a massive granular system of large elements each weighing tens of tonnes.The dumped quarry materials in the core are protected by progressively coarser particulates.The outer armour layer of freely placed units is intended to both dissipate wave energy and remain structurally stable as strong flows are drawn in and out of the particulate core.Design guidance on the mass and shape of these units is based on empirical equations derived from sealed physical model tests.The main failure mode for armour layers exposed to severe storms is hydraulic instability where the armour units of concrete or rock are subjected to uplift and drag forces which can in turn lead to rocking,displacement and collisions sufficient to cause breakage of units.Recently invented armour unit designs making up such granular layered system owe much of their success to the desirable emergent properties of interlock and porosity and how these combine with individual unit structural strength and inertial mass. Fundamental understanding of the forces governing such wave-structure interaction remains poor.We use discrete element and combined finite-discrete element methods to model the granular solid skeleton of randomly packed units coupled to a CFD code which resolves the wave dynamics through an interface tracking technique.The CFD code exploits several methods including a compressive advection scheme, node movement, and general mesh optimization.We provide the engineering context and report progress towards the numerical modelling of instability in these massive granular systems.

  4. A hybrid CFD-DSMC model designed to simulate rapidly rarefying flow fields and its application to physical vapor deposition

    Gott, Kevin

    This research endeavors to better understand the physical vapor deposition (PVD) vapor transport process by determining the most appropriate fluidic model to design PVD coating manufacturing. An initial analysis was completed based on the calculation of Knudsen number from titanium vapor properties. The results show a dense Navier-Stokes solver best describes flow near the evaporative source, but the material properties suggest expansion into the chamber may result in a strong drop in density and a rarefied flow close to the substrate. A hybrid CFD-DSMC solver is constructed in OpenFOAM for rapidly rarefying flow fields such as PVD vapor transport. The models are patched together combined using a new patching methodology designed to take advantage of the one-way motion of vapor from the CFD region to the DSMC region. Particles do not return to the dense CFD region, therefore the temperature and velocity can be solved independently in each domain. This novel technique allows a hybrid method to be applied to rapidly rarefying PVD flow fields in a stable manner. Parameter studies are performed on a CFD, Navier-Stokes continuum based compressible solver, a Direct Simulation Monte Carlo (DSMC) rarefied particle solver, a collisionless free molecular solver and the hybrid CFD-DSMC solver. The radial momentum at the inlet and radial diffusion characteristics in the flow field are shown to be the most important to achieve an accurate deposition profile. The hybrid model also shows sensitivity to the shape of the CFD region and rarefied regions shows sensitivity to the Knudsen number. The models are also compared to each other and appropriate experimental data to determine which model is most likely to accurately describe PVD coating deposition processes. The Navier-Stokes solvers are expected to yield backflow across the majority of realistic inlet conditions, making their physics unrealistic for PVD flow fields. A DSMC with improved collision model may yield an accurate

  5. Overview 2004 of NASA-Stirling Convertor CFD Model Development and Regenerator R and D Efforts

    Tew, Roy C.; Dyson, Rodger W.; Wilson, Scott D.; Demko, Rikako


    This paper reports on accomplishments in 2004 in (1) development of Stirling-convertor CFD models at NASA Glenn and via a NASA grant, (2) a Stirling regenerator-research effort being conducted via a NASA grant (a follow-on effort to an earlier DOE contract), and (3) a regenerator-microfabrication contract for development of a "next-generation Stirling regenerator." Cleveland State University is the lead organization for all three grant/contractual efforts, with the University of Minnesota and Gedeon Associates as subcontractors. Also, the Stirling Technology Company and Sunpower, Inc. are both involved in all three efforts, either as funded or unfunded participants. International Mezzo Technologies of Baton Rouge, Louisiana is the regenerator fabricator for the regenerator-microfabrication contract. Results of the efforts in these three areas are summarized.

  6. Inviscid and viscous flow modelling of complex aircraft configurations using the CFD simulation system sauna

    Peace, Andrew J.; May, Nicholas E.; Pocock, Mark F.; Shaw, Jonathon A.


    This paper is concerned with the flow modelling capabilities of an advanced CFD simulation system known by the acronym SAUNA. This system is aimed primarily at complex aircraft configurations and possesses a unique grid generation strategy in its use of block-structured, unstructured or hybrid grids, depending on the geometric complexity of the addressed configuration. The main focus of the paper is in demonstrating the recently developed multi-grid, block-structured grid, viscous flow capability of SAUNA, through its evaluation on a number of configurations. Inviscid predictions are also presented, both as a means of interpreting the viscous results and with a view to showing more completely the capabilities of SAUNA. It is shown that accuracy and flexibility are combined in an efficient manner, thus demonstrating the value of SAUNA in aerodynamic design.

  7. Evaluating the catching performance of aerodynamic rain gauges through field comparisons and CFD modelling

    Pollock, Michael; Colli, Matteo; Stagnaro, Mattia; Lanza, Luca; Quinn, Paul; Dutton, Mark; O'Donnell, Greg; Wilkinson, Mark; Black, Andrew; O'Connell, Enda


    Accurate rainfall measurement is a fundamental requirement in a broad range of applications including flood risk and water resource management. The most widely used method of measuring rainfall is the rain gauge, which is often also considered to be the most accurate. In the context of hydrological modelling, measurements from rain gauges are interpolated to produce an areal representation, which forms an important input to drive hydrological models and calibrate rainfall radars. In each stage of this process another layer of uncertainty is introduced. The initial measurement errors are propagated through the chain, compounding the overall uncertainty. This study looks at the fundamental source of error, in the rainfall measurement itself; and specifically addresses the largest of these, the systematic 'wind-induced' error. Snowfall is outside the scope. The shape of a precipitation gauge significantly affects its collection efficiency (CE), with respect to a reference measurement. This is due to the airflow around the gauge, which causes a deflection in the trajectories of the raindrops near the gauge orifice. Computational Fluid-Dynamic (CFD) simulations are used to evaluate the time-averaged airflows realized around the EML ARG100, EML SBS500 and EML Kalyx-RG rain gauges, when impacted by wind. These gauges have a similar aerodynamic profile - a shape comparable to that of a champagne flute - and they are used globally. The funnel diameter of each gauge, respectively, is 252mm, 254mm and 127mm. The SBS500 is used by the UK Met Office and the Scottish Environmental Protection Agency. Terms of comparison are provided by the results obtained for standard rain gauge shapes manufactured by Casella and OTT which, respectively, have a uniform and a tapered cylindrical shape. The simulations were executed for five different wind speeds; 2, 5, 7, 10 and 18 ms-1. Results indicate that aerodynamic gauges have a different impact on the time-averaged airflow patterns

  8. An inter-comparison exercise on the capabilities of CFD models to predict the short and long term distribution and mixing of hydrogen in a garage

    Venetsanos, A.G.; Papanikolaou, E.; Delichatsios, M.; Garcia, J.; Hansen, O.R.; Heitsch, M.; Huser, A.; Jahn, W.; Jordan, T.; Lacome, J.-M.; Ledin, H.S.; Makarov, D.; Middha, P.; Studer, E.; Tchouvelev, A.V.; Teodorczyk, A.; Verbecke, F.; Voort, M.M. van der


    The paper presents the results of the CFD inter-comparison exercise SBEP-V3, performed within the activity InsHyde, internal project of the HySafe network of excellence, in the framework of evaluating the capability of various CFD tools and modelling approaches in predicting the short and long term


    Leishear, R.; Poirier, M.; Lee, S.; Fowley, M.


    This paper documents testing methods, statistical data analysis, and a comparison of experimental results to CFD models for blending of fluids, which were blended using a single pump designed with dual opposing nozzles in an eight foot diameter tank. Overall, this research presents new findings in the field of mixing research. Specifically, blending processes were clearly shown to have random, chaotic effects, where possible causal factors such as turbulence, pump fluctuations, and eddies required future evaluation. CFD models were shown to provide reasonable estimates for the average blending times, but large variations -- or scatter -- occurred for blending times during similar tests. Using this experimental blending time data, the chaotic nature of blending was demonstrated and the variability of blending times with respect to average blending times were shown to increase with system complexity. Prior to this research, the variation in blending times caused discrepancies between CFD models and experiments. This research addressed this discrepancy, and determined statistical correction factors that can be applied to CFD models, and thereby quantified techniques to permit the application of CFD models to complex systems, such as blending. These blending time correction factors for CFD models are comparable to safety factors used in structural design, and compensate variability that cannot be theoretically calculated. To determine these correction factors, research was performed to investigate blending, using a pump with dual opposing jets which re-circulate fluids in the tank to promote blending when fluids are added to the tank. In all, eighty-five tests were performed both in a tank without internal obstructions and a tank with vertical obstructions similar to a tube bank in a heat exchanger. These obstructions provided scale models of vertical cooling coils below the liquid surface for a full scale, liquid radioactive waste storage tank. Also, different jet

  10. Investigation on a gas-liquid ejector using three-dimensional CFD model

    Kang, S. H.; Song, X. G.; Park, Y. C.


    This paper is focusing on the numeral study of a gas-liquid ejector used for ballast water treatment. The gasliquid ejector is investigated through steady three-dimensional multiphase CFD analysis with commercial software ANSYS-CFX 13.0. Water as the primary fluid is driven through the driving nozzle and air is ejected into as the second gas instead of the ozone in real application. Several turbulence models such as Standard k-ɛ model, RNG k-ɛ model, SST model and k-ω model, and different mesh size and compared extensively with the experimental results to eliminate the influence of the auxiliary system, turbulence models and mesh generation. The appropriate numerical model in terms of the best combination of turbulence model and mesh size are used in the subsequent research the study the influence of the operating condition such as the driving pressure/velocity and the back pressure of the ejector on its performance. The results provide deep insight on the influence of various factors on the performance of gas-liquid ejector. And the proposed numerical model will be very helpful in the further design optimization of the gas-liquid ejectors.

  11. Mitigation of turbidity currents in reservoirs with passive retention systems: validation of CFD modeling

    Ferreira, E.; Alves, E.; Ferreira, R. M. L.


    Sediment deposition by continuous turbidity currents may affect eco-environmental river dynamics in natural reservoirs and hinder the maneuverability of bottom discharge gates in dam reservoirs. In recent years, innovative techniques have been proposed to enforce the deposition of turbidity further upstream in the reservoir (and away from the dam), namely, the use of solid and permeable obstacles such as water jet screens , geotextile screens, etc.. The main objective of this study is to validate a computational fluid dynamics (CFD) code applied to the simulation of the interaction between a turbidity current and a passive retention system, designed to induce sediment deposition. To accomplish the proposed objective, laboratory tests were conducted where a simple obstacle configuration was subjected to the passage of currents with different initial sediment concentrations. The experimental data was used to build benchmark cases to validate the 3D CFD software ANSYS-CFX. Sensitivity tests of mesh design, turbulence models and discretization requirements were performed. The validation consisted in comparing experimental and numerical results, involving instantaneous and time-averaged sediment concentrations and velocities. In general, a good agreement between the numerical and the experimental values is achieved when: i) realistic outlet conditions are specified, ii) channel roughness is properly calibrated, iii) two equation k - ɛ models are employed iv) a fine mesh is employed near the bottom boundary. Acknowledgements This study was funded by the Portuguese Foundation for Science and Technology through the project PTDC/ECM/099485/2008. The first author thanks the assistance of Professor Moitinho de Almeida from ICIST and to all members of the project and of the Fluvial Hydraulics group of CEHIDRO.

  12. CFD Modelling of Bore Erosion in Two-Stage Light Gas Guns

    Bogdanoff, D. W.


    A well-validated quasi-one-dimensional computational fluid dynamics (CFD) code for the analysis of the internal ballistics of two-stage light gas guns is modified to explicitly calculate the ablation of steel from the gun bore and the incorporation of the ablated wall material into the hydrogen working cas. The modified code is used to model 45 shots made with the NASA Ames 0.5 inch light gas gun over an extremely wide variety of gun operating conditions. Good agreement is found between the experimental and theoretical piston velocities (maximum errors of +/-2% to +/-6%) and maximum powder pressures (maximum errors of +/-10% with good igniters). Overall, the agreement between the experimental and numerically calculated gun erosion values (within a factor of 2) was judged to be reasonably good, considering the complexity of the processes modelled. Experimental muzzle velocities agree very well (maximum errors of 0.5-0.7 km/sec) with theoretical muzzle velocities calculated with loading of the hydrogen gas with the ablated barrel wall material. Comparison of results for pump tube volumes of 100%, 60% and 40% of an initial benchmark value show that, at the higher muzzle velocities, operation at 40% pump tube volume produces much lower hydrogen loading and gun erosion and substantially lower maximum pressures in the gun. Large muzzle velocity gains (2.4-5.4 km/sec) are predicted upon driving the gun harder (that is, upon using, higher powder loads and/or lower hydrogen fill pressures) when hydrogen loading is neglected; much smaller muzzle velocity gains (1.1-2.2 km/sec) are predicted when hydrogen loading is taken into account. These smaller predicted velocity gains agree well with those achieved in practice. CFD snapshots of the hydrogen mass fraction, density and pressure of the in-bore medium are presented for a very erosive shot.

  13. Large Eddy Simulation of Spatially Developing Turbulent Reacting Shear Layers with the One-Dimensional Turbulence Model

    Hoffie, Andreas Frank

    Large eddy simulation (LES) combined with the one-dimensional turbulence (ODT) model is used to simulate spatially developing turbulent reacting shear layers with high heat release and high Reynolds numbers. The LES-ODT results are compared to results from direct numerical simulations (DNS), for model development and validation purposes. The LES-ODT approach is based on LES solutions for momentum and pressure on a coarse grid and solutions for momentum and reactive scalars on a fine, one-dimensional, but three-dimensionally coupled ODT subgrid, which is embedded into the LES computational domain. Although one-dimensional, all three velocity components are transported along the ODT domain. The low-dimensional spatial and temporal resolution of the subgrid scales describe a new modeling paradigm, referred to as autonomous microstructure evolution (AME) models, which resolve the multiscale nature of turbulence down to the Kolmogorv scales. While this new concept aims to mimic the turbulent cascade and to reduce the number of input parameters, AME enables also regime-independent combustion modeling, capable to simulate multiphysics problems simultaneously. The LES as well as the one-dimensional transport equations are solved using an incompressible, low Mach number approximation, however the effects of heat release are accounted for through variable density computed by the ideal gas equation of state, based on temperature variations. The computations are carried out on a three-dimensional structured mesh, which is stretched in the transverse direction. While the LES momentum equation is integrated with a third-order Runge-Kutta time-integration, the time integration at the ODT level is accomplished with an explicit Forward-Euler method. Spatial finite-difference schemes of third (LES) and first (ODT) order are utilized and a fully consistent fractional-step method at the LES level is used. Turbulence closure at the LES level is achieved by utilizing the Smagorinsky

  14. A CFD model for biomass fast pyrolysis in fluidized-bed reactors

    Xue, Qingluan; Heindel, T. J.; Fox, R. O.


    A numerical study is conducted to evaluate the performance and optimal operating conditions of fluidized-bed reactors for fast pyrolysis of biomass to bio-oil. A comprehensive CFD model, coupling a pyrolysis kinetic model with a detailed hydrodynamics model, is developed. A lumped kinetic model is applied to describe the pyrolysis of biomass particles. Variable particle porosity is used to account for the evolution of particle physical properties. The kinetic scheme includes primary decomposition and secondary cracking of tar. Biomass is composed of reference components: cellulose, hemicellulose, and lignin. Products are categorized into groups: gaseous, tar vapor, and solid char. The particle kinetic processes and their interaction with the reactive gas phase are modeled with a multi-fluid model derived from the kinetic theory of granular flow. The gas, sand and biomass constitute three continuum phases coupled by the interphase source terms. The model is applied to investigate the effect of operating conditions on the tar yield in a fluidized-bed reactor. The influence of various parameters on tar yield, including operating temperature and others are investigated. Predicted optimal conditions for tar yield and scale-up of the reactor are discussed.

  15. Development of a CFD Model for Secondary Final Settling Tanks in Water Pollution Control Plants

    Gong, Minwei; Xanthos, Savvas; Ramalingam, Krish; Fillos, John


    To assess performance and evaluate alternatives to improve efficiency of the New York City the Wards Island Water Pollution Control Plant (WPCP) FSTs at peak loads, a 3D CFD model has been developed. Fluent was utilized as the base platform, where sub-models of the Suspended Solids (SS), settling characteristics, density currents and SS flocculation were incorporated. This was supplemented by field and bench scale experiments to quantify the coefficients integral to the sub-models. Model calibration and validation have been carried out by using the extensive set of data collected. The model can be used to evaluate different modes of operation, alternate hydraulic and solids loading rates, as well as addition of auxiliary components such as baffles to improve process performance. The model is being used to compare potential benefits for different alternatives of design and operation of the existing FSTs. After comparing series of inlet baffles, a baffle with 4 horizontal and 7 vertical slots has been recommended for installation in the FSTs. Additional baffle type, configurations and locations within the tank are also being evaluated to improve the performance of the FSTs especially during periods of poor settling and peak flow conditions.

  16. An assessment of CFD-based wall heat transfer models in piston engines

    Sircar, Arpan [Pennsylvania State Univ., University Park, PA (United States); Paul, Chandan [Pennsylvania State Univ., University Park, PA (United States); Ferreyro-Fernandez, Sebastian [Pennsylvania State Univ., University Park, PA (United States); Imren, Abdurrahman [Pennsylvania State Univ., University Park, PA (United States); Haworth, Daniel C [Pennsylvania State Univ., University Park, PA (United States)


    The lack of accurate submodels for in-cylinder heat transfer has been identified as a key shortcoming in developing truly predictive, physics-based computational fluid dynamics (CFD) models that can be used to develop combustion systems for advanced high-efficiency, low-emissions engines. Only recently have experimental methods become available that enable accurate near-wall measurements to enhance simulation capability via advancing models. Initial results show crank-angle dependent discrepancies with respect to previously used boundary-layer models of up to 100%. However, available experimental data is quite sparse (only few data points on engine walls) and limited (available measurements are those of heat flux only). Predictive submodels are needed for medium-resolution ("engineering") LES and for unsteady Reynolds-averaged simulations (URANS). Recently, some research groups have performed DNS studies on engine-relevant conditions using simple geometries. These provide very useful data for benchmarking wall heat transfer models under such conditions. Further, a number of new and more sophisticated models have also become available in the literature which account for these engine-like conditions. Some of these have been incorporated while others of a more complex nature, which include solving additional partial differential equations (PDEs) within the thin boundary layer near the wall, are underway. These models will then be tested against the available DNS/experimental data in both SI (spark-ignition) and CI (compression-ignition) engines.

  17. Integrating CFD and building simulation

    Bartak, M.; Beausoleil-Morrison, I.; Clarke, J.A.


    Commission, which furthered the CFD modelling aspects of the ESP-r system. The paper summarises the form of the CFD model, describes the method used to integrate the thermal and 3ow domains and reports the outcome from an empirical validation exercise. © 2002 Published by Elsevier Science Ltd....

  18. Mathematical modeling of turbulent reacting plumes - II. Application to the NO-NO/sub 2/-O/sub 3/ system

    Georgopoulos, P.G.; Seinfeld, J.H.


    Calculations performed with the Turbulent Reacting plume model (TPRM) developed in Part I are compared with the experimental data of Builtjes (1981, Netherlands Organization for Applied Scientific Research, Div. of Technology for Soc., Ref. No. 81-013563) for the reaction between NO in a point source plume and ambient O/sub 3/, taking place in a wind tunnel simulating a neutral atmospheric boundary layer. The comparison shows the TRPM capable of quantitatively predicting the retardation imposed on the evolution of nonlinear plume chemistry by incomplete mixing. (authors).

  19. A comparison of contaminant plume statistics from a Gaussian puff and urban CFD model for two large cities

    Pullen, Julie; Boris, Jay P.; Young, Theodore; Patnaik, Gopal; Iselin, John

    This paper quantitatively assesses the spatial extent of modeled contaminated regions resulting from hypothetical airborne agent releases in major urban areas. We compare statistics from a release at several different sites in Washington DC and Chicago using a Gaussian puff model (SCIPUFF, version 1.3, with urban parameter settings) and a building-resolving computational fluid dynamics (CFD) model (FAST3D-CT). For a neutrally buoyant gas source term with urban meteorology, we compare near-surface dosage values within several kilometers of the release during the first half hour, before the gas is dispersed beyond the critical lethal level. In particular, using "fine-grain" point-wise statistics such as fractional bias, spatial correlations and the percentage of points lying within a factor of two, we find that dosage distributions from the Gaussian puff and CFD model share few features in common. Yet the "coarse-grain" statistic that compares areas contained within a given contour level reveals that the differences between the models are less pronounced. Most significant among these distinctions is the rapid lofting, leading to enhanced vertical mixing, and projection downwind of the contaminant by the interaction of the winds with the urban landscape in the CFD model. This model-to-model discrepancy is partially ameliorated by supplying the puff model with more detailed information about the urban boundary layer that evolves on the CFD grid. While improving the correspondence of the models when using the "coarse-grain" statistic, the additional information does not lead to quite as substantial an overall agreement between the models when the "fine-grain" statistics are compared. The taller, denser and more variable building landscape of Chicago created increased sensitivity to release site and led to greater divergence in FAST3D-CT and SCIPUFF results relative to the flatter, sparser and more uniform urban morphology of Washington DC.

  20. Concept of CFD model of natural draft wet-cooling tower flow

    Hyhlík T.


    Full Text Available The article deals with the development of CFD model of natural draft wet-cooling tower flow. The physical phenomena taking place within a natural draft wet cooling tower are described by the system of conservation law equations along with additional equations. The heat and mass transfer in the counterflow wet-cooling tower fill are described by model [1] which is based on the system of ordinary differential equations. Utilization of model [1] of the fill allows us to apply commonly measured fill characteristics as shown by [2].The boundary value problem resulting from the fill model is solved separately. The system of conservation law equations is interlinked with the system of ordinary differential equations describing the phenomena occurring in the counterflow wet-cooling tower fill via heat and mass sources and via boundary conditions. The concept of numerical solution is presented for the quasi one dimensional model of natural draft wet-cooling tower flow. The simulation results are shown.

  1. Modeling and CFD prediction for diffusion and adsorption within room with various adsorption isotherms.

    Murakami, S; Kato, S; Ito, K; Zhu, Q


    This paper presents physical models that are used for analyzing numerically the transportation of volatile organic compounds (VOCs) from building materials in a room. The models are based on fundamental physicochemical principles of their diffusion and adsorption/desorption (hereafter simply sorption) both in building materials and in room air. The performance of the proposed physical models is examined numerically in a test room with a technique supported by computational fluid dynamics (CFD). Two building materials are used in this study. One is a VOC emitting material for which the emission rate is mainly controlled by the internal diffusion of the material. The other is an adsorptive material that has no VOC source. It affects the room air concentration of VOCs with its sorption process. The floor is covered with an emission material made of polypropylene styrene-butadiene rubber (SBR). An adsorbent material made of coal-based activated carbon is spread over the sidewalls. The results of numerical prediction show that the physical models and their numerical simulations explain well the mechanism of the transportation of VOCs in a room.

  2. CFD modelling approaches against single wind turbine wake measurements using RANS

    Stergiannis, N.; Lacor, C.; Beeck, J. V.; Donnelly, R.


    Numerical simulations of two wind turbine generators including the exact geometry of their blades and hub are compared against a simplified actuator disk model (ADM). The wake expansion of the upstream rotor is investigated and compared with measurements. Computational Fluid Dynamics (CFD) simulations have been performed using the open-source platform OpenFOAM [1]. The multiple reference frame (MRF) approach was used to model the inner rotating reference frames in a stationary computational mesh and outer reference frame for the full wind turbine rotor simulations. The standard k — ε and k — ω turbulence closure schemes have been used to solve the steady state, three dimensional Reynolds Averaged Navier- Stokes (RANS) equations. Results of near and far wake regions are compared with wind tunnel measurements along three horizontal lines downstream. The ADM under-predicted the velocity deficit at the wake for both turbulence models. Full wind turbine rotor simulations showed good agreement against the experimental data at the near wake, amplifying the differences between the simplified models.

  3. CFD modelling of an open core downdraft moving bed biomass gasifier; Modelado de un gasificador estratificado de lecho movil de biomasa, utilizando CFD

    Rogel-Ramirez, A [Universidad Nacional Autonoma de Mexico, Mexico, D.F. (Mexico)]. E-mail:


    This paper contains the description of a bidimensional Computational Fluid Dynamics (CFD), model Developer to simulate the flow and reaction in a stratified downdraft biomass gasifier, whereby Eulerian conservation equations are solved for particle and gas phase components, velocities and specific enthalpies. The model is based on the PHOENICS package and represents a tool which can be used in gasifier analysis and design. Contributions of chemical kinetics and the mixing rate using the EBU approach are considered in the gas phase global homogeneous reactions. The harmonic blending of chemical kinetics and mass transfer effects, determine the global heterogeneous reactions between char and O{sub 2}, CO{sub 2} and H{sub 2}O. The turbulence effect in the gas phase is accounted by the standard {kappa}-{epsilon} approach. The model provides information of the producer gas composition, velocities and temperature at the outlet, and allows different operating parameters and feed properties to be changed. Finally, a comparison with experimental data available in literature was done, which showed satisfactory agreement from a qualitative point of view, though further validation is required. [Spanish] Este estudio describe un modelo numerico bidimensional, basado en Dinamica de Fluidos Computacional (CFD), desarrollado para simular el flujo y las reacciones que ocurren en un gasificador estratificado de flujos paralelos, en el que se resuelven ecuaciones de conservacion Eulerianas para los componentes de la fase gaseosa, la fase solida, velocidades y entalpias especificas. El modelo esta basado en el codigo PHOENICS y representa una herramienta que puede ser utilizada en el analisis y diseno de gasificadores. En las reacciones globales homogeneas se consideran las contribuciones de la cinetica quimica y la rapidez de mezclado, usando el modelo Eddy Brake-UP (EBU). La medida harmonica de la cinetica quimica y la transferencia de masa, determinan las velocidades globales de

  4. An integrated approach for wind fields assessment in coastal areas, based on bioindicators, CFD modeling, and observations

    Meneses, Bruno M.; Lopes, António


    Wind-deformed trees can be good bioindicators of the mean wind speed and prevailing wind directions. The current research used bioindicators, computational fluid dynamics (CFD), and linear models to assess the wind fields in the windy coastal area of Cascais/Portugal. The main objectives of this research are to assess mean speed and directions of winds by using bioindicators and modeling techniques and to correlate both results in order to assess the best methods. The results obtained with the bioindicators showed that carpeting, the most severe deformation, was observed near the shoreline showing that the highest wind speeds are felt in this sector. Inland, where the winds have lower mean speeds, flagging forms are more frequent. When correlated with the bioindicators, the linear model gave better results than CFD models. We can conclude that in areas with good wind potential, the use of bioindicators can be a good alternative in the absence of wind data.

  5. Pilot in the Loop CFD Method Development


    of the tail rotor is calculated via simple momentum theory . When the flight simulation is not coupled with the CFD, the airflow impinging on the tail...simple empirical model (Ref 3). In fully coupled simulations, the main rotor downwash component is disabled , so as not “double count” this effect when...model will then be disabled when fully coupled with CFD. This implementation doesn’t require any modification on the CFD code, since the CFD solver was

  6. CFD modeling of liquid-solid fluidization: Effect of drag correlation and added mass force

    Xiao yan Huang


    Computational fluid dynamics (CFD) has been widely used to study the hydrodynamics of gas-solid fluidization; however,its applications in liquid-solid fluidization are relatively rare.In this study,CFD simulations of a liquid-solid fluidized bed are carried out,focusing on the effect of drag correlation and added mass force on the hydrodynamics of liquid-solid fluidization.It is shown that drag correlation has a significant effect on the simulation results and the correlation proposed by Beetstra et al.(2007) gives the best agreement with experimental data.We further show that the added mass force does play an important role in CFD simulation of liquid-solid fluidization,and therefore should not be ignored in CFD simulations.

  7. Accumulation and transport of microbial-size particles in a pressure protected model burn unit: CFD simulations and experimental evidence

    Mimoun Maurice


    Full Text Available Abstract Background Controlling airborne contamination is of major importance in burn units because of the high susceptibility of burned patients to infections and the unique environmental conditions that can accentuate the infection risk. In particular the required elevated temperatures in the patient room can create thermal convection flows which can transport airborne contaminates throughout the unit. In order to estimate this risk and optimize the design of an intensive care room intended to host severely burned patients, we have relied on a computational fluid dynamic methodology (CFD. Methods The study was carried out in 4 steps: i patient room design, ii CFD simulations of patient room design to model air flows throughout the patient room, adjacent anterooms and the corridor, iii construction of a prototype room and subsequent experimental studies to characterize its performance iv qualitative comparison of the tendencies between CFD prediction and experimental results. The Electricité De France (EDF open-source software Code_Saturne® ( was used and CFD simulations were conducted with an hexahedral mesh containing about 300 000 computational cells. The computational domain included the treatment room and two anterooms including equipment, staff and patient. Experiments with inert aerosol particles followed by time-resolved particle counting were conducted in the prototype room for comparison with the CFD observations. Results We found that thermal convection can create contaminated zones near the ceiling of the room, which can subsequently lead to contaminate transfer in adjacent rooms. Experimental confirmation of these phenomena agreed well with CFD predictions and showed that particles greater than one micron (i.e. bacterial or fungal spore sizes can be influenced by these thermally induced flows. When the temperature difference between rooms was 7°C, a significant contamination transfer was observed to

  8. Modeling contrast agent flow in cerebral aneurysms: comparison of CFD with medical imaging

    Rayz, Vitaliy; Vali, Alireza; Sigovan, Monica; Lawton, Michael; Saloner, David; Boussel, Loic


    PURPOSE: The flow in cerebral aneurysms is routinely assessed with X-ray angiography, an imaging technique based on a contrast agent injection. In addition to requiring a patient's catheterization and radiation exposure, the X-ray angiography may inaccurately estimate the flow residence time, as the injection alters the native blood flow patterns. Numerical modeling of the contrast transport based on MRI imaging, provides a non-invasive alternative for the flow diagnostics. METHODS: The flow in 3 cerebral aneurysms was measured in vivo with 4D PC-MRI, which provides time-resolved, 3D velocity field. The measured velocities were used to simulate a contrast agent transport by solving the advection-diffusion equation. In addition, the flow in the same patient-specific geometries was simulated with CFD and the velocities obtained from the Navier-Stokes solution were used to model the transport of a virtual contrast. RESULTS: Contrast filling and washout patterns obtained in simulations based on MRI-measured velocities were in agreement with those obtained using the Navier-Stokes solution. Some discrepancies were observed in comparison to the X-ray angiography data, as numerical modeling of the contrast transport is based on the native blood flow unaffected by the contrast injection. NIH HL115267.

  9. CFD modeling of stripper ash cooler of circulating fluidized bed boiler

    Ravi Inder Singh


    Full Text Available The stable operation of a bottom ash cooler is vital for the operation of the circulating fluidized bed boiler. To assess, the stability of the ash cooler, it is important to have a thorough understanding of the flow behaviour. Although, many experimental results been reported in literature, CFD modelling of the ash cooler has not been carried out. In this paper, the transient computational analysis of a novel stripper ash cooler has been carried out using the Eulerian–Eulerian multiphase approach. The phase coupled SIMPLE algorithm has been used to solve the multiphase equations and the Gidaspow drag model has been employed to model the interaction between the fluidized air and ash. Two cases have been analysed in this paper. In the first case, the filling of the ash in the cooler has been analysed and in the second case, the phenomenon of fluidized bed bubbling in the ash cooler has been simulated. The study the of flow characteristics of hot ash has been studied. The contours of temperature, phase volume and bubbling have been analyzed in this paper.

  10. Airflow and thermal simulation in a controlled test chamber with different heating configurations using CFD modeling

    Candanedo, L.; Karava, P.; Bessoudo, M.; Tzempelikos, A.; Athienitis, A. [Concordia Univ., Montreal, PQ (Canada). Dept. of Building, Civil and Environmental Engineering; Handfield, L. [Inst. de Recherche d' Hydro-Quebec, Shawnigan, PQ (Canada)


    Efficient windows and facades can reduce perimeter heating and energy consumption costs in buildings. In this study, 3-D computational fluid dynamics (CFD) models were developed to model airflow and heat transfer in a controlled test chamber at a Hydro-Quebec laboratory. The aim of the study was to investigate thermofluidic phenomena in the vicinity of windows and facades for rooms heated with baseboard heaters and rooms heated with heated windows. The particle image velocimetry (PIV) technique was employed to study the airflow in a plane close to a window that was heated with either embedded heaters or indirectly with a baseboard heater. The PIV system was synchronized with a data acquisition system which collected temperature data from the 4 walls, ceiling, floor, and each of the 5 windows. Time-averaged values were used for boundaries. Navier-Stokes equations were used to calculate laminar flow and heat transfer. An indoor zero-equation turbulence model was used to characterize indoor airflow. The Rayleigh number was used to categorize the nature of the buoyancy-induced flow. The simulations showed good agreement with experimental data. The largest differences in air speed measurements were found in the cavity formed by the blind and the window glazing. 6 refs., 3 tabs., 11 figs.

  11. CFD Analysis of a Void Distribution Benchmark of the NUPEC PSBT Tests: Model Calibration and Influence of Turbulence Modelling

    E. Krepper


    Full Text Available The paper presents CFD calculations of the void distribution tests of the PSBT benchmark using ANSYS CFX-12.1. First, relevant aspects of the implemented wall boiling model are reviewed highlighting the uncertainties in several model parameters. It is then shown that the measured cross-sectionally averaged values can be reproduced well with a single set of calibrated model parameters for different test cases. For the reproduction of patterns of void distribution cross-sections, attention has to be focussed on the modelling of turbulence in the narrow channel. Only a turbulence model with the capability to resolve turbulent secondary flows is able to reproduce at least qualitatively the observed void distribution patterns.


    San Jose, R.; Perez, J. L.; Gonzalez, R. M.


    Urban metabolism modeling has advanced substantially during the last years due to the increased detail in mesoscale urban parameterization in meteorological mesoscale models and CFD numerical tools. Recently the implementation of the “urban canopy model” (UCM) into the WRF mesoscale meteorological model has produced a substantial advance on the understanding of the urban atmospheric heat flux exchanges in the urban canopy. The need to optimize the use of heat energy in urban environment has produced a substantial increase in the detailed investigation of the urban heat flux exchanges. In this contribution we will show the performance of using a tool called MICROSYS (MICRO scale CFD modelling SYStem) which is an adaptation of the classical urban canopy model but on a high resolution environment by using a classical CFD approach. The energy balance in the urban system can be determined in a micrometeorologicl sense by considering the energy flows in and out of a control volume. For such a control volume reaching from ground to a certain height above buildings, the energy balance equation includes the net radiation, the anthropogenic heat flux, the turbulent sensible heat flux, the turbulent latent heat flux, the net storage change within the control volume, the net advected flux and other sources and sinks. We have applied the MICROSYS model to an area of 5 km x 5 km with 200 m spatial resolution by using the WRF-UCM (adapted and the MICROSYS CFD model. The anthropogenic heat flux has been estimated by using the Flanner M.G. (2009) database and detailed GIS information (50 m resolution) of Madrid city. The Storage energy has been estimated by calculating the energy balance according to the UCM procedure and implementing it into the MICROSYS tool. Results show that MICROSYS can be used as an energy efficient tool to estimate the energy balance of different urban areas and buildings.

  13. A General Nonlinear Fluid Model for Reacting Plasma-Neutral Mixtures

    Meier, E T; Shumlak, U


    A generalized, computationally tractable fluid model for capturing the effects of neutral particles in plasmas is derived. The model derivation begins with Boltzmann equations for singly charged ions, electrons, and a single neutral species. Electron-impact ionization, radiative recombination, and resonant charge exchange reactions are included. Moments of the reaction collision terms are detailed. Moments of the Boltzmann equations for electron, ion, and neutral species are combined to yield a two-component plasma-neutral fluid model. Separate density, momentum, and energy equations, each including reaction transfer terms, are produced for the plasma and neutral equations. The required closures for the plasma-neutral model are discussed.

  14. CFD modelling of longwall goaf gas flow to improve gas capture and prevent goaf self-heating

    REN Ting-xiang


    CFD models have been developed to investigate the Iongwall goaf gas flow pat-terns under different mining and geological control conditions. The Iongwall goaf was treated as porous regions and gas flow was modelled as a momentum sink added to the momentum equation. Gas desorption from the caved goaf and destressed coal seams within the mining disturbed area was modelled as additional mass sources in the continu-ity equation. These CFD models were developed according to specific Iongwall layouts and calibrated against field monitoring data. Two case studies were presented demon-strating the application of CFD modelling of goaf gas flow characteristics for improved goaf gas capture and the reduction of oxygen ingress into the goaf areas for self-heating pre-vention. Results from the case studies indicate that the optimum goaf drainage strategy would be a combination of shallow (near the face) and deep holes to improve the overall drainage efficiency and gas purity. For gassy longwall faces retreating against the seam dip, it is recommended to conduct cross-measure roof hole drainage targeting the fractured zones overlying the return comer, rather than high capacity surface goaf drainage deep in the goaf.

  15. Modeling and simulation of PEM fuel cell's flow channels using CFD techniques

    Cunha, Edgar F.; Andrade, Alexandre B.; Robalinho, Eric; Bejarano, Martha L.M.; Linardi, Marcelo [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mails:;;;;; Cekinski, Efraim [Instituto de Pesquisas Tecnologicas (IPT-SP), Sao Paulo, SP (Brazil)]. E-mail:


    Fuel cells are one of the most important devices to obtain electrical energy from hydrogen. The Proton Exchange Membrane Fuel Cell (PEMFC) consists of two important parts: the Membrane Electrode Assembly (MEA), where the reactions occur, and the flow field plates. The plates have many functions in a fuel cell: distribute reactant gases (hydrogen and air or oxygen), conduct electrical current, remove heat and water from the electrodes and make the cell robust. The cost of the bipolar plates corresponds up to 45% of the total stack costs. The Computational Fluid Dynamic (CFD) is a very useful tool to simulate hydrogen and oxygen gases flow channels, to reduce the costs of bipolar plates production and to optimize mass transport. Two types of flow channels were studied. The first type was a commercial plate by ELECTROCELL and the other was entirely projected at Programa de Celula a Combustivel (IPEN/CNEN-SP) and the experimental data were compared with modelling results. Optimum values for each set of variables were obtained and the models verification was carried out in order to show the feasibility of this technique to improve fuel cell efficiency. (author)

  16. A study on the dependency between turbulent models and mesh configurations of CFD codes

    Bang, Jungjin; Heo, Yujin; Jerng, Dong-Wook [CAU, Seoul (Korea, Republic of)


    This paper focuses on the analysis of the behavior of hydrogen mixing and hydrogen stratification, using the GOTHIC code and the CFD code. Specifically, we examined the mesh sensitivity and how the turbulence model affects hydrogen stratification or hydrogen mixing, depending on the mesh configuration. In this work, sensitivity analyses for the meshes and the turbulence models were conducted for missing and stratification phenomena. During severe accidents in a nuclear power plants, the generation of hydrogen may occur and this will complicate the atmospheric condition of the containment by causing stratification of air, steam, and hydrogen. This could significantly impact containment integrity analyses, as hydrogen could be accumulated in local region. From this need arises the importance of research about stratification of gases in the containment. Two computation fluid dynamics code, i.e. GOTHIC and STAR-CCM+ were adopted and the computational results were benchmarked against the experimental data from PANDA facility. The main findings observed through the present work can be summarized as follows: 1) In the case of the GOTHIC code, it was observed that the aspect ratio of the mesh was found more important than the mesh size. Also, if the number of the mesh is over 3,000, the effects of the turbulence models were marginal. 2) For STAR-CCM+, the tendency is quite different from the GOTHIC code. That is, the effects of the turbulence models were small for fewer number of the mesh, however, as the number of mesh increases, the effects of the turbulence models becomes significant. Another observation is that away from the injection orifice, the role of the turbulence models tended to be important due to the nature of mixing process and inducted jet stream.

  17. Modelling NOX concentrations through CFD-RANS in an urban hot-spot using high resolution traffic emissions and meteorology from a mesoscale model

    Sanchez, Beatriz; Santiago, Jose Luis; Martilli, Alberto; Martin, Fernando; Borge, Rafael; Quaassdorff, Christina; de la Paz, David


    Air quality management requires more detailed studies about air pollution at urban and local scale over long periods of time. This work focuses on obtaining the spatial distribution of NOx concentration averaged over several days in a heavily trafficked urban area in Madrid (Spain) using a computational fluid dynamics (CFD) model. A methodology based on weighted average of CFD simulations is applied computing the time evolution of NOx dispersion as a sequence of steady-state scenarios taking into account the actual atmospheric conditions. The inputs of emissions are estimated from the traffic emission model and the meteorological information used is derived from a mesoscale model. Finally, the computed concentration map correlates well with 72 passive samplers deployed in the research area. This work reveals the potential of using urban mesoscale simulations together with detailed traffic emissions so as to provide accurate maps of pollutant concentration at microscale using CFD simulations.

  18. Development of a flocculation sub-model for a 3-D CFD model based on rectangular settling tanks.

    Gong, M; Xanthos, S; Ramalingam, K; Fillos, J; Beckmann, K; Deur, A; McCorquodale, J A


    To assess performance and evaluate alternatives to improve the efficiency of rectangular Gould II type final settling tanks (FSTs), New York City Department of Environmental Protection and City College of NY developed a 3D computer model depicting the actual structural configuration of the tanks and the current and proposed hydraulic and solids loading rates. Fluent 6.3.26™ was the base platform for the computational fluid dynamics (CFD) model, for which sub-models of the SS settling characteristics, turbulence, flocculation and rheology were incorporated. This was supplemented by field and bench scale experiments to quantify the coefficients integral to the sub-models. The 3D model developed can be used to consider different baffle arrangements, sludge withdrawal mechanisms and loading alternatives to the FSTs. Flocculation in the front half of the rectangular tank especially in the region before and after the inlet baffle is one of the vital parameters that influences the capture efficiency of SS. Flocculation could be further improved by capturing medium and small size particles by creating an additional zone with an in-tank baffle. This was one of the methods that was adopted in optimizing the performance of the tank where the CCNY 3D CFD model was used to locate the in-tank baffle position. This paper describes the development of the flocculation sub-model and the relationship of the flocculation coefficients in the known Parker equation to the initial mixed liquor suspended solids (MLSS) concentration X0. A new modified equation is proposed removing the dependency of the breakup coefficient to the initial value of X0 based on preliminary data using normal and low concentration mixed liquor suspended solids values in flocculation experiments performed.

