Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.
Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A
2017-11-14
The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread
Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions
International Nuclear Information System (INIS)
Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia
2013-01-01
16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.
Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G
2015-06-01
Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation
Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex
Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa
2016-01-01
Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051
Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.
Roa, Fernando; Guerra, Marcelo
2015-01-01
5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