  19. CFD Study of NOx Emissions in a Model Commercial Aircraft Engine Combustor

    ZHANG Man; FU Zhenbo; LIN Yuzhen; LI Jibao


    Air worthiness requirements of the aircraft engine emission bring new challenges to the combustor research and design.With the motivation to design high performance and clean combustor,computational fluid dynamics (CFD) is utilized as the powerful design approach.In this paper,Reynolds averaged Navier-Stokes (RANS) equations of reactive two-phase flow in an experimental low emission combustor is performed.The numerical approach uses an implicit compressible gas solver together with a Lagrangian liquid-phase tracking method and the extended coherent flamelet model for turbulence-combustion interaction.The NOx formation is modeled by the concept of post-processing,which resolves the NOx transport equation with the assumption of frozen temperature distribution.Both turbulence-combustion interaction model and NOx formation model are firstly evaluated by the comparison of experimental data published in open literature of a lean direct injection (LDI) combustor.The test rig studied in this paper is called low emission stirred swirl (LESS) combustor,which is a two-stage model combustor,fueled with liquid kerosene (RP-3) and designed by Beihang University (BUAA).The main stage of LESS combustor employs the principle of lean prevaporized and premixed (LPP) concept to reduce pollutant,and the pilot stage depends on a diffusion flame for flame stabilization.Detailed numerical results including species distribution,turbulence performance and burning performance are qualitatively and quantitatively evaluated.Numerical prediction of NOx emission shows a good agreement with test data at both idle condition and full power condition of LESS combustor.Preliminary results of the flame structure are shown in this paper.The flame stabilization mechanism and NOx reduction effort are also discussed with in-depth analysis.

  20. Investigation of mucus transport in an idealized lung airway model using multiphase CFD analysis

    Rajendran, Rahul; Banerjee, Arindam


    Mucus, a Bingham fluid is transported in the pulmonary airways by consistent beating of the cilia and exhibits a wide range of physical properties in response to the core air flow and various pathological conditions. A better understanding of the interfacial instability is required as it plays a crucial role in gas transport, mixing, mucus clearance and drug delivery. In the current study, mucus is modelled as a Newtonian fluid and the two phase gas-liquid flow in the airways is investigated using an inhomogeneous Eulerian-Eulerian approach. The complex interface between the phases is tracked using the conventional VOF (Volume of Fluid) method. Results from our CFD simulations which are performed in idealized single and double bifurcation geometries will be presented and the influence of airflow rate, mucus layer thickness, mucus viscosity, airway geometry (branching & diameter) and surface tension on mucus flow behavior will be discussed. Mean mucus layer thickness, pressure drop due to momentum transfer & increased airway resistance, mucus transport speed and the flow morphology will be compared to existing experimental and theoretical data.

  1. Modern multicore and manycore architectures: Modelling, optimisation and benchmarking a multiblock CFD code

    Hadade, Ioan; di Mare, Luca


    Modern multicore and manycore processors exhibit multiple levels of parallelism through a wide range of architectural features such as SIMD for data parallel execution or threads for core parallelism. The exploitation of multi-level parallelism is therefore crucial for achieving superior performance on current and future processors. This paper presents the performance tuning of a multiblock CFD solver on Intel SandyBridge and Haswell multicore CPUs and the Intel Xeon Phi Knights Corner coprocessor. Code optimisations have been applied on two computational kernels exhibiting different computational patterns: the update of flow variables and the evaluation of the Roe numerical fluxes. We discuss at great length the code transformations required for achieving efficient SIMD computations for both kernels across the selected devices including SIMD shuffles and transpositions for flux stencil computations and global memory transformations. Core parallelism is expressed through threading based on a number of domain decomposition techniques together with optimisations pertaining to alleviating NUMA effects found in multi-socket compute nodes. Results are correlated with the Roofline performance model in order to assert their efficiency for each distinct architecture. We report significant speedups for single thread execution across both kernels: 2-5X on the multicore CPUs and 14-23X on the Xeon Phi coprocessor. Computations at full node and chip concurrency deliver a factor of three speedup on the multicore processors and up to 24X on the Xeon Phi manycore coprocessor.

  2. "A Context-Adaptive Model for Program Evaluation": A Reader Reacts.

    Meinke, Mark W.


    Discusses a model of English-as-a-Second-Language (ESL) program evaluation and suggests ESL professionals begin to see themselves within the wider context of training and development and begin applying useful disciplines of the business world to their activities. (four references) (JL)

  3. Improvement of AEP Predictions Using Diurnal CFD Modelling with Site-Specific Stability Weightings Provided from Mesoscale Simulation

    Hristov, Y.; Oxley, G.; Žagar, M.


    The Bolund measurement campaign, performed by Danish Technical University (DTU) Wind Energy Department (also known as RISØ), provided significant insight into wind flow modeling over complex terrain. In the blind comparison study several modelling solutions were submitted with the vast majority being steady-state Computational Fluid Dynamics (CFD) approaches with two equation k-epsilon turbulence closure. This approach yielded the most accurate results, and was identified as the state-of-the-art tool for wind turbine generator (WTG) micro-siting. Based on the findings from Bolund, further comparison between CFD and field measurement data has been deemed essential in order to improve simulation accuracy for turbine load and long-term Annual Energy Production (AEP) estimations. Vestas Wind Systems A/S is a major WTG original equipment manufacturer (OEM) with an installed base of over 60GW in over 70 countries accounting for 19% of the global installed base. The Vestas Performance and Diagnostic Centre (VPDC) provides online live data to more than 47GW of these turbines allowing a comprehensive comparison between modelled and real-world energy production data. In previous studies, multiple sites have been simulated with a steady neutral CFD formulation for the atmospheric surface layer (ASL), and wind resource (RSF) files have been generated as a base for long-term AEP predictions showing significant improvement over predictions performed with the industry standard linear WAsP tool. In this study, further improvements to the wind resource file generation with CFD are examined using an unsteady diurnal cycle approach with a full atmospheric boundary layer (ABL) formulation, with the unique stratifications throughout the cycle weighted according to mesoscale simulated sectorwise stability frequencies.

  4. A validated CFD model to predict O₂ and CO₂ transfer within hollow fiber membrane oxygenators.

    Hormes, Marcus; Borchardt, Ralf; Mager, Ilona; Rode, Thomas Schmitz; Behr, Marek; Steinseifer, Ulrich


    Hollow fiber oxygenators provide gas exchange to and from the blood during heart surgery or lung recovery. Minimal fiber surface area and optimal gas exchange rate may be achieved by optimization of hollow fiber shape and orientation (1). In this study, a modified CFD model is developed and validated with a specially developed micro membrane oxygenator (MicroMox). The MicroMox was designed in such a way that fiber arrangement and bundle geometry are highly reproducible and potential flow channeling is avoided, which is important for the validation. Its small size (V(Fluid)=0.04 mL) allows the simulation of the entire bundle of 120 fibers. A non-Newtonian blood model was used as simulation fluid. Physical solubility and chemical bond of O₂ and CO₂ in blood was represented by the numerical model. Constant oxygen partial pressure at the pores of the fibers and a steady state flow field was used to calculate the mass transport. In order to resolve the entire MicroMox fiber bundle, the mass transport was simulated for symmetric geometry sections in flow direction. In vitro validation was achieved by measurements of the gas transfer rates of the MicroMox. All measurements were performed according to DIN EN 12022 (2) using porcine blood. The numerical simulation of the mass transfer showed good agreement with the experimental data for different mass flows and constant inlet partial pressures. Good agreement could be achieved for two different fiber configurations. Thus, it was possible to establish a validated model for the prediction of gas exchange in hollow fiber oxygenators.

  5. Combustion characteristics and turbulence modeling of swirling reacting flow in solid fuel ramjet

    Musa, Omer; Xiong, Chen; Changsheng, Zhou


    This paper reviews the historical studies have been done on the solid-fuel ramjet engine and difficulties associated with numerical modeling of swirling flow with combustible gases. A literature survey about works related to numerical and experimental investigations on solid-fuel ramjet as well as using swirling flow and different numerical approaches has been provided. An overview of turbulence modeling of swirling flow and the behavior of turbulence at streamline curvature and system rotation are presented. A new and simple curvature/correction factor is proposed in order to reduce the programming complexity of SST-CC turbulence model. Finally, numerical and experimental investigations on the impact of swirling flow on SFRJ have been carried out. For that regard, a multi-physics coupling code is developed to solve the problems of multi-physics coupling of fluid mechanics, solid pyrolysis, heat transfer, thermodynamics, and chemical kinetics. The connected-pipe test facility is used to carry out the experiments. The results showed a positive impact of swirling flow on SFRJ along with, three correlations are proposed.

  6. Multi-scale Model Coupling for CFD Simulations of Discharge Dispersion in the Sea

    Robinson, D.; Wood, M.; Piggott, M. D.; Gorman, G.


    The processes that influence the dispersion of effluent discharges in the sea occur over a wide range of length and time scales. The distance that effluent can travel before it is considered mixed can be several kilometres, whereas the turbulent eddies that affect the near-field mixing of a discharge can be as small as a few centimetres. The range of scales that are involved mean that it is not generally practical to include all influencing physical phenomena within one model. Typically, the modelling of effluent dispersion is performed using two separate numerical models: a local model of the outlet(s), including the near-field effects of momentum, buoyancy and turbulence; and a larger scale model that can include the far-field effects of tidal-, wind- and wave-driven-currents, water depth variations, atmospheric fluxes, and Coriolis forces. The boundary between the two models is often not strictly defined, but is usually placed at the transition from where the behaviour of the effluent is dominated by the ambient environment, rather than the discharge characteristics and outfall configuration. In most real applications, this transition line varies considerably in time and space. This paper presents the findings of collaborative research between the Applied Modelling and Computation Group (AMCG) at Imperial College London, UK, and HR Wallingford Ltd. Results are presented using a range of coupling methods to link the near- and far-field mixing regions. An idealised domain and tidal conditions are used, with the outfall and ambient conditions typical of those found at small coastal desalination plants. Open-source CFD code Fluidity is used for both the near-field and far-field modelling. Fluidity scales well when run in parallel on large numbers of cores. It also has an anisotropic adaptive mesh capability which allows local control over solution accuracy throughout the domain. This combination means that accuracy can be achieved without excessive time costs, with


    Lee, S.; Garrett, A.; Bollinger, J.


    Mechanical draft cooling towers are designed to cool process water via sensible and latent heat transfer to air. Heat and mass transfer take place simultaneously. Heat is transferred as sensible heat due to the temperature difference between liquid and gas phases, and as the latent heat of the water as it evaporates. Mass of water vapor is transferred due to the difference between the vapor pressure at the air-liquid interface and the partial pressure of water vapor in the bulk of the air. Equations to govern these phenomena are discussed here. The governing equations are solved by taking a computational fluid dynamics (CFD) approach. The purpose of the work is to develop a three-dimensional CFD model to evaluate the flow patterns inside the cooling tower cell driven by cooling fan and wind, considering the cooling fans to be on or off. Two types of the cooling towers are considered here. One is cross-flow type cooling tower located in A-Area, and the other is counterflow type cooling tower located in H-Area. The cooling tower located in A-Area is mechanical draft cooling tower (MDCT) consisting of four compartment cells as shown in Fig. 1. It is 13.7m wide, 36.8m long, and 9.4m high. Each cell has its own cooling fan and shroud without any flow communications between two adjacent cells. There are water distribution decks on both sides of the fan shroud. The deck floor has an array of about 25mm size holes through which water droplet falls into the cell region cooled by the ambient air driven by fan and wind, and it is eventually collected in basin area. As shown in Fig. 1, about 0.15-m thick drift eliminator allows ambient air to be humidified through the evaporative cooling process without entrainment of water droplets into the shroud exit. The H-Area cooling tower is about 7.3 m wide, 29.3 m long, and 9.0 m high. Each cell has its own cooling fan and shroud, but each of two corner cells has two panels to shield wind at the bottom of the cells. There is some

  8. An evaluation of mathematical models of the transport of biologically reacting solutes in saturated soils and aquifers

    Baveye, Philippe; Valocchi, Albert


    Three different conceptual frameworks have been adopted in the past for the development of mathematical models of bacterial growth and biologically reacting solute transport in saturated porous media. Two schools of thought are based upon assuming that the pore scale geometrical configuration of the attached bacteria consists of biofilms or microcolonies; the third school of thought represents the traditional approach where pore scale processes are neglected and the bacteria are assumed to respond to the macroscopic bulk fluid substrate concentration. On the basis of a schematic block diagram representation of a saturated porous medium hosting a microbial population, it is shown that these frameworks share a common theoretical foundation, and that they differ only by the choice of particular constitutive equations for several transfer parameters. Using one possible option in this respect, we derive a mathematical model that involves no unwarranted assumption about the distribution of the microorganisms in the pore space. The governing equations of this latter model are shown to be formally identical to those obtained by F.J. Molz et al. (1986), using the concept of microcolony, and to those that would result from adopting a simple form of biofilm model to describe bacterial growth in the pore space. Some of the consequences of this formal similarity between macroscopic transport equations obtained in different conceptual frameworks are discussed from an operational standpoint and in terms of model validation.

  9. CFD analysis and flow model reduction for surfactant production in helix reactor = CFD analiza i redukcija modela strujanja za proizvodnju surfaktanta u helix reaktoru

    Nikačević, N.M.; Thielen, L.; Twerda, A.; Hof, P.M.J. van den


    Flow pattern analysis in a spiral Helix reactor is conducted, for the application in commercial surfactant production. Step change response curves (SCR) were obtained from numerical tracer experiments by three-dimensional computational fluid dynamics (CFD) simulations. Non-reactive flow is simulated

  10. CFD analysis and flow model reduction for surfactant production in helix reactor = CFD analiza i redukcija modela strujanja za proizvodnju surfaktanta u helix reaktoru

    Nikačević, N.M.; Thielen, L.; Twerda, A.; Hof, P.M.J. van den


    Flow pattern analysis in a spiral Helix reactor is conducted, for the application in commercial surfactant production. Step change response curves (SCR) were obtained from numerical tracer experiments by three-dimensional computational fluid dynamics (CFD) simulations. Non-reactive flow is

  11. CFD modeling of convection heat transfer using 1.7 MHz and 24 kHz ultrasonic waves: a comparative study

    Dehbani, Maryam; Rahimi, Masoud; Abolhasani, Mahdieh; Maghsoodi, Abbas; Afshar, Parisa Ghaderi; Dodmantipi, Ali Reza; Alsairafi, Ammar A.


    The effects of 24 kHz and 1.7 MHz ultrasonic waves on heat transfer from a thin platinum wire are investigated. The results revealed that the 1.7 MHz ultrasound waves could increase the heat transfer rate more efficiently than the lower frequency one. The CFD modeling of ultrasonication was performed to compare heat transfer, predict fluid flow patterns. The CFD results were validated by the experimental results with an excellent agreement.

  12. CFD and Gaussian atmospheric dispersion models: A comparison for leak from carbon dioxide transportation and storage facilities

    Mazzoldi, Alberto; Hill, Tim; Colls, Jeremy J.

    Carbon Capture and Storage (CCS) is of interest to the scientific community as a way of achieving significant global reduction of atmospheric CO 2 emission in the medium term. CO 2 would be transported from large emission points (e.g. coal fired power plants) to storage sites by surface/shallow high pressure pipelines. Modelling of CO 2 atmospheric dispersion after leakages from transportation facilities will be required before starting large scale CCS projects. This paper deals with the evaluation of the atmospheric dispersion CFD tool Fluidyn-PANACHE against Prairie Grass and Kit Fox field experiments. A description of the models for turbulence generation and dissipation used ( k- ɛ and k- l) and a comparison with the Gaussian model ALOHA for both field experiments are also outlined. The main outcome of this work puts PANACHE among the "fit-for-purpose" models, respecting all the prerequisites stated by Hanna et al. [Hanna, S.R., Chang, J.C. and Strimaitis, D.G., 1993. Hazardous gas model evaluation with field observations. Atmospheric Environment, 27, 2265-2285] for the evaluation of atmospheric dispersion model performance. The average under-prediction has been ascribed to the usage of mean wind speed and direction, which is characteristic of all CFD models. The authors suggest a modification of performance ranges for model acceptability measures, within the field of high pressure CO 2 transportation risk assessment, with the aim of accounting for the overall simplification induced by the usage of constant wind speed and direction within CFD atmospheric dispersion models.

  13. Comparison of Homogeneous and Heterogeneous CFD Fuel Models for Phase I of the IAEA CRP on HTR Uncertainties Benchmark

    Gerhard Strydom; Su-Jong Yoon


    Computational Fluid Dynamics (CFD) evaluation of homogeneous and heterogeneous fuel models was performed as part of the Phase I calculations of the International Atomic Energy Agency (IAEA) Coordinate Research Program (CRP) on High Temperature Reactor (HTR) Uncertainties in Modeling (UAM). This study was focused on the nominal localized stand-alone fuel thermal response, as defined in Ex. I-3 and I-4 of the HTR UAM. The aim of the stand-alone thermal unit-cell simulation is to isolate the effect of material and boundary input uncertainties on a very simplified problem, before propagation of these uncertainties are performed in subsequent coupled neutronics/thermal fluids phases on the benchmark. In many of the previous studies for high temperature gas cooled reactors, the volume-averaged homogeneous mixture model of a single fuel compact has been applied. In the homogeneous model, the Tristructural Isotropic (TRISO) fuel particles in the fuel compact were not modeled directly and an effective thermal conductivity was employed for the thermo-physical properties of the fuel compact. On the contrary, in the heterogeneous model, the uranium carbide (UCO), inner and outer pyrolytic carbon (IPyC/OPyC) and silicon carbide (SiC) layers of the TRISO fuel particles are explicitly modeled. The fuel compact is modeled as a heterogeneous mixture of TRISO fuel kernels embedded in H-451 matrix graphite. In this study, a steady-state and transient CFD simulations were performed with both homogeneous and heterogeneous models to compare the thermal characteristics. The nominal values of the input parameters are used for this CFD analysis. In a future study, the effects of input uncertainties in the material properties and boundary parameters will be investigated and reported.

  14. CFD model of air movement in ventilated façade: comparison between natural and forced air flow

    Miguel Mora Pérez, Gonzalo López Patiño, P. Amparo López Jiménez


    Full Text Available This study describes computational fluid dynamics (CFD modeling of ventilated façade. Ventilated façades are normal façade but it has an extra channel between the concrete wall and the (double skin façade. Several studies found in the literature are carried out with CFD simulations about the behavior of the thermodynamic phenomena of the double skin façades systems. These studies conclude that the presence of the air gap in the ventilated façade affects the temperature in the building skin, causing a cooling effect, at least in low-rise buildings. One of the most important factors affecting the thermal effects of ventilated façades is the wind velocity. In this contribution, a CFD analysis applied on two different velocity assumptions for air movement in the air gap of a ventilated façade is presented. A comparison is proposed considering natural wind induced velocity with forced fan induced velocity in the gap. Finally, comparing temperatures in the building skin, the differences between both solutions are described determining that, related to the considered boundary conditions, there is a maximum height in which the thermal effect of the induced flow is significantly observed.

  15. Investigation on hydrodynamics and mass transfer characteristics of a gas-liquid ejector using three-dimensional CFD modeling

    Utomo, Tony; Jin, Zhenhua; Rahman, MSq; Jeong, Hyo Min; Chung, Han Shik [Gyeongsang National University, Jinju (Korea, Republic of)


    An investigation of the gas-liquid ejector has been carried out to study the influence of operating conditions and ejector geometries on the hydrodynamics and mass transfer characteristics of the ejector by using three-dimensional CFD modeling. The CFD results were validated with experimental data. Flow field analysis and prediction of ejector performance were also conducted. Variations of the operating conditions were made by changing the gas-liquid flow rates ratio in the range of 0.2 to 1.2. The length to diameter ratio of mixing tube (L{sub M}/D{sub M}) was also varied from 4 to 10. CFD studies show that at L{sub M}/D{sub M}=5.5, the volumetric mass transfer coefficient increases with respect to gas flow rate. Meanwhile, at L{sub M}/D{sub M}=4, the plot of volumetric mass transfer coefficient to gas-liquid flow rate ratio reaches the maximum at gas-liquid flow rate ratio of 0.6. This study also shows that volumetric mass transfer coefficient decreases with the increase of mixing tube length

  16. Application of S{gamma} Model for the Mechanistic Bubble Size Prediction in the Subcooled Boiling Flow with CFD Code

    Yun, B. J.; Song, C. H. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Splawski, A.; Lo, S. [CD-adapco, Melville (United States)


    Accurate simulation of subcooled boiling flow is essential for the operation and safety of nuclear power plants (NPP). In recent years, the use of computational fluid dynamics (CFD) codes has been extended to the analysis of multi-dimensional two-phase flow for the NPP. Among the applications of CFD code for the NPP analysis, the first target was selected as a mechanistic prediction of DNB (Departure from Nucleate Boiling) in PWR. In DNB-type CHF (Critical Heat Flux), the expected flow regime is bubbly or churn turbulent flow in the high mass flux and high heat flux condition and thus subcooled boiling is also one of the key phenomena for the precise prediction of DNB. In this paper, S{gamma},which is a mechanistic transport equation for the bubble parameters, was examined in a CFD code with the objective of enhancing the prediction capability of subcooled boiling flows. The models were applied in the STAR-CD 4.12 software

  17. On Modeling the Response of Synovial Fluid: Unsteady Flow of a Shear-Thinning, Chemically-Reacting Fluid Mixture

    Bridges, Craig; Rajagopal, K R


    We study the flow of a shear-thinning, chemically-reacting fluid that could be used to model the flow of the synovial fluid. The actual geometry where the flow of the synovial fluid takes place is very complicated, and therefore the governing equations are not amenable to simple mathematical analysis. In order to understand the response of the model, we choose to study the flow in a simple geometry. While the flow domain is not a geometry relevant to the flow of the synovial fluid in the human body it yet provides a flow which can be used to assess the efficacy of different models that have been proposed to describe synovial fluids. We study the flow in the annular region between two cylinders, one of which is undergoing unsteady oscillations about their common axis, in order to understand the quintessential behavioral characteristics of the synovial fluid. We use the three models suggested by Hron et al. [ J. Hron, J. M\\'{a}lek, P. Pust\\v{e}jovsk\\'{a}, K. R. Rajagopal, On concentration dependent shear-thinni...

  18. Modeling of Multisize Bubbly Flow and Application to the Simulation of Boiling Flows with the Neptune_CFD Code

    Christophe Morel


    Full Text Available This paper describes the modeling of boiling multisize bubbly flows and its application to the simulation of the DEBORA experiment. We follow the method proposed originally by Kamp, assuming a given mathematical expression for the bubble diameter pdf. The original model is completed by the addition of some new terms for vapor compressibility and phase change. The liquid-to-interface heat transfer term, which essentially determines the bubbles condensation rate in the DEBORA experiment, is also modeled with care. First numerical results realized with the Neptune_CFD code are presented and discussed.

  19. CFD Modeling of Thermal Manikin Heat Loss in a Comfort Evaluation Benchmark Test

    Nilsson, Håkan O.; Brohus, Henrik; Nielsen, Peter V.


    and companies still use several in-house codes for their calculations. The validation and association with human perception and heat losses in reality is consequently very difficult to make. This paper is providing requirements for the design and development of computer manikins and CFD benchmark tests...

  20. A Transient 3D-CFD Model Incorporating Biological Processes for Use in Tissue Engineering

    Krühne, Ulrich; Wendt, D.; Martin, I.


    after 2, 8 and 13 days. The development of the cells is compared to the simulated growth of cells and it is attempted to draw a conclusion about the impact of the shear stress on the cell growth. Keyword: Computational fluid dynamics (CFD),Micro pores,Scaffold,Bioreactor,Fluid structure interaction,Tissue...... engineering...

  1. CFD analysis and flow model reduction for surfactant production in helix reactor

    Nikačević, N.M.; Thielen, L.; Twerda, A.; Hof, P.M.J. van den


    Flow pattern analysis in a spiral Helix reactor is conducted, for the application in the commercial surfactant production. Step change response curves (SCR) were obtained from numerical tracer experiments by three-dimensional computational fluid dynamics (CFD) simulations. Non-reactive flow is simul

  2. Physical characterization of biomass fuels prepared for suspension firing in utility boilers for CFD modelling

    Rosendahl, Lasse; Yin, Chungen; Kær, Søren Knudsen


    shapes. The sample is subdivided by straw type, and coherent size, type and mass distribution parameters are reported for the entire sample. This type of data is necessary in order to use CFD reliably as a design and retrofit tool for co-firing biomass with fossil fuels, as the combustion processes...

  3. A Coupled VOF-Eulerian Multiphase CFD Model to Simulate Breaking Wave Impacts on Offshore Structures

    Tomaselli, Pietro; Christensen, Erik Damgaard


    Breaking wave-induced loads on offshore structures can be extremely severe. The air entrainment mechanism during the breaking process plays a not well-known role in the exerted forces. This paper present a CFD solver, developed in the Open-FOAM environment, capable of simulating the wave breaking...

  4. A CFD Model for Wave Transformation and Breaking in the Surf Zone

    Chopakatla, S. C.; Lippmann, T. C.; Richardson, J. E.; Thornton, E. B.; Holman, R. A.


    Wind-generated surface gravity waves are the major driving force for nearshore circulation and sediment transport. As waves shoal in shallow coastal waters, spectra evolve strongly owing to refraction, nonlinear energy transfers, and dissipation caused by wave breaking and bottom friction. Although considerable progress has been made in modeling wave propagation over complex bottom topography, the dissipation mechanisms are still poorly understood. As a consequence, wave transformation models for the surf zone use crude descriptions of the wave breaking process based on simple saturation criteria or empirical probability distributions that do not always work well for the range of bathymetric and wave conditions commonly observed in nature. In this report, we will discuss the results of studies made with the commercially available Computational Fluid Dynamics (CFD) software system known as FLOW-3D (Flow Science, Inc., Sante Fe, NM). FLOW-3D is designed to solve transient, free surface flow problems based on the solution of the Navier-Stokes equations in three-dimensions. As part of FLOW-3D's formulation, the dissipation of energy is determined by use of coupled turbulence closure schemes (e.g., closure schemes based on the solution of turbulent kinetic energy transport equations). In this study, fine scale pressures and velocities are computed over a two-dimensional beach profile measured during the 1990 Delilah experiment. The model is driven by observed wave spectra obtained in 8 meter water depths, and results compared with a cross-shore array of pressure sensors and current meters spanning the width of the surf zone. In the calculations, wave breaking is a natural consequence of the fluid dynamics and does not require the use of empirical formulations, or breaking criteria. The spatial and temporal variability in the wave breaking locations will be compared with video observations obtained during the experiment. Good comparison between modeled and observed wave


    Yu-Hsin Tung; Richard W. Johnson; Ching-Chang Chieng; Yuh-Ming Ferng


    A prismatic gas-cooled very high temperature reactor (VHTR) is being developed under the next generation nuclear plant program (NGNP) of the U.S. Department of Energy, Office of Nuclear Energy. In the design of the prismatic VHTR, hexagonal shaped graphite blocks are drilled to allow insertion of fuel pins, made of compacted TRISO fuel particles, and coolant channels for the helium coolant. One of the concerns for the reactor design is the effects of a loss of flow accident (LOFA) where the coolant circulators are lost for some reason, causing a loss of forced coolant flow through the core. In such an event, it is desired to know what happens to the (reduced) heat still being generated in the core and if it represents a problem for the fuel compacts, the graphite core or the reactor vessel (RV) walls. One of the mechanisms for the transport of heat out of the core is by the natural circulation of the coolant, which is still present. That is, how much heat may be transported by natural circulation through the core and upwards to the top of the upper plenum? It is beyond current capability for a computational fluid dynamic (CFD) analysis to perform a calculation on the whole RV with a sufficiently refined mesh to examine the full potential of natural circulation in the vessel. The present paper reports the investigation of several strategies to model the flow and heat transfer in the RV. It is found that it is necessary to employ representative geometries of the core to estimate the heat transfer. However, by taking advantage of global and local symmetries, a detailed estimate of the strength of the resulting natural circulation and the level of heat transfer to the top of the upper plenum is obtained.

  6. On the modeling of bubble evolution and transport using coupled level-set/CFD method

    Bartlomiej Wierzbicki; Steven P Antal; Michael Z Podowski [Dept. of Mechanical, Aerospace and Nuclear Engineering, and Center for Multiphase Research, Rensselaer Polytechnic Institute, Troy, NY 12180 (United States)


    Full text of publication follows: The ability to predict the shape of the gas/liquid/solid interfaces is important for various multiphase flow and heat transfer applications. Specific issues of interest to nuclear reactor thermal-hydraulics, include the evolution of the shape of bubbles attached to solid surfaces during nucleation, bubble surface interactions in complex geometries, etc. Additional problems, making the overall task even more complicated, are associated with the effect of material properties that may be significantly altered by the addition of minute amounts of impurities, such as surfactants or nano-particles. The present paper is concerned with the development of an innovative approach to model time-dependent shape of gas/liquid interfaces in the presence of solid walls. The proposed approach combines a modified level-set method with an advanced CFD code, NPHASE. The coupled numerical solver can be used to simulate the evolution of gas/liquid interfaces in two-phase flows for a variety of geometries and flow conditions, from individual bubbles to free surfaces (stratified flows). The issues discussed in the full paper will include: a description of the novel aspects of the proposed level-set concept based method, an overview of the NPHASE code modeling framework and a description of the coupling method between these two elements of the overall model. A particular attention will be give to the consistency and completeness of model formulation for the interfacial phenomena near the liquid/gas/solid triple line, and to the impact of the proposed numerical approach on the accuracy and consistency of predictions. The accuracy will be measured in terms of both the calculated shape of the interfaces and the gas and liquid velocity fields around the interfaces and in the entire computational domain. The results of model testing and validation will also be shown in the full paper. The situations analyzed will include: bubbles of different sizes and varying

  7. Validation of GAMMA+ model for Evaluating Heat Transfer of VHTR core in Accident Conditions by CFD analysis

    Shin, Dongho; Yoon, Sujong; Park, Gooncherl; Cho, Hyoungkyu [Seoul National Univ., Seoul (Korea, Republic of)


    KAERI has established a plan to demonstrate massive production of hydrogen using a VHTR by the early 2020s. In addition the GAMMA+ code is developed to analyze VHTR thermo-fluid transients at KAERI. One of the candidate reactor designs for VHTR is prismatic modular reactor (PMR), of which reference reactor is the 600MWth GT-MHR. This type of reactor has a passive safety system. During the High Pressure Conduction Cooling (HPCC) or Low Pressure Conduction Cooling (LPCC) accident, the core heats up by decay heat and then starts to cool down by conduction and radiation cooling to the Reactor Cavity Cooling System (RCCS) through the prismatic core. In this mechanism, the solid conduction occurs in graphite and fuel blocks, and the gas conduction and radiation occurs in coolant holes and bypass gaps. It is important to predict conduction and radiation heat transfer in the core for safety analysis. Effective thermal conductivity is derived by Maxwell's far-field methodology Radiation effect is expressed as corresponding conductivity and added to gas conductivity. In this study, ETC model used in GAMMA+ code is validated with the commercial CFD code, CFX-13. In this study, the effective thermal conductivity model of the GAMMA+ was evaluated by comparison of CFD analysis. The CFD analysis was conducted for various numbers and volume fractions of coolant holes and temperatures. Although slight disagreement was shown for the cases run with small number of holes, the result of GAMMA+ model is accurate for the large numbers of holes sufficiently. Since there are 102 coolant holes and 210 fuel holes in a fuel block, it is concluded that GAMMA+ model is proper formula for predicting effective thermal conductivity of the VHTR fuel block. However, in high temperature region above 500 .deg. C, the GAMMA+ model underestimates the effective thermal conductivity since radiation heat transfer is not reflected precisely. Further researches on it seem to be necessary.

  8. A CFD model for analysis of performance, water and thermal distribution, and mechanical related failure in PEM fuel cells

    Maher A.R. Sadiq Al-Baghdadi


    Full Text Available This paper presents a comprehensive three–dimensional, multi–phase, non-isothermal model of a Proton Exchange Membrane (PEM fuel cell that incorporates significant physical processes and key parameters affecting the fuel cell performance. The model construction involves equations derivation, boundary conditions setting, and solution algorithm flow chart. Equations in gas flow channels, gas diffusion layers (GDLs, catalyst layers (CLs, and membrane as well as equations governing cell potential and hygro-thermal stresses are described. The algorithm flow chart starts from input of the desired cell current density, initialization, iteration of the equations solution, and finalizations by calculating the cell potential. In order to analyze performance, water and thermal distribution, and mechanical related failure in the cell, the equations are solved using a computational fluid dynamic (CFD code. Performance analysis includes a performance curve which plots the cell potential (Volt against nominal current density (A/cm2 as well as losses. Velocity vectors of gas and liquid water, liquid water saturation, and water content profile are calculated. Thermal distribution is then calculated together with hygro-thermal stresses and deformation. The CFD model was executed under boundary conditions of 20°C room temperature, 35% relative humidity, and 1 MPA pressure on the lower surface. Parameters values of membrane electrode assembly (MEA and other base conditions are selected. A cell with dimension of 1 mm x 1 mm x 50 mm is used as the object of analysis. The nominal current density of 1.4 A/cm2 is given as the input of the CFD calculation. The results show that the model represents well the performance curve obtained through experiment. Moreover, it can be concluded that the model can help in understanding complex process in the cell which is hard to be studied experimentally, and also provides computer aided tool for design and optimization of PEM

  9. CFD modeling of reactive pollutant dispersion in simplified urban configurations with different chemical mechanisms

    Sanchez, Beatriz; Santiago, Jose-Luis; Martilli, Alberto; Palacios, Magdalena; Kirchner, Frank


    An accurate understanding of urban air quality requires considering a coupled behavior between the dispersion of reactive pollutants and atmospheric dynamics. Currently, urban air pollution is mostly dominated by traffic emission, where nitrogen oxides (NOx) and volatile organic compounds (VOCs) are the primary emitted pollutants. However, modeling reactive pollutants with a large set of chemical reactions, using a computational fluid dynamic (CFD) model, requires a large amount of computational (CPU) time. In this sense, the selection of the chemical reactions needed in different atmospheric conditions becomes essential in finding the best compromise between CPU time and accuracy. The purpose of this work is to assess the differences in NO and NO2 concentrations by considering three chemical approaches: (a) passive tracers (non-reactive), (b) the NOx-O3 photostationary state and (c) a reduced complex chemical mechanism based on 23 species and 25 reactions. The appraisal of the effects of chemical reactions focuses on studying the NO and NO2 dispersion in comparison with the tracer behavior within the street. In turn, the effect of including VOC reactions is also analyzed taking into account several VOC / NOx ratios of traffic emission. Given that the NO and NO2 dispersion can also be affected by atmospheric conditions, such as wind flow or the background concentration from season-dependent pollutants, in this work the influence of wind speeds and background O3 concentrations are studied. The results show that the presence of ozone in the street plays an important role in NO and NO2 concentrations. Therefore, greater differences linked to the chemical approach used are found with higher O3 concentrations and faster wind speeds. This bears relation to the vertical flux as a function of ambient wind speed since it increases the pollutant exchange between the street and the overlying air. This detailed study allows one to ascertain under which atmospheric conditions

  10. A CFD and experimental study on cavitation in positive displacement pumps: Benefits and drawbacks of the ‘full’ cavitation model

    Aldo Iannetti


    Full Text Available To fill the gap in the literature in terms of numerical studies of positive displacement (PD pumps in a cavitating condition, a comprehensive and transient computational fluid dynamics (CFD model of a PD pump, simulating the cavitation arising during the suction stroke, was created. The ‘full’ cavitation model was utilized to study its capability on PD pump cavitation. A set of three plunger speeds were simulated. Using the highest plunger speed, an assessment was made of the effect of 1.5, 3, 4.5 and 15 parts per million (ppm of air mass fraction on pump performance and cavitation. An experimental test rig, replicating the CFD model, was designed and built in order to validate the numerical model and find its weaknesses. CFD modeled, in a consistent way, the fluid dynamics phenomena related to cavitation (the chamber pressure approaching the vapor pressure, the vaporization/condensation and the pressure spike occurrence at the end of the suction stroke marking the end of cavitation. On the other hand the CFD pressure trends calculated appeared stretched along the time axis with respect to the experimental data, and this highlighted issues in the multiphase and cavitation models: the vaporization/condensation rate calculated by CFD did not follow the real dynamics correctly because the non-condensable gas expansion was overestimated. This was seen when comparing the CFD/experimental results where the simulated pressure drop gradient at the beginning of the suction stroke and the pressure peaks as the valve closed exhibited a delay in their occurrence. The simulation results were sensitive to the dissolved air mass fraction as the delay depended on the amount of air dissolved in the water. Although the influence of the air mass fraction was considered consistent, the 3 ppm CFD case was the closest to the experimental results, whereas the analyst expected the 15 ppm case to be more accurate.

  11. CFD modeling of reaction and mass transfer through a single pellet:Catalytic oxidative coupling of methane

    Siavash Seyednej adian; Nakisa Yaghobi; Ramin Maghrebi; Leila Vafajoo


    In this study a mathematical model of a small scale single pellet for the oxidative coupling of methane (OCM) over titanite pervoskité isdeveloped.The method is based on a computational fluid dynamics (CFD) code which known as Fluent may be adopted to model the reactions that take place inside the porous catalyst pellet.The steady state single pellet model is coupled with a kinetic model and the intra-pellet concentration profiles of species are provided.Subsequent to achieving this goal,a nonlinear reaction network consisting of nine catalytic reactions and one gas phase reaction as an external program is successfully implemented to CFD-code as a reaction term in solving the equations.This study is based on the experimental design which is conducted in a differential reactor with a Sn/BaTiO3 catalyst (7-8 mesh) at atmospheric pressure,GHSV of 12000 h-1,ratio of methane to oxygen of 2,and three different temperatures of 1023,1048 and 1073 K.The modeling results such as selectivity and conversion at the pellet exit are in good agreement with the experimental data.Therefore,it is suggested that to achieve high yield in OCM process the modeling of the single pellet should be considered as the heart of catalytic fixed bed reactor.

  12. Using an improved 1D boundary layer model with CFD for flux prediction in gas-sparged tubular membrane ultrafiltration.

    Smith, R; Taha, T; Cui, Z F


    Tubular membrane ultrafiltration and microfiltration are important industrial separation and concentration processes. Process optimisation requires reduction of membrane build-up. Gas slug introduction has been shown to be a useful approach for flux enhancement. However, process quantification is required for design and optimisation. In this work we employ a non-porous wall CFD model to quantify hydrodynamics in the two-phase slug flow process. Mass transfer is subsequently quantified from wall shear stress, which was determined from the CFD. The mass transfer model is an improved one-dimensional boundary layer model, which empirically incorporates effects of wall suction and analytically includes edge effects for circular conduits. Predicted shear stress profiles are in agreement with experimental results and flux estimates prove more reliable than that from previous models. Previous models ignored suction effects and employed less rigorous fluid property inclusion, which ultimately led to under-predictive flux estimates. The presented model offers reliable process design and optimisation criteria for gas-sparged tubular membrane ultrafiltration.

  13. Development and Assessment of CFD Models Including a Supplemental Program Code for Analyzing Buoyancy-Driven Flows Through BWR Fuel Assemblies in SFP Complete LOCA Scenarios

    Artnak, Edward Joseph, III

    This work seeks to illustrate the potential benefits afforded by implementing aspects of fluid dynamics, especially the latest computational fluid dynamics (CFD) modeling approach, through numerical experimentation and the traditional discipline of physical experimentation to improve the calibration of the severe reactor accident analysis code, MELCOR, in one of several spent fuel pool (SFP) complete loss-ofcoolant accident (LOCA) scenarios. While the scope of experimental work performed by Sandia National Laboratories (SNL) extends well beyond that which is reasonably addressed by our allotted resources and computational time in accordance with initial project allocations to complete the report, these simulated case trials produced a significant array of supplementary high-fidelity solutions and hydraulic flow-field data in support of SNL research objectives. Results contained herein show FLUENT CFD model representations of a 9x9 BWR fuel assembly in conditions corresponding to a complete loss-of-coolant accident scenario. In addition to the CFD model developments, a MATLAB based controlvolume model was constructed to independently assess the 9x9 BWR fuel assembly under similar accident scenarios. The data produced from this work show that FLUENT CFD models are capable of resolving complex flow fields within a BWR fuel assembly in the realm of buoyancy-induced mass flow rates and that characteristic hydraulic parameters from such CFD simulations (or physical experiments) are reasonably employed in corresponding constitutive correlations for developing simplified numerical models of comparable solution accuracy.

  14. Modeling industrial thickener using computational fluid dynamics (CFD), a case study:Tailing thickener in the Sarcheshmeh copper mine

    Majid Ebrahimzadeh Gheshlaghi; Ataallah Soltani Goharrizi; Alireza Aghajani Shahrivar; Hadi Abdollahi


    Separation of particles from liquid in the large gravitational tanks is widely used in mining and industrial wastewater treatment process. Thickener is key unit in the operational processes of hydrometallurgy and is used to separate solid from liquid. In this study, population balance models were combined with com-putational fluid dynamics (CFD) for modeling the tailing thickener. Parameters such as feed flow rate, flocculant dosage, inlet solid percent and feedwell were investigated. CFD was used to simulate the industrial tailing thickener with settled bed of 120 m diameter which is located in the Sarcheshmeh cop-per mine. Important factor of drag force that defines the rake torque of rotating paddles on the bed was also determined. Two phases turbulence model of Eulerian/Eulerian in accordance with turbulence model of k-e was used in the steady-state. Also population balance model consists of 15 groups of particle sizes with Luo and Lehr kernel was used for aggregation/breakage kernel. The simulation results showed good agreement with the operational data.

  15. CFD Evaluation of a 3rd Generation LDI Combustor

    Ajmani, Kumud; Mongia, Hukam; Lee, Phil


    An effort was undertaken to perform CFD analysis of fluid flow in Lean-Direct Injection (LDI) combustors with axial swirl-venturi elements for next-generation LDI-3 combustor design. The National Combustion Code (NCC) was used to perform non-reacting and two-phase reacting flow computations for a nineteen-element injector array arranged in a three-module, 7-5-7 element configuration. All computations were performed with a consistent approach of mesh-optimization, spray-modeling, ignition and kinetics-modeling with the NCC. Computational predictions of the aerodynamics of the injector were used to arrive at an optimal injector design that meets effective area and fuel-air mixing criteria. LDI-3 emissions (EINOx, EICO and UHC) were compared with the previous generation LDI-2 combustor experimental data at representative engine cycle conditions.

  16. 3D CFD modeling of subsonic and transonic flowing-gas DPALs with different pumping geometries

    Yacoby, Eyal; Sadot, Oren; Barmashenko, Boris D.; Rosenwaks, Salman


    Three-dimensional computational fluid dynamics (3D CFD) modeling of subsonic (Mach number M ~ 0.2) and transonic (M ~ 0.9) diode pumped alkali lasers (DPALs), taking into account fluid dynamics and kinetic processes in the lasing medium is reported. The performance of these lasers is compared with that of supersonic (M ~ 2.7 for Cs and M ~ 2.4 for K) DPALs. The motivation for this study stems from the fact that subsonic and transonic DPALs require much simpler hardware than supersonic ones where supersonic nozzle, diffuser and high power mechanical pump (due to a drop in the gas total pressure in the nozzle) are required for continuous closed cycle operation. For Cs DPALs with 5 x 5 cm2 flow cross section pumped by large cross section (5 x 2 cm2) beam the maximum achievable power of supersonic devices is higher than that of the transonic and subsonic devices by only ~ 3% and ~ 10%, respectively. Thus in this case the supersonic operation mode has no substantial advantage over the transonic one. The main processes limiting the power of Cs supersonic DPALs are saturation of the D2 transition and large ~ 60% losses of alkali atoms due to ionization, whereas the influence of gas heating is negligible. For K transonic DPALs both the gas heating and ionization effects are shown to be unimportant. The maximum values of the power are higher than those in Cs transonic laser by ~ 11%. The power achieved in the supersonic and transonic K DPAL is higher than for the subsonic version, with the same resonator and K density at the inlet, by ~ 84% and ~ 27%, respectively, showing a considerable advantaged of the supersonic device over the transonic one. For pumping by rectangular beams of the same (5 x 2 cm2) cross section, comparison between end-pumping - where the laser beam and pump beam both propagate at along the same axis, and transverse-pumping - where they propagate perpendicularly to each other, shows that the output power and optical-to-optical efficiency are not

  17. Estimation of Radius Ratio in a Fin Using Inverse CFD Model

    Ranjan Das


    Full Text Available

    This article deals with the retrieval of parameters such as the radius-ratio in a rectangular fin using an inverse CFD model involving a mixed boundary condition. At first, the temperature field is obtained from a forward problem using the finite difference method (FDM in which the inner and outer radii or the radius-ratio is assumed to be known. Next, by an inverse approach using the FDM in conjunction with the genetic algorithm (GA, the inner and outer radii or the radius-ratio is retrieved. To accomplish the task, an objective function represented by the sum of square of the error between the guessed and the exact/measured temperature fields is minimized. Apart from demonstrating the suitability of the FDM

  18. CFD modelling of nocturnal low-level jet effects on wind energy related variables

    Sogachev, Andrey; Mann, Jakob; Dellwik, Ebba; Ejsing Jørgensen, Hans


    The development of a wind speed maximum in the nocturnal boundary layer, referred to as a low-level jet (LLJ), is a common feature of the vertical structure of the atmospheric boundary layer (ABL). Characterizing and understanding LLJ streams is growing in importance as wind turbines are being built larger and taller to take advantage of higher wind speeds at increased heights. We used a computational fluid dynamics (CFD) model to explore LLJs effect on wind speed, wind directional and speed shear inside the surface layer 40 - 130 m, where their physical measurements are not trivial and still rare today. We used the one-dimensional version of the ABL model SCADIS (Sogachev et al. 2002: Tellus 54:784-819). The unique feature of the model, based on a two-equation closure approach, is the treatment of buoyancy effects in a universal way, which overcomes the uncertainties with model coefficients for non-shear source/sink terms (Sogachev, 2009: Boundary Layer Meteor. 130:423-435). From a variety of mechanisms suggested for formation of LLJs, such as inertial oscillations, baroclinicity over sloping terrain, and land-sea breeze effects, the one-dimensional ABL model is capable of simulating only the first one. However, that mechanism, which is caused by the diurnal oscillation of eddy viscosity, is often responsible for jet formation. Sensitivity tests carried out showed that SCADIS captures the most prominent features of the LLJ, including its vertical structure as well as its diurnal phase and amplitude. We simulated ABL pattern under conditions typical for LLJ formation (a fair day on July 1, a flat low-roughness underlying surface) at 30 and 50o latitudes. Diurnal variability of wind speed and turbulence intensity at four levels of 40, 70, 100 and 130 m above ground and of wind and directional shear between those levels were analysed. Despite of small differences in LLJ structure the properties of LLJ important for wind energy production are still common for two

  19. Examining the Impact of Greenspace Patterns on Land Surface Temperature by Coupling LiDAR Data with a CFD Model

    Weizhong Su


    Full Text Available Understanding the link between greenspace patterns and land surface temperature is very important for mitigating the urban heat island (UHI effect and is also useful for planners and decision-makers for providing a sustainable design for urban greenspace. Although coupling remote sensing data with a computational fluid dynamics (CFD model has widely been used to examine interactions between UHI and greenspace patterns, the paper aims to examine the impact of five theoretical models of greenspace patterns on land surface temperature based on the improvement of the accuracy of CFD modeling by the combination of LiDAR data with remote sensing images to build a 3D urban model. The simulated results demonstrated that the zonal pattern always had the obvious cooling effects when there are no large buildings or terrain obstacles. For ambient environments, the building or terrain obstacles and the type of greenspace have the hugest influence on mitigating the UHI, but the greenspace area behaves as having the least cooling effect. A dotted greenspace pattern shows the best cooling effect in the central area or residential district within a city, while a radial and a wedge pattern may result in a “cold source” for the urban thermal environment.

  20. Predicting night-time natural ventilation in Stanford's Y2E2 building using an integral model in combination with a CFD model

    Lamberti, Giacomo; Gorle', Catherine


    Natural ventilation can significantly reduce energy consumption in buildings, but the presence of uncertainty makes robust design a challenging task. We will discuss the prediction of the natural ventilation performance during a 4 hour night-flush in Stanford's Y2E2 building using a combination of two models with different levels of fidelity: an integral model that solves for the average air and thermal mass temperature and a CFD model, used to calculate discharge and heat transfer coefficients to update the integral model. Uncertainties are propagated using polynomial chaos expansion to compute the mean and 95% confidence intervals of the quantities of interest. Comparison with building measurements shows that, despite a slightly to fast cooling rate, the measured air temperature is inside the 95% confidence interval predicted by the integral model. The use of information from the CFD model in the integral model reduces the maximum standard deviation of the volume-averaged air temperature by 20% when compared to using literature-based estimates for these quantities. The heat transfer coefficient resulting from the CFD model was found to be within the literature-based interval initially assumed for the integral model, but the discharge coefficients were found to be different.


    Ning Yang; Wei Wang; Wei Ge; Jinghai Li


    Meso-scale structures existing in the form of particle-rich clusters, streamers or strands in circulating fluidized beds, and of ascending bubble plumes and descending liquid-rich vortices in bubble columns and slurry-bed reactors, as commonly observed, have played an important role in the macro-scale behavior of particle-fluid systems. These meso-scale structures span a wide range of length and time scales, and their origin, evolution and influence are still far from being well understood.Recent decades have witnessed the emergence of computer simulation of particle-fluid systems based on computational fluid dynamic (CFD) models. However, strictly speaking these models are far from mature and the complex nature of particle-fluid systems arising from the meso-scale structures has been posing great challenges to investigators. The reason may be that the current two-fluid models (TFM) are derived either from continuum mechanics by using different kinds of averaging techniques for the conservation equations of single-phase flow, or from the kinetic theory of gases in which the assumption of molecular chaos is employed, thereby losing sight of the meso-scale heterogeneity at the scale of computational cells and leading to inaccurate calculation of the interaction force between particles and fluids. For example, the overall drag force for particles in a cell is usually calculated from the empirical Wen & Yu/Ergun correlations,which should be suspected since these correlations were originally derived from homogeneous systems.Schemes to solve this problem for gas-particles systems may be classified into four categories. First, one could capture the detailed meso-scale structure information at the cell scale by employing the so-called direct numerical simulation (DNS) (Hu, 1996), the pseudo-particle modeling (PPM) (Ge & Li, 2003), or the Lattice-Boltzmann method (LBM) to track the interface between gas and particles. Second, refinement of the computational meshes may

  2. Non-travelling wave solutions to a (3 + 1)-dimensional potential-YTSF equation and a simplified model for reacting mixtures

    Zhang Tingxuan [Huaian University of Radio and TV, Huaian, Jiangsu 223005 (China); Xuan, Heng-Nong [School of Information Engineering, Nanjing University of Finance and Economics, Nanjing 210003 (China)]. E-mail:; Zhang Dafang [School of Software, Hunan University, Changsha 410082 (China); Wang Changji [Computer Science Department, Sun Yet-Sen University, Guangzhou 510275 (China)


    In the paper, the generalized projective Riccati equation method is extended to construct some non-travelling wave solutions to a (3 + 1)-dimensional potential-YTSF equation and a simplified model for reacting mixtures. When some arbitrary functions included in these solutions are taken as some special functions, these solutions possess abundant structures.

  3. CFD modelling of most probable bubble nucleation rate from binary mixture with estimation of components' mole fraction in critical cluster

    Hong, Ban Zhen; Keong, Lau Kok; Shariff, Azmi Mohd


    The employment of different mathematical models to address specifically for the bubble nucleation rates of water vapour and dissolved air molecules is essential as the physics for them to form bubble nuclei is different. The available methods to calculate bubble nucleation rate in binary mixture such as density functional theory are complicated to be coupled along with computational fluid dynamics (CFD) approach. In addition, effect of dissolved gas concentration was neglected in most study for the prediction of bubble nucleation rates. The most probable bubble nucleation rate for the water vapour and dissolved air mixture in a 2D quasi-stable flow across a cavitating nozzle in current work was estimated via the statistical mean of all possible bubble nucleation rates of the mixture (different mole fractions of water vapour and dissolved air) and the corresponding number of molecules in critical cluster. Theoretically, the bubble nucleation rate is greatly dependent on components' mole fraction in a critical cluster. Hence, the dissolved gas concentration effect was included in current work. Besides, the possible bubble nucleation rates were predicted based on the calculated number of molecules required to form a critical cluster. The estimation of components' mole fraction in critical cluster for water vapour and dissolved air mixture was obtained by coupling the enhanced classical nucleation theory and CFD approach. In addition, the distribution of bubble nuclei of water vapour and dissolved air mixture could be predicted via the utilisation of population balance model.

  4. Effects of moisture release and radiation properties in pulverized fuel combustion: A CFD modelling study

    Yin, Chungen


    Pulverized fuels (PF) prepared and fired in utility boilers always contain some moisture. For some fuels with high moisture contents (e.g., brown coals), the share of the evaporation enthalpy is quite significant compared to the heat released during combustion, which often needs to be reclaimed.......g., oxy-fuel or air–fuel), account for the variations in CO2 and H2O concentrations in a flame, and include the impacts of other participating gases (e.g., CO and hydrocarbons) needs to be derived for combustion CFD community....

  5. Application of the e-KT-UNIFAC Model for the Improved and Innovative Design of Biphasic Reacting Systems

    Anantpinijwatna, Amata; Kim, Sun H.; Sales-Cruz, Mauricio


    Biphasic reacting systems contain effectively immiscible aqueous and organic liquid phases in which reactants, products, and catalysts can partition. These conditions allow novel synthesis paths, higher yields, and faster reactions, as well as facilitate product(s) separation. A systematic modeli...... of epoxidation of palm oil and production of furan derivatives....

  6. Modelling of Underground Coal Gasification Process Using CFD Methods / Modelowanie Procesu Podziemnego Zgazowania Węgla Kamiennego Z Zastosowaniem Metod CFD

    Wachowicz, Jan; Łączny, Jacek Marian; Iwaszenko, Sebastian; Janoszek, Tomasz; Cempa-Balewicz, Magdalena


    The results of model studies involving numerical simulation of underground coal gasification process are presented. For the purpose of the study, the software of computational fluid dynamics (CFD) was selected for simulation of underground coal gasification. Based on the review of the literature, it was decided that ANSYS-Fluent will be used as software for the performance of model studies. The ANSYS- -Fluent software was used for numerical calculations in order to identify the distribution of changes in the concentration of syngas components as a function of duration of coal gasification process. The nature of the calculations was predictive. A geometric model has been developed based on construction data of the georeactor used during the researches in Experimental Mine "Barbara" and Coal Mine "Wieczorek" and it was prepared by generating a numerical grid. Data concerning the georeactor power supply method and the parameters maintained during the process used to define the numerical model. Some part of data was supplemented based on the literature sources. The main assumption was to base the simulation of the georeactor operation on a mathematical models describing reactive fluid flow. Components of the process gas and the gasification agent move along the gasification channel and simulate physicochemical phenomena associated with the transfer of mass and energy as well as chemical reactions (together with the energy effect). Chemical reactions of the gasification process are based on a kinetic equation which determines the course of a particular type of equation of chemical coal gasification. The interaction of gas with the surrounding coal layer has also been described as a part of the model. The description concerned the transport of thermal energy. The coal seam and the mass rock are treated as a homogeneous body. Modelling studies assumed the coal gasification process is carried out with the participation of separately oxygen and air as a gasification agent


    Ning; Yang; Wei; Wang; Wei; Ge; Jinghai; Li


    Meso-scale structures existing in the form of particle-rich clusters, streamers or strands in circulating fluidized beds, and of ascending bubble plumes and descending liquid-rich vortices in bubble columns and slurry-bed reactors, as commonly observed, have played an important role in the macro-scale behavior of particle-fluid systems. These meso-scale structures span a wide range of length and time scales, and their origin, evolution and influence are still far from being well understood.Recent decades have witnessed the emergence of computer simulation of particle-fluid systems based on computational fluid dynamic (CFD) models. However, strictly speaking these models are far from mature and the complex nature of particle-fluid systems arising from the meso-scale structures has been posing great challenges to investigators. The reason may be that the current two-fluid models (TFM) are derived either from continuum mechanics by using different kinds of averaging techniques for the conservation equations of single-phase flow, or from the kinetic theory of gases in which the assumption of molecular chaos is employed, thereby losing sight of the meso-scale heterogeneity at the scale of computational cells and leading to inaccurate calculation of the interaction force between particles and fluids. For example, the overall drag force for particles in a cell is usually calculated from the empirical Wen & Yu/Ergun correlations,which should be suspected since these correlations were originally derived from homogeneous systems.Schemes to solve this problem for gas-particles systems may be classified into four categories. First, one could capture the detailed meso-scale structure information at the cell scale by employing the so-called direct numerical simulation (DNS) (Hu, 1996), the pseudo-particle modeling (PPM) (Ge & Li, 2003), or the Lattice-Boltzmann method (LBM) to track the interface between gas and particles. Second, refinement of the computational meshes may

  8. An automatic generation of non-uniform mesh for CFD analyses of image-based multiscale human airway models

    Miyawaki, Shinjiro; Tawhai, Merryn H.; Hoffman, Eric A.; Lin, Ching-Long


    The authors have developed a method to automatically generate non-uniform CFD mesh for image-based human airway models. The sizes of generated tetrahedral elements vary in both radial and longitudinal directions to account for boundary layer and multiscale nature of pulmonary airflow. The proposed method takes advantage of our previously developed centerline-based geometry reconstruction method. In order to generate the mesh branch by branch in parallel, we used the open-source programs Gmsh and TetGen for surface and volume meshes, respectively. Both programs can specify element sizes by means of background mesh. The size of an arbitrary element in the domain is a function of wall distance, element size on the wall, and element size at the center of airway lumen. The element sizes on the wall are computed based on local flow rate and airway diameter. The total number of elements in the non-uniform mesh (10 M) was about half of that in the uniform mesh, although the computational time for the non-uniform mesh was about twice longer (170 min). The proposed method generates CFD meshes with fine elements near the wall and smooth variation of element size in longitudinal direction, which are required, e.g., for simulations with high flow rate. NIH Grants R01-HL094315, U01-HL114494, and S10-RR022421. Computer time provided by XSEDE.

  9. CFD Modelling of a Quadrupole Vortex Inside a Cylindrical Channel for Research into Advanced Hybrid Rocket Designs

    Godfrey, B.; Majdalani, J.


    This study relies on computational fluid dynamics (CFD) tools to analyse a possible method for creating a stable quadrupole vortex within a simulated, circular-port, cylindrical rocket chamber. A model of the vortex generator is created in a SolidWorks CAD program and then the grid is generated using the Pointwise mesh generation software. The non-reactive flowfield is simulated using an open source computational program, Stanford University Unstructured (SU2). Subsequent analysis and visualization are performed using ParaView. The vortex generation approach that we employ consists of four tangentially injected monopole vortex generators that are arranged symmetrically with respect to the center of the chamber in such a way to produce a quadrupole vortex with a common downwash. The present investigation focuses on characterizing the flow dynamics so that future investigations can be undertaken with increasing levels of complexity. Our CFD simulations help to elucidate the onset of vortex filaments within the monopole tubes, and the evolution of quadrupole vortices downstream of the injection faceplate. Our results indicate that the quadrupole vortices produced using the present injection pattern can become quickly unstable to the extent of dissipating soon after being introduced into simulated rocket chamber. We conclude that a change in the geometrical configuration will be necessary to produce more stable quadrupoles.

  10. An advanced CFD model to study the effect of non-condensable gas on cavitation in positive displacement pumps

    Iannetti, Aldo; Stickland, Matthew T.; Dempster, William M.


    An advanced transient CFD model of a positive displacement reciprocating pump was created to study its behavior and performance in cavitating condition during the inlet stroke. The "full" cavitation model developed by Singhal et al. was utilized, and a sensitivity analysis test on two air mass fraction amounts (1.5 and 15 parts per million) was carried out to study the influence of the dissolved air content in water on the cavitation phenomenon. The model was equipped with user defined functions to introduce the liquid compressibility, which stabilizes the simulation, and to handle the two-way coupling between the pressure field and the inlet valve lift history. Estimation of the performance is also presented in both cases.

  11. An advanced CFD model to study the effect of non-condensable gas on cavitation in positive displacement pumps

    Iannetti Aldo


    Full Text Available An advanced transient CFD model of a positive displacement reciprocating pump was created to study its behavior and performance in cavitating condition during the inlet stroke. The “full” cavitation model developed by Singhal et al. was utilized, and a sensitivity analysis test on two air mass fraction amounts (1.5 and 15 parts per million was carried out to study the influence of the dissolved air content in water on the cavitation phenomenon. The model was equipped with user defined functions to introduce the liquid compressibility, which stabilizes the simulation, and to handle the two-way coupling between the pressure field and the inlet valve lift history. Estimation of the performance is also presented in both cases.

  12. CFD Script for Rapid TPS Damage Assessment

    McCloud, Peter


    This grid generation script creates unstructured CFD grids for rapid thermal protection system (TPS) damage aeroheating assessments. The existing manual solution is cumbersome, open to errors, and slow. The invention takes a large-scale geometry grid and its large-scale CFD solution, and creates a unstructured patch grid that models the TPS damage. The flow field boundary condition for the patch grid is then interpolated from the large-scale CFD solution. It speeds up the generation of CFD grids and solutions in the modeling of TPS damages and their aeroheating assessment. This process was successfully utilized during STS-134.

  13. 3D CFD Electrochemical and Heat Transfer Model of an Integrated-Planar Solid Oxide Electrolysis Cells

    Grant Hawkes; James E. O' Brien


    A three-dimensional computational fluid dynamics (CFD) electrochemical model has been created to model high-temperature electrolysis cell performance and steam electrolysis in a new novel integrated planar porous-tube supported solid oxide electrolysis cell (SOEC). The model is of several integrated planar cells attached to a ceramic support tube. This design is being evaluated with modeling at the Idaho National Laboratory. Mass, momentum, energy, and species conservation and transport are provided via the core features of the commercial CFD code FLUENT. A solid-oxide fuel cell (SOFC) model adds the electrochemical reactions and loss mechanisms and computation of the electric field throughout the cell. The FLUENT SOFC user-defined subroutine was modified for this work to allow for operation in the SOEC mode. Model results provide detailed profiles of temperature, Nernst potential, operating potential, activation over-potential, anode-side gas composition, cathode-side gas composition, current density and hydrogen production over a range of stack operating conditions. Mean per-cell area-specific-resistance (ASR) values decrease with increasing current density. Predicted mean outlet hydrogen and steam concentrations vary linearly with current density, as expected. Effects of variations in operating temperature, gas flow rate, cathode and anode exchange current density, and contact resistance from the base case are presented. Contour plots of local electrolyte temperature, current density, and Nernst potential indicated the effects of heat transfer, reaction cooling/heating, and change in local gas composition. Results are discussed for using this design in the electrolysis mode. Discussion of thermal neutral voltage, enthalpy of reaction, hydrogen production, cell thermal efficiency, cell electrical efficiency, and Gibbs free energy are discussed and reported herein.

  14. REACT-Mod: a mathematical model for transient calculation of chemical reactions with U-Pu-Np-Tc in the aqueous nitric acid solution

    Tachimori, Shoichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kitamura, Tatsuaki


    A computer code REACT-Mod which simulates various chemical reactions in an aqueous nitric acid solution involving uranium, plutonium, neptunium, technetium etc. e.g., redox, radiolytic and disproportionation reactions of 68, was developed based on the kinetics model. The numerical solution method adopted in the code are two, a kinetics model totally based on the rate law of which differential equations are solved by the modified Porsing method, and a two-step model based on both the rate law and equilibrium law. Only the former treats 27 radiolytic reactions. The latter is beneficially used to have a quick and approximate result by economical computation. The present report aims not only to explain the concept, chemical reactions treated and characteristics of the model but also to provide details of the program for users of the REACT-Mod code. (author)

  15. 3-D CFD Modeling for Parametric Study in a 300-MWe One-Stage Oxygen-Blown Entrained-Bed Coal Gasifier

    Sang Shin Park


    Full Text Available Three-dimensional computational fluid dynamics (CFD modeling of the gasification performance in a one-stage, entrained-bed coal gasifier (Shell Coal Gasification Process (SCGP gasifier was performed, for the first time. The parametric study used various O2/coal and steam/coal ratios, and the modeling used a commercial code, ANSYS FLUENT. CFD modeling was conducted by solving the steady-state Navier–Stokes and energy equations using the Eulerian–Lagrangian method. Gas-phase chemical reactions were solved with the Finite–Rate/Eddy–Dissipation Model. The CFD model was verified with actual operating data of Demkolec demo Integrated Gasification Combined Cycle (IGCC facility in Netherlands that used Drayton coal. For Illinois #6 coal, the CFD model was compared with ASPEN Plus results reported in National Energy Technology Laboratory (NETL. For design coal used in the SCGP gasifier in Korea, carbon conversion efficiency, cold gas efficiency, temperature, and species mole fractions at the gasifier exit were calculated and the results were compared with those obtained by using ASPEN Plus-Kinetic. The optimal O2/coal and steam/coal ratios were 0.7 and 0.05, respectively, for the selected operating conditions.

  16. Experimental Analysis and Simultaneous Heat and Moisture Transfer with Coupled CFD Model for Convective Drying of Moist Object

    Chandramohan, V. P.


    Convective drying of rectangular-shaped moist object has been analyzed both experimentally and numerically. Transient mass of the potato sample is measured experimentally. Moisture content, diffusivity, and density of the object are calculated at different drying air temperatures from 40°C to 70°C with an air velocity of 2 m/s. A three-dimensional (3D) finite volume method (FVM) based numerical model is developed to predict the temperature and moisture distribution. A computational fluid dynamics (CFD) code is used for predicting heat and mass transfer coefficients required in the boundary conditions of the heat and mass transfer model. The experimental and numerical data are compared and good agreement is observed.

  17. Modelling and analysis of sputter deposited ZrN coating by CFD

    Kapopara, Jaydeep M.; Mengar, Akshaykumar R.; Chauhan, Kamlesh V.; Patel, Nicky P.; Rawal, Sushant K.


    The objective of the present work is to investigate the effect of various sputtering parameters such as velocity, mass flow rate on velocity profiles, pressure profiles, density profiles and concentration distribution of the process gases (argon and nitrogen) of zirconium nitride films deposited on glass and silica substrate by RF magnetron sputtering. A three dimensional Computational Fluid Dynamics (CFD) study has been carried out using Fluent-ANSYS commercial code to visualize the mixing behavior of process gases inside the deposition chamber. The results show that the location of gas inlet port has a greater influence on gas distribution inside the chamber where reactive gas will form coating. By having this information, one can able to modify the reactor geometry and gas flow openings along with its positions for better gas flow over the substrate which in turns gives an indirect indication of coating from the composition point of view.

  18. V&V Of CFD Modeling Of The Argonne Bubble Experiment: FY15 Summary Report

    Hoyt, Nathaniel C. [Argonne National Lab. (ANL), Argonne, IL (United States); Wardle, Kent E. [Argonne National Lab. (ANL), Argonne, IL (United States); Bailey, James L. [Argonne National Lab. (ANL), Argonne, IL (United States); Basavarajappa, Manjunath [Univ. of Utah, Salt Lake City, UT (United States)


    In support of the development of accelerator-driven production of the fission product Mo 99, computational fluid dynamics (CFD) simulations of an electron-beam irradiated, experimental-scale bubble chamber have been conducted in order to aid in interpretation of existing experimental results, provide additional insights into the physical phenomena, and develop predictive thermal hydraulic capabilities that can be applied to full-scale target solution vessels. Toward that end, a custom hybrid Eulerian-Eulerian-Lagrangian multiphase solver was developed, and simulations have been performed on high-resolution meshes. Good agreement between experiments and simulations has been achieved, especially with respect to the prediction of the maximum temperature of the uranyl sulfate solution in the experimental vessel. These positive results suggest that the simulation methodology that has been developed will prove to be suitable to assist in the development of full-scale production hardware.

  19. CFD lends the government a hand

    Lekoudis, Spiro; Singleton, Robert E.; Mehta, Unmeel B.


    The present survey of important and novel CFD applications being developed and implemented by U.S. Government contractors gives attention to naval vessel flow-modeling, Army ballistic and rotary wing aerodynamics, and NASA hypersonic vehicle related applications of CFD. CFD-generated knowledge of numerical algorithms, fluid motion, and supercomputer use is being incorporated into such additional areas as computational electromagnetics and acoustics. Attention is presently given to CFD methods' development status in such fields as submarine boundary layers, hypersonic kinetic energy projectile shock structures, helicopter main rotor tip flows, and National Aerospace Plane aerothermodynamics.

  20. CFD Modeling of Methane Gas Distribution and Control Strategies in a Gassy Coal Mine

    K. Tanguturi


    Full Text Available High methane (CH4 gas emission from the goaf in a gassy coal mine diffuses the gas into the face that leads to hazardous working environment and create operational difficulties. Electrical equipment which are loaded with sensors get tripped off when CH4 level is greater than 2%. Oxygen (O2 ingresses more on the maingate (MG side than the tailgate (TG side of the goaf due to high ventilation air pressure and hence no major gas issues are dealt on this side of the goaf. However, when the air flows along the face, air pressure decreases and less O2 ingress on TG side of goaf and more CH4 gas diffuse into the face in these regions. CH4 gas diffusion not only disrupts the functioning of electrical equipment but also creates hazardous environment for the operator. In this paper, an attempt was made to understand the CH4 gas distribution at the TG for gas emission rate of 1000l/s respectively and investigate the control options available for diluting the gas concentrations in the TG region. From Computational Fluid Dynamics (CFD investigations, it was concluded that for gas emission rates over 1000l/s the CH4 concentration level at the TG region was above 2% and demand for control measures. Gas control strategies with goaf drainage, back return ventilation system and curtains across the face in the TG region were investigated using CFD techniques. From numerical investigations, it can be concluded that gas control strategy with goaf drainage was able to reduce the CH4 level to below 1% and back return system at the TG side was able to completely eliminate gas traces. Placing a curtain assisted in shifting the gas fringes into the goaf and thereby reducing the gas concentrations to below 1%.

  1. Overview 2004 of NASA Stirling-Convertor CFD-Model Development and Regenerator R&D Efforts

    Tew, Roy C.; Dyson, Rodger W.; Wilson, Scott D.; Demko, Rikako


    This paper reports on accomplishments in 2004 in development of Stirling-convertor CFD model at NASA GRC and via a NASA grant, a Stirling regenerator-research effort being conducted via a NASA grant (a follow-on effort to an earlier DOE contract), and a regenerator-microfabrication contract for development of a "next-generation Stirling regenerator." Cleveland State University is the lead organization for all three grant/contractual efforts, with the University of Minnesota and Gedeor Associates as subcontractors. Also, the Stirling Technology Co. and Sunpower, Inc. are both involved in all three efforts, either as funded or unfunded participants. International Mezzo Technologies of Baton Rouge, LA is the regenerator fabricator for the regenerator-microfabrication contract. Results of the efforts in these three areas are summarized.

  2. Electrical capacitance tomography (ECT) and gamma radiation meter for comparison with and validation and tuning of computational fluid dynamics (CFD) modeling of multiphase flow

    Pradeep, Chaminda; Yan, Ru; Vestøl, Sondre; Melaaen, Morten C.; Mylvaganam, Saba


    The electrical capacitance tomographic (ECT) approach is increasingly seen as attractive for measurement and control applications in the process industries. Recently, there is increased interest in using the tomographic details from ECT for comparing with and validating and tuning CFD models of multiphase flow. Collaboration with researchers working in the field of computational fluid dynamics (CFD) modeling of multiphase flows gives valuable information for both groups of researchers in the field of ECT and CFD. By studying the ECT tomograms of multiphase flows under carefully monitored inflow conditions of the different media and by obtaining the capacitance values, C(i, j, t) with i = 1…N, j = 1, 2,…N and i ≠ j obtained from ECT modules with N electrodes, it is shown how the interface heights in a pipe with stratified flow of oil and air can be fruitfully compared to the values of those obtained from ECT and gamma radiation meter (GRM) for improving CFD modeling. Monitored inflow conditions in this study are flow rates of air, water and oil into a pipe which can be positioned at varying inclinations to the horizontal, thus emulating the pipelines laid in subsea installations. It is found that ECT-based tomograms show most of the features seen in the GRM-based visualizations with nearly one-to-one correspondence to interface heights obtained from these two methods, albeit some anomalies at the pipe wall. However, there are some interesting features the ECT manages to capture: features which the GRM or the CFD modeling apparently do not show, possibly due to parameters not defined in the inputs to the CFD model or much slower response of the GRM. Results presented in this paper indicate that a combination of ECT and GRM and preferably with other modalities with enhanced data fusion and analysis combined with CFD modeling can help to improve the modeling, measurement and control of multiphase flow in the oil and gas industries and in the process industries

  3. Implementation of CFD modeling in the performance assessment and optimization of secondary clarifiers: the PVSC case study.

    Xanthos, S; Ramalingam, K; Lipke, S; McKenna, B; Fillos, J


    The water industry and especially the wastewater treatment sector has come under steadily increasing pressure to optimize their existing and new facilities to meet their discharge limits and reduce overall cost. Gravity separation of solids, producing clarified overflow and thickened solids underflow has long been one of the principal separation processes used in treating secondary effluent. Final settling tanks (FSTs) are a central link in the treatment process and often times act as the limiting step to the maximum solids handling capacity when high throughput requirements need to be met. The Passaic Valley Sewerage Commission (PVSC) is interested in using a computational fluid dynamics (CFD) modeling approach to explore any further FST retrofit alternatives to sustain significantly higher plant influent flows, especially under wet weather conditions. In detail there is an interest in modifying and/or upgrading/optimizing the existing FSTs to handle flows in the range of 280-720 million gallons per day (MGD) (12.25-31.55 m(3)/s) in compliance with the plant's effluent discharge limits for total suspended solids (TSS). The CFD model development for this specific plant will be discussed, 2D and 3D simulation results will be presented and initial results of a sensitivity study between two FST effluent weir structure designs will be reviewed at a flow of 550 MGD (∼24 m(3)/s) and 1,800 mg/L MLSS (mixed liquor suspended solids). The latter will provide useful information in determining whether the existing retrofit of one of the FSTs would enable compliance under wet weather conditions and warrants further consideration for implementing it in the remaining FSTs.

  4. Use of CFD modeling for estimating spatial representativeness of urban air pollution monitoring sites and suitability of their locations

    Santiago, J. L.; Martin, F.


    A methodology to estimate the spatial representativeness of air pollution monitoring sites is applied to two urban districts. This methodology is based on high resolution maps of air pollution computed by using Computational Fluid Dynamics (CFD) modelling tools. Traffic-emitted NO{sub 2} dispersion is simulated for several meteorological conditions taking into account the effect of the buildings on air flow and pollutant dispersion and using a steady state CFD-RANS approach. From these results, maps of average pollutant concentrations for January -May 2011 are computed as a combination of the simulated scenarios. Two urban districts of Madrid City were simulated. Spatial representativeness areas for 32 different sites within the same district (including the site of the operative air quality stations) have been estimated by computing the portion of the domains with average NO{sub 2} concentration differing less than a 20% of the concentration at each candidate monitoring site. New parameters such as the ratio AR between the representativeness area and the whole domain area or the representativeness index (IR) has been proposed to discuss and compare the representativeness areas. Significant differences between the spatial representativeness of the candidate sites of both studied districts have been found. The sites of the Escuelas Aguirre district have generally smaller representativeness areas than those of the Plaza de Castilla. More stations are needed to cover the Escuelas Aguirre district than for the Plaza de Castilla one. The operative air quality station of the Escuelas Aguirre district is less representative than the station of the Plaza de Castilla district. The cause of these differences seems to be the differences in urban structure of both districts prompting different ventilation. (Author)

  5. Use of CFD modeling for estimating spatial representativeness of urban air pollution monitoring sites and suitability of their locations

    Santiago, J.L.; Martin, F.


    A methodology to estimate the spatial representativeness of air pollution monitoring sites is applied to two urban districts. This methodology is based on high resolution maps of air pollution computed by using Computational Fluid Dynamics (CFD) modelling tools. Traffic-emitted NO2 dispersion is simulated for several meteorological conditions taking into account the effect of the buildings on air flow and pollutant dispersion and using a steady state CFD-RANS approach. From these results, maps of average pollutant concentrations for January–May 2011 are computed as a combination of the simulated scenarios. Two urban districts of Madrid City were simulated. Spatial representativeness areas for 32 different sites within the same district (including the site of the operative air quality stations) have been estimated by computing the portion of the domains with average NO2 concentration differing less than a 20% of the concentration at each candidate monitoring site. New parameters such as the ratio AR between the representativeness area and the whole domain area or the representativeness index (IR) has been proposed to discuss and compare the representativeness areas. Significant differences between the spatial representativeness of the candidate sites of both studied districts have been found. The sites of the Escuelas Aguirre district have generally smaller representativeness areas than those of the Plaza de Castilla. More stations are needed to cover the Escuelas Aguirre district than for the Plaza de Castilla one. The operative air quality station of the Escuelas Aguirre district is less representative than the station of the Plaza de Castilla district. The cause of these differences seems to be the differences in urban structure of both districts prompting different ventilation. (Author)

  6. A comparison of the CFD simulation results in 5 x 5 sub-channels with mixing grids using different turbulence models

    Yang, L.X.; Zhou, M.J.; Chao, Y.M. [Beijing Jiaotong Univ. (China). School of Mechanical Electronic and Control Engineering


    We evaluated the performance of various turbulence models, including eddy viscosity models and Reynolds stress models, when analyzing rod bundles in fuel assemblies using the Computational Fluid Dynamics (CFD) method. The models were assessed by calculating the pressure drop and Nusselt numbers in 5 x 5 rod bundles using the CFD software ANSYS CFX. Comparisons between the numerical and experimental results, as well as the swirl factor, cross-flow factor, and turbulence intensity utilized to evaluate the swirling and cross-flow, were used to analyze the inner relationship between the flow field and heat transfer. These comparisons allow the selection of the most appropriate turbulence model for modeling flow features and heat transfer in rod bundles.

  7. Statistical Analysis of Detailed 3-D CFD LES Simulations with Regard to CCV Modeling

    Vítek Oldřich


    Full Text Available The paper deals with statistical analysis of large amount of detailed 3-D CFD data in terms of cycle-to-cycle variations (CCVs. These data were obtained by means of LES calculations of many consecutive cycles. Due to non-linear nature of Navier-Stokes equation set, there is a relatively significant CCV. Hence, every cycle is slightly different – this leads to requirement to perform statistical analysis based on ensemble averaging procedure which enables better understanding of CCV in ICE including its quantification. The data obtained from the averaging procedure provides results on different space resolution levels. The procedure is applied locally, i.e., in every cell of the mesh. Hence there is detailed CCV information on local level – such information can be compared with RANS simulations. Next, volume/mass averaging provides information at specific locations – e.g., gap between electrodes of a spark plug. Finally, volume/mass averaging of the whole combustion chamber leads to global information which can be compared with experimental data or results of system simulation tools (which are based on 0-D/1-D approach.

  8. CFD Lagrangian Modeling of Water Droplet Transport for ISS Hygiene Activity Application

    Son, Chang H.


    The goal of this study was to assess the impacts of free water propagation in the Waste and Hygiene Compartment (WHC) installed in Node 3. Free water can be generated inside the WHC in small quantities due to crew hygiene activity. To mitigate potential impact of free water in Node 3 cabin the WHC doorway is enclosed by a waterproof bump-out, Kabin, with openings at the top and bottom. At the overhead side of the rack, there is a screen that prevents large drops of water from exiting. However, as the avionics fan in the WHC causes airflow toward the deck side of the rack, small quantities of free water may exit at the bottom of the Kabin. A Computational Fluid Dynamics (CFD) analysis of Node 3 cabin airflow enable identifying the paths of water transport. To simulate the droplet transport the Lagrangian discrete phase approach was used. Various initial droplet distributions were considered in the study. The droplet diameter was varied in the range of 5-20 mm. The results of the computations showed that most of the drops fall to the rack surface not far from the WHC curtain.

  9. A non-CFD modeling system for computing 3D wind and concentration fields in urban environments

    Nelson, Matthew A [Los Alamos National Laboratory; Brown, Michael J [Los Alamos National Laboratory; Williams, Michael D [Los Alamos National Laboratory; Gowardhan, Akshay [Los Alamos National Laboratory; Pardyjak, Eric R [UNIV OF UTAH


    The Quick Urban & Industrial Complex (QUIC) Dispersion Modeling System has been developed to rapidly compute the transport and dispersion of toxic agent releases in the vicinity of buildings. It is composed of an empirical-diagnostic wind solver, an 'urbanized' Lagrangian random-walk model, and a graphical user interface. The code has been used for homeland security and environmental air pollution applications. In this paper, we discuss the wind solver methodology and improvements made to the original Roeckle schemes in order to better capture flow fields in dense built-up areas. The mode1-computed wind and concentration fields are then compared to measurements from several field experiments. Improvements to the QUIC Dispersion Modeling System have been made to account for the inhomogeneous and complex building layouts found in large cities. The logic that has been introduced into the code is described and comparisons of model output to full-scale outdoor urban measurements in Oklahoma City and New York City are given. Although far from perfect, the model agreed fairly well with measurements and in many cases performed equally to CFD codes.

  10. CFD model for ventilation assessment in poultry houses with different distribution of windows

    Eva H. Guerra-Galdo, Salvador Calvet Sanz, Fernando Estellés Barber, P. Amparo López-Jiménez


    Full Text Available The design of structures for animal husbandry has energy and environmental implications. Particularly, the design of broiler houses should consider the comfort of animals in different situations, which is crucial for their proper development. Building geometry and distribution of fans and windows determine critically the ventilation flows and temperature distribution. The use of fluid analysis techniques can be of valuable help in the initial phases of the design of farms, because potential alternatives may be explored. In this study, Computational Fluid Dynamics (CFD simulations were used to evaluate the ventilation and temperature distribution in three tunnel, mechanically ventilated broiler houses with identical geometry but different distribution of inlet windows and exhaust fans. The three distributions were: (1 Tunnel (fans at the end of the building; (2 Semitunnel (fans at the middle of the building; and (3 Improved Semitunnel (with improved window distribution. For each distribution, air velocity and temperature at the height of the broilers are evaluated at different outdoor conditions. The Index of Temperature and Velocity (ITV was used as an indicator of animal comfort. Improved tunnel presented more homogeneous values of velocity and air temperature, with average velocity of 0.89 ± 0.30m.s-1 and average temperature of 23.37 ± 0.79ºC. This distribution had the highest comfort area considering air velocity and temperature (88.45% and 94.52% of the area, respectively. The lowest average ITV corresponded to tunnel type (23.24 ± 1.54ºC but the highest proportion of comfort zone considering ITV (ITV less than 25 corresponded to the improved semitunnel (90.35% of the area. The three configurations maintained a productive environment of ITV. The simulation results were similar to the literature indications for velocities and temperatures at animal level.

  11. DEM/CFD modelling of the deposition of dilute granular systems in a vertical container

    YU Shen; GUO Yu; WU ChuanYu


    Deposition of granular materials into a container is a general industrial packing process. In this study, the deposition behaviour of dilute granular mixtures consisting of two types of particles that were of the same particle size but different particle densities in the presence of air was numerically analyzed using a coupled discrete element method (DEM) and computational fluid dynamics (CFD). Bilayer gra-nular mixtures with light particles at bottom and heavy particles at top were first simulated. It was found that the presence of air significantly affected the flow behaviour of the bilayer mixtures. For the system with a relatively low initial void fraction, the air entrapped inside the container escaped through the dilated zones induced due to the friction between the powder bed and wall surfaces. The escaping air streams entrained light particles that were originally located at the bottom of the granular system. Consequently, these light particles were migrated to the top of the granular bed at the end of deposition process. More light particles were migrated when the deposition distance was increased. For the sys-tem with a high initial void fraction, some light particles penetrated into the top layer of heavy particles and created a mixing zone. Deposition of random mixtures with different initial void fractions was also investigated and the influence of initial void fraction on the segregation behaviour was explored as well. It was found that the increase of void fraction promoted segregation during the deposition in air. It was demonstrated that, for granular mixtures consisting of particles of different air sensitivities, the pres-ence of air had a significant impact on the mixing and segregation behaviour during the deposition.

  12. CFD Modelling of the Effects of Operating Parameters on the Spreading of Liquids on a Spinning Disc

    Y. Pan


    Full Text Available A novel dry slag granulation process based on a spinning disc is being developed by CSIRO. This process utilises centrifugal force to break up molten slag into droplets, which are then quenched into solidified granules by a flow of cold air. In this process the sensible heat of slag is recovered as hot air. In the present work, a previously developed steady-state, two-dimensional and multiphase CFD model was applied to perform parametric numerical experiments to investigate the effects of a number of parameters on the liquid film thickness at the disc edge, which included liquid mass feeding (pouring rate, disc spinning speed, disc radius, liquid viscosity, density and surface tension. The modelling results were compared with experimental data and were found to be in good agreement. To reduce the number of simulations needed, Box and Behnken's fractional factorial design of numerical experiment was adopted. Furthermore, in order for the modelling results to be applicable to atomisation of different liquids using spinning discs of different sizes, a dimensionless correlation was developed based on dimensional analysis of the numerical simulation data. The modelling results indicate that the liquid film thickness can be significantly influenced by the disc radius and spinning speed, the liquid mass feeding rate, viscosity and density, whereas the liquid surface tension has a negligible effect.

  13. The REACT Project

    Bloch, Paul; Blystad, Astrid; Byskov, Jens;

    selected disease and programme interventions and services, within general care and on health systems management. Efforts to improve health sector performance have not yet been satisfactory, and adequate and sustainable improvements in health outcomes have not been shown. Priority setting in health systems...... decisions; and the provision of leadership and the enforcement of conditions. REACT - "REsponse to ACcountable priority setting for Trust in health systems" is an EU-funded five-year intervention study, which started in 2006 testing the application and effects of the AFR approach in one district each...... in Kenya, Tanzania and Zambia. Qualitative and quantitative methods are applied in an action research framework. The project baseline surveys have already been completed and indicate both a strong need and a high willingness for change in the study districts. REACT has developed active research...

  14. Application of CFD Modeling to Hydrodynamics of CycloBio Fluidized Sand Bed in Recirculating Aquaculture Systems

    LIU Yao; SONG Xiefa; LIANG Zhenlin; PENG Lei


    To improve the efficiency of a CycloBio fluidized sand bed (CB FSB) in removal of dissolved wastes in recirculating aquaculture systems, the hydrodynamics of solid-liquid flow was investigated using computational fluid dynamics (CFD) modeling tools. The dynamic characteristics of silica sand within the CB FSB were determined using three-dimensional, unsteady-state simula-tions with the granular Eulerian multiphase approach and the RNG k-ε turbulence model, and the simulation results were validated using available lab-scale measurements. The bed expansion of CB FSB increased with the increase in water inflow rate in numerical simulations. Upon validation, the simulation involving 0.55 mm particles, the Gidaspow correlation for drag coefficient model and the Syamlal-O’Brien correlation for kinetic granular viscosity showed the closest match to the experimental results. The volume frac-tion of numerical simulations peaked as the wall was approached. The hydrodynamics of a pilot-scale CB FSB was simulated in or-der to predict the range of water flow to avoid the silica sand overflowing. The numerical simulations were in agreement with the experimental results qualitatively and quantitatively, and thus can be used to study the hydrodynamics of solid-liquid multiphase flow in CB FSB, which is of importance to the design, optimization, and amplification of CB FSBs.


    Jan Skočilas


    Full Text Available This paper deals with a computational fluid dynamics (CFD simulation of the heat transfer process during turbulent hot water flow between two chevron plates in a plate heat exchanger. A three-dimensional model with the simplified geometry of two cross-corrugated channels provided by chevron plates, taking into account the inlet and outlet ports, has been designed for the numerical study. The numerical model was based on the shear-stress transport (SST k-! model. The basic characteristics of the heat exchanger, as values of heat transfer coefficient and pressure drop, have been investigated. A comparative analysis of analytical calculation results, based on experimental data obtained from literature, and of the results obtained by numerical simulation, has been carried out. The coefficients and the exponents in the design equations for the considered plates have been arranged by using simulation results. The influence on the main flow parameters of the corrugation inclination angle relative to the flow direction has been taken into account. An analysis of the temperature distribution across the plates has been carried out, and it has shown the presence of zones with higher heat losses and low fluid flow intensity.

  16. Využití programu SolidWorks k přípravě modelů CFD

    Švaňhal, Radek


    Tato bakalářská práce analyzuje využití programu SolidWorks k přípravě modelů CFD (výpočet proudění metodou konečných objemů). Práce v první části popisuje způsob přípravy modelu kapaliny protékající oběžným kolem Francisovy turbíny a uvádí obzvláště užitečné funkce a vhodné postupy. V druhé části je rozebrány výhody přípravy modelů v programu SolidWorks. V poslední části je popsána tvorba sítě konečných objemů pro sestrojený model v programu Gambit. Závěrem je zhodnocen celkový přínos použit...

  17. Development and validation of advanced CFD models for detailed predictions of void distribution in a BWR bundle

    Neykov, Boyan

    In recent years, a commonly adopted approach is to use Computational Fluid Dynamics (CFD) codes as computational tools for simulation of different aspects of the nuclear reactor thermal-hydraulic performance where high-resolution and high-fidelity modeling is needed. Within the framework of this PhD work, the CFD code STAR-CD [1] is used for investigations of two phase flow in air-water systems as well as boiling phenomena in simple pipe geometry and in a Boiling Water Reactor (BWR) fuel assembly. Based on the two-fluid Eulerian solver, improvements of the STAR-CD code in the treatment of the drag, lift and wall lubrication forces in a dispersed two phase flow at high vapor (gas) phase fractions are investigated and introduced. These improvements constitute a new two phase modeling framework for STAR-CD, which has been shown to be superior as compared to the default models in STAR-CD. The conservation equations are discretized using the finite-volume method and solved using a solution procedure is based on Pressure Implicit with Splitting of Operators (PISO) algorithm, adapted to the solution of the two-fluid model. The improvements in the drag force modeling include investigation and integration of models with dependence on both void fraction and bubble diameter. The set of the models incorporated into STAR-CD is selected based on an extensive literature review focused on two phase systems with high vapor fractions. The research related to the modeling of wall lubrication force is focused on the validation of the already existing model in STAR-CD. The major contribution of this research is the development and implementation of an improved correlation for the lift coefficient used in the lift force formula. While a variety of correlations for the lift coefficient can be found in the open literature, most of those were derived from experiments conducted at low vapor (gas) phase fractions and are not applicable to the flow conditions existing in the BWRs. Therefore

  18. A Performance Prediction Method for Pumps as Turbines (PAT Using a Computational Fluid Dynamics (CFD Modeling Approach

    Emma Frosina


    Full Text Available Small and micro hydropower systems represent an attractive solution for generating electricity at low cost and with low environmental impact. The pump-as-turbine (PAT approach has promise in this application due to its low purchase and maintenance costs. In this paper, a new method to predict the inverse characteristic of industrial centrifugal pumps is presented. This method is based on results of simulations performed with commercial three-dimensional Computational Fluid Dynamics (CFD software. Model results have been first validated in pumping mode using data supplied by pump manufacturers. Then, the results have been compared to experimental data for a pump running in reverse. Experimentation has been performed on a dedicated test bench installed in the Department of Civil Construction and Environmental Engineering of the University of Naples Federico II. Three different pumps, with different specific speeds, have been analyzed. Using the model results, the inverse characteristic and the best efficiency point have been evaluated. Finally, results have been compared to prediction methods available in the literature.

  19. Two-compartmental population balance modeling of a pulsed spray fluidized bed granulation based on computational fluid dynamics (CFD) analysis.

    Liu, Huolong; Li, Mingzhong


    In this work a two-compartmental population balance model (TCPBM) was proposed to model a pulsed top-spray fluidized bed granulation. The proposed TCPBM considered the spatially heterogeneous granulation mechanisms of the granule growth by dividing the granulator into two perfectly mixed zones of the wetting compartment and drying compartment, in which the aggregation mechanism was assumed in the wetting compartment and the breakage mechanism was considered in the drying compartment. The sizes of the wetting and drying compartments were constant in the TCPBM, in which 30% of the bed was the wetting compartment and 70% of the bed was the drying compartment. The exchange rate of particles between the wetting and drying compartments was determined by the details of the flow properties and distribution of particles predicted by the computational fluid dynamics (CFD) simulation. The experimental validation has shown that the proposed TCPBM can predict evolution of the granule size and distribution within the granulator under different binder spray operating conditions accurately. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Three-Dimensional CFD Modeling of Transport Phenomena in a Cross-Flow Anode-Supported Planar SOFC

    Zhonggang Zhang


    Full Text Available In this study, a three-dimensional computational fluid dynamics (CFD model is developed for an anode-supported planar SOFC from the Chinese Academy of Science Ningbo Institute of Material Technology and Engineering (NIMTE. The simulation results of the developed model are in good agreement with the experimental data obtained under the same conditions. With the simulation results, the distribution of temperature, flow velocity and the gas concentrations through the cell components and gas channels is presented and discussed. Potential and current density distributions in the cell and overall fuel utilization are also presented. It is also found that the temperature gradients exist along the length of the cell, and the maximum value of the temperature for the cross-flow is at the outlet region of the cell. The distribution of the current density is uneven, and the maximum current density is located at the interfaces between the channels, ribs and the electrodes, the maximum current density result in a large over-potential and heat source in the electrodes, which is harmful to the overall performance and working lifespan of the fuel cells. A new type of flow structure should be developed to make the current flow be more evenly distributed and promote most of the TPB areas to take part in the electrochemical reactions.

  1. Evaluation of a Heating System in Poultry Houses Using a CFD Model / Evaluación de un Sistema de Calefacción en Galpones Avicolas Usando un Modelo en CFD

    Flávio Alves Damasceno


    Full Text Available Abstract.. The objective of this study was to adapt and validate a computer model using the Computational Fluid Dinamics (CFD, in the prediction of temperature and air speed in a duct distribution system coupled to a heating furnace that is used in typical poultry houses in tropical and subtropical countries. The validation of the model with experimental data was satisfactory, presentingnormalized mean square error NMSE values of 0.25 and 0.02 for air temperature and air speed, respectively. The results evidenced that the proposed model is adequate for predicting the air speed and temperature for this type of system, and could be used to improve the efficiency of the distribution of heat inside and around air ducts using different air speeds, types of materials and dimensions. / Resumen. El objetivo de este estudio fue adaptar y validar un modelo computacional haciendo uso de la dinámica de fluidos computacional (CFD para predecir la temperatura y la velocidad del aire en un sistema de distribución de ductos acoplado a un sitema de calefacción que es utilizado en las instalaciones avícola en los países tropicales y subtropicales. La validación del modelo con los datos experimentales fue satisfactoria, presentando valores medios normalizados del error cuadrado NMSE de 0,25 y 0,02 para la temperatura y velocidad del aire respectivamente. Los resultados muestran que el modelo propuesto es adecuado para predecir la velocidad del aire y la temperatura alrededor de este tipo de sistema, y podría ser utilizado para mejorar la eficiencia la distribución de calor en el interior y alrededor de los conductos, usando diferentes velocidades, tipos de materiales y dimensiones. 

  2. Real gas CFD simulations of hydrogen/oxygen supercritical combustion

    Pohl, S.; Jarczyk, M.; Pfitzner, M.; Rogg, B.


    A comprehensive numerical framework has been established to simulate reacting flows under conditions typically encountered in rocket combustion chambers. The model implemented into the commercial CFD Code ANSYS CFX includes appropriate real gas relations based on the volume-corrected Peng-Robinson (PR) equation of state (EOS) for the flow field and a real gas extension of the laminar flamelet combustion model. The results indicate that the real gas relations have a considerably larger impact on the flow field than on the detailed flame structure. Generally, a realistic flame shape could be achieved for the real gas approach compared to experimental data from the Mascotte test rig V03 operated at ONERA when the differential diffusion processes were only considered within the flame zone.

  3. Phase-contrast MRI and CFD modeling of apparent 3He gas flow in rat pulmonary airways

    Minard, Kevin R.; Kuprat, Andrew P.; Kabilan, Senthil; Jacob, Richard E.; Einstein, Daniel R.; Carson, James P.; Corley, Richard A.


    Phase-contrast (PC) magnetic resonance imaging (MRI) with hyperpolarized 3He is potentially useful for developing and testing patient-specific models of pulmonary airflow. One challenge, however, is that PC-MRI provides apparent values of local 3He velocity that not only depend on actual airflow but also on gas diffusion. This not only blurs laminar flow patterns in narrow airways but also introduces anomalous airflow structure that reflects gas-wall interactions. Here, both effects are predicted in a live rat using computational fluid dynamics (CFD), and for the first time, simulated patterns of apparent 3He gas velocity are compared with in vivo PC-MRI. Results show (1) that correlations (R2) between measured and simulated airflow patterns increase from 0.23 to 0.79 simply by accounting for apparent 3He transport, and (2) that remaining differences are mainly due to uncertain airway segmentation and partial volume effects stemming from relatively coarse MRI resolution. Higher-fidelity testing of pulmonary airflow predictions should therefore be possible with future imaging improvements.

  4. Numerical simulation of reacting and non-reacting flow in a combustion chamber; Numerisk simulering av reagerande och icke-reagerande stroemning i en braennkammare

    Borg, A.; Revstedt, J.


    The purpose of this work has been to do a preliminary study of how well numerical calculations with different turbulence models can predict the flow and temperature fields of a strongly swirling and combusting flow in an experimental combustion chamber and to see which parameters in the mathematical model are the most important. The combustion chamber on which we have done the calculations is called Validation Rig II and was designed by Volvo Aero Corporation. The main part of the study has been carried out on a non-reacting flow but some work has also been done on reacting flow. In most cases it has not been meaningful to compare the calculations with the measurements because they differ quite a lot from each other. For the non-reacting case the following investigations have been made: * How the solution differs for different turbulence models, * The solutions sensitivity to inlet boundary conditions, * How different types of leakage disturb the flow, and * The difference in results between two different CFD-codes, the commercial code CFDS-Flow3D and a code developed at the department of fluid mechanics. For the reacting cases we have studied the influence of: * one or two reaction steps, * the effects of a change in reaction rate, * the influence of thermal radiation, and * the effects of changing the boundary conditions for temperature on the walls. The results from these calculations show that the inlet turbulence intensity has very little effect on the values of the turbulent quantities as well as the velocity profiles at the outlet. Changing the turbulence model or the outlet boundary conditions gives some change in velocity profiles at the outlet but only marginal effects on the swirl number. 21 refs, 54 figs, 19 tabs

  5. Development of an unresolved CFD-DEM model for the flow of viscous suspensions and its application to solid-liquid mixing

    Blais, Bruno; Lassaigne, Manon; Goniva, Christoph; Fradette, Louis; Bertrand, François


    Although viscous solid-liquid mixing plays a key role in the industry, the vast majority of the literature on the mixing of suspensions is centered around the turbulent regime of operation. However, the laminar and transitional regimes face considerable challenges. In particular, it is important to know the minimum impeller speed (Njs) that guarantees the suspension of all particles. In addition, local information on the flow patterns is necessary to evaluate the quality of mixing and identify the presence of dead zones. Multiphase computational fluid dynamics (CFD) is a powerful tool that can be used to gain insight into local and macroscopic properties of mixing processes. Among the variety of numerical models available in the literature, which are reviewed in this work, unresolved CFD-DEM, which combines CFD for the fluid phase with the discrete element method (DEM) for the solid particles, is an interesting approach due to its accurate prediction of the granular dynamics and its capability to simulate large amounts of particles. In this work, the unresolved CFD-DEM method is extended to viscous solid-liquid flows. Different solid-liquid momentum coupling strategies, along with their stability criteria, are investigated and their accuracies are compared. Furthermore, it is shown that an additional sub-grid viscosity model is necessary to ensure the correct rheology of the suspensions. The proposed model is used to study solid-liquid mixing in a stirred tank equipped with a pitched blade turbine. It is validated qualitatively by comparing the particle distribution against experimental observations, and quantitatively by compairing the fraction of suspended solids with results obtained via the pressure gauge technique.

  6. Film Cooled Recession of SiC/SiC Ceramic Matrix Composites: Test Development, CFD Modeling and Experimental Observations

    Zhu, Dongming; Sakowski, Barbara A.; Fisher, Caleb


    SiCSiC ceramic matrix composites (CMCs) systems will play a crucial role in next generation turbine engines for hot-section component applications because of their ability to significantly increase engine operating temperatures, reduce engine weight and cooling requirements. However, the environmental stability of Si-based ceramics in high pressure, high velocity turbine engine combustion environment is of major concern. The water vapor containing combustion gas leads to accelerated oxidation and corrosion of the SiC based ceramics due to the water vapor reactions with silica (SiO2) scales forming non-protective volatile hydroxide species, resulting in recession of the ceramic components. Although environmental barrier coatings are being developed to help protect the CMC components, there is a need to better understand the fundamental recession behavior of in more realistic cooled engine component environments.In this paper, we describe a comprehensive film cooled high pressure burner rig based testing approach, by using standardized film cooled SiCSiC disc test specimen configurations. The SiCSiC specimens were designed for implementing the burner rig testing in turbine engine relevant combustion environments, obtaining generic film cooled recession rate data under the combustion water vapor conditions, and helping developing the Computational Fluid Dynamics (CFD) film cooled models and performing model validation. Factors affecting the film cooled recession such as temperature, water vapor concentration, combustion gas velocity, and pressure are particularly investigated and modeled, and compared with impingement cooling only recession data in similar combustion flow environments. The experimental and modeling work will help predict the SiCSiC CMC recession behavior, and developing durable CMC systems in complex turbine engine operating conditions.

  7. Multi-physics CFD simulations in engineering

    Yamamoto, Makoto


    Nowadays Computational Fluid Dynamics (CFD) software is adopted as a design and analysis tool in a great number of engineering fields. We can say that single-physics CFD has been sufficiently matured in the practical point of view. The main target of existing CFD software is single-phase flows such as water and air. However, many multi-physics problems exist in engineering. Most of them consist of flow and other physics, and the interactions between different physics are very important. Obviously, multi-physics phenomena are critical in developing machines and processes. A multi-physics phenomenon seems to be very complex, and it is so difficult to be predicted by adding other physics to flow phenomenon. Therefore, multi-physics CFD techniques are still under research and development. This would be caused from the facts that processing speed of current computers is not fast enough for conducting a multi-physics simulation, and furthermore physical models except for flow physics have not been suitably established. Therefore, in near future, we have to develop various physical models and efficient CFD techniques, in order to success multi-physics simulations in engineering. In the present paper, I will describe the present states of multi-physics CFD simulations, and then show some numerical results such as ice accretion and electro-chemical machining process of a three-dimensional compressor blade which were obtained in my laboratory. Multi-physics CFD simulations would be a key technology in near future.

  8. 3D-CFD simulation and neural network model for the j and f factors of the wavy fin-and-flat tube heat exchangers

    M Khoshvaght Aliabadi


    Full Text Available A three dimensional (3D computational fluid dynamics (CFD simulation and a neural network model are presented to estimate the behaviors of the Colburn factor (j and the Fanning friction factor (f for wavy fin - and - flat tube (WFFT heat exchangers. Effects of the five geometrical factors of fin pitch, fin height, fin length, fin thickness, and wavy amplitude are investigated over a wide range of Reynolds number (600CFD simulation results express that the geometrical parameters of wavy fins have significant effects on the j and f factors as a function of Reynolds number. The computational results have an adequate accuracy when compared to experimental data. The accuracy of the calculations of the j and f factors are evaluated by the values of the absolute average relative deviation (AARD, being respectively 3.8% and 8.2% for the CFD simulation and 1.3% and 1% for the neural network model. Finally, new correlations are proposed to estimate the values of the j and f factors with 3.22% and 3.68% AARD respectively.

  9. Thermal management optimization of a thermoelectric-integrated methanol evaporator using a compact CFD modeling approach

    Xin, Gao; Chen, Min; Snyder, G. Jeffrey


    of the TERs under the system working condition fluctuations and during the system cold start. A 3-dimensional evaporator model is generated in ANSYS FLUENT® by combining a compact TE model with various heat exchange structure geometries. The compact TE model can dramatically improve the computation efficiency...

  10. Improving broiler lifestyle: a CFD approach

    Humbert, U


    Full Text Available on Computational and Applied Mechanics Somerset West 14 – 16 January 2014 1 Improving broiler lifestyle: a CFD approach U Humbert 1, 2 , GJC Wessels 2 , JE Smit 2* , O Ubbink 2 1 Institut Polytechnique de Bordeaux for ENSEIRB-MATMECA, France; uhumbert... this is a complex model to replicate and solve, computational fluid dynamics can assist in broiler house design. Keywords: CFD modelling, broiler houses, environmental control, ventilation, food security INTRODUCTION In South Africa agriculture...

  11. A theoretical model on the formation mechanism and kinetics of highly toxic air pollutants from halogenated formaldehydes reacted with halogen atoms

    Ji, Y. M.; Wang, H. H.; Gao, Y. P.; Li, G. Y.; An, T. C.


    The atmospheric reactions of halogenated formaldehydes with halogen atoms were investigated by high-accuracy molecular orbital calculation. Our studies showed that compared to X-addition pathway, the H-abstraction pathway was demonstrated to be more preferred to form halogenated formyl radicals and hydrogen halides (HX). In specific areas with abundant halogen atoms, such as the marine boundary layer (MBL), halogenated formyl radical was reacted easily with halogen atoms and finally transformed into HX and CO2 in the presence of water; otherwise, this radical was degraded to CO2, halogen gas, and halogenated oxide in the presence of O2 and halogen atoms. By using the canonical variational transition state theory, the kinetics calculations were performed within a wide atmospheric temperature range of 200-368 K, and theoretical values agreed well with the available experimental data. Under atmospheric conditions, rate constants decreased as altitude increased, and especially the rate constants of halogen atoms reacted with FCHO quickly reduced. The kinetic results showed that although the reactions of halogenated formaldehydes with F atoms occurred more easily than did those with Cl and Br atoms, the two latter reactions were still important atmospheric degradation process, especially in the MBL. The modified Arrhenius equations of rate constants within the atmospheric temperature range were fitted, which helped to understand the established atmospheric model and estimated the contribution of title reactions to atmospheric chemistry pollution.

  12. An effectiveness-NTU technique for characterising a finned tubes PCM system using a CFD model

    Tay, N. H. Steven; Belusko, M.; Castell, Albert; Cabeza, Luisa F.; Bruno, F.


    Numerical modelling is commonly used to design, analyse and optimise tube-in-tank phase change thermal energy storage systems with fins. A new simplified two dimensional mathematical model, based on the effectiveness-number of transfer units technique, has been developed to characterise tube-in-tank phase change material systems, with radial round fins. The model applies an empirically derived P factor which defines the proportion of the heat flow which is parallel and isothermal....

  13. A comparison of turbulence models in airship steady-state CFD simulations

    Voloshin, Vitaly; Calay, Rajnish K


    The accuracy and resource consumption of the four different turbulence models based on the eddy viscosity assumption, namely, $k-\\varepsilon$, two $k-\\omega$ and Spallart-Allmaram models, in modeling airships are investigated. The test airship shape is a conventional shape. Three different angles of attack are considered. The results are checked against the wind tunnel experimental data. The resource consumption study is based on the benchmark of 1500 iterations. Based on all data obtained it is evident that Spallart-Allmaras model is the most optimal one in the majority of cases.

  14. CFD Modeling of Flow, Temperature, and Concentration Fields in a Pilot-Scale Rotary Hearth Furnace

    Liu, Ying; Su, Fu-Yong; Wen, Zhi; Li, Zhi; Yong, Hai-Quan; Feng, Xiao-Hong


    A three-dimensional mathematical model for simulation of flow, temperature, and concentration fields in a pilot-scale rotary hearth furnace (RHF) has been developed using a commercial computational fluid dynamics software, FLUENT. The layer of composite pellets under the hearth is assumed to be a porous media layer with CO source and energy sink calculated by an independent mathematical model. User-defined functions are developed and linked to FLUENT to process the reduction process of the layer of composite pellets. The standard k-ɛ turbulence model in combination with standard wall functions is used for modeling of gas flow. Turbulence-chemistry interaction is taken into account through the eddy-dissipation model. The discrete ordinates model is used for modeling of radiative heat transfer. A comparison is made between the predictions of the present model and the data from a test of the pilot-scale RHF, and a reasonable agreement is found. Finally, flow field, temperature, and CO concentration fields in the furnace are investigated by the model.

  15. Co-firing biomass and coal-progress in CFD modelling capabilities

    Kær, Søren Knudsen; Rosendahl, Lasse Aistrup; Yin, Chungen


    This paper discusses the development of user defined FLUENT™ sub models to improve the modelling capabilities in the area of large biomass particle motion and conversion. Focus is put on a model that includes the influence from particle size and shape on the reactivity by resolving intra-particle...... particle conversion patterns. The improved model will impact the simulation capabilities of biomass fired boilers in the areas of thermal conditions, NOx formation and particle deposition behaviour.......This paper discusses the development of user defined FLUENT™ sub models to improve the modelling capabilities in the area of large biomass particle motion and conversion. Focus is put on a model that includes the influence from particle size and shape on the reactivity by resolving intra-particle...... gradients. The advanced reaction model predicts moisture and volatiles release characteristics that differ significantly from those found from a 0-dimensional model partly due to the processes occurring in parallel rather than sequentially. This is demonstrated for a test case that illustrates single...

  16. CFD Modeling of Helium Pressurant Effects on Cryogenic Tank Pressure Rise Rates in Normal Gravity

    Grayson, Gary; Lopez, Alfredo; Chandler, Frank; Hastings, Leon; Hedayat, Ali; Brethour, James


    A recently developed computational fluid dynamics modeling capability for cryogenic tanks is used to simulate both self-pressurization from external heating and also depressurization from thermodynamic vent operation. Axisymmetric models using a modified version of the commercially available FLOW-3D software are used to simulate actual physical tests. The models assume an incompressible liquid phase with density that is a function of temperature only. A fully compressible formulation is used for the ullage gas mixture that contains both condensable vapor and a noncondensable gas component. The tests, conducted at the NASA Marshall Space Flight Center, include both liquid hydrogen and nitrogen in tanks with ullage gas mixtures of each liquid's vapor and helium. Pressure and temperature predictions from the model are compared to sensor measurements from the tests and a good agreement is achieved. This further establishes the accuracy of the developed FLOW-3D based modeling approach for cryogenic systems.

  17. Comparison of particle-wall interaction boundary conditions in the prediction of cyclone collection efficiency in computational fluid dynamics (CFD) modeling

    Valverde Ramirez, M.; Coury, J.R.; Goncalves, J.A.S., E-mail: [Universidade Federal de Sao Carlos (UFSCar), Sao Carlos, SP (Brazil). Departamento de Engenharia Quimica


    In recent years, many computational fluid dynamics (CFD) studies have appeared attempting to predict cyclone pressure drop and collection efficiency. While these studies have been able to predict pressure drop well, they have been only moderately successful in predicting collection efficiency. Part of the reason for this failure has been attributed to the relatively simple wall boundary conditions implemented in the commercially available CFD software, which are not capable of accurately describing the complex particle-wall interaction present in a cyclone. According, researches have proposed a number of different boundary conditions in order to improve the model performance. This work implemented the critical velocity boundary condition through a user defined function (UDF) in the Fluent software and compared its predictions both with experimental data and with the predictions obtained when using Fluent's built-in boundary conditions. Experimental data was obtained from eight laboratory scale cyclones with varying geometric ratios. The CFD simulations were made using the software Fluent 6.3.26. (author)

  18. Experimental determination of temperatures of the inner wall of a boiler combustion chamber for the purpose of verification of a CFD model

    Petr Trávníček


    Full Text Available The paper focuses on the non-destructive method of determination of temperatures in the boiler combustion chamber. This method proves to be significant mainly as regards CFD (Computational Fluid Dynamics simulations of combustion processes, in case of which it is subsequently advisable to verify the data calculated using CFD software application with the actually measured data. Verification of the method was based on usage of reference combustion equipment (130 kW which performs combustion of a mixture of waste sawdust and shavings originating in the course of production of wooden furniture. Measuring of temperatures inside the combustion chamber is – considering mainly the high temperature values – highly demanding and requires a special type of temperature sensors. Furthermore, as regards standard operation, it is not possible to install such sensors without performing structural alterations of the boiler. Therefore, for the purpose of determination of these temperatures a special experimental device was constructed while exploiting a thermal imaging system used for monitoring of the surface temperature of outer wall of the reference boiler. Temperatures on the wall of the boiler combustion chamber were determined on the basis of data measured using the experimental device as well as data from the thermal imaging system. These values might serve for verification of the respective CFD model of combustion equipment.

  19. Turbulence-induced bubble collision force modeling and validation in adiabatic two-phase flow using CFD

    Sharma, Subash L., E-mail: [School of Nuclear Engineering, Purdue University, West Lafayette, IN 47907-1290 (United States); Hibiki, Takashi; Ishii, Mamoru [School of Nuclear Engineering, Purdue University, West Lafayette, IN 47907-1290 (United States); Brooks, Caleb S. [Department of Nuclear, Plasma, and Radiological Engineering, University of Illinois, Urbana, IL 61801 (United States); Schlegel, Joshua P. [Nuclear Engineering Program, Missouri University of Science and Technology, Rolla, MO 65409 (United States); Liu, Yang [Nuclear Engineering Program, Department of Mechanical Engineering, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061 (United States); Buchanan, John R. [Bechtel Marine Propulsion Corporation, Bettis Laboratory, West Mifflin, PA 15122 (United States)


    Highlights: • Void distribution in narrow rectangular channel with various non-uniform inlet conditions. • Modeling of void diffusion due to bubble collision force. • Validation of new modeling in adiabatic air–water two-phase flow in a narrow channel. - Abstract: The prediction capability of the two-fluid model for gas–liquid dispersed two-phase flow depends on the accuracy of the closure relations for the interfacial forces. In previous studies of two-phase flow Computational Fluid Dynamics (CFD), interfacial force models for a single isolated bubble has been extended to disperse two-phase flow assuming the effect in a swarm of bubbles is similar. Limited studies have been performed investigating the effect of the bubble concentration on the lateral phase distribution. Bubbles, while moving through the liquid phase, may undergo turbulence-driven random collision with neighboring bubbles without significant coalescence. The rate of these collisions depends upon the bubble approach velocity and bubble spacing. The bubble collision frequency is expected to be higher in locations with higher bubble concentrations, i.e., volume fraction. This turbulence-driven random collision causes the diffusion of the bubbles from high concentration to low concentration. Based on experimental observations, a phenomenological model has been developed for a “turbulence-induced bubble collision force” for use in the two-fluid model. For testing the validity of the model, two-phase flow data measured at Purdue University are utilized. The geometry is a 10 mm × 200 mm cross section channel. Experimentally, non-uniform inlet boundary conditions are applied with different sparger combinations to vary the volume fraction distribution across the wider dimension. Examining uniform and non-uniform inlet data allows for the influence of the volume fraction to be studied as a separate effect. The turbulence-induced bubble collision force has been implemented in ANSYS CFX. The

  20. A CFD Model for Fluid Dynamics in a Gas-fluidised Bed

    ZHANG Kai; Stefano Brandani


    A modified particle bed model derived from the two-fluid momentum balance equations was employed to predict the gas-fluidised bed behaviour. Additional terms are included in both the fluid and the particle momentum balance equations to take into account the effect of the dispersed solid phase. This model has been extended to two-dimensional formulations and has been implemented in the commercial code CFX 4.3. The model correctly simulates the homogeneous fluidisation of Geldart Group A and the bubbling fluidisation of Geldart Group B in gas-solid fluidised beds.

  1. Prediction and validation of pool fire development in enclosures by means of CFD Models for risk assessment of nuclear power plants (Poolfire) - Report year 2

    van Hees, P.; Wahlqvist, J.; Kong, D. [Lund Univ., Lund (Sweden); Hostikka, S.; Sikanen, T. [VTT Technical Research Centre of Finland (Finland); Husted, B. [Haugesund Univ. College, Stord (Norway); Magnusson, T. [Ringhals AB, Vaeroebacka (Sweden); Joerud, F. [European Spallation Source (ESS), Lund (Sweden)


    Fires in nuclear power plants can be an important hazard for the overall safety of the facility. One of the typical fire sources is a pool fire. It is therefore important to have good knowledge on the fire behaviour of pool fire and be able to predict the heat release rate by prediction of the mass loss rate. This project envisages developing a pyrolysis model to be used in CFD models. In this report the activities for second year are reported, which is an overview of the experiments conducted, further development and validation of models and cases study to be selected in year 3. (Author)

  2. The role of CFD combustion modelling in hydrogen safety management – VI: Validation for slow deflagration in homogeneous hydrogen-air-steam experiments

    Cutrono Rakhimov, A., E-mail: [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands); Visser, D.C., E-mail: [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands); Holler, T., E-mail: [Jožef Stefan Institute (JSI), Jamova cesta 39, 1000 Ljubljana (Slovenia); Komen, E.M.J., E-mail: [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands)


    Highlights: • Deflagration of hydrogen-air-steam homogeneous mixtures is modeled in a medium-scale containment. • Adaptive mesh refinement is applied on flame front positions. • Steam effect influence on combustion modeling capabilities is investigated. • Mean pressure rise is predicted with 18% under-prediction when steam is involved. • Peak pressure is evaluated with 5% accuracy when steam is involved. - Abstract: Large quantities of hydrogen can be generated during a severe accident in a water-cooled nuclear reactor. When released in the containment, the hydrogen can create a potential deflagration risk. The dynamic pressure loads resulting from hydrogen combustion can be detrimental to the structural integrity of the reactor. Therefore, accurate prediction of these pressure loads is an important safety issue. In previous papers, we validated a Computational Fluid Dynamics (CFD) based method to determine the pressure loads from a fast deflagration. The combustion model applied in the CFD method is based on the Turbulent Flame Speed Closure (TFC). In our last paper, we presented the extension of this combustion model, Extended Turbulent Flame Speed Closure (ETFC), and its validation against hydrogen deflagration experiments in the slow deflagration regime. During a severe accident, cooling water will enter the containment as steam. Therefore, the effect of steam on hydrogen deflagration is important to capture in a CFD model. The primary objectives of the present paper are to further validate the TFC and ETFC combustion models, and investigate their capability to predict the effect of steam. The peak pressures, the trends of the flame velocity, and the pressure rise with an increase in the initial steam dilution are captured reasonably well by both combustion models. In addition, the ETFC model appeared to be more robust to mesh resolution changes. The mean pressure rise is evaluated with 18% under-prediction and the peak pressure is evaluated with 5

  3. CFD-DP Modeling of Multiphase Flow in Dense Medium Cyclone

    Okan Topcu


    Full Text Available A numerical study of the gas-liquid-solid multi-phase flow in a hydrocyclone is summarized in this paper. The turbulent flow of the gas and the liquid is modelled using the realizable k-epsilon turbulence model, the interface between the liquid and the air core is modelled using the Eulerian multi-phase model and the simulation of the particle flow described by the dense discrete phase model in which the data of the multi-phase flow are used. Separation efficiency, particle trajectories, split ratios, flow field and pressure drop are the examined flow features. The results show that the flow fields in the hydrocyclones are possible to simulate by realizable k-epsilon model which is a fast solver for turbulent flows. The cut size is achieved between 3 and 15 µm. The air-core development is observed to be a transport effect due to the velocity of surrounding fluid rather than a pressure effect. The approach offers a useful method to observe the flow of a hydrocyclone in relation to design of the system and operational conditions.

  4. Improved CFD Model to Predict Flow and Temperature Distributions in a Blast Furnace Hearth

    Komiyama, Keisuke M.; Guo, Bao-Yu; Zughbi, Habib; Zulli, Paul; Yu, Ai-Bing


    The campaign life of a blast furnace is limited by the erosion of hearth refractories. Flow and temperature distributions of the liquid iron have a significant influence on the erosion mechanism. In this work, an improved three-dimensional computational fluid dynamics model is developed to simulate the flow and heat transfer phenomena in the hearth of BlueScope's Port Kembla No. 5 Blast Furnace. Model improvements feature more justified input parameters in turbulence modeling, buoyancy modeling, wall boundary conditions, material properties, and modeling of the solidification of iron. The model is validated by comparing the calculated temperatures with the thermocouple data available, where agreements are established within ±3 pct. The flow distribution in the hearth is discussed for intact and eroded hearth profiles, for sitting and floating coke bed states. It is shown that natural convection affects the flow in several ways: for example, the formation of (a) stagnant zones preventing hearth bottom from eroding or (b) the downward jetting of molten liquid promoting side wall erosion, or (c) at times, a vortex-like peripheral flow, promoting the "elephant foot" type erosion. A significant influence of coke bed permeability on the macroscopic flow pattern and the refractory temperature is observed.

  5. Enhanced Kalman Filtering for a 2D CFD NS Wind Farm Flow Model

    Doekemeijer, B. M.; van Wingerden, J. W.; Boersma, S.; Pao, L. Y.


    Wind turbines are often grouped together for financial reasons, but due to wake development this usually results in decreased turbine lifetimes and power capture, and thereby an increased levelized cost of energy (LCOE). Wind farm control aims to minimize this cost by operating turbines at their optimal control settings. Most state-of-the-art control algorithms are open-loop and rely on low fidelity, static flow models. Closed-loop control relying on a dynamic model and state observer has real potential to further decrease wind's LCOE, but is often too computationally expensive for practical use. In this paper two time-efficient Kalman filter (KF) variants are outlined incorporating the medium fidelity, dynamic flow model “WindFarmSimulator” (WFSim). This model relies on a discretized set of Navier-Stokes equations in two dimensions to predict the flow in wind farms at low computational cost. The filters implemented are an Ensemble KF and an Approximate KF. Simulations in which a high fidelity simulation model represents the true wind farm show that these filters are 101 —102 times faster than a regular KF with comparable or better performance, correcting for wake dynamics that are not modeled in WFSim (noticeably, wake meandering and turbine hub effects). This is a first big step towards real-time closed-loop control for wind farms.

  6. 3D CFD Modeling of Local Scouring, Bed Armoring and Sediment Deposition

    Gergely T. Török


    Full Text Available 3D numerical models are increasingly used to simulate flow, sediment transport and morphological changes of rivers. For the simulation of bedload transport, the numerical flow model is generally coupled with an empirical sediment transport model. The application range of the most widely used empirical models is, however, often limited in terms of hydraulic and sedimentological features and therefore the numerical model can hardly be applied to complex situations where different kinds of morphological processes take place at the same time, such as local scouring, bed armoring and aggradation of finer particles. As a possible solution method for this issue, we present the combined application of two bedload transport formulas that widens the application range and thus gives more appropriate simulation results. An example of this technique is presented in the paper by combining two bedload transport formulas. For model validation, the results of a laboratory experiment, where bed armoring, local scouring and local sediment deposition processes occurred, were used. The results showed that the combined application method can improve the reliability of the numerical simulations.

  7. Advanced Multi-Phase Flow CFD Model Development for Solid Rocket Motor Flowfield Analysis

    Liaw, Paul; Chen, Y. S.; Shang, H. M.; Doran, Denise


    It is known that the simulations of solid rocket motor internal flow field with AL-based propellants require complex multi-phase turbulent flow model. The objective of this study is to develop an advanced particulate multi-phase flow model which includes the effects of particle dynamics, chemical reaction and hot gas flow turbulence. The inclusion of particle agglomeration, particle/gas reaction and mass transfer, particle collision, coalescence and breakup mechanisms in modeling the particle dynamics will allow the proposed model to realistically simulate the flowfield inside a solid rocket motor. The Finite Difference Navier-Stokes numerical code FDNS is used to simulate the steady-state multi-phase particulate flow field for a 3-zone 2-D axisymmetric ASRM model and a 6-zone 3-D ASRM model at launch conditions. The 2-D model includes aft-end cavity and submerged nozzle. The 3-D model represents the whole ASRM geometry, including additional grain port area in the gas cavity and two inhibitors. FDNS is a pressure based finite difference Navier-Stokes flow solver with time-accurate adaptive second-order upwind schemes, standard and extended k-epsilon models with compressibility corrections, multi zone body-fitted formulations, and turbulence particle interaction model. Eulerian/Lagrangian multi-phase solution method is applied for multi-zone mesh. To simulate the chemical reaction, penalty function corrected efficient finite-rate chemistry integration method is used in FDNS. For the AL particle combustion rate, the Hermsen correlation is employed. To simulate the turbulent dispersion of particles, the Gaussian probability distribution with standard deviation equal to (2k/3)(exp 1/2) is used for the random turbulent velocity components. The computational results reveal that the flow field near the juncture of aft-end cavity and the submerged nozzle is very complex. The effects of the turbulent particles affect the flow field significantly and provide better

  8. CFD Studies on Biomass Thermochemical Conversion

    Lifeng Yan


    Full Text Available Thermochemical conversion of biomass offers an efficient and economically process to provide gaseous, liquid and solid fuels and prepare chemicals derived from biomass. Computational fluid dynamic (CFD modeling applications on biomass thermochemical processes help to optimize the design and operation of thermochemical reactors. Recent progression in numerical techniques and computing efficacy has advanced CFD as a widely used approach to provide efficient design solutions in industry. This paper introduces the fundamentals involved in developing a CFD solution. Mathematical equations governing the fluid flow, heat and mass transfer and chemical reactions in thermochemical systems are described and sub-models for individual processes are presented. It provides a review of various applications of CFD in the biomass thermochemical process field.

  9. Passive urban ventilation by combined buoyancy-driven slope flow and wall flow: Parametric CFD studies on idealized city models

    Luo, Zhiwen; Li, Yuguo


    This paper reports the results of a parametric CFD study on idealized city models to investigate the potential of slope flow in ventilating a city located in a mountainous region when the background synoptic wind is absent. Examples of such a city include Tokyo in Japan, Los Angeles and Phoenix in the US, and Hong Kong. Two types of buoyancy-driven flow are considered, i.e., slope flow from the mountain slope (katabatic wind at night and anabatic wind in the daytime), and wall flow due to heated/cooled urban surfaces. The combined buoyancy-driven flow system can serve the purpose of dispersing the accumulated urban air pollutants when the background wind is weak or absent. The microscopic picture of ventilation performance within the urban structures was evaluated in terms of air change rate (ACH) and age of air. The simulation results reveal that the slope flow plays an important role in ventilating the urban area, especially in calm conditions. Katabatic flow at night is conducive to mitigating the nocturnal urban heat island. In the present parametric study, the mountain slope angle and mountain height are assumed to be constant, and the changing variables are heating/cooling intensity and building height. For a typical mountain of 500 m inclined at an angle of 20° to the horizontal level, the interactive structure is very much dependent on the ratio of heating/cooling intensity as well as building height. When the building is lower than 60 m, the slope wind dominates. When the building is as high as 100 m, the contribution from the urban wall flow cannot be ignored. It is found that katabatic wind can be very beneficial to the thermal environment as well as air quality at the pedestrian level. The air change rate for the pedestrian volume can be as high as 300 ACH.

  10. The effect of a number of selective points in modeling of polymerization reacting Monte Carlo method: studying the initiation reaction

    Sadi, M; Dabir, B


    Monte Carlo Method is one of the most powerful techniques to model different processes, such as polymerization reactions. By this method, without any need to solve moment equations, a very detailed information on the structure and properties of polymers are obtained. The number of algorithm repetitions (selected volumes of reactor for modelling which represent the number of initial molecules) is very important in this method. In Monte Carlo method calculations are based on the random number of generations and reaction probability determinations. so the number of algorithm repetition is very important. In this paper, the initiation reaction was considered alone and the importance of number of initiator molecules on the result were studied. It can be concluded that Monte Carlo method will not give accurate results if the number of molecules is not satisfied to be big enough, because in that case , selected volume would not be representative of the whole system.

  11. Development and validation of a CFD-based steam reformer model

    Kær, Søren Knudsen; Dahlqvist, Mathis; Saksager, Anders


    of the ethanol steam reformer.  Based on the model predictions, a detailed investigation of the processes controlling the hydrogen production rates is presented. It was found that efficient heat transfer from the flue gas to the endothermic steam reforming reactions is critical and represents a limiting factor...... a detailed mechanism for the reforming reactions. Heat exchange between the flue gas and reformate streams through the reformer reactor walls was also included as a conjugate heat transfer process.  From a review of published models for the catalytic steam reforming of ethanol and preliminary predictions...

  12. Comparative analysis of CFD models for jetting fluidized beds: Effect of particle-phase viscosity

    Pei Pei; Kai Zhang; Gang Xu; Yongping Yang; Dongsheng Wen


    Under the Eulerian-Eulerian framework of simulating gas-solid two-phase flow,the accuracy of the hydrodynamic prediction is strongly affected by the selection of rheology of the particulate phase,for which a detailed assessment is still absent.Using a jetting fluidized bed as an example,this work investigates the influence of solid theology on the hydrodynamic behavior by employing different particle-phase viscosity models.Both constant particle-phase viscosity model (CVM) with different viscosity values and a simple two-fluid model without particle-phase viscosity (NVM) are incorporated into the classical twofluid model and compared with the experimental measurements.Qualitative and quantitative results show that the jet penetration depth,jet frequency and averaged bed pressure drop are not a strong function of the particle-phase viscosity.Compared to CVM,the NVM exhibits better predictions on the jet behaviors,which is more suitable for investigating the hydrodynamics of gas-solid fluidized bed with a central jet.

  13. CFD Modeling of Flow and Ion Exchange Kinetics in a Rotating Bed Reactor System

    Larsson, Hilde Kristina; Schjøtt Andersen, Patrick Alexander; Byström, Emil


    be achieved by making the baffles deeper. Two-phase simulations were performed, which managed to reproduce the deflection of the gas–liquid interface in an unbaffled system. A chemical reaction was implemented in the model, describing the ion-exchange phenomena in the porous material using four different...

  14. Hypersonic simulations using open-source CFD and DSMC solvers

    Casseau, V.; Scanlon, T. J.; John, B.; Emerson, D. R.; Brown, R. E.


    Hypersonic hybrid hydrodynamic-molecular gas flow solvers are required to satisfy the two essential requirements of any high-speed reacting code, these being physical accuracy and computational efficiency. The James Weir Fluids Laboratory at the University of Strathclyde is currently developing an open-source hybrid code which will eventually reconcile the direct simulation Monte-Carlo method, making use of the OpenFOAM application called dsmcFoam, and the newly coded open-source two-temperature computational fluid dynamics solver named hy2Foam. In conjunction with employing the CVDV chemistry-vibration model in hy2Foam, novel use is made of the QK rates in a CFD solver. In this paper, further testing is performed, in particular with the CFD solver, to ensure its efficacy before considering more advanced test cases. The hy2Foam and dsmcFoam codes have shown to compare reasonably well, thus providing a useful basis for other codes to compare against.

  15. The Three-Dimensional Velocity Distribution of Wide Gap Taylor-Couette Flow Modelled by CFD

    David Shina Adebayo


    Full Text Available A numerical investigation is conducted for the flow between two concentric cylinders with a wide gap, relevant to bearing chamber applications. This wide gap configuration has received comparatively less attention than narrow gap journal bearing type geometries. The flow in the gap between an inner rotating cylinder and an outer stationary cylinder has been modelled as an incompressible flow using an implicit finite volume RANS scheme with the realisable k-ε model. The model flow is above the critical Taylor number at which axisymmetric counterrotating Taylor vortices are formed. The tangential velocity profiles at all axial locations are different from typical journal bearing applications, where the velocity profiles are quasilinear. The predicted results led to two significant findings of impact in rotating machinery operations. Firstly, the axial variation of the tangential velocity gradient induces an axially varying shear stress, resulting in local bands of enhanced work input to the working fluid. This is likely to cause unwanted heat transfer on the surface in high torque turbomachinery applications. Secondly, the radial inflow at the axial end-wall boundaries is likely to promote the transport of debris to the junction between the end-collar and the rotating cylinder, causing the build-up of fouling in the seal.

  16. Thermal Management Optimization of a Thermoelectric-Integrated Methanol Evaporator Using a Compact CFD Modeling Approach

    Gao, Xin; Chen, Min; Snyder, G. Jeffrey; Andreasen, Søren Juhl; Kær, Søren Knudsen


    To better manage the magnitude and direction of the heat flux in an exchanger-based methanol evaporator of a fuel cell system, thermoelectric (TE) modules can be deployed as TE heat flux regulators (TERs). The performance of the TE-integrated evaporator is strongly influenced by its heat exchange structure. The structure transfers the fuel cell exhaust heat to the evaporation chamber to evaporate the methanol, where TE modules are installed in between to facilitate the heat regulation. In this work, firstly, a numerical study is conducted to determine the working currents and working modes of the TERs under the system working condition fluctuations and during the system cold start. A three-dimensional evaporator model is generated in ANSYS FLUENT® by combining a compact TE model with various heat exchange structure geometries. The compact TE model can dramatically improve the computational efficiency, and uses a different material property acquisition method based on module manufacturers' datasheets. Secondly, a simulation study is carried out on the novel evaporator to minimize its thermal resistance and to assess the evaporator pressure drop. The factors studied include the type of fins in the heat exchange structure, the thickness of the fins, the axial conduction penalty, etc. Results show that the TE-integrated evaporator can work more efficiently and smoothly during both load fluctuations and system cold start, offering superior performance.

  17. MyrrhaFoam: A CFD model for the study of the thermal hydraulic behavior of MYRRHA

    Koloszar, Lilla; Buckingham, Sophia; Planquart, Philippe [von Karman Institute, Chaussée de Waterloo 72, B-1640 Rhode-St-Genèse (Belgium); Keijers, Steven [SCK-CEN, Boeretang 200, 2400 Mol (Belgium)


    Highlights: • Development of a modeling approach for simulating the thermal hydraulics of heavy liquid metal nuclear reactors. • Detailed description of the modeling of each component through the MYRRHA reactor. • Detailed analysis of the flow field of the MYRRHA reactor under operating condition. • Assessment of the thermal load on the structures as well as the thermal stratification in the upper and the lower plenum. - Abstract: Numerical analysis of the thermohydraulic behavior of the innovative flexible fast spectrum research reactor, MYRRHA, under design by the Belgian Nuclear Research Center (SCK• CEN) is a very challenging task. The primary coolant of the reactor is Lead Bismuth Eutectic, LBE, which is an opaque heavy liquid metal with low Prandtl number. The simulation tool needs to involve many complex physical phenomena to be able to predict accurately the flow and thermal field in the pool type reactor. In the past few years, within the frame of a collaboration between SCK• CEN and the von Karman Institute, a new platform, MyrrhaFoam, was developed based on the open source simulation environment, OpenFOAM. The current tool can deal with incompressible buoyancy corrected steady/unsteady single phase flows. It takes into account conjugate heat transfer in the solid parts which is mandatory due to the expected high temperature gradients between the different parts of the reactor. The temperature dependent properties of LBE are also considered. MyrrhaFoam is supplemented with the most relevant thermal turbulence models for low Prandtl number liquids up to date.

  18. Hydrodynamic optimization of twin-skeg LNG ships by CFD and model testing

    Keunjae Kim


    Full Text Available SSPA experiences a growing interest in twin skeg ships as one attractive green ship solution. The twin skeg concept is well proven with obvious advantages for the design of ships with full hull forms, restricted draft or highly loaded propellers. SSPA has conducted extensive hull optimizations studies of LNG ships of different size based on an extensive hull data base with over 7,000 models tested, including over 400 twin skeg hull forms. Main hull dimensions and different hull concepts such as twin skeg and single screw were of main interest in the studies. In the present paper, one twin skeg and one single screw 170 K LNG ship were designed for optimally selected main dimension parameters. The twin skeg hull was further optimized and evaluated using SHIPFLOW FRIENDSHIP design package by performing parameter variation in order to modify the shape and positions of the skegs. The finally optimized models were then built and tested in order to confirm the lower power demand of twin skeg designed compaed with the signle screw design. This paper is a full description of one of the design developments of a LNG twin skeg hull, from early dimensional parameter study, through design optimization phase towards the confirmation by model tests.

  19. Hydrodynamic optimization of twin-skeg LNG ships by CFD and model testing

    Kim, Keunjae; Tillig, Fabian; Bathfield, Nicolas; Liljenberg, Hans


    SSPA experiences a growing interest in twin skeg ships as one attractive green ship solution. The twin skeg concept is well proven with obvious advantages for the design of ships with full hull forms, restricted draft or highly loaded propellers. SSPA has conducted extensive hull optimizations studies of LNG ships of different size based on an extensive hull data base with over 7,000 models tested, including over 400 twin skeg hull forms. Main hull dimensions and different hull concepts such as twin skeg and single screw were of main interest in the studies. In the present paper, one twin skeg and one single screw 170 K LNG ship were designed for optimally selected main dimension parameters. The twin skeg hull was further optimized and evaluated using SHIPFLOW FRIENDSHIP design package by performing parameter variation in order to modify the shape and positions of the skegs. The finally optimized models were then built and tested in order to confirm the lower power demand of twin skeg designed compaed with the signle screw design. This paper is a full description of one of the design developments of a LNG twin skeg hull, from early dimensional parameter study, through design optimization phase towards the confirmation by model tests.

  20. Experimental Measurements and CFD Simulations

    Arijit A. Ganguli


    Full Text Available Bubble dynamics of a single condensing vapor bubble in a subcooled pool boiling system with a centrally heated cylindrical tank has been studied in the Rayleigh number range 7.9×1012CFD investigation has been performed using Volume of Fluid (VOF method. The heat source has been modeled using simple heat balance. The rise behavior of condensing bubbles (change in size during rise and path tracking was studied and the CFD model was validated both quantitatively and qualitatively.

  1. Analysis of mass transfer characteristics in a tubular membrane using CFD modeling.

    Yang, Jixiang; Vedantam, Sreepriya; Spanjers, Henri; Nopens, Ingmar; van Lier, Jules B


    In contrast to the large amount of research into aerobic membrane bioreactors, little work has been reported on anaerobic membrane bioreactors (AMBRs). As to the application of membrane bioreactors, membrane fouling is a key issue. Membrane fouling generally occurs more seriously in AMBRs than in aerobic membrane bioreactors. However, membrane fouling could be managed through the application of suitable shear stress that can be introduced by the application of a two-phase flow. When the two-phase flow is applied in AMBRs, little is known about the mass transfer characteristics, which is of particular importance, in tubular membranes of AMBRs. In our present work, we have employed fluid dynamic modeling to analyze the mass transfer characteristics in the tubular membrane of a side stream AMBR in which, gas-lift two-phase flow was applied. The modeling indicated that the mass transfer capacity at the membrane surface at the noses of gas bubbles was higher than the mass transfer capacity at the tails of the bubbles, which is in contrast to the results when water instead of sludge is applied. At the given mass transfer rate, the filterability of the sludge was found to have a strong influence on the transmembrane pressure at a steady flux. In addition, the model also showed that the shear stress in the internal space of the tubular membrane was mainly around 20 Pa but could be as high as about 40 Pa due to gas bubble movements. Nonetheless, at these shear stresses a stable particle size distribution was found for sludge particles.

  2. CFD modelling of condensation process of water vapor in supersonic flows

    Wen, Chuang; Walther, Jens Honore; Yan, Yuying;


    -liquid phase change both in space and in time. The spontaneous condensation of water vapor will not appear immediately when the steam reaches the saturation state. Instead, it occurs further downstream the nozzle throat, where the steam is in the state of supersaturation.......The condensation phenomenon of vapor plays an important role in various industries, such as the steam flow in turbines and refrigeration system. A mathematical model is developed to predict the spontaneous condensing phenomenon in the supersonic conditions using the nucleation and droplet growth...

  3. CFD based aerodynamic modeling to study flight dynamics of a flapping wing micro air vehicle

    Rege, Alok Ashok

    The demand for small unmanned air vehicles, commonly termed micro air vehicles or MAV's, is rapidly increasing. Driven by applications ranging from civil search-and-rescue missions to military surveillance missions, there is a rising level of interest and investment in better vehicle designs, and miniaturized components are enabling many rapid advances. The need to better understand fundamental aspects of flight for small vehicles has spawned a surge in high quality research in the area of micro air vehicles. These aircraft have a set of constraints which are, in many ways, considerably different from that of traditional aircraft and are often best addressed by a multidisciplinary approach. Fast-response non-linear controls, nano-structures, integrated propulsion and lift mechanisms, highly flexible structures, and low Reynolds aerodynamics are just a few of the important considerations which may be combined in the execution of MAV research. The main objective of this thesis is to derive a consistent nonlinear dynamic model to study the flight dynamics of micro air vehicles with a reasonably accurate representation of aerodynamic forces and moments. The research is divided into two sections. In the first section, derivation of the nonlinear dynamics of flapping wing micro air vehicles is presented. The flapping wing micro air vehicle (MAV) used in this research is modeled as a system of three rigid bodies: a body and two wings. The design is based on an insect called Drosophila Melanogaster, commonly known as fruit-fly. The mass and inertial effects of the wing on the body are neglected for the present work. The nonlinear dynamics is simulated with the aerodynamic data published in the open literature. The flapping frequency is used as the control input. Simulations are run for different cases of wing positions and the chosen parameters are studied for boundedness. Results show a qualitative inconsistency in boundedness for some cases, and demand a better

  4. Accuracy details in realistic CFD modeling of an industrial centrifugal pump in direct and reverse modes

    Páscoa, J. C.; Silva, F. J.; Pinheiro, J. S.; Martins, D. J.


    Numerical computation of the flowfield inside a pump is herein used as a numerical laboratory, subject to the limitations of modeling assumptions and to experimental verification. A numerical computation of the flow inside a real industrial centrifugal pump is performed that includes a very sophisticated geometry. Conversely to other computations, in this test case no simplification of the geometry was introduced. Numerical computations are obtained using Spalart-Allmaras turbulence model. A detailed analysis of the turbulent flowstructure is performed for the design point and two off design conditions. Additional computations were performed in order to compare the numerical and experimental pump characteristics; these were obtained under normalized testing conditions. Further computations are presented for the pump working in reverse turbine mode (PAT). Detailed analyses of the flow allow a comparison of the internal flow losses when the pump is operating in direct and reverse mode. This is also useful to help in the selection of an adequate pump geometry that can work in both modes with best efficiency.

  5. Experimental Measurement and CFD Model Development of Thick Wind Turbine Airfoils with Leading Edge Erosion

    Maniaci, David C.; White, Edward B.; Wilcox, Benjamin; Langel, Christopher M.; van Dam, C. P.; Paquette, Joshua A.


    Leading edge erosion and roughness accumulation is an issue observed with great variability by wind plant operators, but with little understanding of the effect on wind turbine performance. In wind tunnels, airfoil models are typically tested with standard grit roughness and trip tape to simulate the effects of roughness and erosion observed in field operation, but there is a lack of established relation between field measurements and wind tunnel test conditions. A research collaboration between lab, academic, and industry partners has sought to establish a method to estimate the effect of erosion in wind turbine blades that correlates to roughness and erosion measured in the field. Measurements of roughness and erosion were taken off of operational utility wind turbine blades using a profilometer. The field measurements were statistically reproduced in the wind tunnel on representative tip and midspan airfoils. Simultaneously, a computational model was developed and calibrated to capture the effect of roughness and erosion on airfoil transition and performance characteristics. The results indicate that the effects of field roughness fall between clean airfoil performance and the effects of transition tape. Severe leading edge erosion can cause detrimental performance effects beyond standard roughness. The results also indicate that a heavily eroded wind turbine blade can reduce annual energy production by over 5% for a utility scale wind turbine.

  6. High-temperature thermocline TES combining sensible and latent heat - CFD modeling and experimental validation

    Zavattoni, Simone A.; Geissbühler, Lukas; Barbato, Maurizio C.; Zanganeh, Giw; Haselbacher, Andreas; Steinfeld, Aldo


    The concept of combined sensible/latent heat thermal energy storage (TES) has been exploited to mitigate an intrinsic thermocline TES systems drawback of heat transfer fluid outflow temperature reduction during discharging. In this study, the combined sensible/latent TES prototype under investigation is constituted by a packed bed of rocks and a small amount of encapsulated phase change material (AlSi12) as sensible heat and latent heat sections respectively. The thermo-fluid dynamics behavior of the combined TES prototype was analyzed by means of a computational fluid dynamics approach. Due to the small value of the characteristic vessel-to-particles diameter ratio, the effect of radial void-fraction variation, also known as channeling, was accounted for. Both the sensible and the latent heat sections of the storage were modeled as porous media under the assumption of local thermal non-equilibrium (LTNE). The commercial code ANSYS Fluent 15.0 was used to solve the model's constitutive conservation and transport equations obtaining a fairly good agreement with reference experimental measurements.

  7. Numerical simulation for the upper airway flow characteristics of Chinese patients with OSAHS using CFD models.

    Tan, Jie; Huang, Jianmin; Yang, Jianguo; Wang, Desheng; Liu, Jianzhi; Liu, Jingbo; Lin, Shuchun; Li, Chen; Lai, Haichun; Zhu, Hongyu; Hu, Xiaohua; Chen, Dongxu; Zheng, Longxiang


    OSAHS is a common disease with many factors related to the etiology. Airflow plays an important role in the pathogenesis of OSAHS. Previous research has not yielded a sufficient understanding of the relationship between airflow in upper airway and the pathophysiology of OSAHS. Therefore, a better understanding of the flow inside the upper airway in an OSAHS patient is necessary. In this study, ten Chinese adults with OSAHS were recruited. We used the software MIMICS 13.1 to construct 3-dimensional (3-D) models based on the computer tomography scans of them. The numerical simulations were carried out using the software ANSYS 12.0. We found that during the inhalation phase, the vortices and turbulences were located in both the anterior part of the cavity and nasopharynx. But there is no vortex in the whole nasal cavity during the expiratory phase. The airflow velocity is much higher than that of the normal models. The distributions of pressure and wall shear stress are different in two phases. The maximum velocity, pressure and wall shear stress (WSS) are located in velopharynx. It is notable that a strong negative pressure region is found in pharyngeal airway. The maximum velocity is 19.26 ± 12.4 and 19.46 ± 13.1 m/s; the average pressure drop is 222.71 ± 208.84 and 238.5 ± 218.56 Pa and the maximum average WSS is 0.72 ± 0.58 and 1.01 ± 0.61 Pa in inspiratory and expiratory, respectively. The changes of airflow due to the structure changes play an important role in the occurrence of collapse and obstruction of the upper airway, especially, the abnormal pressure changes in velopharyngeal during both inspiratory and expiratory phases. We can say that the airway narrowing in the pharynx may be one of the most important factors driving airway collapse. In addition, the most collapsible region of the pharyngeal airway of the patient with OSAHS may be the velopharynx and oropharynx. In spite of limitations, our results can provide a basis for the further research

  8. CFD Modeling of a Laser-Induced Ethane Pyrolysis in a Wall-less Reactor

    Stadnichenko, Olga; Snytnikov, Valeriy; Yang, Junfeng; Matar, Omar


    Ethylene, as the most important feedstock, is widely used in chemical industry to produce various rubbers, plastics and synthetics. A recent study found the IR-laser irradiation induced ethane pyrolysis yields 25% higher ethylene production rates compared to the conventional steam cracking method. Laser induced pyrolysis is initiated by the generation of radicals upon heating of the ethane, then, followed by ethane/ethylene autocatalytic reaction in which ethane is converted into ethylene and other light hydrocarbons. This procedure is governed by micro-mixing of reactants and the feedstock residence time in reactor. Under mild turbulent conditions, the turbulence enhances the micro-mixing process and allows a high yield of ethylene. On the other hand, the high flow rate only allows a short residence time in the reactor which causes incomplete pyrolysis. This work attempts to investigate the interaction between turbulence and ethane pyrolysis process using large eddy simulation method. The modelling results could be applied to optimize the reactor design and operating conditions. Skolkovo Foundation through the UNIHEAT Project.

  9. CFD Analysis of the Runaway Stability of a Model Pump-Turbine

    Xia, L. S.; Cheng, Y. G.; You, J. F.; Jiang, Y. Q.


    The relations between the runaway stability characteristics and the flow patterns inside the runner of pump-turbine are supposed to be close and should be studied. The runaway processes of a model pump-turbine at four guide-vane openings (GVOs) were simulated by the three-dimensional computational fluid dynamics. The results show that the runaway stability characteristics for the pump-turbine are different at different GVOs. For the small GVOs, the turbine characteristic trajectory undergoes damped oscillations; however, for large GVOs, the turbine characteristic trajectory settles into an un-damping oscillation. The evolution features of the reverse flow vortex structures (RFVS) at the runner inlet during the runaway oscillations have distinct patterns between the small and large GVOs. For small GVOs, the RFVSs only locate at the mid-span; however, for the large GVOs, the location of the RFVSs switches back and forth between the mid-span section and the hub side when the turbine passes in and out the turbine braking mode. The changes of RFVS at the runner inlet dominate the energy transfer among the hydraulic, mechanical and dissipation energies during the transient processes, and therefore affect the stability of hydraulic system.

  10. CFD Model Development and validation for High Temperature Gas Cooled Reactor Cavity Cooling System (RCCS) Applications

    Hassan, Yassin [Univ. of Wisconsin, Madison, WI (United Texas A & M Univ., College Station, TX (United States); Corradini, Michael; Tokuhiro, Akira; Wei, Thomas Y.C.


    The Reactor Cavity Cooling Systems (RCCS) is a passive safety system that will be incorporated in the VTHR design. The system was designed to remove the heat from the reactor cavity and maintain the temperature of structures and concrete walls under desired limits during normal operation (steady-state) and accident scenarios. A small scale (1:23) water-cooled experimental facility was scaled, designed, and constructed in order to study the complex thermohydraulic phenomena taking place in the RCCS during steady-state and transient conditions. The facility represents a portion of the reactor vessel with nine stainless steel coolant risers and utilizes water as coolant. The facility was equipped with instrumentation to measure temperatures and flow rates and a general verification was completed during the shakedown. A model of the experimental facility was prepared using RELAP5-3D and simulations were performed to validate the scaling procedure. The experimental data produced during the steady-state run were compared with the simulation results obtained using RELAP5-3D. The overall behavior of the facility met the expectations. The facility capabilities were confirmed to be very promising in performing additional experimental tests, including flow visualization, and produce data for code validation.

  11. CFD simulation of reverse water-hammer induced by collapse of draft-tube cavity in a model pump-turbine during runaway process

    Zhang, Xiaoxi; Cheng, Yongguang; Xia, Linsheng; Yang, Jiandong


    This paper reports the preliminary progress in the CFD simulation of the reverse water-hammer induced by the collapse of a draft-tube cavity in a model pump-turbine during the runaway process. Firstly, the Fluent customized 1D-3D coupling model for hydraulic transients and the Schnerr & Sauer cavitation model for cavity development are introduced. Then, the methods are validated by simulating the benchmark reverse water-hammer in a long pipe caused by a valve instant closure. The simulated head history at the valve agrees well with the measured data in literature. After that, the more complicated reverse water-hammer in the draft-tube of a runaway model pump-turbine, which is installed in a model pumped-storage power plant, is simulated. The dynamic processes of a vapor cavity, from generation, expansion, shrink to collapse, are shown. After the cavity collapsed, a sudden increase of pressure can be evidently observed. The process is featured by a locally expending and collapsing vapor cavity that is around the runner cone, which is different from the conventional recognition of violent water- column separation. This work reveals the possibility for simulating the reverse water-hammer phenomenon in turbines by 3D CFD.

  12. An interfacial shear term evaluation study for adiabatic dispersed air–water two-phase flow with the two-fluid model using CFD

    Sharma, S.L., E-mail: [School of Nuclear Engineering, Purdue University, West Lafayette, IN (United States); Hibiki, T.; Ishii, M. [School of Nuclear Engineering, Purdue University, West Lafayette, IN (United States); Schlegel, J.P. [Department of Mining and Nuclear Engineering, Missouri University of Science and Technology, Rolla, MO (United States); Buchanan, J.R.; Hogan, K.J. [Bettis Laboratory, Naval Nuclear Laboratory, West Mifflin, PA (United States); Guilbert, P.W. [ANSYS UK Ltd, Oxfordshire (United Kingdom)


    Highlights: • Closure form of the interfacial shear term in three-dimensional form is investigated. • Assessment against adiabatic upward bubbly air–water flow data using CFD. • Effect of addition of the interfacial shear term on the phase distribution. - Abstract: In commercially available Computational Fluid Dynamics (CFD) codes such as ANSYS CFX and Fluent, the interfacial shear term is missing in the field momentum equations. The derivation of the two-fluid model (Ishii and Hibiki, 2011) indicates the presence of this term as a momentum source in the right hand side of the field momentum equation. The inclusion of this term is considered important for proper modeling of the interfacial momentum coupling between phases. For separated flows, such as annular flow, the importance of the shear term is understood in the one-dimensional (1-D) form as the major mechanism by which the wall shear is transferred to the gas phase (Ishii and Mishima, 1984). For gas dispersed two-phase flow CFD simulations, it is important to assess the significance of this term in the prediction of phase distributions. In the first part of this work, the closure of this term in three-dimensional (3-D) form in a CFD code is investigated. For dispersed gas–liquid flow, such as bubbly or churn-turbulent flow, bubbles are dispersed in the shear layer of the continuous phase. The continuous phase shear stress is mainly due to the presence of the wall and the modeling of turbulence through the Boussinesq hypothesis. In a 3-D simulation, the continuous phase shear stress can be calculated from the continuous fluid velocity gradient, so that the interfacial shear term can be closed using the local values of the volume fraction and the total stress of liquid phase. This form also assures that the term acts as an action-reaction force for multiple phases. In the second part of this work, the effect of this term on the volume fraction distribution is investigated. For testing the model two

  13. Validation and comparison of two-phase flow modeling capabilities of CFD, sub channel and system codes by means of post-test calculations of BFBT transient tests

    Jaeger, Wadim; Manes, Jorge Perez; Imke, Uwe; Escalante, Javier Jimenez; Espinoza, Victor Sanchez, E-mail:


    Highlights: • Simulation of BFBT turbine and pump transients at multiple scales. • CFD, sub-channel and system codes are used for the comparative study. • Heat transfer models are compared to identify difference between the code predictions. • All three scales predict results in good agreement to experiment. • Sub cooled boiling models are identified as field for future research. -- Abstract: The Institute for Neutron Physics and Reactor Technology (INR) at the Karlsruhe Institute of Technology (KIT) is involved in the validation and qualification of modern thermo hydraulic simulations tools at various scales. In the present paper, the prediction capabilities of four codes from three different scales – NEPTUNE{sub C}FD as fine mesh computational fluid dynamics code, SUBCHANFLOW and COBRA-TF as sub channels codes and TRACE as system code – are assessed with respect to their two-phase flow modeling capabilities. The subject of the investigations is the well-known and widely used data base provided within the NUPEC BFBT benchmark related to BWRs. Void fraction measurements simulating a turbine and a re-circulation pump trip are provided at several axial levels of the bundle. The prediction capabilities of the codes for transient conditions with various combinations of boundary conditions are validated by comparing the code predictions with the experimental data. In addition, the physical models of the different codes are described and compared to each other in order to explain the different results and to identify areas for further improvements.

  14. Flow modification in canine intracranial aneurysm model by an asymmetric stent: studies using digital subtraction angiography (DSA) and image-based computational fluid dynamics (CFD) analyses

    Hoi, Yiemeng; Ionita, Ciprian N.; Tranquebar, Rekha V.; Hoffmann, Kenneth R.; Woodward, Scott H.; Taulbee, Dale B.; Meng, Hui; Rudin, Stephen


    An asymmetric stent with low porosity patch across the intracranial aneurysm neck and high porosity elsewhere is designed to modify the flow to result in thrombogenesis and occlusion of the aneurysm and yet to reduce the possibility of also occluding adjacent perforator vessels. The purposes of this study are to evaluate the flow field induced by an asymmetric stent using both numerical and digital subtraction angiography (DSA) methods and to quantify the flow dynamics of an asymmetric stent in an in vivo aneurysm model. We created a vein-pouch aneurysm model on the canine carotid artery. An asymmetric stent was implanted at the aneurysm, with 25% porosity across the aneurysm neck and 80% porosity elsewhere. The aneurysm geometry, before and after stent implantation, was acquired using cone beam CT and reconstructed for computational fluid dynamics (CFD) analysis. Both steady-state and pulsatile flow conditions using the measured waveforms from the aneurysm model were studied. To reduce computational costs, we modeled the asymmetric stent effect by specifying a pressure drop over the layer across the aneurysm orifice where the low porosity patch was located. From the CFD results, we found the asymmetric stent reduced the inflow into the aneurysm by 51%, and appeared to create a stasis-like environment which favors thrombus formation. The DSA sequences also showed substantial flow reduction into the aneurysm. Asymmetric stents may be a viable image guided intervention for treating intracranial aneurysms with desired flow modification features.

  15. Prediction of gasoline yield in a fluid catalytic cracking (FCC riser using k-epsilon turbulence and 4-lump kinetic models: A computational fluid dynamics (CFD approach

    Muhammad Ahsan


    Full Text Available Fluid catalytic cracking (FCC is an essential process for the conversion of gas oil to gasoline. This study is an effort to model the phenomenon numerically using commercial computational fluid dynamics (CFD software, heavy density catalyst and 4-lump kinetic model. Geometry, boundary conditions and dimensions of industrial riser for catalytic cracking unit are conferred for 2D simulation using commercial CFD code FLUENT 6.3. Continuity, momentum, energy and species transport equations, applicable to two phase solid and gas flow, are used to simulate the physical phenomenon as efficient as possible. This study implements and predicts the use of the granular Eulerian multiphase model with species transport. Time accurate transient problem is solved with the prediction of mass fraction profiles of gas oil, gasoline, light gas and coke. The output curves demonstrate the breaking of heavy hydrocarbon in the presence of catalyst. An approach proposed in this study shows good agreement with the experimental and numerical data available in the literature.

  16. Three-dimensional all-speed CFD code for safety analysis of nuclear reactor containment: Status of GASFLOW parallelization, model development, validation and application

    Xiao, Jianjun, E-mail: [Institute of Nuclear and Energy Technologies, Karlsruhe Institute of Technology, P.O. Box 3640, 76021 Karlsruhe (Germany); Travis, John R., E-mail: [Engineering and Scientific Software Inc., 3010 Old Pecos Trail, Santa Fe, NM 87505 (United States); Royl, Peter, E-mail: [Institute of Nuclear and Energy Technologies, Karlsruhe Institute of Technology, P.O. Box 3640, 76021 Karlsruhe (Germany); Necker, Gottfried, E-mail: [Institute of Nuclear and Energy Technologies, Karlsruhe Institute of Technology, P.O. Box 3640, 76021 Karlsruhe (Germany); Svishchev, Anatoly, E-mail: [Institute of Nuclear and Energy Technologies, Karlsruhe Institute of Technology, P.O. Box 3640, 76021 Karlsruhe (Germany); Jordan, Thomas, E-mail: [Institute of Nuclear and Energy Technologies, Karlsruhe Institute of Technology, P.O. Box 3640, 76021 Karlsruhe (Germany)


    Highlights: • 3-D scalable semi-implicit pressure-based CFD code for containment safety analysis. • Robust solution algorithm valid for all-speed flows. • Well validated and widely used CFD code for hydrogen safety analysis. • Code applied in various types of nuclear reactor containments. • Parallelization enables high-fidelity models in large scale containment simulations. - Abstract: GASFLOW is a three dimensional semi-implicit all-speed CFD code which can be used to predict fluid dynamics, chemical kinetics, heat and mass transfer, aerosol transportation and other related phenomena involved in postulated accidents in nuclear reactor containments. The main purpose of the paper is to give a brief review on recent GASFLOW code development, validations and applications in the field of nuclear safety. GASFLOW code has been well validated by international experimental benchmarks, and has been widely applied to hydrogen safety analysis in various types of nuclear power plants in European and Asian countries, which have been summarized in this paper. Furthermore, four benchmark tests of a lid-driven cavity flow, low Mach number jet flow, 1-D shock tube and supersonic flow over a forward-facing step are presented in order to demonstrate the accuracy and wide-ranging capability of ICE’d ALE solution algorithm for all-speed flows. GASFLOW has been successfully parallelized using the paradigms of Message Passing Interface (MPI) and domain decomposition. The parallel version, GASFLOW-MPI, adds great value to large scale containment simulations by enabling high-fidelity models, including more geometric details and more complex physics. It will be helpful for the nuclear safety engineers to better understand the hydrogen safety related physical phenomena during the severe accident, to optimize the design of the hydrogen risk mitigation systems and to fulfill the licensing requirements by the nuclear regulatory authorities. GASFLOW-MPI is targeting a high

  17. Investigations of Fluid-Structure-Coupling and Turbulence Model Effects on the DLR Results of the Fifth AIAA CFD Drag Prediction Workshop

    Keye, Stefan; Togiti, Vamish; Eisfeld, Bernhard; Brodersen, Olaf P.; Rivers, Melissa B.


    The accurate calculation of aerodynamic forces and moments is of significant importance during the design phase of an aircraft. Reynolds-averaged Navier-Stokes (RANS) based Computational Fluid Dynamics (CFD) has been strongly developed over the last two decades regarding robustness, efficiency, and capabilities for aerodynamically complex configurations. Incremental aerodynamic coefficients of different designs can be calculated with an acceptable reliability at the cruise design point of transonic aircraft for non-separated flows. But regarding absolute values as well as increments at off-design significant challenges still exist to compute aerodynamic data and the underlying flow physics with the accuracy required. In addition to drag, pitching moments are difficult to predict because small deviations of the pressure distributions, e.g. due to neglecting wing bending and twisting caused by the aerodynamic loads can result in large discrepancies compared to experimental data. Flow separations that start to develop at off-design conditions, e.g. in corner-flows, at trailing edges, or shock induced, can have a strong impact on the predictions of aerodynamic coefficients too. Based on these challenges faced by the CFD community a working group of the AIAA Applied Aerodynamics Technical Committee initiated in 2001 the CFD Drag Prediction Workshop (DPW) series resulting in five international workshops. The results of the participants and the committee are summarized in more than 120 papers. The latest, fifth workshop took place in June 2012 in conjunction with the 30th AIAA Applied Aerodynamics Conference. The results in this paper will evaluate the influence of static aeroelastic wing deformations onto pressure distributions and overall aerodynamic coefficients based on the NASA finite element structural model and the common grids.

  18. Degradation of pharmaceuticals in UV (LP)/H₂O₂ reactors simulated by means of kinetic modeling and computational fluid dynamics (CFD).

    Wols, B A; Harmsen, D J H; Wanders-Dijk, J; Beerendonk, E F; Hofman-Caris, C H M


    UV/H2O2 treatment is a well-established technique to degrade organic micropollutants. A CFD model in combination with an advanced kinetic model is presented to predict the degradation of organic micropollutants in UV (LP)/H2O2 reactors, accounting for the hydraulics, fluence rate, complex (photo)chemical reactions in the water matrix and the interactions between these processes. The model incorporates compound degradation by means of direct UV photolysis, OH radical and carbonate radical reactions. Measurements of pharmaceutical degradations in pilot-scale UV/H2O2 reactors are presented under different operating conditions. A comparison between measured and modeled degradation for a group of 35 pharmaceuticals resulted in good model predictions for most of the compounds. The research also shows that the degradation of organic micropollutants can be dependent on temperature, which is relevant for full-scale installations that are operated at different temperatures over the year.

  19. Simulation and Scale-up of Barium Sulphate Precipitation Process Using CFD Modeling%应用CFD技术对工业结晶过程进行模拟和放大

    龚俊波; 卫宏远; 王静康; John Garside


    Some empirical mixing models were used to describe the imperfect mixing in precipitation process.However, the models can not, in general, reflect the details of interactions between mixing and crystallization in a vessel. In this study, CFD (computational fluid dynamics) technique were developed by simulating the precipitation of barium sulphate in stirred tanks by integration of population balance equations with a CFD solver. Two typical impellers, Rushton and pitched blade turbines, were employed for agitation. The influence of feed concentration and position on crystal product properties was investigated by CFD simulation. The scale-up of these precipitators was systematically studied. Significant effect on the crystal properties was found for the scale-up under some conditions.

  20. CFD simulation of neutral ABL flows

    Zhang, Xiaodong

    This work is to evaluate the CFD prediction of Atmospheric Boundary Layer flow field over different terrains employing Fluent 6.3 software. How accurate the simulation could achieve depend on following aspects: viscous model, wall functions, agreement of CFD model with inlet wind velocity profile...... and top boundary condition. Fluent employ wall function roughness modifications based on data from experiments with sand grain roughened pipes and channels, describe wall adjacent zone with Roughness Height (Ks) instead of Roughness Length (z0). In a CFD simulation of ABL flow, the mean wind velocity...... will result in some undesirable gradient along flow direction. There are some methods to improve the simulation model in literatures, some of them are discussed in this report, but none of those remedial methods are perfect to eliminate the streamwise gradients in mean wind speed and turbulence, as EllipSys3D...

  1. The role of CFD combustion modeling in hydrogen safety management – V: Validation for slow deflagrations in homogeneous hydrogen-air experiments

    Sathiah, Pratap [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands); Holler, Tadej, E-mail: [Jozef Stefan Institute (JSI), Jamova cesta 39, 1000 Ljubljana (Slovenia); Kljenak, Ivo [Jozef Stefan Institute (JSI), Jamova cesta 39, 1000 Ljubljana (Slovenia); Komen, Ed [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands)


    Highlights: • Validation of the modeling approach for hydrogen deflagration is presented. • Modeling approach is based on two combustion models implemented in ANSYS Fluent. • Experiments with various initial hydrogen concentrations were used for validation. • The effects of heat transfer mechanisms selection were also investigated. • The grid sensitivity analysis was performed as well. - Abstract: The control of hydrogen in the containment is an important safety issue following rapid oxidation of the uncovered reactor core during a severe accident in a Nuclear Power Plant (NPP), because dynamic pressure loads from eventual hydrogen combustion can be detrimental to the structural integrity of the reactor safety systems and the reactor containment. In the set of our previous papers, a CFD-based method to assess the consequence of fast combustion of uniform hydrogen-air mixtures was presented, followed by its validation for hydrogen-air mixtures with diluents and for non-uniform hydrogen-air mixtures. In the present paper, the extension of this model for the slow deflagration regime is presented and validated using the hydrogen deflagration experiments performed in the medium-scale experimental facility THAI. The proposed method is implemented in the CFD software ANSYS Fluent using user defined functions. The paper describes the combustion model and the main results of code validation. It addresses questions regarding turbulence model selection, effect of heat transfer mechanisms, and grid sensitivity, as well as provides insights into the importance of combustion model choice for the slow deflagration regime of hydrogen combustion in medium-scale and large-scale experimental vessels mimicking the NPP containment.

  2. Development of a %22solar patch%22 calculator to evaluate heliostat-field irradiance as a boundary condition in CFD models.

    Khalsa, Siri Sahib; Ho, Clifford Kuofei


    A rigorous computational fluid dynamics (CFD) approach to calculating temperature distributions, radiative and convective losses, and flow fields in a cavity receiver irradiated by a heliostat field is typically limited to the receiver domain alone for computational reasons. A CFD simulation cannot realistically yield a precise solution that includes the details within the vast domain of an entire heliostat field in addition to the detailed processes and features within a cavity receiver. Instead, the incoming field irradiance can be represented as a boundary condition on the receiver domain. This paper describes a program, the Solar Patch Calculator, written in Microsoft Excel VBA to characterize multiple beams emanating from a 'solar patch' located at the aperture of a cavity receiver, in order to represent the incoming irradiance from any field of heliostats as a boundary condition on the receiver domain. This program accounts for cosine losses; receiver location; heliostat reflectivity, areas and locations; field location; time of day and day of year. This paper also describes the implementation of the boundary conditions calculated by this program into a Discrete Ordinates radiation model using Ansys{reg_sign} FLUENT (, and compares the results to experimental data and to results generated by the code DELSOL.

  3. Development of a %22Solar Patch%22 calculator to evaluate heliostat-field irradiance as a boundary condition in CFD models.

    Khalsa, Siri Sahib S. (Sandia Staffing Alliance); Ho, Clifford Kuofei


    A rigorous computational fluid dynamics (CFD) approach to calculating temperature distributions, radiative and convective losses, and flow fields in a cavity receiver irradiated by a heliostat field is typically limited to the receiver domain alone for computational reasons. A CFD simulation cannot realistically yield a precise solution that includes the details within the vast domain of an entire heliostat field in addition to the detailed processes and features within a cavity receiver. Instead, the incoming field irradiance can be represented as a boundary condition on the receiver domain. This paper describes a program, the Solar Patch Calculator, written in Microsoft Excel VBA to characterize multiple beams emanating from a 'solar patch' located at the aperture of a cavity receiver, in order to represent the incoming irradiance from any field of heliostats as a boundary condition on the receiver domain. This program accounts for cosine losses; receiver location; heliostat reflectivity, areas and locations; field location; time of day and day of year. This paper also describes the implementation of the boundary conditions calculated by this program into a Discrete Ordinates radiation model using Ansys{reg_sign} FLUENT (, and compares the results to experimental data and to results generated by the code DELSOL.

  4. Thermal-hydraulic analysis of heat transfer in subchannels of the European high performance supercritical Water-Cooled Reactor for different CFD turbulence models

    Castro, Landy Y.; Rojas, Leorlen Y.; Gamez, Abel; Rosales, Jesus; Gonzalez, Daniel; Garcia, Carlos, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Instituto Superior de Tecnologias y Ciencias Aplicadas (InSTEC), La Habana (Cuba); Oliveira, Carlos Brayner de, E-mail: [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil); Dominguez, Dany S., E-mail: [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Pos-Graduacao em Modelagem Computacional


    Chosen as one of six Generation‒IV nuclear-reactor concepts, Supercritical Water-cooled Reactors (SCWRs) are expected to have high thermal efficiencies within the range of 45 - 50% owing to the reactor's high pressures and outlet temperatures. In this reactor, the primary water enters the core under supercritical-pressure condition (25 MPa) at a temperature of 280 deg C and leaves it at a temperature of up to 510 deg C. Due to the significant changes in the physical properties of water at supercritical-pressure, the system is susceptible to local temperature, density and power oscillations. The behavior of supercritical water into the core of the SCWR, need to be sufficiently studied. Most of the methods available to predict the effects of the heat transfer phenomena within the pseudocritical region are based on empirical one-directional correlations, which do not capture the multidimensional effects and do not provide accurate results in regions such as the deteriorated heat transfer regime. In this paper, computational fluid dynamics (CFD) analysis was carried out to study the thermal-hydraulic behavior of supercritical water flows in sub-channels of a typical European High Performance Light Water Reactor (HPLWR) fuel assembly using commercial CFD code CFX-14. It was determined the steady-state equilibrium parameters and calculated the temperature and density distributions. A comparative study for different turbulence models were carried out and the obtained results are discussed. (author)

  5. Computational fluid dynamics-habitat suitability index (CFD-HSI) modelling as an exploratory tool for assessing passability of riverine migratory challenge zones for fish

    Haro, Alexander J.; Chelminski, Michael; Dudley, Robert W.


    We developed two-dimensional computational fluid hydraulics-habitat suitability index (CFD-HSI) models to identify and qualitatively assess potential zones of shallow water depth and high water velocity that may present passage challenges for five major anadromous fish species in a 2.63-km reach of the main stem Penobscot River, Maine, as a result of a dam removal downstream of the reach. Suitability parameters were based on distribution of fish lengths and body depths and transformed to cruising, maximum sustained and sprint swimming speeds. Zones of potential depth and velocity challenges were calculated based on the hydraulic models; ability of fish to pass a challenge zone was based on the percent of river channel that the contiguous zone spanned and its maximum along-current length. Three river flows (low: 99.1 m3 sec-1; normal: 344.9 m3 sec-1; and high: 792.9 m3 sec-1) were modelled to simulate existing hydraulic conditions and hydraulic conditions simulating removal of a dam at the downstream boundary of the reach. Potential depth challenge zones were nonexistent for all low-flow simulations of existing conditions for deeper-bodied fishes. Increasing flows for existing conditions and removal of the dam under all flow conditions increased the number and size of potential velocity challenge zones, with the effects of zones being more pronounced for smaller species. The two-dimensional CFD-HSI model has utility in demonstrating gross effects of flow and hydraulic alteration, but may not be as precise a predictive tool as a three-dimensional model. Passability of the potential challenge zones cannot be precisely quantified for two-dimensional or three-dimensional models due to untested assumptions and incomplete data on fish swimming performance and behaviours.

  6. Numerical Simulation of Desulfurization Behavior in Gas-Stirred Systems Based on Computation Fluid Dynamics-Simultaneous Reaction Model (CFD-SRM) Coupled Model

    Lou, Wentao; Zhu, Miaoyong


    A computation fluid dynamics-simultaneous reaction model (CFD-SRM) coupled model has been proposed to describe the desulfurization behavior in a gas-stirred ladle. For the desulfurization thermodynamics, different models were investigated to determine sulfide capacity and oxygen activity. For the desulfurization kinetic, the effect of bubbly plume flow, as well as oxygen absorption and oxidation reactions in slag eyes are considered. The thermodynamic and kinetic modification coefficients are proposed to fit the measured data, respectively. Finally, the effects of slag basicity and gas flow rate on the desulfurization efficiency are investigated. The results show that as the interfacial reactions (Al2O3)-(FeO)-(SiO2)-(MnO)-[S]-[O] simultaneous kinetic equilibrium is adopted to determine the oxygen activity, and the Young's model with the modification coefficient R th of 1.5 is adopted to determine slag sulfide capacity, the predicted sulfur distribution ratio LS agrees well with the measured data. With an increase of the gas blowing time, the predicted desulfurization rate gradually decreased, and when the modification parameter R k is 0.8, the predicted sulfur content changing with time in ladle agrees well with the measured data. If the oxygen absorption and oxidation reactions in slag eyes are not considered in this model, then the sulfur removal rate in the ladle would be overestimated, and this trend would become more obvious with an increase of the gas flow rate and decrease of the slag layer height. With the slag basicity increasing, the total desulfurization ratio increases; however, the total desulfurization ratio changes weakly as the slag basicity exceeds 7. With the increase of the gas flow rate, the desulfurization ratio first increases and then decreases. When the gas flow rate is 200 NL/min, the desulfurization ratio reaches a maximum value in an 80-ton gas-stirred ladle.

  7. CFD computations of the second round of MEXICO rotor measurements

    Sørensen, Niels N.; Zahle, Frederik; Boorsma, K.


    A comparison, between selected wind tunnel data from the NEW MEXICO measuring campaign and CFD computations are shown. The present work, documents that a state of the art CFD code, including a laminar turbulent transition model, can provide good agreement with experimental data. Good agreement...

  8. 基于CFD的潜艇模型水池试验方法研究%Test method of submarine model test in towing tank by CFD

    郑亚雄; 史圣哲; 许靖锋


    The submarine model test in a towing tank is greatly different from the test conducted under the unlimited condition. This paper studies the inlfuences of the connection device in test and the size of the towing tank size on the submarine model test by the computational lfuid dynamic(CFD) method. The submarine sailing in the unlimited condition is ifrstly simulated to check and evaluate the CFD settings. Then, the submarine model test in towing tank is modeled and calculated. The results are analyzed to investigate the effects of the connection devices, the side wall and the bottom on the force measurement. Finally, the numerical simulation results are combined with the model test results to verify the feasibility of the test facilities.%潜艇水池试验与深广水域航行区别很大,采用计算流体力学(CFD)方法研究试验连接装置及试验水池尺度对潜艇试验的影响。首先对深广水域的潜艇进行计算,以此来校核CFD算法;然后对潜艇试验实况进行建模计算,根据计算结果来分析模型连接件、池壁和池底效应等对于潜艇受力测试的影响;最后结合实际试验和仿真计算结果,分析并证明试验装置的可行性。

  9. 基于三维CFD的RBCC发动机建模方法%Modeling method of RBCC engine based on three-dimensional CFD

    潘浩; 潘宏亮; 秦飞; 何国强; 王亚军


    RBCC engine can operate at multi⁃modes( ( inject⁃,ramjet,scramjet and rocket as well) ) and adapt to a wide flight envelope,which is mainly resulted from the shearing action between the primary rocket plume and inlet air varies drastically. The cross⁃section along the flow path varies a lot for mounting the rocket,stabling the burning and accelerating the gases, and meanwhile the fuel is injected changing in both the amounts and the positions as well according to the operating mode. The complex driving⁃forces result in the difficulties to develop the performance model and to control RBCC.Based on the ground test configuration of RB⁃CC engine,the characteristics of flow field and state variables of RBCC engine were studied by using three⁃dimensional CFD,and then a state variable model with the method of CFD and linear fitting was developed.It is shown that the state variable model matches up with CFD calculations. Studies also show that modeling accuracy can be improved by increasing the data points till 20.%RBCC发动机可多模态工作,能适应宽广的飞行包线,因而其火箭尾流剪切作用变化强烈、流道截面变化大,喷油规律复杂,给发动机建模与控制研究带来困难。针对RBCC发动机的地面直连实验构型,采用三维CFD计算分析RBCC流场特点,研究发动机状态变量特征,并基于CFD计算结合拟合法的建模思路,建立了RBCC状态空间模型,模型的计算结果与三维CFD的计算结果有较好的吻合度,均方差满足要求。研究表明,在一定范围内增加计算特征数据点个数,可提高建模精度,但当计算特征数据点的个数超过20时,继续增加点的个数对精度的提高非常有限。

  10. Coarse Grid CFD for underresolved simulation

    Class, Andreas G.; Viellieber, Mathias O.; Himmel, Steffen R.


    CFD simulation of the complete reactor core of a nuclear power plant requires exceedingly huge computational resources so that this crude power approach has not been pursued yet. The traditional approach is 1D subchannel analysis employing calibrated transport models. Coarse grid CFD is an attractive alternative technique based on strongly under-resolved CFD and the inviscid Euler equations. Obviously, using inviscid equations and coarse grids does not resolve all the physics requiring additional volumetric source terms modelling viscosity and other sub-grid effects. The source terms are implemented via correlations derived from fully resolved representative simulations which can be tabulated or computed on the fly. The technique is demonstrated for a Carnot diffusor and a wire-wrap fuel assembly [1]. [4pt] [1] Himmel, S.R. phd thesis, Stuttgart University, Germany 2009,

  11. Developments and Validations of Fully Coupled CFD and Practical Vortex Transport Method for High-Fidelity Wake Modeling in Fixed and Rotary Wing Applications

    Anusonti-Inthra, Phuriwat


    A novel Computational Fluid Dynamics (CFD) coupling framework using a conventional Reynolds-Averaged Navier-Stokes (BANS) solver to resolve the near-body flow field and a Particle-based Vorticity Transport Method (PVTM) to predict the evolution of the far field wake is developed, refined, and evaluated for fixed and rotary wing cases. For the rotary wing case, the RANS/PVTM modules are loosely coupled to a Computational Structural Dynamics (CSD) module that provides blade motion and vehicle trim information. The PVTM module is refined by the addition of vortex diffusion, stretching, and reorientation models as well as an efficient memory model. Results from the coupled framework are compared with several experimental data sets (a fixed-wing wind tunnel test and a rotary-wing hover test).

  12. An Integrated Modeling Approach for Predicting Process Maps of Residual Stress and Distortion in a Laser Weld: A Combined CFD-FE Methodology

    Turner, Richard P.; Panwisawas, Chinnapat; Sovani, Yogesh; Perumal, Bama; Ward, R. Mark; Brooks, Jeffery W.; Basoalto, Hector C.


    Laser welding has become an important joining methodology within a number of industries for the structural joining of metallic parts. It offers a high power density welding capability which is desirable for deep weld sections, but is equally suited to performing thinner welded joints with sensible amendments to key process variables. However, as with any welding process, the introduction of severe thermal gradients at the weld line will inevitably lead to process-induced residual stress formation and distortions. Finite element (FE) predictions for weld simulation have been made within academia and industrial research for a number of years, although given the fluid nature of the molten weld pool, FE methodologies have limited capabilities. An improvement upon this established method would be to incorporate a computational fluid dynamics (CFD) model formulation prior to the FE model, to predict the weld pool shape and fluid flow, such that details can be fed into FE from CFD as a starting condition. The key outputs of residual stress and distortions predicted by the FE model can then be monitored against the process variables input to the model. Further, a link between the thermal results and the microstructural properties is of interest. Therefore, an empirical relationship between lamellar spacing and the cooling rate was developed and used to make predictions about the lamellar spacing for welds of different process parameters. Processing parameter combinations that lead to regions of high residual stress formation and high distortion have been determined, and the impact of processing parameters upon the predicted lamellar spacing has been presented.

  13. Analysis of the Hydrogen Reduction Rate of Magnetite Concentrate Particles in a Drop Tube Reactor Through CFD Modeling

    Fan, Deqiu; Mohassab, Yousef; Elzohiery, Mohamed; Sohn, H. Y.


    A computational fluid dynamics (CFD) approach, coupled with experimental results, was developed to accurately evaluate the kinetic parameters of iron oxide particle reduction. Hydrogen reduction of magnetite concentrate particles was used as a sample case. A detailed evaluation of the particle residence time and temperature profile inside the reactor is presented. This approach eliminates the errors associated with assumptions like constant particle temperature and velocity while the particles travel down a drop tube reactor. The gas phase was treated as a continuum in the Eulerian frame of reference, and the particles are tracked using a Lagrangian approach in which the trajectory and velocity are determined by integrating the equation of particle motion. In addition, a heat balance on the particle that relates the particle temperature to convection and radiation was also applied. An iterative algorithm that numerically solves the governing coupled ordinary differential equations was developed to determine the pre-exponential factor and activation energy that best fit the experimental data.

  14. Loss of vacuum accident (LOVA): Comparison of computational fluid dynamics (CFD) flow velocities against experimental data for the model validation

    Bellecci, C.; Gaudio, P.; Lupelli, I. [Faculty of Engineering, University of Rome ' Tor Vergata' , Via del Politecnico 1, 00133 Rome (Italy); Malizia, A., E-mail: [Faculty of Engineering, University of Rome ' Tor Vergata' , Via del Politecnico 1, 00133 Rome (Italy); Porfiri, M.T. [ENEA Nuclear Fusion Technologies, Via Enrico Fermi 45 I, 00044, Frascati (Italy); Quaranta, R.; Richetta, M. [Faculty of Engineering, University of Rome ' Tor Vergata' , Via del Politecnico 1, 00133 Rome (Italy)


    A recognized safety issue for future fusion reactors fueled with deuterium and tritium is the generation of sizeable quantities of dust. Several mechanisms resulting from material response to plasma bombardment in normal and off-normal conditions are responsible for generating dust of micron and sub-micron length scales inside the VV (Vacuum Vessel) of experimental fusion facilities. The loss of coolant accidents (LOCA), loss of coolant flow accidents (LOFA) and loss of vacuum accidents (LOVA) are types of accidents, expected in experimental fusion reactors like ITER, that may jeopardize components and plasma vessel integrity and cause dust mobilization risky for workers and public. The air velocity is the driven parameter for dust resuspension and its characterization, in the very first phase of the accidents, is critical for the dust release. To study the air velocity trend a small facility, Small Tank for Aerosol Removal and Dust (STARDUST), was set up at the University of Rome 'Tor Vergata', in collaboration with ENEA Frascati laboratories. It simulates a low pressurization rate (300 Pa/s) LOVA event in ITER due to a small air inlet from two different positions of the leak: at the equatorial port level and at the divertor port level. The velocity magnitude in STARDUST was investigated in order to map the velocity field by means of a punctual capacitive transducer placed inside STARDUST without obstacles. FLUENT was used to simulate the flow behavior for the same LOVA scenarios used during the experimental tests. The results of these simulations were compared against the experimental data for CFD code validation. For validation purposes, the CFD simulation data were extracted at the same locations as the experimental data were collected for the first four seconds, because at the beginning of the experiments the maximum velocity values (that could cause the almost complete dust mobilization) have been measured. In this paper the authors present and

  15. A semi-parabolic wake model for large offshore wind farms based on the open source CFD solver OpenFOAM

    Cabezón D.


    Full Text Available Wake effect represents one of the main sources of energy loss and uncertainty when designing offshore wind farms. Traditionally analytical models have been used to optimize and estimate power deficits. However these models have shown to underestimate wake effect and consequently overestimate output power [1, 2]. This means that analytical models can be very helpful at optimizing preliminary layouts but not as accurate as needed for an ultimate fine design. Different techniques can be found in the literature to study wind turbine wakes that include simplified kinematic models and more advanced field models, that solve flow equations with different turbulence closure schemes. See the review papers of Crespo et al. [3], Vermeer et al. [4], and Sanderse et al. [5]. Purely elliptic Computational Fluid Dynamics (CFD models based on the actuator disk technique have been developed during the last years [6–8]. They consider wind turbine rotor as a disk where a distribution of axial forces act over the incoming air. It is a fair approach but it can still be computationally expensive for big wind farms in an operative mode. With this technique still active, an alternative approach inspired on the parabolic wake models [9, 10] is proposed. Wind turbine rotors continue to be represented as actuator disks but now the domain is split into subdomains containing one or more wind turbines. The output of each subdomain is mapped onto the input boundary of the next one until the end of the domain is reached, getting a considerable decrease on computational time, by a factor of order 10. As the model is based on the open source CFD solver OpenFOAM, it can be parallelized to speed-up convergence. The near wake is calculated so no initial wind speed deficit profiles have to be supposed as in totally parabolic models and alternative turbulence models, such as the anisotropic Reynolds Stress Model (RSM can be used. Traditional problems of elliptic models related to

  16. CFD studies on the phenomena around counter-current flow limitations of gas/liquid two-phase flow in a model of a PWR hot leg

    Deendarlianto, E-mail: [Helmholtz-Zentrum Dresden-Rossendorf e.V., Institute of Safety Research, P.O. Box 510 119, D-01314 Dresden (Germany); Department of Mechanical and Industrial Engineering, Faculty of Engineering, Gadjah Mada University, Jalan Grafika No. 2, Yogyakarta 55281 (Indonesia); Hoehne, Thomas; Lucas, Dirk; Vallee, Christophe [Helmholtz-Zentrum Dresden-Rossendorf e.V., Institute of Safety Research, P.O. Box 510 119, D-01314 Dresden (Germany); Zabala, Gustavo Adolfo Montoya [Department of Chemical Engineering, Simon Bolivar University, Valle of Sartenejas, Caracas 1080 (Venezuela, Bolivarian Republic of)


    Highlights: Black-Right-Pointing-Pointer We modelled CCFL in a PWR hot leg using Algebraic Interfacial Area Density model. Black-Right-Pointing-Pointer The model is able to distinguish the local flow morphologies. Black-Right-Pointing-Pointer Test fluids are air-water and steam-water. Black-Right-Pointing-Pointer Calculated CCFL and water level are in good agreement with experimental data. - Abstract: In order to improve the understanding of counter-current two-phase flow and to validate new physical models, CFD simulations of a 1/3rd scale model of the hot leg of a German Konvoi pressurized water reactor (PWR) with rectangular cross section were performed. Selected counter-current flow limitation (CCFL) experiments conducted at Helmholtz-Zentrum Dresden-Rossendorf (HZDR) were calculated with ANSYS CFX using the multi-fluid Euler-Euler modelling approach. The transient calculations were carried out using a gas/liquid inhomogeneous multiphase flow model coupled with a shear stress transport (SST) turbulence model. In the simulation, the drag law was approached by a newly developed correlation of the drag coefficient in the Algebraic Interfacial Area Density (AIAD) model. The model can distinguish the bubbles, droplets and the free surface using the local liquid phase volume fraction value. A comparison with the high-speed video observations shows a good qualitative agreement. The results indicate also a quantitative agreement between calculations and experimental data for the CCFL characteristics and the water level inside the hot leg channel.

  17. Analysis of the hydraulic effects associated to the location of an inflatable rubber weir over a spillway profile through experimental and numerical (CFD model

    Sarai Díaz García


    Full Text Available The ease of rubber weirs to adapt themselves to different flow conditions makes them interesting for placement over spillway profiles, allowing to increase the stored volume in ordinary operation without compromising the dam’s response in case of flooding. The objective of this study is to analyze the effect of locating an inflatable weir over a spillway profile in what regards its hydraulic response. With this purpose, an experimental and a numerical CFD model of a WES original spillway profile are developed, to then include an EPDM weir whose effect is analyzed for different inflation levels. Numerical and experimental results are close and highlight significant variations in the pressure distribution along the spillway, with aeration playing a significant role. This study concludes that the placement of this particular inflatable weir has an overall positive result if conveniently undertaken, but additional studies with different geometries are required to delve in the topic.

  18. New weighted sum of gray gases model applicable to Computational Fluid Dynamics (CFD) modeling of oxy-fuel combustion

    Yin, Chungen; Johansen, Lars Christian Riis; Rosendahl, Lasse


    Radiation is the principal mode of heat transfer in furnaces. Models for gaseous radiative properties have been well established for air combustion. However, there is uncertainty regarding their applicability to oxy-fuel conditions. In this paper, a new and complete set of weighted sum of gray...

  19. Navier-Stokes Solvers and Generalizations for Reacting Flow Problems

    Elman, Howard C


    This is an overview of our accomplishments during the final term of this grant (1 September 2008 -- 30 June 2012). These fall mainly into three categories: fast algorithms for linear eigenvalue problems; solution algorithms and modeling methods for partial differential equations with uncertain coefficients; and preconditioning methods and solvers for models of computational fluid dynamics (CFD).

  20. Experimental verification of a CFD model intended for the determination of restitution coefficients used in erosion modelling

    Hernik Bartłomiej


    Full Text Available Erosion caused by solid particles transported with the steam or flue gas has a negative impact on the power unit reliability and availability. The erosion rate depends inter alia on the restitution of the particle velocity upon impact. The restitution coefficients determine the angle of the particle reflection off the tube surface and the particle post-impingement velocity, i.e., they determine the direction of the particle path, which has a substantial impact on the erosion phenomenon inside the tube. An attempt is made herein to develop a method of determination of restitution coefficients by means of numerical modelling assisted by experimental testing on physical models that will be implemented further in the Ansys Fluent code. Such a numerical procedure will verify the model of erosion caused by particles of iron oxides. The erodent impingement angle α1, the impingement velocity w1, and the reflection velocity w2 are measured using the Casio High-Speed Exilim EX-F1 camera, which enables filming at a high rate. The film is then processed graphically for “frame-by-frame” tracking. The following erodents were used in the testing: iron oxides, quartz sand with a different grain size (490, 1000, 1500, 2000 μm, and 1000 μm-diameter steel balls. The steel balls, due to their ideal shape, were treated as the comparative analysis reference standard. Erosion of three types of 5x10 cm plates was tested: a plasma-coated plate with an anti-erosion layer, an aluminium plate; and a steel sheet plate. Based on the restitution coefficient testing results, numerical simulations were performed of the particle reflection off the surface.

  1. State of the art in CFD pre- and postprocessing

    Vembe, B. E.; Hansen, E. W. M.


    Computational fluid dynamics (CFD) is a generic name for a wide range of numerical techniques that are used for obtaining solutions to the governing equations of thermo-fluid dynamics with or without chemical reactions. The report presents to the state of the art in pre- and postprocessing for CFD codes, both commercial and in-house SINTEF-NTH codes. The objectives of advanced CFD systems are discussed and the techniques for pre- and postprocessing are reviewed. The user friendliness of CFD codes, in general, are highlighted. A common definition of a user friendly computer program is one that is easy to learn, efficient, easy to remember, and satisfactory to use. Most of today's commercial CFD codes could benefit from an enhanced interface. It is desirable to develop standard data formats for input and output of CFD codes and direct-manipulation user interfaces are desirable in CFD applications. Largest potential for improvements of CFD codes and for users is in geometry modeling and grid generation.

  2. Arbitrary Shape Deformation in CFD Design

    Landon, Mark; Perry, Ernest


    Sculptor(R) is a commercially available software tool, based on an Arbitrary Shape Design (ASD), which allows the user to perform shape optimization for computational fluid dynamics (CFD) design. The developed software tool provides important advances in the state-of-the-art of automatic CFD shape deformations and optimization software. CFD is an analysis tool that is used by engineering designers to help gain a greater understanding of the fluid flow phenomena involved in the components being designed. The next step in the engineering design process is to then modify, the design to improve the components' performance. This step has traditionally been performed manually via trial and error. Two major problems that have, in the past, hindered the development of an automated CFD shape optimization are (1) inadequate shape parameterization algorithms, and (2) inadequate algorithms for CFD grid modification. The ASD that has been developed as part of the Sculptor(R) software tool is a major advancement in solving these two issues. First, the ASD allows the CFD designer to freely create his own shape parameters, thereby eliminating the restriction of only being able to use the CAD model parameters. Then, the software performs a smooth volumetric deformation, which eliminates the extremely costly process of having to remesh the grid for every shape change (which is how this process had previously been achieved). Sculptor(R) can be used to optimize shapes for aerodynamic and structural design of spacecraft, aircraft, watercraft, ducts, and other objects that affect and are affected by flows of fluids and heat. Sculptor(R) makes it possible to perform, in real time, a design change that would manually take hours or days if remeshing were needed.

  3. Wind Loads on Ships and Offshore Structures Estimated by CFD

    Aage, Christian; Hvid, S.L.; Hughes, P.H.;


    on a seagoing ferry and on a semisubmersible offshore platform have been estimated by CFD. The results have been compared with wind tunnel model tests and, for the ferry, a few full-scale measurements, and good agreement is obtained. The CFD method offers the possibility of a computational estimate of scale...... effects related to wind tunnel model testing. An example of such an estimate on the ferry is discussed. Due to the time involved in generating the computational mesh and in computing the solution, the CFD method is not at the moment economically competitive to routine wind tunnel model testing....

  4. 基于高精度近似模型的舰船线型优化%A method of hull line optimization based on CFD and approximate model

    刘鹏; 付雪峰


    Hull line optimization was an important part of general design for naval architecture. The common way of hull line optimization by CFD was limited by model construction and mesh building which greatly delayed the optimization. A model contains CFD and neural network was set up to forecast the result of hull line optimization, which made the prediction faster and better.%线型优化是船舶总体性能设计的重要内容,借助 CFD 软件开展船舶线型优化需要进行三维建模和复杂的网格划分,时效性有限。本文提出一种基于高精度近似模型的线型优化法,在 CFD 计算结果的基础上,通过构建神经网络近似模型,对线型优化结果进行预报。该方法不仅能够实现线型优化结果的快速预报,而且可以解决 CFD离散优化随机性的难题,大大提高线型优化的效率。

  5. Interactive CFD simulations

    Duque Lombana, Juan Fernando


    This project is about the development of an implementable Interactive Computer Fluid Dynamics methodology -- The range of this work begins with an overview of the current status of computational fluid dynamics simulation software and methodologies, continues with an introduction to what interactive and interactivity mean, develops an all original interactive CFD methodology to follow for the solution of fluid scenarios and finally, the description of the implementation of an interactive solve...

  6. Numerical Methods For Chemically Reacting Flows

    Leveque, R. J.; Yee, H. C.


    Issues related to numerical stability, accuracy, and resolution discussed. Technical memorandum presents issues in numerical solution of hyperbolic conservation laws containing "stiff" (relatively large and rapidly changing) source terms. Such equations often used to represent chemically reacting flows. Usually solved by finite-difference numerical methods. Source terms generally necessitate use of small time and/or space steps to obtain sufficient resolution, especially at discontinuities, where incorrect mathematical modeling results in unphysical solutions.

  7. Algorithm For Computation Of Chemically Reacting Flow

    Chen, Yen-Sen; Chen, Chein-Pin; Shang, Huan-Min


    Efficient algorithm developed for use in solving differential equations of transient, chemically reacting flows at all speeds from zero to high mach numbers. Mathematical models represent coupling of thermal, chemical, and dynamical effects. Original intended application is numerical simulation of flows in rocket engines; also applicable to other complex flows affected by finite-rate chemistry - for example, flows in turbines and in internal-combustion engines.

  8. CFD Applications in Energy and Environment Sectors: Volume 1

    Maher A.R. Sadiq Al-Baghdadi and Hashim R. Abdol Hamid


    Full Text Available Chapter 1: Simulation and Modelling of Oxygen Coal Combustion with Flue Gas Recirculation. Chaouki Ghenai Chapter 2: The Choice of the Best Air Distribution Concept in Air-Conditioned Auditorium by Means of CFD Numerical Prediction. Barbara Lipska, Piotr Koper Chapter 3: CFD Applications in Natural Ventilation of Buildings and Air Quality Dispersion. N. Nikolopoulos, A. Nikolopoulos, I. Papadakis, K.-S. P. Nikas Chapter 4: CFD Modeling of Air Pollutant Transport and Dispersion. Labovský Juraj, Jelemenský Ľudovít Chapter 5: CFD Modeling of Multiphase Flow in Environmental Engineering. Masroor Mohajerani, Mehrab Mehrvar, Farhad Ein-Mozaffari Chapter 6: CFD Study on the Roles of Trees on Airflow and Pollutant Dispersion within Urban Street Canyons. Salim Mohamed Salim, Andrew Chan, Riccardo Buccolieri, Silvana Di Sabatino Chapter 7: Energy Efficiency and Air Quality in Hospitals Design. Essam E. Khalil Chapter 8: Application of CFD in Pulverized Fuel Combustion. M. Tayyeb Javed, Tahira Sultana Chapter 9: A Heat Transfer Model For Fluids Based on Cellular Automaton Application to an Air Conditioning of A Building. Andrés Saiz Martínez Chapter 10: CFD Application in Power Plants. Essam E. Khalil Chapter 11: Analysis and Computation of the Heat Charge/Discharge Behavior in Packed Bed Thermal Storage Systems. Pei-Wen Li, Jon Van Lew, Wafaa Karaki, Cho Lik Chan, Jake Stephens

  9. The role of computational fluid dynamics (CFD) in hair science.

    Spicka, Peter; Grald, Eric


    The use of computational fluid dynamics (CFD) as a virtual prototyping tool is widespread in the consumer packaged goods industry. CFD refers to the calculation on a computer of the velocity, pressure, and temperature and chemical species concentrations within a flowing liquid or gas. Because the performance of manufacturing equipment and product designs can be simulated on the computer, the benefit of using CFD is significant time and cost savings when compared to traditional physical testing methods. CFD has been used to design, scale-up and troubleshoot mixing tanks, spray dryers, heat exchangers and other process equipment. Recently, computer models of the capillary wicking process inside fibrous structures have been added to CFD software. These models have been used to gain a better understanding of the absorbent performance of diapers and feminine protection products. The same models can also be used to represent the movement of shampoo, conditioner, colorants and other products through the hair and scalp. In this paper, we provide an introduction to CFD and show some examples of its application to the manufacture of consumer products. We also provide sonic examples to show the potential of CFD for understanding the performance of products applied to the hair and scalp.

  10. Viscous flow simulation in a stenosis model using discrete particle dynamics: a comparison between DPD and CFD.

    Feng, Rui; Xenos, Michalis; Girdhar, Gaurav; Kang, Wei; Davenport, James W; Deng, Yuefan; Bluestein, Danny


    Flow and stresses induced by blood flow acting on the blood cellular constituents can be represented to a certain extent by a continuum mechanics approach down to the order of the μm level. However, the molecular effects of, e.g., adhesion/aggregation bonds of blood clotting can be on the order of nm. The coupling of the disparate length and timescales between such molecular levels and macroscopic transport represents a major computational challenge. To address this challenge, a multiscale numerical approach based on discrete particle dynamics (DPD) methodology derived from molecular dynamics (MD) principles is proposed. The feasibility of the approach was firstly tested for its ability to simulate viscous flow conditions. Simulations were conducted in low Reynolds numbers flows (Re = 25-33) through constricted tubes representing blood vessels with various degrees of stenosis. Multiple discrete particles interacting with each other were simulated, with 1.24-1.36 million particles representing the flow domain and 0.4 million particles representing the vessel wall. The computation was carried out on the massive parallel supercomputer NY BlueGene/L employing NAMD-a parallel MD package for high performance computing (HPC). Typical recirculation zones were formed distal to the stenoses. The velocity profiles and recirculation zones were in excellent agreement with computational fluid dynamics (CFD) 3D Navier-Stokes viscous fluid flow simulations and with classic numerical and experimental results by YC Fung in constricted tubes. This feasibility analysis demonstrates the potential of a methodology that widely departs from a continuum approach to simulate multiscale phenomena such as flow induced blood clotting.

  11. The role of CFD combustion modeling in hydrogen safety management – IV: Validation based on non-homogeneous hydrogen–air experiments

    Sathiah, Pratap, E-mail: [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands); Komen, Ed, E-mail: [Nuclear Research and Consultancy Group (NRG), Westerduinweg 3, 1755 ZG Petten (Netherlands); Roekaerts, Dirk, E-mail: [Delft University of Technology, Department of Process and Energy, Section Fluid Mechanics, Mekelweg 2, 2628 CD Delft (Netherlands)


    Highlights: • TFC combustion model is further extended to simulate flame propagation in non-homogeneous hydrogen–air mixtures. • TFC combustion model results are in good agreement with large-scale non-homogeneous hydrogen–air experiments. • The model is further extended to account for the non-uniform hydrogen–air–steam mixture for the presence of PARs on hydrogen deflagration. - Abstract: The control of hydrogen in the containment is an important safety issue in NPPs during a loss of coolant accident, because the dynamic pressure loads from hydrogen combustion can be detrimental to the structural integrity of the reactor safety systems and the reactor containment. In Sathiah et al. (2012b), we presented a computational fluid dynamics based method to assess the consequence of the combustion of uniform hydrogen–air mixtures. In the present article, the extension of this method to and its validation for non-uniform hydrogen–air mixture is described. The method is implemented in the CFD software ANSYS FLUENT using user defined functions. The extended code is validated against non-uniform hydrogen–air experiments in the ENACCEF facility. It is concluded that the maximum pressure and intermediate peak pressure were predicted within 12% and 18% accuracy. The eigen frequencies of the residual pressure wave phenomena were predicted within 4%. It is overall concluded that the current model predicts the considered ENACCEF experiments well.

  12. Analysis CFD for the hydrogen transport in the primary containment of a BWR; Analisis CFD para el transporte de hidrogeno en la contencion primaria de un reactor BWR

    Jimenez P, D. A.; Del Valle G, E. [IPN, Escuela Superior de Fisica y Matematicas, Av. IPN s/n, Edificio 9, Col. San Pedro Zacatenco, 07738 Mexico D. F. (Mexico); Gomez T, A. M., E-mail: [ININ, Departamento de Sistemas Nucleares, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)


    This study presents a qualitative and quantitative comparison among the CFD GASFLOW and OpenFOAM codes which are related with the phenomenon of hydrogen transport and other gases in the primary containment of a Boiling Water Reactor (BWR). GASFLOW is a commercial license code that is well validated and that was developed in Germany for the analysis of the gases transport in containments of nuclear reactors. On the other hand, OpenFOAM is an open source code that offers several evaluation solvers for different types of phenomena; in this case, the solver reacting-Foam is used to analyze the hydrogen transport inside the primary containment of the BWR. The results that offer the solver reacting-Foam of OpenFOAM are evaluated in the hydrogen transport calculation and the results are compared with those of the program of commercial license GASFLOW to see if is viable the use of the open source code in the case of the hydrogen transport in the primary containment of a BWR. Of the obtained results so much quantitative as qualitative some differences were identified between both codes, the differences (with a percentage of maximum error of 4%) in the quantitative results are small and they are considered acceptable for this analysis type, also, these differences are attributed mainly to the used transport models, considering that OpenFOAM uses a homogeneous model and GASFLOW uses a heterogeneous model. (Author)

  13. CFD simulations of the MEXICO rotor

    Bechmann, Andreas; Sørensen, Niels N.; Zahle, Frederik


    The wake behind a wind turbine model is investigated using Computational Fluid Dynamics (CFD), and results are compared with measurements. The turbine investigated is the three‐bladed test rotor (D = 4.5 m) used in the Model Experiments in Controlled Conditions (MEXICO) wind tunnel experiment....... During the MEXICO experiment, particle image velocimetry measurements of the induction upstream and downstream of the rotor were performed for different operating conditions, giving a unique dataset to verify theoretical models and CFD models. The present paper first describes the efforts in reproducing...... the experimental results using the Reynold‐Averaged Navier‐Stokes method. Second, three‐dimensional airfoil characteristics are extracted that allow simulations with simpler wake models. Copyright © 2011 John Wiley & Sons, Ltd....

  14. State of the Art of Multi-Dimensional Modeling of Engine Reacting Flows État de l'art de la modélisation multidimensionnelle pour les écoulements réactifs dans les moteurs

    Gosman A. D.


    Full Text Available An overview is provided of the state of art and future prospects for the use of CFD simulation in engine analysis and design. The aspects covered include geometry handling and mesh generation, numerical solvers, mathematical modeling of key physical phenomena, exploitation of parallel computers and industrial application. The main conclusions are that:- solver and mesh generation methodology developments, allied to parallel computing technology, now enable much more rapid turnaround in CFD simulations than hitherto;- physics modeling is at an advanced stage for most aspects of SI combustion simulation, but less so for Diesel combustion and for spray-related processes generally;- the overall picture is one of rapidly-increasing use of CFD for engine design;- future developments, including the use of LES, promise even better results. Cet article dresse un aperçu de l'état de l'art et des perspectives de l'utilisation de la modélisation 3D pour l'analyse et le développement des moteurs. Les aspects abordés comprennent l'acquisition des géométries, la génération des maillages, les méthodologies numériques, la modélisation mathématique des phénomènes physiques importants, l'exploitation des calculateurs parallèles et l'application industrielle. Les conclusions principales de cette analyse font apparaître les points suivants : - les méthodologies numériques et la génération des maillages, associées au calcul parallèle, permettent maintenant de raccourcir notablement le cycle total de simulation ; - la modélisation physique a atteint sa maturité dans la plupart des aspects relatifs à la simulation de la combustion en allumage commandé ; en revanche, elle reste encore à acquérir en ce qui concerne la combustion Diesel et certains aspects des processus reliés aux sprays ; - globalement, l'utilisation de la simulation 3D pour la conception des moteurs est en forte augmentation ; - les développements futurs, dont l


    Sankaran Sundaresan


    The principal goal of this project, funded under the ''DOE Vision 21 Virtual Demonstration Initiative'' is virtual demonstration of circulating fluidized bed performance. We had proposed a ''virtual demonstration tool'', which is based on the open-domain CFD code MFIX. The principal challenge funded through this grant is to devise and implement in this CFD code sound physical models for the rheological characteristics of the gas-particle mixtures. Within the past year, which was the third year of the project, we have made the following specific advances. (a) We have completed a study of the impact of sub-grid models of different levels of detail on the results obtained in coarse-grid simulations of gas-particle flow. (b) We have also completed a study of a model problem to understand the effect of wall friction, which was proved in our earlier work to be very important for stable operation of standpipes in a circulating fluidized bed circuit. These are described in a greater detail in this report.

  16. Acquisition of Long-Duration, Low-Gravity Slosh Data Utilizing Existing ISS Equipment (SPHERES) for Calibration of CFD Models of Coupled Fluid-Vehicle Behavior

    Schallhorn, Paul; Roth, Jacob; Marsell, Brandon; Kirk, Daniel; Gutierrez, Hector; Saenz-Otero, Alvar; Dorney, Daniel; Moder, Jeffrey


    Accurate prediction of coupled fluid slosh and launch vehicle or spacecraft dynamics (e.g., nutation/precessional movement about various axes, attitude changes, ect.) requires Computational Fluid Dynamics (CFD) models calibrated with low-gravity, long duration slosh data. Recently completed investigations of reduced gravity slosh behavior have demonstrated the limitations of utilizing parabolic flights on specialized aircraft with respect to the specific objectives of the experiments. Although valuable data was collected, the benefits of longer duration low-gravity environments were clearly established. The proposed research provides the first data set from long duration tests in zero gravity that can be directly used to benchmark CFD models, including the interaction between the sloshing fluid and the tank/vehicle dynamics. To explore the coupling of liquid slosh with the motion of an unconstrained tank in microgravity, NASA's Kennedy Space Center, Launch Services Program has teamed up with the Florida Institute of Technology (FIT), Massachusetts Institute of Technology (MIT) and the NASA Game Changing Development Program (GCD) to perform a series of slosh dynamics experiments on the International Space Station using the SPHERES platform. The Synchronized Position Hold Engage Reorient Experimental Satellites (SPHERES) testbed provides a unique, free-floating instrumented platform on ISS that can be utilized in a manner that would solve many of the limitations of the current knowledge related to propellant slosh dynamics on launch vehicle and spacecraft fuel tanks. The six degree of freedom (6-DOF) motion of the SPHERES free-flyer is controlled by an array of cold-flow C02 thrusters, supplied from a built-in liquid C02 tank. These SPHERES can independently navigate and re-orient themselves within the ISS. The intent of this project is to design an externally mounted tank to be driven inside the ISS by a set of two SPHERES devices (Figure 1). The tank geometry

  17. CFD simulation of a solar tower

    Koten, Hasan; Yukselenturk, Yalcyn; Yilmaz, Mustafa [Marmara University Mechanical Engineering Department (Turkey)], E-mail:


    With the depletion of fossil fuels and the rising concerns about their impacts on the environment, the use of alternative energy sources has become necessary. Among the alternatives, solar energy, with its unlimited resources and its low impact on the environment, is the most promising. The aim of this paper is to present a numerical model of a regular solar tower. A CFD analysis of the solar tower was performed with a commercial CFD code and velocity fields, temperature measurements and flow characteristics were determined and compared to experimental results available in the literature. It was found that the numerical model is capable of assessing the buoyant air flow in chimneys. In addition results showed that increasing the solar chimney height, solar collector area, or solar irradiance increases power generation capacity while ambient temperature does not significantly affect this capacity. This study provided a numerical model which is proficient in modeling solar towers.

  18. CFD analysis of the plate heat exchanger - Mathematical modelling of mass and heat transfer in serial connection with tubular heat exchanger

    Bojko, Marian; Kocich, Radim


    Application of numerical simulations based on the CFD calculation when the mass and heat transfer between the fluid flows is essential component of thermal calculation. In this article the mathematical model of the heat exchanger is defined, which is subsequently applied to the plate heat exchanger, which is connected in series with the other heat exchanger (tubular heat exchanger). The present contribution deals with the possibility to use the waste heat of the flue gas produced by small micro turbine. Inlet boundary conditions to the mathematical model of the plate heat exchanger are obtained from the results of numerical simulation of the tubular heat exchanger. Required parameters such for example inlet temperature was evaluated from temperature field, which was subsequently imported to the inlet boundary condition to the simulation of plate heat exchanger. From the results of 3D numerical simulations are evaluated basic flow variables including the evaluation of dimensionless parameters such as Colburn j-factor and friction ft factor. Numerical simulation is realized by software ANSYS Fluent15.0.

  19. 3D-FE Modeling of 316 SS under Strain-Controlled Fatigue Loading and CFD Simulation of PWR Surge Line

    Mohanty, Subhasish [Argonne National Lab. (ANL), Argonne, IL (United States); Barua, Bipul [Argonne National Lab. (ANL), Argonne, IL (United States); Listwan, Joseph [Argonne National Lab. (ANL), Argonne, IL (United States); Majumdar, Saurin [Argonne National Lab. (ANL), Argonne, IL (United States); Natesan, Ken [Argonne National Lab. (ANL), Argonne, IL (United States)


    In financial year 2017, we are focusing on developing a mechanistic fatigue model of surge line pipes for pressurized water reactors (PWRs). To that end, we plan to perform the following tasks: (1) conduct stress- and strain-controlled fatigue testing of surge-line base metal such as 316 stainless steel (SS) under constant, variable, and random fatigue loading, (2) develop cyclic plasticity material models of 316 SS, (3) develop one-dimensional (1D) analytical or closed-form model to validate the material models and to understand the mechanics associated with 316 SS cyclic hardening and/or softening, (4) develop three-dimensional (3D) finite element (FE) models with implementation of evolutionary cyclic plasticity, and (5) develop computational fluid dynamics (CFD) model for thermal stratification, thermal-mechanical stress, and fatigue of example reactor components, such as a PWR surge line under plant heat-up, cool-down, and normal operation with/without grid-load-following. This semi-annual progress report presents the work completed on the above tasks for a 316 SS laboratory-scale specimen subjected to strain-controlled cyclic loading with constant, variable, and random amplitude. This is the first time that the accurate 3D-FE modeling of the specimen for its entire fatigue life, including the hardening and softening behavior, has been achieved. We anticipate that this work will pave the way for the development of a fully mechanistic-computer model that can be used for fatigue evaluation of safety-critical metallic components, which are traditionally evaluated by heavy reliance on time-consuming and costly test-based approaches. This basic research will not only help the nuclear reactor industry for fatigue evaluation of reactor components in a cost effective and less time-consuming way, but will also help other safety-related industries, such as aerospace, which is heavily dependent on test-based approaches, where a single full-scale fatigue test can cost

  20. CFD Simulation on Ethylene Furnace Reactor Tubes


    Different mathematical models for ethylene furnace reactor tubes were reviewed. On the basis of these models a new mathematical simulation approach for reactor tubes based on computational fluid dynamics (CFD) technique was presented. This approach took the flow, heat transfer, mass transfer and thermal cracking reactions in the reactor tubes into consideration. The coupled reactor model was solved with the SIMPLE algorithm. Some detailed information about the flow field, temperature field and concentration distribution in the reactor tubes was obtained, revealing the basic characteristics of the hydrodynamic phenomena and reaction behavior in the reactor tubes. The CFD approach provides the necessary information for conclusive decisions regarding the production optimization, the design and improvement of reactor tubes, and the new techniques implementation.

  1. Effect of Dietary Countermeasures and Impact of Gravity on Renal Calculi Size Distributions Predicted by PBE-System and PBE-CFD Models

    Kassemi, M.; Thompson, D.; Goodenow, D.; Gokoglu, S.; Myers, J.


    Renal stone disease is not only a concern on earth but can conceivably pose a serious risk to the astronauts health and safety in Space. In this work, two different deterministic models based on a Population Balance Equation (PBE) analysis of renal stone formation are developed to assess the risks of critical renal stone incidence for astronauts during space travel. In the first model, the nephron is treated as a continuous mixed suspension mixed product removal crystallizer and the PBE for the nucleating, growing and agglomerating renal calculi is coupled to speciation calculations performed by JESS. Predictions of stone size distributions in the kidney using this model indicate that the astronaut in microgravity is at noticeably greater but still subcritical risk and recommend administration of citrate and augmented hydration as effective means of minimizing and containing this risk. In the second model, the PBE analysis is coupled to a Computational Fluid Dynamics (CFD) model for flow of urine and transport of Calcium and Oxalate in the nephron to predict the impact of gravity on the stone size distributions. Results presented for realistic 3D tubule and collecting duct geometries, clearly indicate that agglomeration is the primary mode of size enhancement in both 1g and microgravity. 3D numerical simulations seem to further indicate that there will be an increased number of smaller stones developed in microgravity that will likely pass through the nephron in the absence of wall adhesion. However, upon reentry to a 1g (Earth) or 38g (Mars) partial gravitational fields, the renal calculi can lag behind the urinary flow in tubules that are adversely oriented with respect to the gravitational field and grow agglomerate to large sizes that are sedimented near the wall with increased propensity for wall adhesion, plaque formation, and risk to the astronauts.

  2. Development of an integrated methodology for the design and optimization of charging and EGR circuits in modern diesel engines based on 1D-CFD engine modelling

    Arrigoni, Stefano; Avolio, Giovanni; Loudjertli, Lydia; Renella, Alfonso; Vassallo, Alberto [General Motors Powertrain Europe, Turin (Italy)


    In modern diesel engines, the requirements on the combustion system are very tightening, due to an aggressive combination of pollutant emission, fuel economy, NVH and fun-to-drive targets. In particular, the charging and EGR circuits, with their impact on combustion system performance, deserve a special attention, both in terms of architecture selection, as well as component design and specifications. Since most of these choices occur very early in the engine design phase, it is of high importance to have a reliable analytical tool capable to predict the performance of such components, prior than the actual hardware is available for testing. The present paper describes the development and application to a new diesel engine of an integrated approach for charging and EGR circuit design optimization, based on a set of high-level targets for emissions, fuel economy and performance. In order to achieve this goal, a 1D-CFD approach based on GT-Power suite has been employed: specific sub-routines and semi-empirical models for accurate heat-release and emission prediction have been developed and validated, and finally applied to a light-duty passenger car diesel engine under development. The results show that the tool is capable to predict engine indicated cycle as well as NOx, PM emissions depending on the characteristics of charging and EGR circuits, and can be used to cascade high-level engine target to component specifications (turbocharger, EGR cooler, intercooler) in an effective way. (orig.)

  3. CFD Vision 2030 Study: A Path to Revolutionary Computational Aerosciences

    Slotnick, Jeffrey; Khodadoust, Abdollah; Alonso, Juan; Darmofal, David; Gropp, William; Lurie, Elizabeth; Mavriplis, Dimitri


    This report documents the results of a study to address the long range, strategic planning required by NASA's Revolutionary Computational Aerosciences (RCA) program in the area of computational fluid dynamics (CFD), including future software and hardware requirements for High Performance Computing (HPC). Specifically, the "Vision 2030" CFD study is to provide a knowledge-based forecast of the future computational capabilities required for turbulent, transitional, and reacting flow simulations across a broad Mach number regime, and to lay the foundation for the development of a future framework and/or environment where physics-based, accurate predictions of complex turbulent flows, including flow separation, can be accomplished routinely and efficiently in cooperation with other physics-based simulations to enable multi-physics analysis and design. Specific technical requirements from the aerospace industrial and scientific communities were obtained to determine critical capability gaps, anticipated technical challenges, and impediments to achieving the target CFD capability in 2030. A preliminary development plan and roadmap were created to help focus investments in technology development to help achieve the CFD vision in 2030.

  4. CFD simulations of filling and emptying of hydrogen tanks



    During the filling of hydrogen tanks high temperatures can be generated inside the vessel because of the gas compression while during the emptying low temperatures can be reached because of the gas expansion. The design temperature range goes from 40 C to 85 C. Temperatures outside that range could affect the mechanical properties of the tank materials. CFD analyses of the filling and emptying processes have been performed in the HyTransfer project. To assess the accuracy of the CFD model the...

  5. Aircraft Design Analysis, CFD And Manufacturing

    Haifa El-Sadi


    Full Text Available Aircraft design, manufacturing and CFD analysis as part of aerodynamic course, the students achieve sizing from a conceptual sketch, select the airfoil geometry and the tail geometry, calculate thrust to weight ratio and wing loading, use initial sizing and calculate the aerodynamic forces. The students design their aircraft based on the geometrical dimensions resulted from the calculations and use the model to build a prototype, test it in wind tunnel and achieve CFD analysis to be compared with the experimental results. The theory of aerodynamic is taught and applied as a project based. In this paper, the design process, aircraft manufacturing and CFD analysis are presented to show the effect of project based on student’s learning of aerodynamic course. This project based learning has improved and accelerated students understanding of aerodynamic concepts and involved students in a constructive exploration. The analysis of the aircraft resulted in a study that revolved around the lift and drag generation of this particular aircraft. As to determine the lift and drag forces generated by this plane, a model was created in Solidworks a 3-D model-rendering program. After this model was created it was 3-D printed in a reduced scale, and subjected to wind tunnel testing. The results from the wind tunnel lab experiment were recorded. For accuracy, the same 3-D model was then simulated using CFD simulation software within Solidworks and compared with the results from the wind tunnel test. The values derived from both the simulation and the wind tunnel tests were then compared with the theoretical calculations for further proof of accuracy.

  6. The Dalles Dam, Columbia River: Spillway Improvement CFD Study

    Cook, Chris B.; Richmond, Marshall C.; Serkowski, John A.


    This report documents development of computational fluid dynamics (CFD) models that were applied to The Dalles spillway for the US Army Corps of Engineers, Portland District. The models have been successfully validated against physical models and prototype data, and are suitable to support biological research and operations management. The CFD models have been proven to provide reliable information in the turbulent high-velocity flow field downstream of the spillway face that is typically difficult to monitor in the prototype. In addition, CFD data provides hydraulic information throughout the solution domain that can be easily extracted from archived simulations for later use if necessary. This project is part of an ongoing program at the Portland District to improve spillway survival conditions for juvenile salmon at The Dalles. Biological data collected at The Dalles spillway have shown that for the original spillway configuration juvenile salmon passage survival is lower than desired. Therefore, the Portland District is seeking to identify operational and/or structural changes that might be implemented to improve fish passage survival. Pacific Northwest National Laboratory (PNNL) went through a sequence of steps to develop a CFD model of The Dalles spillway and tailrace. The first step was to identify a preferred CFD modeling package. In the case of The Dalles spillway, Flow-3D was as selected because of its ability to simulate the turbulent free-surface flows that occur downstream of each spilling bay. The second step in development of The Dalles CFD model was to assemble bathymetric datasets and structural drawings sufficient to describe the dam (powerhouse, non-overflow dam, spillway, fish ladder entrances, etc.) and tailrace. These datasets are documented in this report as are various 3-D graphical representations of The Dalles spillway and tailrace. The performance of the CFD model was then validated for several cases as the third step. The validated model

  7. CFD as a seakeeping tool for ship design

    Sungeun Peter Kim


    Full Text Available Seakeeping analysis has progressed from the linear frequency-domain 2D strip method to the nonlinear time-domain 3D panel method. Nevertheless, the violent free surface flows such as slamming and green water on deck are beyond the scope of traditional panel methods based on potential theory. Recently, Computational Fluid Dynamics (CFD has become an attractive numerical tool that can effectively deal with the violent free surface flows. ABS, as a classification society, is putting forth a significant amount of effort to implement the CFD technology to the advanced strength assessment of modern commercial ships and high-speed naval craft. The main objective of this study is to validate the CFD technology as a seakeeping tool for ship design considering fully nonlinear three-dimensional slamming and green water on deck. The structural loads on a large container carrier were successfully calculated from the CFD analysis and validated with segmented model test measurements.

  8. Correlation of Puma airloads: Evaluation of CFD prediction methods

    Strawn, Roger C.; Desopper, Andre; Miller, Judith; Jones, Alan


    A cooperative program was undertaken by research organizations in England, France, Australia and the U.S. to study the capabilities of computational fluid dynamics codes (CFD) to predict the aerodynamic loading on helicopter rotor blades. The program goal is to compare predictions with experimental data for flight tests of a research Puma helicopter with rectangular and swept tip blades. Two topics are studied. First, computed results from three CFD codes are compared for flight test cases where all three codes use the same partial inflow-angle boundary conditions. Second, one of the CFD codes (FPR) is iteratively coupled with the CAMRAD/JA helicopter performance code. These results are compared with experimental data and with an uncoupled CAMRAD/JA solution. The influence of flow field unsteadiness is found to play an important role in the blade aerodynamics. Alternate boundary conditions are suggested in order to properly model this unsteadiness in the CFD codes.

  9. Correlation of Puma airfoils - Evaluation of CFD prediction methods

    Strawn, Roger C.; Desopper, Andre; Miller, Judith; Jones, Alan


    A cooperative program was undertaken by research organizations in England, France, Australia and the U.S. to study the capabilities of computational fluid dynamics codes (CFD) to predict the aerodynamic loading on helicopter rotor blades. The program goal is to compare predictions with experimental data for flight tests of a research Puma helicopter with rectangular and swept tip blades. Two topics are studied. First, computed results from three CFD codes are compared for flight test cases where all three codes use the same partial inflow-angle boundary conditions. Second, one of the CFD codes (FPR) is iteratively coupled with the CAMRAD/JA heilcopter performance code. These results are compared with experimental data and with an uncoupled CAMRAD/JA solution. The influence of flow field unsteadiness is found to play an important role in the blade aerodynamics. Alternate boundary conditions are suggested in order to properly model this unsteadiness in the CFD codes.

  10. Dicty_cDB: CFD712 [Dicty_cDB

    Full Text Available Representative seq. ID CFD71...2F (Link to Original site) Representative DNA sequence >CFD712 (CFD712Q) /CSM/CF/CFD7-A/CFD712Q.Seq.d/ AAAAA

  11. Turbulent diffusion of chemically reacting gaseous admixtures

    Elperin, T.; Kleeorin, N.; Liberman, M.; Rogachevskii, I.


    We study turbulent diffusion of chemically reacting gaseous admixtures in a developed turbulence. In our previous study [Phys. Rev. Lett. 80, 69 (1998), 10.1103/PhysRevLett.80.69] using a path-integral approach for a delta-correlated in a time random velocity field, we demonstrated a strong modification of turbulent transport in fluid flows with chemical reactions or phase transitions. In the present study we use the spectral τ approximation that is valid for large Reynolds and Peclet numbers and show that turbulent diffusion of the reacting species can be strongly depleted by a large factor that is the ratio of turbulent and chemical times (turbulent Damköhler number). We have demonstrated that the derived theoretical dependence of a turbulent diffusion coefficient versus the turbulent Damköhler number is in good agreement with that obtained previously in the numerical modeling of a reactive front propagating in a turbulent flow and described by the Kolmogorov-Petrovskii-Piskunov-Fisher equation. We have found that turbulent cross-effects, e.g., turbulent mutual diffusion of gaseous admixtures and turbulent Dufour effect of the chemically reacting gaseous admixtures, are less sensitive to the values of stoichiometric coefficients. The mechanisms of the turbulent cross-effects differ from the molecular cross-effects known in irreversible thermodynamics. In a fully developed turbulence and at large Peclet numbers the turbulent cross-effects are much larger than the molecular ones. The obtained results are applicable also to heterogeneous phase transitions.

  12. Mathematical aspects of reacting and diffusing systems

    Fife, Paul C


    Modeling and analyzing the dynamics of chemical mixtures by means of differ- tial equations is one of the prime concerns of chemical engineering theorists. These equations often take the form of systems of nonlinear parabolic partial d- ferential equations, or reaction-diffusion equations, when there is diffusion of chemical substances involved. A good overview of this endeavor can be had by re- ing the two volumes by R. Aris (1975), who himself was one of the main contributors to the theory. Enthusiasm for the models developed has been shared by parts of the mathematical community, and these models have, in fact, provided motivation for some beautiful mathematical results. There are analogies between chemical reactors and certain biological systems. One such analogy is rather obvious: a single living organism is a dynamic structure built of molecules and ions, many of which react and diffuse. Other analogies are less obvious; for example, the electric potential of a membrane can diffuse like a chemical, and ...

  13. CFD validation of the thermal comfort in a room using draft rates


    Air temperature and velocity are the two main factors affecting the thermal comfort indoors. These two values can be easily obtained using computational fluid dynamic (CFD) simulations together with the turbulence kinetic energy value. This paper evaluates methods of calculating thermal comfort indices using CFD. Simulated results are compared against experimental data measured in a purpose build full-scale model room. The results show that CFD data can reliably predict thermal comfort values...

  14. CFD based Investigation of Wave-Structure Interaction and Hydrodynamics of an Oscillating Water Column Device

    Kamath, Arun


    The application of computational fluid dynamics (CFD) methods to various problems in the field of coastal and ocean engineering is gaining importance due to the level of detail and accuracy offered by these methods. With the advances made in the computing power over the last decade and anticipated future increase in computational power, large and complex problems can be handled using CFD modeling. The PhD study aims at the development of a CFD-based numerical wave tank, vali...

  15. Quantitative Relative Comparison of CFD Simulation Uncertainties for a Transonic Diffuser Problem

    Hosder, Serhat; Grossman, Bernard; Haftka, Raphael T.; Mason, William H.; Watson, Layne T.


    Different sources of uncertainty in CFD simulations are illustrated by a detailed study of two-dimensional, turbulent, transonic flow in a converging-diverging channel. Runs were performed with the commercial CFD code GASP using different turbulence models, grid levels, and flux-limiters to see the effect of each on the CFD simulation uncertainties. Two flow conditions were studied by changing the exit pressure ratio: the first is a complex case with a strong shock and a separated flow region...

  16. Alpine Windharvest: development of information base regarding potentials and the necessary technical, legal and socio-economic conditions for expanding wind energy in the Alpine Space - CFD modelling evaluation - Summary of WindSim CFD modelling procedure and validation

    Schaffner, B.; Cattin, R. [Meteotest, Berne (Switzerland)


    This report presents the development work carried out by the Swiss meteorology specialists of the company METEOTEST as part of a project carried out together with the Swiss wind-energy organisation 'Suisse Eole'. The framework for the project is the EU Interreg IIIB Alpine Space Programme, a European Community Initiative Programme funded by the European Regional Development Fund. The project investigated the use of digital relief-analysis. The report describes the development of a basic information system to aid the investigation of the technical, legal and socio-economical conditions for the use of wind energy in the alpine area. The report deals with the use of computational fluid dynamics and wind simulation modelling techniques and their validation. Recommendations on the use of the results are made.

  17. CFD Analysis-based Torque Converter Performance Prediction Model with Equivalent Parameters%基于CFD的液力变矩器等效参数性能预测模型

    吴光强; 王立军


    The correlation between parameters of one dimensional flow model and computational fluid dynamics (CFD) results is derived from guaranteeing precision of estimation of incidence loss. Energy loss within each impeller passages are extracted from CFD results, and the exact energy loss coefficients are achieved by the least mean square method which minimizes the deviation of the calculated energy loss from CFD results. Then, the component of energy loss is analyzed, which provides reference for further modification of design. The one dimensional flow model is modified by taking account of the equivalent parameters and energy loss coefficients, and the deviation of predictive pump torque capacity from CFD results is reduced within 3. 2%. Furthermore, this deviation still keeps less than 7. 3% after modifying the shape parameters of blades which leads to 6. 9 % increment of torque capacity at rotating stall and 2. 5% decrement of peak efficiency.%从保证冲击损失计算精度的角度出发,推导了一维束流理论性能预测模型中各参数基于计算流体力学(CFD)分析的等效表达式.从CFD分析结果中提取各叶轮的损失功率,运用最小二乘法确定各损失项的损失系数,进而得到液力损失的构成情况,为进一步改进设计提供依据.运用得到的等效参数与各项损失系数修正一维束流理论性能预测模型,修正后的等效参数性能预测模型的泵轮转矩系数与CFD分析最大偏差减小至3.2%以内.改变液力变矩器的叶形参数,使失速时泵轮转矩系数提高6.9%,最高效率降低2.5%.分别使用等效参数性能预测模型与CFD分析重新计算,等效参数性能预测模型的泵轮转矩系数与CFD计算结果偏差在7.3%以内,仍然保持较好的一致性.

  18. From EMPD to CFD – overview of different approaches for Heat Air and Moisture modeling in IEA Annex 41

    Janssens, Arnold; Woloszyn, Monica; Rode, Carsten;


    This paper provides an overview of the recent developments of Heat, Air and Moisture modeling of Whole Buildings, which were carried out within a collaborative project of the International Energy Agency. The project has strived to advance the possibilities to calculate the integrated phenomena of...

  19. Three dimensional CFD modeling and experimental validation of a single chamber solid oxide fuel cell fed by methane

    Nguyen, H. T.; Le, M. V.; Nguyen, T. A.; Nguyen, T. A. N.


    The solid oxide fuel cell is one of the promising technologies for future energy demand. Solid oxide fuel cell operated in the single-chamber mode exhibits several advantages over conventional single oxide fuel cell due to the simplified, compact, sealing-free cell structure. There are some studies on simulating the behavior of this type of fuel cell but they mainly focus on the 2D model. In the present study, a three-dimensional numerical model of a single chamber solid oxide fuel cell (SOFC) is reported and solved using COMSOL Multiphysics software. Experiments of a planar button solid oxide fuel cell were used to verify the simulation results. The system is fed by methane and oxygen and operated at 700°C. The cathode is LSCF6482, the anode is GDC-Ni, the electrolyte is LDM and the operating pressure is 1 atm. There was a good agreement between the cell temperature and current voltage estimated from the model and measured from the experiment. The results indicate that the model is applicable for the single chamber solid oxide fuel cell and it can provide a basic for the design, scale up of single chamber solid oxide fuel cell system.

  20. From EMPD to CFD – overview of different approaches for Heat Air and Moisture modeling in IEA Annex 41

    Woloszyn, Monika; Rode, Carsten; Kalagasidis, Angela S.;


    This paper provides an overview of the recent developments of Heat, Air and Moisture modeling of Whole Buildings, which were carried out within a collaborative project of the International Energy Agency. The project has strived to advance the possibilities to calculate the integrated phenomena of...

  1. Coupled simulation of CFD-flight-mechanics with a two-species-gas-model for the hot rocket staging

    Li, Yi; Reimann, Bodo; Eggers, Thino


    The hot rocket staging is to separate the lowest stage by directly ignite the continuing-stage-motor. During the hot staging, the rocket stages move in a harsh dynamic environment. In this work, the hot staging dynamics of a multistage rocket is studied using the coupled simulation of Computational Fluid Dynamics and Flight Mechanics. Plume modeling is crucial for a coupled simulation with high fidelity. A 2-species-gas model is proposed to simulate the flow system of the rocket during the staging: the free-stream is modeled as "cold air" and the exhausted plume from the continuing-stage-motor is modeled with an equivalent calorically-perfect-gas that approximates the properties of the plume at the nozzle exit. This gas model can well comprise between the computation accuracy and efficiency. In the coupled simulations, the Navier-Stokes equations are time-accurately solved in moving system, with which the Flight Mechanics equations can be fully coupled. The Chimera mesh technique is utilized to deal with the relative motions of the separated stages. A few representative staging cases with different initial flight conditions of the rocket are studied with the coupled simulation. The torque led by the plume-induced-flow-separation at the aft-wall of the continuing-stage is captured during the staging, which can assist the design of the controller of the rocket. With the increasing of the initial angle-of-attack of the rocket, the staging quality becomes evidently poorer, but the separated stages are generally stable when the initial angle-of-attack of the rocket is small.

  2. Experimental and CFD Studies of Coolant Flow Mixing within Scaled Models of the Upper and Lower Plenums of NGNP Gas-Cooled Reactors

    Hassan, Yassin [Texas A & M Univ., College Station, TX (United States); Anand, Nk [Texas A & M Univ., College Station, TX (United States)


    A 1/16th scaled VHTR experimental model was constructed and the preliminary test was performed in this study. To produce benchmark data for CFD validation in the future, the facility was first run at partial operation with five pipes being heated. PIV was performed to extract the vector velocity field for three adjacent naturally convective jets at statistically steady state. A small recirculation zone was found between the pipes, and the jets entered the merging zone at 3 cm from the pipe outlet but diverged as the flow approached the top of the test geometry. Turbulence analysis shows the turbulence intensity peaked at 41-45% as the jets mixed. A sensitivity analysis confirmed that 1000 frames were sufficient to measure statistically steady state. The results were then validated by extracting the flow rate from the PIV jet velocity profile, and comparing it with an analytic flow rate and ultrasonic flowmeter; all flow rates lie within the uncertainty of the other two methods for Tests 1 and 2. This test facility can be used for further analysis of naturally convective mixing, and eventually produce benchmark data for CFD validation for the VHTR during a PCC or DCC accident scenario. Next, a PTV study of 3000 images (1500 image pairs) were used to quantify the velocity field in the upper plenum. A sensitivity analysis confirmed that 1500 frames were sufficient to precisely estimate the flow. Subsequently, three (3, 9, and 15 cm) Y-lines from the pipe output were extracted to consider the output differences between 50 to 1500 frames. The average velocity field and standard deviation error that accrued in the three different tests were calculated to assess repeatability. The error was varied, from 1 to 14%, depending on Y-elevation. The error decreased as the flow moved farther from the output pipe. In addition, turbulent intensity was calculated and found to be high near the output. Reynolds stresses and turbulent intensity were used to validate the data by

  3. Development of a 3D CFD model for velocity and concentration field of a jet flow in CANDU-6 moderator tank induced by high velocity injection of liquid neutron poison

    Rhee, Bo Wook; Choi, Hang Bok [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Yun, Hye Jeong [Korea Electric Power Research Institute, Taejon (Korea, Republic of)


    This report describes the development and validation work of developing a 3D CFD model for analyzing the liquid poison jet velocity and concentration which is necessary for the performance test of SDS2 of CANDU-6 among the forseeable problems expected in the CANDU-6 loaded with DUPIC fuel. As a boundary condition the liquid poison injection rate through each injection hole was given and the 3D CFD model for analyzing the downstream flow and concentration field is developed and validated. The injection rate is calculated by the ALITRIG code developed by AECL. As the ratio of the calandria tank and the injection hole drilled at the injection nozzle is as big as 2000, the grid generation for the calandria is very difficult as the number of the grid can easily exceed the computational load limit of the available work station. Thus to overcome this difficulty the inlet jet flow has been modeled as a source term of the mass, momentum and concentration at the grid near the real inlet. This modeling method enabled the analysis of the jet velocity and concentration possible within the computation limit of the available work station. And as the experimental data available for validating this model has only video taped pictures, and the jet height growth rate is estimated by the observer's subjective judgement, it was most difficult to convert the location of the jet front to the corresponding concentration value. Utilizing the experiment data from Bhabha Atomic Research Center in India, the jet growth rate was validated and the result was very much encouraging. Based on the results the 3D CFD model developed in this report shows physically reasonable results and will be used for the analysis of SDS2 performance test along with the reactor physics codes.

  4. CFD for wastewater treatment: an overview.

    Samstag, R W; Ducoste, J J; Griborio, A; Nopens, I; Batstone, D J; Wicks, J D; Saunders, S; Wicklein, E A; Kenny, G; Laurent, J

    Computational fluid dynamics (CFD) is a rapidly emerging field in wastewater treatment (WWT), with application to almost all unit processes. This paper provides an overview of CFD applied to a wide range of unit processes in water and WWT from hydraulic elements like flow splitting to physical, chemical and biological processes like suspended growth nutrient removal and anaerobic digestion. The paper's focus is on articulating the state of practice and research and development needs. The level of CFD's capability varies between different process units, with a high frequency of application in the areas of final sedimentation, activated sludge basin modelling and disinfection, and greater needs in primary sedimentation and anaerobic digestion. While approaches are comprehensive, generally capable of incorporating non-Newtonian fluids, multiphase systems and biokinetics, they are not broad, and further work should be done to address the diversity of process designs. Many units have not been addressed to date. Further needs are identified throughout, but common requirements include improved particle aggregation and breakup (flocculation), and improved coupling of biology and hydraulics.

  5. Investigation of the influence of peniche and flow boundaries on the flow around a half-model using CFD simulation

    Glazkov, S. A.; Gorbushin, A. R.; Kursakov, I. A.; Yasenok, K. A.


    The paper presents the results of an investigation of the flow around a half-model of a passenger aircraft and its components in T-128 wind tunnel test section with perforated walls with the help of numerical solutions of the Reynolds-averaged Navier-Stokes (RANS) equations. Cases of limitless flow in the presence of a peniche and without it were considered. To configure the peniche without a flow-through between the symmetry plane and the half-model, several options for the peniche height were considered. Its optimum height was determined based on the analysis of the obtained results. Simulation of the flow around a half-fuselage with gas flow-through under the peniche was carried out. Corrections to the coefficients of aerodynamic load acting on the half-fuselage were obtained. Comparison of the test results for an alone configuration fuselage and a half-fuselage without corrections and with the obtained computed correction is presented.

  6. Heat transfer partitioning model of film boiling of particle cluster in a liquid pool: implementation in a CFD code

    Mahapatra, Pallab S.; Ghosh, Koushik; Manna, Nirmal K.


    In the present work an effective heat transfer partitioning model of three phase (particles, liquid and vapour) flow and thermal interaction have been developed by a multi-fluid approach under film boiling condition. The in-house multiphase flow code is based on finite volume method of discretization and SIMPLE-based pressure correction algorithm. From consideration of mass, momentum and energy balance across the liquid-vapour interface, the vapour bubble generated from the vapour film have been modeled and incorporated in the code. Different interaction terms between each phase are incorporated depending upon the flow regime. The code is validated with in-house and available experimental results. Finally the effect of relevant parameters on void generation under film boiling condition of particles is estimated.

  7. CFD Modelling and Experimental Testing of Thermal Calcination of Kaolinite Rich Clay Particles - An Effort towards Green Concrete

    Gebremariam, Abraham Teklay

    Cement industry is one of the major industrial emitters of greenhouse gases, generating 5-7% of the total anthropogenic CO2 emissions. Consequently, use of supplementary cementitious materials (SCM) to replace part of the CO2-intensive cement clinker is an attractive way to mitigate CO2 emissions...... from cement industry. SCMs based on industrial byproducts like fly ashes and slags are subject to availability problems. Yet clays are the most ubiquitous material on earth's crust. Thus, properly calcined clays are a very promising candidate for SCMs to produce green cements. Calcination...... PROcess Modeling System) software, which is suspended during the project due to the adjustment made by the project consortium. The model results from both C++ and gPROMS software show good similarity. Various experiments have been performed to derive key kinetic data, to collect data from a gas suspension...

  8. CFD RANS Simulations on a Generic Conventional Scale Model Submarine: Comparison between Fluent and OpenFOAM


    functions have such a small effect on the simulated value for the drag coefficient as the switch to the laminar behaviour at y+ ~ 11 would explain the source of these differences. The modification to the wall functions in OpenFOAM described in Section 6 partially explains the...model currently implemented in Fluent incorporates modifications for low Reynolds number effects, compressibility and shear flow spreading [11]. The

  9. CFD modeling and experimental validation of heat and mass transfer in wood poles subjected to high temperatures: a conjugate approach

    Younsi, R.; Kocaefe, D.; Poncsak, S.; Kocaefe, Y.; Gastonguay, L.


    In this article, a coupling method is presented in the case of high thermal treatment of a wood pole and a three-dimensional numerical simulation is proposed. The conservation equations for the wood sample are obtained using diffusion equation with variables diffusion coefficients and the incompressible Reynolds averaged Navier Stokes equations have been solved for the flow field. The connection between the two problems is achieved by expressing the continuity of the state variables and their respective fluxes through the interface. Turbulence closure is obtained by the use of the standard k ɛ model with the usual wall function treatment. The model equations are solved numerically by the commercial package ANSYS-CFX10. The wood pole was subjected to high temperature treatment under different operating conditions. The model validation is carried out via a comparison between the predicted values with those obtained experimentally. The comparison of the numerical and experimental results shows good agreement, implying that the proposed numerical algorithm can be used as a useful tool in designing high-temperature wood treatment processes. A parametric study was also carried out to determine the effects of several parameters such as initial moisture content, wood aspect ratio and final gas temperature on temperature and moisture content distributions within the samples during heat treatment.

  10. Numerical modelling of the flow in the annular multi-recess hydrostatic thrust bearing using CFD methods

    Drbáková S.


    Full Text Available The current research of hydrostatic bearings and hydrostatic slide-ways is far from being over. The topic is constantly evolving, creating new geometries of the sliding bearings, developing new types of friction materials and lubricants. The control elements of hydraulic mechanisms that serve to regulation of the hydrostatic bearings tipping are still in progress. Almost every application has different requirements for the bearings, whether in terms of loading capacity, speed rotation, and also the price. All these aspects should be included in the design of hydrostatic thrust bearings. Thanks to great advances in the development of computer technology and software for numerical modelling, we can simulate real movement of viscous fluids. To create a numerical model of hydrostatic thrust bearing, Ansys Fluent 14.0 software package has been applied. The article describes the basic methods of numerical modelling of the given problem and evaluates the pressure field and the loading capacity of annular multi-recess hydrostatic thrust bearing and its dependence on the change in static pressure.

  11. Prediction of deformation and hygro-thermal stresses distribution in PEM fuel cell vehicle using three-dimensional CFD model

    Sadiq Al-Baghdadi, Maher A.R. [Fuel Cell Research Center, International Energy & Environment Foundation, Al-Najaf, P.O.Box 39 (Iraq)


    Durability is one of the most critical remaining issues impeding successful commercialization of broad PEM fuel cell transportation energy applications. Automotive fuel cells are likely to operate with neat hydrogen under load-following or load-levelled modes and be expected to withstand variations in environmental conditions, particularly in the context of temperature and atmospheric composition. In addition, they are also required to survive over the course of their expected operational lifetimes i.e., around 5,500 hrs, while undergoing as many as 30,000 startup/shutdown cycles. The damage mechanisms in a PEM fuel cell are accelerated by mechanical stresses arising during fuel cell assembly (bolt assembling), and the stresses arise during fuel cell running, because it consists of the materials with different thermal expansion and swelling coefficients. Therefore, in order to acquire a complete understanding of the damage mechanisms in the membrane, mechanical response under steady-state hygro-thermal stresses should be studied under real cell operating conditions and in real cell geometry (three-dimensional). In this work, full three-dimensional, non-isothermal computational fluid dynamics model of a PEM fuel cell has been developed to simulate the stresses inside the PEM fuel cell, which are occurring during fuel cell assembly (bolt assembling), and the stresses arise during fuel cell running due to the changes of temperature and relative humidity. A unique feature of the present model is to incorporate the effect of hygro and thermal stresses into actual three-dimensional fuel cell model. In addition, the temperature and humidity dependent material properties are utilize in the simulation for the membrane. The model is shown to be able to understand the many interacting, complex electrochemical, transport phenomena, and stresses distribution that have limited experimental data. This model is used to study and analyse the effect of operating parameters on the

  12. Prediction of deformation and hygro-thermal stresses distribution in PEM fuel cell vehicle using three-dimensional CFD model

    Maher A.R. Sadiq Al-Baghdadi


    Full Text Available Durability is one of the most critical remaining issues impeding successful commercialization of broad PEM fuel cell transportation energy applications. Automotive fuel cells are likely to operate with neat hydrogen under load-following or load-levelled modes and be expected to withstand variations in environmental conditions, particularly in the context of temperature and atmospheric composition. In addition, they are also required to survive over the course of their expected operational lifetimes i.e., around 5,500 hrs, while undergoing as many as 30,000 startup/shutdown cycles. The damage mechanisms in a PEM fuel cell are accelerated by mechanical stresses arising during fuel cell assembly (bolt assembling, and the stresses arise during fuel cell running, because it consists of the materials with different thermal expansion and swelling coefficients. Therefore, in order to acquire a complete understanding of the damage mechanisms in the membrane, mechanical response under steady-state hygro-thermal stresses should be studied under real cell operating conditions and in real cell geometry (three-dimensional. In this work, full three-dimensional, non-isothermal computational fluid dynamics model of a PEM fuel cell has been developed to simulate the stresses inside the PEM fuel cell, which are occurring during fuel cell assembly (bolt assembling, and the stresses arise during fuel cell running due to the changes of temperature and relative humidity. A unique feature of the present model is to incorporate the effect of hygro and thermal stresses into actual three-dimensional fuel cell model. In addition, the temperature and humidity dependent material properties are utilize in the simulation for the membrane. The model is shown to be able to understand the many interacting, complex electrochemical, transport phenomena, and stresses distribution that have limited experimental data. This model is used to study and analyse the effect of operating

  13. Assessment of the Bordas-Carnot Losses within the diffuser of tidal turbines using far-field and near-field CFD models.

    Hajaali, Arthur


    This project has for ambition to analyse and further the general understanding on cross-flows interactions and behaviours at the mouth of a mini/small tidal hydropower plant and a river. Although, the study of these interactions could benefit and find applications in multiple hydraulic problems, this project concentrates its focus on the influence of the transposed turbulences generated by the cross-flow into the diffuser. These eddies affect the overall performance and efficiency of the bulb-turbines by minimizing the pressure recovery. In the past, these turbulences were accounted with the implementation of the Bordas-Carnot losses coefficient for the design of tidal project using bulb-turbines. The bulb turbine technology has been the interest and subject of many scientific papers but most of them concentrate and narrow their focus on the design of the rotor, blades and combiner. This project wants to focus the design of the diffuser by performing an analysis on the development of eddies and the turbulences using computational fluid dynamic (CFD) models. The Severn estuary is endowed with one of the highest tidal range around the hemisphere. The first part of the research requires to select case studies sites such as Briton-Ferry to virtually design mini-tidal plant in 0-Dimentional (D), 2D and 3D modelling to study development and behaviour of turbulences within the diffuser. The far-field model represents the marine environment prior and after the structure where bulb turbines are located. The near-field modelling has allowed researcher to study at much higher resolution and precision the design of a single turbine feeding model with predetermined and fix boundary condition. For this reason, a near-field model is required to study in depth the behaviour and evolution of the turbulence with the diffuser. One of the main challenge and advancement of this research is to find a methodology and system to link the far-field and near-field modelling to produce an

  14. CFD Studies of Combustion in Direct Injection Single Cylinder Diesel Engine Using Non-Premixed Combustion Model

    S Gavudhama Karunanidhi


    Full Text Available In this study the simulation process of non-premixed combustion in a direct injection single cylinder diesel engine has been described. Direct injection diesel engines are used both in heavy duty vehicles and light duty vehicles. The fuel is injected directly into the combustion chamber. The fuel mixes with the high pressure air in the combustion chamber and combustion occurs. Due to the non-premixed nature of the combustion occurring in such engines, non-premixed combustion model of ANSYS FLUENT 14.5 can be used to simulate the combustion process. A 4-stroke diesel engine corresponds to one fuel injector hole without considering valves was modeled and combustion simulation process was studied. Here two types of combustion chambers were compared. Combustion studies of both chambers:- shallow depth and hemispherical combustion chambers were carried out. Emission characteristics of both combustion chambers had also been carried out. The obtained results are compared. It has been found that hemispherical combustion chamber is more efficient as it produces higher pressure and temperature compared to that of shallow depth combustion chamber. As the temperature increases the formation of NOx emissions and soot formation also get increased.

  15. Design of 500kW grate fired test facility using CFD

    Rosendahl, Lasse Aistrup; Kær, Søren Knudsen; Jørgensen, K.


    A 500kW vibrating grate fired test facility for solid biomass fuels has been designed using numerical models including CFD. The CFD modelling has focussed on the nozzle layout and flowpatterns in the lower part of the furnace, and the results have established confidence in the chosen design...

  16. Pilot‐scale investigation and CFD modeling of particle deposition in low‐dust monolithic SCR DeNOx catalysts

    Heiredal, Michael Lykke; Jensen, Anker Degn; Thøgersen, Joakim Reimer


    Deposition of particles in selective catalytic reduction DeNOx monolithic catalysts was studied by low‐dust pilot‐scale experiments. The experiments showed a total deposition efficiency of about 30%, and the deposition pattern was similar to that observed in full‐scale low‐dust applications....... On extended exposure to the dust‐laden flue gas, complete blocking of channels was observed, showing that also in low‐dust applications soot blowing is necessary to keep the catalyst clean. A particle deposition model was developed in computational fluid dynamics, and simulations were carried out assuming...... either laminar or turbulent flow. Assuming laminar flow, the accumulated mass was underpredicted with a factor of about 17, whereas assuming turbulent flow overpredicted the experimental result with a factor of about 2. The simulations showed that turbulent diffusion in the monolith channels and inertial...

  17. Modeling and CFD simulation of nutrient distribution in picoliter bioreactors for bacterial growth studies on single-cell level.

    Westerwalbesloh, Christoph; Grünberger, Alexander; Stute, Birgit; Weber, Sophie; Wiechert, Wolfgang; Kohlheyer, Dietrich; von Lieres, Eric


    A microfluidic device for microbial single-cell cultivation of bacteria was modeled and simulated using COMSOL Multiphysics. The liquid velocity field and the mass transfer within the supply channels and cultivation chambers were calculated to gain insight in the distribution of supplied nutrients and metabolic products secreted by the cultivated bacteria. The goal was to identify potential substrate limitations or product accumulations within the cultivation device. The metabolic uptake and production rates, colony size, and growth medium composition were varied covering a wide range of operating conditions. Simulations with glucose as substrate did not show limitations within the typically used concentration range, but for alternative substrates limitations could not be ruled out. This lays the foundation for further studies and the optimization of existing picoliter bioreactor systems.

  18. Francis-99: Transient CFD simulation of load changes and turbine shutdown in a model sized high-head Francis turbine

    Mössinger, Peter; Jester-Zürker, Roland; Jung, Alexander


    With increasing requirements for hydropower plant operation due to intermittent renewable energy sources like wind and solar, numerical simulations of transient operations in hydraulic turbo machines become more important. As a continuation of the work performed for the first workshop which covered three steady operating conditions, in the present paper load changes and a shutdown procedure are investigated. The findings of previous studies are used to create a 360° model and compare measurements with simulation results for the operating points part load, high load and best efficiency. A mesh motion procedure is introduced, allowing to represent moving guide vanes for load changes from best efficiency to part load and high load. Additionally an automated re-mesh procedure is added for turbine shutdown to ensure reliable mesh quality during guide vane closing. All three transient operations are compared to PIV velocity measurements in the draft tube and pressure signals in the vaneless space. Simulation results of axial velocity distributions for all three steady operation points, during both load changes and for the shutdown correlated well with the measurement. An offset at vaneless space pressure is found to be a result of guide vane corrections for the simulation to ensure similar velocity fields. Short-time Fourier transformation indicating increasing amplitudes and frequencies at speed-no load conditions. Further studies will discuss the already measured start-up procedure and investigate the necessity to consider the hydraulic system dynamics upstream of the turbine by means of a 1D3D coupling between the 3D flow field and a 1D system model.

  19. CFD Simulation On CFBC Boiler

    Amol S. Kinkar


    Full Text Available Abstract Heavy industrialization amp modernization of society demands in increasing of power cause to research amp develop new technology amp efficient utilization of existing power units. Variety of sources are available for power generation such as conventional sources like thermal hydro nuclear and renewable sources like wind tidal biomass geothermal amp solar. Out of these most common amp economical way for producing the power is by thermal power stations. Various industrial boilers plays an important role to complete the power generation cycle such as CFBC Circulating Fluidized Bed Combustion FBC Fluidized Bed Combustion AFBC Atmospheric Fluidized Bed Combustion Boiler CO Boiler RG amp WHR Boiler Waster heat recovery Boiler. This paper is intended to comprehensively give an account of knowledge related to refractory amp its failure in CFBC boiler with due effect of flue gas flow during operation on refractory by using latest technology of CAD Computer aided Design amp CAE Computer aided Engineering. By conceptual application of these technology the full scale model is able to analyze in regards the flow of flue gas amp bed material flow inside the CFBC loop via CFD Computational Fluid Dynamics software. The results obtained are helpful to understand the impact of gas amp particles on refractory in different areas amp also helped to choose suitable refractory material in different regions.

  20. Introducing CFD in the optical simulation of linear Fresnel collectors

    Moghimi, M. A.; Rungasamy, A.; Craig, K. J.; Meyer, J. P.


    This paper seeks to determine whether the Finite Volume method within a commercially available Computational Fluid Dynamics (CFD) solver (ANSYS Fluent) can model radiation with comparable accuracy to a Monte Carlo ray-tracing software package (SolTrace). A detailed investigation was performed into modeling techniques that can be used to significantly reduce the optical errors traditionally associated with CFD modeling of radiation false scattering and ray effect using a simple optical test case. The strategies formulated in the first part of this paper were used to model a variety of Linear Fresnel Collector Concentrating Solar Power Plants. This paper shows that commercial CFD packages yield accurate results for line focusing concentrating solar applications and simple geometries, validating its use in an integrated environment where both optical and thermal performance of these plants can be simulated and optimized.

  1. A CFD model for gas uniform distribution in turbulent flow for the production of titanium pigment in chloride process☆

    Yadong Li; Gang Xie; Ting Lei; Chongjun Bao; Lin Tian; Yanqing Hou


    The fluid dynamic behavior of feeding gas (TiCl4) in an annular channel affects the combination of O2 and TiCl4 in an oxidation reactor, a key piece of equipment in titanium pigment production. The numerical procedure was validated by a 3-dimensional gas flow in the annular channel. Applying the validated model, the flow character-istics of TiCl4 in the oxidation reactor with a tangential inlet were simulated and characterized. The flow distribu-tion with five rectifying rings of different structure was simulated and analyzed. The results showed that the rectifying ring improved the distribution uniformity of the pressure and outlet velocity. Compared to the original case without a rectifying ring, the non-uniformity of the pressure and outlet velocity could be reduced by up to 91%and 69%respectively. The rectifying ring #5, which can be instal ed and adjusted easily, is more effective in realizing even distribution. In addition, instal ation of the rectifying ring effectively reduced the circulating flow in an annular channel as well as the total energy loss.

  2. Dicty_cDB: CFD139 [Dicty_cDB

    Full Text Available CF (Link to library) CFD139 (Link to dictyBase) - - - Contig-U13855-1 CFD139Z (Link... to Original site) - - CFD139Z 648 - - - - Show CFD139 Library CF (Link to library) Clone ID CFD139 (Link Representative seq. ID CFD13...9Z (Link to Original site) Representative DNA sequence >CFD139 (CFD139Q) /CSM/CF/CFD1-B/CFD139Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value CFD139 (CFD139Q) /CSM/CF/CFD1-B/CFD139Q.Se

  3. CFD analysis of turbopump volutes

    Ascoli, Edward P.; Chan, Daniel C.; Darian, Armen; Hsu, Wayne W.; Tran, Ken


    An effort is underway to develop a procedure for the regular use of CFD analysis in the design of turbopump volutes. Airflow data to be taken at NASA Marshall will be used to validate the CFD code and overall procedure. Initial focus has been on preprocessing (geometry creation, translation, and grid generation). Volute geometries have been acquired electronically and imported into the CATIA CAD system and RAGGS (Rockwell Automated Grid Generation System) via the IGES standard. An initial grid topology has been identified and grids have been constructed for turbine inlet and discharge volutes. For CFD analysis of volutes to be used regularly, a procedure must be defined to meet engineering design needs in a timely manner. Thus, a compromise must be established between making geometric approximations, the selection of grid topologies, and possible CFD code enhancements. While the initial grid developed approximated the volute tongue with a zero thickness, final computations should more accurately account for the geometry in this region. Additionally, grid topologies will be explored to minimize skewness and high aspect ratio cells that can affect solution accuracy and slow code convergence. Finally, as appropriate, code modifications will be made to allow for new grid topologies in an effort to expedite the overall CFD analysis process.

  4. A Study on the Role of Reaction Modeling in Multi-phase CFD-based Simulations of Chemical Looping Combustion Impact du modèle de réaction sur les simulations CFD de la combustion en boucle chimique

    Kruggel-Emden H.


    Full Text Available Chemical Looping Combustion is an energy efficient combustion technology for the inherent separation of carbon dioxide for both gaseous and solid fuels. For scale up and further development of this process multi-phase CFD-based simulations have a strong potential which rely on kinetic models for the solid/gaseous reactions. Reaction models are usually simple in structure in order to keep the computational cost low. They are commonly derived from thermogravimetric experiments. With only few CFD-based simulations performed on chemical looping combustion, there is a lack in understanding of the role and of the sensitivity of the applied chemical reaction model on the outcome of a simulation. The aim of this investigation is therefore the study of three different carrier materials CaSO4, Mn3O4 and NiO with the gaseous fuels H2 and CH4 in a batch type reaction vessel. Four reaction models namely the linear shrinking core, the spherical shrinking core, the Avrami-Erofeev and a recently proposed multi parameter model are applied and compared on a case by case basis. La combustion en boucle chimique (Chemical Looping Combustion est une technologie de combustion efficace permettant le captage in situ du CO2 pour des charges gazeuses ou solides. Dans l’optique du développement et de l’extrapolation du procédé, la CFD est un outil de simulation à fort potentiel qui s’appuie notamment sur des modèles cinétiques pour décrire les réactions gaz-solide. Ces modèles décrivant les réactions sont généralement assez simples pour limiter les temps de simulation et sont obtenus à partir d’expérimentations en thermobalance. Il y a encore peu de travaux de modélisation CFD du procédé CLC et il est difficile d’estimer l’importance du modèle décrivant les réactions chimiques sur les résultats des simulations. Le but de ce travail est donc d’étudier la combustion de charges gazeuses H2 et CH4 dans des réacteurs en batch en consid

  5. 3D CFD modeling of flowing-gas DPALs with different pumping geometries and various flow velocities

    Yacoby, Eyal; Waichman, Karol; Sadot, Oren; Barmashenko, Boris D.; Rosenwaks, Salman


    Scaling-up flowing-gas diode pumped alkali lasers (DPALs) to megawatt class power is studied using accurate three-dimensional computational fluid dynamics model, taking into account the effects of temperature rise and losses of alkali atoms due to ionization. Both the maximum achievable power and laser beam quality are estimated for Cs and K lasers. We examined the influence of the flow velocity and Mach number M on the maximum achievable power of subsonic and supersonic lasers. For Cs DPAL devices with M = 0.2 - 3 the output power increases with increasing M by only 20%, implying that supersonic operation mode has only small advantage over subsonic. In contrast, the power achievable in K DPALs strongly depends on M. The output power increases by 100% when M increases from 0.2 to 4, showing a considerable advantage of supersonic device over subsonic. The reason for the increase of the power with M in both Cs and K DPALs is the decrease of the temperature due to the gas expansion in the flow system. However, the power increase for K lasers is much larger than for the Cs devices mainly due to the much smaller fine-structure splitting of the 2P states ( 58 cm-1 for K and 554 cm-1 for Cs), which results in a much stronger effect of the temperature decrease in K DPALs. For pumping by beams of the same rectangular cross section, comparison between end-pumping and transverse-pumping shows that the output power is not affected by the pump geometry. However, the intensity of the output laser beam in the case of transverse-pumped DPALs is strongly non-uniform in the laser beam cross section resulting in higher brightness and better beam quality in the far field for the end-pumping geometry where the intensity of the output beam is uniform.

  6. Viscoelastic Model for Lung Parenchyma for Multi-Scale Modeling of Respiratory System Phase I: Hypo-Elastic Model for CFD Implementation

    Freed, Alan D.; Einstein, Daniel R.


    An isotropic constitutive model for the parenchyma of lung has been derived from the theory of hypo-elasticity. The intent is to use it to represent the mechanical response of this soft tissue in sophisticated, computational, fluid-dynamic models of the lung. This demands that the continuum model be accurate, yet simple and effcient. An objective algorithm for its numeric integration is provided. The response of the model is determined for several boundary-value problems whose experiments are used for material characterization. The effective elastic, bulk, and shear moduli, and Poisson’s ratio, as tangent functions, are also derived. The model is characterized against published experimental data for lung. A bridge between this continuum model and a dodecahedral model of alveolar geometry is investigated, with preliminary findings being reported.

  7. CFD Analyses of Air-Ingress Accident for VHTRs

    Ham, Tae Kyu

    The Very High Temperature Reactor (VHTR) is one of six proposed Generation-IV concepts for the next generation of nuclear powered plants. The VHTR is advantageous because it is able to operate at very high temperatures, thus producing highly efficient electrical generation and hydrogen production. A critical safety event of the VHTR is a loss-of-coolant accident. This accident is initiated, in its worst-case scenario, by a double-ended guillotine break of the cross vessel that connects the reactor vessel and the power conversion unit. Following the depressurization process, the air (i.e., the air and helium mixture) in the reactor cavity could enter the reactor core causing an air-ingress event. In the event of air-ingress into the reactor core, the high-temperature in-core graphite structures will chemically react with the air and could lose their structural integrity. We designed a 1/8th scaled-down test facility to develop an experimental database for studying the mechanisms involved in the air-ingress phenomenon. The current research focuses on the analysis of the air-ingress phenomenon using the computational fluid dynamics (CFD) tool ANSYS FLUENT for better understanding of the air-ingress phenomenon. The anticipated key steps in the air-ingress scenario for guillotine break of VHTR cross vessel are: 1) depressurization; 2) density-driven stratified flow; 3) local hot plenum natural circulation; 4) diffusion into the reactor core; and 5) global natural circulation. However, the OSU air-ingress test facility covers the time from depressurization to local hot plenum natural circulation. Prior to beginning the CFD simulations for the OSU air-ingress test facility, benchmark studies for the mechanisms which are related to the air-ingress accident, were performed to decide the appropriate physical models for the accident analysis. In addition, preliminary experiments were performed with a simplified 1/30th scaled down acrylic set-up to understand the air

  8. A Nonlinear Dynamic Subscale Model for Partially Resolved Numerical Simulation (PRNS)/Very Large Eddy Simulation (VLES) of Internal Non-Reacting Flows

    Shih, Tsan-Hsing; Liu, nan-Suey


    A brief introduction of the temporal filter based partially resolved numerical simulation/very large eddy simulation approach (PRNS/VLES) and its distinct features are presented. A nonlinear dynamic subscale model and its advantages over the linear subscale eddy viscosity model are described. In addition, a guideline for conducting a PRNS/VLES simulation is provided. Results are presented for three turbulent internal flows. The first one is the turbulent pipe flow at low and high Reynolds numbers to illustrate the basic features of PRNS/VLES; the second one is the swirling turbulent flow in a LM6000 single injector to further demonstrate the differences in the calculated flow fields resulting from the nonlinear model versus the pure eddy viscosity model; the third one is a more complex turbulent flow generated in a single-element lean direct injection (LDI) combustor, the calculated result has demonstrated that the current PRNS/VLES approach is capable of capturing the dynamically important, unsteady turbulent structures while using a relatively coarse grid.

  9. Comparison of CFD Predictions with Shuttle Global Flight Thermal Imagery and Discrete Surface Measurements

    Wood, William A.; Kleb, William L.; Tang, chun Y.; Palmer, Grant E.; Hyatt, Andrew J.; Wise, Adam J.; McCloud, Peter L.


    Surface temperature measurements from the STS-119 boundary-layer transition experiment on the space shuttle orbiter Discovery provide a rare opportunity to assess turbulent CFD models at hypersonic flight conditions. This flight data was acquired by on-board thermocouples and by infrared images taken off-board by the Hypersonic Thermodynamic Infrared Measurements (HYTHIRM) team, and is suitable for hypersonic CFD turbulence assessment between Mach 6 and 14. The primary assessment is for the Baldwin-Lomax and Cebeci-Smith algebraic turbulence models in the DPLR and LAURA CFD codes, respectively. A secondary assessment is made of the Shear-Stress Transport (SST) two-equation turbulence model in the DPLR code. Based upon surface temperature comparisons at eleven thermocouple locations, the algebraic-model turbulent CFD results average 4% lower than the measurements for Mach numbers less than 11. For Mach numbers greater than 11, the algebraic-model turbulent CFD results average 5% higher than the three available thermocouple measurements. Surface temperature predictions from the two SST cases were consistently 3 4% higher than the algebraic-model results. The thermocouple temperatures exhibit a change in trend with Mach number at about Mach 11; this trend is not reflected in the CFD results. Because the temperature trends from the turbulent CFD simulations and the flight data diverge above Mach 11, extrapolation of the turbulent CFD accuracy to higher Mach numbers is not recommended.

  10. CFD based extraction column design-Chances and challenges

    Mark W Hlawitschka; Menwer M Attarakih; Samer S Alzyod; Hans-Jrg Bart


    This paper shows that one-dimensional (1-D) [and three-dimensional (3-D) computational fluid dynamics (CFD)] simulations can replace the state-of-the-art usage of pseudo-homogeneous dispersion or back mixing models. This is based on standardized lab-scale cel experiments for the determination of droplet rise, breakage, coalescence and mass transfer parameters in addition to a limited number of additional mini-plant experiments with original fluids. Alternatively, the hydrodynamic parameters can also be derived using more sophisticated 3-D CFD simulations. Computational 1-D modeling served as a basis to replace pilot-plant experiments in any column geometry. The combination of 3-D CFD simulations with droplet population balance models (DPBM) increased the accuracy of the hydrodynamic simulations and gave information about the local droplet size. The high computational costs can be reduced by open source CFD codes when using a flexible mesh generation. First combined simulations using a three way coupled CFD/DPBM/mass-transfer solver pave the way for a safer design of industrial-sized columns, where no correlations are available.

  11. Analysis of the Reduction Rate of Hematite Concentrate Particles in the Solid State by H2 or CO in a Drop-Tube Reactor Through CFD Modeling

    Fan, De-Qiu; Sohn, H. Y.; Elzohiery, Mohamed


    The kinetic analysis of the reduction of hematite concentrate particles by individual reducing gas H2 or CO was performed using a computational fluid dynamics (CFD)-based approach in this paper. The particle residence time was calculated through the integration of the equation of particle motion. Non-uniform particle temperature profiles inside the reactor were obtained, and were taken into consideration for the kinetic analysis. The calculated reduction degrees based on this approach are in good agreement with the experimental values.

  12. Validation of CFD simulation for flat plate solar energy collector

    Selmi, Mohamed; Al-Khawaja, Mohammed J.; Marafia, Abdulhamid [Department of Mechanical Engineering, University of Qatar, P.O. Box 2713, Doha, State of Qatar (Qatar)


    The problem of flat plate solar energy collector with water flow is simulated and analyzed using computational fluid dynamics (CFD) software. The considered case includes the CFD modeling of solar irradiation and the modes of mixed convection and radiation heat transfer between tube surface, glass cover, side walls, and insulating base of the collector as well as the mixed convective heat transfer in the circulating water inside the tube and conduction between the base and tube material. The collector performance, after obtaining 3-D temperature distribution over the volume of the body of the collector, was studied with and without circulating water flow. An experimental model was built and experiments were performed to validate the CFD model. The outlet temperature of water is compared with experimental results and there is a good agreement. (author)

  13. OpenFOAM: Open source CFD in research and industry

    Hrvoje Jasak


    Full Text Available The current focus of development in industrial Computational Fluid Dynamics (CFD is integration of CFD into Computer-Aided product development, geometrical optimisation, robust design and similar. On the other hand, in CFD research aims to extend the boundaries of practical engineering use in “non-traditional” areas. Requirements of computational flexibility and code integration are contradictory: a change of coding paradigm, with object orientation, library components, equation mimicking is proposed as a way forward. This paper describes OpenFOAM, a C++ object oriented library for Computational Continuum Mechanics (CCM developed by the author. Efficient and flexible implementation of complex physical models is achieved by mimicking the form of partial differential equation in software, with code functionality provided in library form. Open Source deployment and development model allows the user to achieve desired versatility in physical modeling without the sacrifice of complex geometry support and execution efficiency.

  14. Accurate Spectral Fits of Jupiter's Great Red Spot: VIMS Visual Spectra Modelled with Chromophores Created by Photolyzed Ammonia Reacting with Acetyleneχ±

    Baines, Kevin; Sromovsky, Lawrence A.; Fry, Patrick M.; Carlson, Robert W.; Momary, Thomas W.


    We report results incorporating the red-tinted photochemically-generated aerosols of Carlson et al (2016, Icarus 274, 106-115) in spectral models of Jupiter's Great Red Spot (GRS). Spectral models of the 0.35-1.0-micron spectrum show good agreement with Cassini/VIMS near-center-meridian and near-limb GRS spectra for model morphologies incorporating an optically-thin layer of Carlson (2016) aerosols at high altitudes, either at the top of the tropospheric GRS cloud, or in a distinct stratospheric haze layer. Specifically, a two-layer "crème brûlée" structure of the Mie-scattering Carlson et al (2016) chromophore attached to the top of a conservatively scattering (hereafter, "white") optically-thick cloud fits the spectra well. Currently, best agreement (reduced χ2 of 0.89 for the central-meridian spectrum) is found for a 0.195-0.217-bar, 0.19 ± 0.02 opacity layer of chromophores with mean particle radius of 0.14 ± 0.01 micron. As well, a structure with a detached stratospheric chromophore layer ~0.25 bar above a white tropospheric GRS cloud provides a good spectral match (reduced χ2 of 1.16). Alternatively, a cloud morphology with the chromophore coating white particles in a single optically- and physically-thick cloud (the "coated-shell model", initially explored by Carlson et al 2016) was found to give significantly inferior fits (best reduced χ2 of 2.9). Overall, we find that models accurately fit the GRS spectrum if (1) most of the optical depth of the chromophore is in a layer near the top of the main cloud or in a distinct separated layer above it, but is not uniformly distributed within the main cloud, (2) the chromophore consists of relatively small, 0.1-0.2-micron-radius particles, and (3) the chromophore layer optical depth is small, ~ 0.1-0.2. Thus, our analysis supports the exogenic origin of the red chromophore consistent with the Carlson et al (2016) photolytic production mechanism rather than an endogenic origin, such as upwelling of material

  15. Quantitative imaging of turbulent and reacting flows

    Paul, P.H. [Sandia National Laboratories, Livermore, CA (United States)


    Quantitative digital imaging, using planar laser light scattering techniques is being developed for the analysis of turbulent and reacting flows. Quantitative image data, implying both a direct relation to flowfield variables as well as sufficient signal and spatial dynamic range, can be readily processed to yield two-dimensional distributions of flowfield scalars and in turn two-dimensional images of gradients and turbulence scales. Much of the development of imaging techniques to date has concentrated on understanding the requisite molecular spectroscopy and collision dynamics to be able to determine how flowfield variable information is encoded into the measured signal. From this standpoint the image is seen as a collection of single point measurements. The present effort aims at realizing necessary improvements in signal and spatial dynamic range, signal-to-noise ratio and spatial resolution in the imaging system as well as developing excitation/detection strategies which provide for a quantitative measure of particular flowfield scalars. The standard camera used for the study is an intensified CCD array operated in a conventional video format. The design of the system was based on detailed modeling of signal and image transfer properties of fast UV imaging lenses, image intensifiers and CCD detector arrays. While this system is suitable for direct scalar imaging, derived quantities (e.g. temperature or velocity images) require an exceptionally wide dynamic range imaging detector. To apply these diagnostics to reacting flows also requires a very fast shuttered camera. The authors have developed and successfully tested a new type of gated low-light level detector. This system relies on fast switching of proximity focused image-diode which is direct fiber-optic coupled to a cooled CCD array. Tests on this new detector show significant improvements in detection limit, dynamic range and spatial resolution as compared to microchannel plate intensified arrays.

  16. Direct numerical simulation of turbulent reacting flows

    Chen, J.H. [Sandia National Laboratories, Livermore, CA (United States)


    The development of turbulent combustion models that reflect some of the most important characteristics of turbulent reacting flows requires knowledge about the behavior of key quantities in well defined combustion regimes. In turbulent flames, the coupling between the turbulence and the chemistry is so strong in certain regimes that is is very difficult to isolate the role played by one individual phenomenon. Direct numerical simulation (DNS) is an extremely useful tool to study in detail the turbulence-chemistry interactions in certain well defined regimes. Globally, non-premixed flames are controlled by two limiting cases: the fast chemistry limit, where the turbulent fluctuations. In between these two limits, finite-rate chemical effects are important and the turbulence interacts strongly with the chemical processes. This regime is important because industrial burners operate in regimes in which, locally the flame undergoes extinction, or is at least in some nonequilibrium condition. Furthermore, these nonequilibrium conditions strongly influence the production of pollutants. To quantify the finite-rate chemistry effect, direct numerical simulations are performed to study the interaction between an initially laminar non-premixed flame and a three-dimensional field of homogeneous isotropic decaying turbulence. Emphasis is placed on the dynamics of extinction and on transient effects on the fine scale mixing process. Differential molecular diffusion among species is also examined with this approach, both for nonreacting and reacting situations. To address the problem of large-scale mixing and to examine the effects of mean shear, efforts are underway to perform large eddy simulations of round three-dimensional jets.

  17. Diesel engine injection simulation using the CFD software Fluent; Einspritzungssimulationen von Dieselmotoren mit der CFD-Software Fluent

    Braun, M.; Wachter, E.M. [Fluent Deutschland GmbH, Darmstadt (Germany); Boemer, A. [DEUTZ AG, Koeln (Germany); Waidmann, W. [Fachhochschule Aalen (Germany)


    The commercial CFD Software FLUENT offers a variety of models and sub-models to simulate and predict the spray injection usually applied in IC-Engines. The following article provides an overview of FLUENT spray and particle flow modeling, and a validation case for high-pressure diesel spray. (orig.)

  18. CFD investigations of the aerodynamics of vehicle overtaking maneuvers

    Uddin, Mesbah; Chellaram, Arune Dhiren; Robinson, Austin Clay


    When two vehicle bodies are involved in a passing maneuver, interesting and intricate aerodynamic interactions occur between them. Such passing maneuvers are very important in racing and have been an area of active interest in motorsports for quite some time. The existing literature shows only a few studies in this area, and, as such, very little is known about the complex aerodynamics of racing in proximity. This paper presents a Computational Fluid Dynamics (CFD) methodology capable of describing the transient effects that occur in this scenario. This is achieved by simulating two tandem simplified vehicle bodies, the Ahmed body, which were placed in a virtual wind tunnel. One Ahmed body was kept stationary, while the other was allowed to move in the longitudinal direction with a relatively low velocity. In order to achieve reliable CFD results when one of the solid objects is moving, a new meshing methodology, called the overset mesh model, was implemented in the CFD process. The simulations were run using Star CCM+, a commercial finite-volume CFD program, in which the unsteady Reynolds Averaged Navier-Stokes (URANS) solver was applied. The CFD results are compared against fully transient and quasi-steady-state experimental results where encouraging correlations between the CFD and experiments are observed. The veracity of the CFD work presented in this paper provides significant insight into the complex aerodynamics of a passing maneuver, and lays the foundation for further analysis in this area using more complex vehicle shapes and more complex tandem racing or passing maneuvers at a yaw angle.

  19. Reducing numerical costs for core wide nuclear reactor CFD simulations by the Coarse-Grid-CFD

    Viellieber, Mathias; Class, Andreas G.


    Traditionally complete nuclear reactor core simulations are performed with subchannel analysis codes, that rely on experimental and empirical input. The Coarse-Grid-CFD (CGCFD) intends to replace the experimental or empirical input with CFD data. The reactor core consists of repetitive flow patterns, allowing the general approach of creating a parametrized model for one segment and composing many of those to obtain the entire reactor simulation. The method is based on a detailed and well-resolved CFD simulation of one representative segment. From this simulation we extract so-called parametrized volumetric forces which close, an otherwise strongly under resolved, coarsely-meshed model of a complete reactor setup. While the formulation so far accounts for forces created internally in the fluid others e.g. obstruction and flow deviation through spacers and wire wraps, still need to be accounted for if the geometric details are not represented in the coarse mesh. These are modelled with an Anisotropic Porosity Formulation (APF). This work focuses on the application of the CGCFD to a complete reactor core setup and the accomplishment of the parametrization of the volumetric forces.

  20. CFD Simulations of Soap Separation; CFD-simulering av avsaapning

    Birkestad, Per


    A part of Vaermeforsk, the 'Skogsindustriella programmet', has identified the possibility to increase the production of tall oil, and hence the competitiveness, in Swedish pulp mills through an increase in the efficiency of the soap separation tanks. Currently, soap is extracted from the black liquor through a sedimentation process where the less dense soap rise to the top of the liquor tank where it is removed through a over-flow ducting at the top of the tank. Vaermeforsk seeks a better understanding of the detailed flow and the separation mechanisms within the liquor tanks and has initiated a study of computational fluid dynamics (CFD) of the tanks. The aim of the study has been threefold; To develop CFD-methods for use in the study of soap separation processes, to investigate the detailed flow within two Swedish liquor tanks and one North American soap skimmer and lastly to develop new design rules for use in future designs of soap separation tanks. The project shows that CFD is a useful tool for the investigation of black liquor and soap flow within a soap separation tank. The CFD simulations of three existing liquor tanks show that the previously used design-rules based on surface loads are inadequate as the actual flow velocities within the tanks are two orders of magnitude larger than those previously used as reference (the surface load). The CFD simulations also show that the black liquor flow, and hence the soap separation, is very sensitive to density variations on the black liquor inlet and temperature variations as small as 1 deg C can significantly affect the liquor flow.

  1. FDNS CFD Code Benchmark for RBCC Ejector Mode Operation

    Holt, James B.; Ruf, Joe


    Computational Fluid Dynamics (CFD) analysis results are compared with benchmark quality test data from the Propulsion Engineering Research Center's (PERC) Rocket Based Combined Cycle (RBCC) experiments to verify fluid dynamic code and application procedures. RBCC engine flowpath development will rely on CFD applications to capture the multi-dimensional fluid dynamic interactions and to quantify their effect on the RBCC system performance. Therefore, the accuracy of these CFD codes must be determined through detailed comparisons with test data. The PERC experiments build upon the well-known 1968 rocket-ejector experiments of Odegaard and Stroup by employing advanced optical and laser based diagnostics to evaluate mixing and secondary combustion. The Finite Difference Navier Stokes (FDNS) code was used to model the fluid dynamics of the PERC RBCC ejector mode configuration. Analyses were performed for both Diffusion and Afterburning (DAB) and Simultaneous Mixing and Combustion (SMC) test conditions. Results from both the 2D and the 3D models are presented.

  2. CFD modeling and experimental verification of a single-stage coaxial Stirling-type pulse tube cryocooler without either double-inlet or multi-bypass operating at 30-35 K using mixed stainless steel mesh regenerator matrices

    Dang, Haizheng; Zhao, Yibo


    This paper presents the CFD modeling and experimental verifications of a single-stage inertance tube coaxial Stirling-type pulse tube cryocooler operating at 30-35 K using mixed stainless steel mesh regenerator matrices without either double-inlet or multi-bypass. A two-dimensional axis-symmetric CFD model with the thermal non-equilibrium mode is developed to simulate the internal process, and the underlying mechanism of significantly reducing the regenerator losses with mixed matrices is discussed in detail based on the given six cases. The modeling also indicates that the combination of the given different mesh segments can be optimized to achieve the highest cooling efficiency or the largest exergy ratio, and then the verification experiments are conducted in which the satisfactory agreements between simulated and tested results are observed. The experiments achieve a no-load temperature of 27.2 K and the cooling power of 0.78 W at 35 K, or 0.29 W at 30 K, with an input electric power of 220 W and a reject temperature of 300 K.

  3. Nuclear Energy CFD Application Management System

    Hyung Lee; Kimberlyn C. Mousseau


    In modeling and simulation (M&S), it is virtually impossible to separately evaluate the effectiveness of the model from the data used because the results produced rely heavily on the interaction between the two. Both the data and the simulation are responsible for achieving the ultimate goal of providing defensible research and development (R&D) products and decisions. It is therefore vital that data verification and validation (V&V) activities, along with stringent configuration management, be considered part of the overall M&S accreditation process. In support of these goals is the Nuclear Energy CFD Application Management System (NE-CAMS) for nuclear system design and safety analysis. Working with Bettis Laboratory and Utah State University, a plan of action is being developed by the Idaho National Laboratory (INL) that will address the highest and most immediate needs to track and manage computational fluid dynamics (CFD) models and experimental data in an electronic database. The database will intrinsically incorporate the Nuclear Regulatory Commission (NRC) approved policies and procedures for quality. The quality requirements will be such that the model and data must conform to the quality specifications outlined by the NRC before they can be entered into the database. The primary focus of this database is CFD V&V for nuclear industry needs and will, in practice, serve as the best practice guideline that will accommodate NRC regulations. Such a database, along with a prescriptive methodology for how to utilize it, will provide the NRC with accepted CFD results that could potentially be used for licensing. NE-CAMS will incorporate data V&V as key precursors to the distribution of nuclear systems design and safety data, ensuring that these data are appropriate for use in a particular M&S application. Verification will be conducted to provide a level of confidence that the data selected are the most appropriate for the simulation and are properly prepared, i

  4. CFD analysis of a rocket exhaust diffuser

    Bose, Tarit K.; Thanawala, R. H.; Annamalai, K.


    The nature of the complex shock structure responsible for the pressure recovery phenomenon in supersonic diffusers is investigated by means of a theoretical CFD analysis using a newly developed computer program for Navier-Stokes solution of an ejector system, and the Prandtl mixing length to model the turbulent boundary layer. The pressure recovery characteristics of an ejector diffuser system was studied for various geometric and flow conditions. A comparison of the results with those of pressure measurements along the diffuser length in an experimental facility showed discrepancies, which are attributed to the boundary conditions imposed.

  5. CFD Modeling of the Multipurpose Hydrogen Test Bed (MHTB) Self-Pressurization and Spray Bar Mixing Experiments in Normal Gravity: Effect of the Accommodation Coefficient on the Tank Pressure

    Kartuzova, Olga; Kassemi, Mohammad


    A CFD model for simulating the self-pressurization of a large scale liquid hydrogen storage tank is utilized in this paper to model the MHTB self-pressurization experiment. The kinetics-based Schrage equation is used to account for the evaporative and condensi ng interfacial mass flows in this model. The effect of the accommodation coefficient for calculating the interfacial mass transfer rate on the tank pressure during tank selfpressurization is studied. The values of the accommodation coefficient which were considered in this study vary from 1.0e-3 to 1.0e-1 for the explicit VOF model and from 1.0e-4 to 1.0e-3 for the implicit VOF model. The ullage pressure evolutions are compared against experimental data. A CFD model for controlling pressure in cryogenic storage tanks by spraying cold liquid into the ullage is also presented. The Euler-Lagrange approach is utilized for tracking the spray droplets and for modeling the interaction between the droplets and the continuous phase (ullage). The spray model is coupled with the VOF model by performing particle tracking in the ullage, removing particles from the ullage when they reach the interface, and then adding their contributions to the liquid. Droplet-ullage heat and mass transfer are modeled. The flow, temperature, and interfacial mass flux, as well as droplets trajectories, size distribution and temperatures predicted by the model are presented. The ul lage pressure and vapor temperature evolutions are compared with experimental data obtained from the MHTB spray bar mixing experiment. The effect of the accommodation coefficient for calculating the interfacial and droplet mass transfer rates on the tank pressure during mixing of the vapor using spray is studied. The values used for the accommodation coefficient at the interface vary from 1.0e-5 to 1.0e-2. The droplet accommodation coefficient values vary from 2.0e-6 to 1.0e-4.

  6. Development of multi-component diesel surrogate fuel models – Part II:Validation of the integrated mechanisms in 0-D kinetic and 2-D CFD spray combustion simulations

    Poon, Hiew Mun; Pang, Kar Mun; Ng, Hoon Kiat;


    The aim of this study is to develop compact yet comprehensive multi-component diesel surrogate fuel models for computational fluid dynamics (CFD) spray combustion modelling studies. The fuel constituent reduced mechanisms including n-hexadecane (HXN), 2,2,4,4,6,8,8-heptamethylnonane (HMN......), cyclohexane(CHX) and toluene developed in Part I are applied in this work. They are combined to produce two different versions of multi-component diesel surrogate models in the form of MCDS1 (HXN + HMN)and MCDS2 (HXN + HMN + toluene + CHX). The integrated mechanisms are then comprehensively validated in zero...... fuel model for diesel fuels with CN values ranging from 15 to100. It also shows that MCDS2 is a more appropriate surrogate model for fuels with aromatics and cyclo-paraffinic contents, particularly when soot calculation is of main interest....

  7. Measurements of Non-reacting and Reacting Flow Fields of a Liquid Swirl Flame Burner

    CHONG Cheng Tung; HOCHGREB Simone


    The understanding of the liquid fuel spray and flow field characteristics inside a combustor is crucial for designing a fuel efficient and low emission device. Characterisation of the flow field of a model gas turbine liquid swirl burner is performed by using a 2-D particle imaging velocimetry(PIV) system. The flow field pattern of an axial flow burner with a fixed swirl intensity is compared under confined and unconfined conditions, i.e., with and without the combustor wall. The effect of temperature on the main swirling air flow is investigated under open and non-reacting conditions. The result shows that axial and radial velocities increase as a result of decreased flow density and increased flow volume. The flow field of the main swirling flow with liquid fuel spray injection is compared to non-spray swirling flow. Introduction of liquid fuel spray changes the swirl air flow field at the burner outlet, where the radial velocity components increase for both open and confined environment. Under reacting condition, the enclosure generates a corner recirculation zone that intensifies the strength of radial velocity. The reverse flow and corner recirculation zone assists in stabilizing the flame by preheating the reactants. The flow field data can be used as validation target for swirl combustion modelling.

  8. Computational Fluid Dynamics (CFD Analysis of Natural Convection of Convergent-Divergent Fins in Marine Environments

    K. Alawadhi


    Full Text Available Computational Fluid Dynamics (CFD analysis was carried out for the convergent-divergent fins arranged inline and staggered on the base plate as per the experimental setup provided in the technical paper [1]. This paper reports on the validation of results of modeling and simulation in CFD. The simulation was carried out using the ANSYS 12.0 as the CFD modeling software. The main objective of the CFD analysis was to calculate the temperature distribution on the surface of the base plate and surface of the convergent-divergent fins for the given inline and staggered arrangement of fins due to the effect of natural convection heat transfer for different heat power inputs, and also to compare the CFD results with the experimental results.

  9. Modelling of temporal and spatial evolution of sulphur oxides and sulphuric acid under large, two-stroke marine engine-like conditions using integrated CFD-chemical kinetics

    Pang, Kar Mun; Karvounis, Nikolas; Walther, Jens Honore


    In this work, three-dimensional computational fluid dynamics (CFD) studies of sulphur oxides (SOx) andsulphuric acid (H2SO4) formation processes in a large, low speed two-stroke marine diesel engine are carriedout. The current numerical study aims to investigate the conversion of sulphuric dioxide...... that the flameimpinges at the cylinder liner near top dead centre. The gas is cooled rapidly by the wall temperatureand H2SO4 is produced in the region where the local temperature is less than 600 K. Based on the fluegas correlation, the acid dew point temperature is higher than the wall temperature, suggesting...

  10. CFD Simulation of Liquid Rocket Engine Injectors

    Farmer, Richard; Cheng, Gary; Chen, Yen-Sen; Garcia, Roberto (Technical Monitor)


    Detailed design issues associated with liquid rocket engine injectors and combustion chamber operation require CFD methodology which simulates highly three-dimensional, turbulent, vaporizing, and combusting flows. The primary utility of such simulations involves predicting multi-dimensional effects caused by specific injector configurations. SECA, Inc. and Engineering Sciences, Inc. have been developing appropriate computational methodology for NASA/MSFC for the past decade. CFD tools and computers have improved dramatically during this time period; however, the physical submodels used in these analyses must still remain relatively simple in order to produce useful results. Simulations of clustered coaxial and impinger injector elements for hydrogen and hydrocarbon fuels, which account for real fluid properties, is the immediate goal of this research. The spray combustion codes are based on the FDNS CFD code' and are structured to represent homogeneous and heterogeneous spray combustion. The homogeneous spray model treats the flow as a continuum of multi-phase, multicomponent fluids which move without thermal or velocity lags between the phases. Two heterogeneous models were developed: (1) a volume-of-fluid (VOF) model which represents the liquid core of coaxial or impinger jets and their atomization and vaporization, and (2) a Blob model which represents the injected streams as a cloud of droplets the size of the injector orifice which subsequently exhibit particle interaction, vaporization, and combustion. All of these spray models are computationally intensive, but this is unavoidable to accurately account for the complex physics and combustion which is to be predicted, Work is currently in progress to parallelize these codes to improve their computational efficiency. These spray combustion codes were used to simulate the three test cases which are the subject of the 2nd International Workshop on-Rocket Combustion Modeling. Such test cases are considered by

  11. REACT: Resettable Hold Down and Release Actuator for Space Applications

    Nava, Nestor; Collado, Marcelo; Cabás, Ramiro


    A new HDRA based on SMA technology, called REACT, has been designed for development of loads and appendixes in space applications. This design involves a rod supported by spheres that block its axial movement during a preload application. The rod shape allows misalignment and blocks the rotation around axial axis for a proper installation of the device. Because of the high preload requirements for this type of actuators, finite element analysis (FEA) has been developed in order to check the structure resistance. The results of the FEA have constrained the REACT design, in terms of dimensions, materials, and shape of the mechanical parts. A complete test campaign for qualification of REACT is proposed. Several qualification models are intended to be built for testing in parallel. Therefore, it is a way to demonstrate margins which allows getting some statistics.

  12. Dicty_cDB: CFD190 [Dicty_cDB

    Full Text Available CF (Link to library) CFD190 (Link to dictyBase) - G00190 DDB0231328 Contig-U14182-1 CFD1...90P (Link to Original site) CFD190F 642 CFD190Z 594 CFD190P 1236 - - Show CFD190 Library CF (Link to library) Clone ID CFD1...Contig-U14182-1 Original site URL Representative seq. ID CFD190P (Link to Original site) Representative DNA sequence >CFD190 (CFD190Q) /CSM/CF/CFD1...-D/CFD190Q.Seq.d/ ATAAATTAAAAAAAAATGAATAAAGAAATTTTTAATTCAAAATTATTTGAAAAATTAGAT AAAGATA

  13. CFD and thermal analysis applications at General Motors

    Johnson, J.P. [General Motors Corp., Warren, Michigan (United States)


    The presentation will include a brief history of the growth of CFD and thermal analysis in GM's vehicle program divisions. Its relationship to the underlying computer infrastructure will be sketched. Application results will be presented for calculations in aerodynamics, flow through heat exchangers, engine compartment thermal studies, HVAC systems and others. Current technical challenges will be outlined including grid generation, turbulence modeling, heat transfer, and solution algorithms. The introduction of CFD and heat transfer results into Virtual Vehicle Reviews, and its potential impact on a company's CAE infrastructure will be noted. Finally, some broad comments will be made on the management of CFD and heat transfer technology across a global corporate enterprise. (author)

  14. CFD Analysis in Advance of the NASA Juncture Flow Experiment

    Lee, H. C.; Pulliam, T. H.; Neuhart, D. H.; Kegerise, M. A.


    NASA through its Transformational Tools and Technologies Project (TTT) under the Advanced Air Vehicle Program, is supporting a substantial effort to investigate the formation and origin of separation bubbles found on wing-body juncture zones. The flow behavior in these regions is highly complex, difficult to measure experimentally, and challenging to model numerically. Multiple wing configurations were designed and evaluated using Computational Fluid Dynamics (CFD), and a series of wind tunnel risk reduction tests were performed to further down-select the candidates for the final experiment. This paper documents the CFD analysis done in conjunction with the 6 percent scale risk reduction experiment performed in NASA Langley's 14- by 22-Foot Subsonic Tunnel. The combined CFD and wind tunnel results ultimately helped the Juncture Flow committee select the wing configurations for the final experiment.

  15. CFD analysis of ejector in a combined ejector cooling system

    Rusly, E.; Aye, Lu [International Technologies Centre (IDTC), Department of Civil and Environmental Engineering, The University of Melbourne, Melbourne, Vic. 3010 (Australia); Charters, W.W.S.; Ooi, A. [Department of Mechanical and Manufacturing Engineering, The University of Melbourne, Melbourne, Vic. 3010 (Australia)


    One-dimensional ejector analyses often use coefficients derived from experimental data for a set of operating conditions with limited functionality. In this study, several ejector designs were modelled using finite volume CFD techniques to resolve the flow dynamics in the ejectors. The CFD results were validated with available experimental data. Flow field analyses and predictions of ejector performance outside the experimental range were also carried out. During validation, data from CFD predicted the entrainment ratios with greater accuracy on definite area ratios, although no shock was recorded in the ejector. Predictions outside the experimental range-at operating conditions in a combined ejector-vapour compression system-and flow conditions resulting from ejector geometry variations are discussed. It is found that the maximum entrainment ratio happens in the ejector just before a shock occurs and that the position of the nozzle is an important ejector design parameter. (author)

  16. Experimental and CFD analysis of nozzle position of subsonic ejector

    Xilai ZHANG; Shiping JIN; Suyi HUANG; Guoqing TIAN


    The influence of nozzle position on the performance of an ejector was analyzed qualitatively with free jet flow model. Experimental investigations and computational fluid dynamics (CFD) analysis of the nozzle position of the subsonic ejector were also conducted. The results show that there is an optimum nozzle position for the ejector. The ejecting coefficient reaches its maximum when the nozzle is positioned at the optimum and decreases when deviating. Moreover, the nozzle position of an ejector is not a fixed value, but is influenced greatly by the flow parameters. Considering the complexity of the ejector, CFD is reckoned as a useful tool in the design of ejectors.

  17. Moment estimation for chemically reacting systems by extended Kalman filtering

    Ruess, J; Milias-Argeitis, A; Summers, S; Lygeros, J


    In stochastic models of chemically reacting systems that contain bimolecular reactions, the dynamics of the moments of order up to n of the species populations do not form a closed system, in the sense that their time-derivatives depend on moments of order n + 1. To close the dynamics, the moments o

  18. Study on Numerical Simulation of Wind Energy Resources Based on WRF and CFD Models%基于WRF和CFD软件结合的风能资源数值模拟试验研究

    方艳莹; 徐海明; 朱蓉; 王鹏; 何晓凤; Didier Delaunay; 付斌; 王黎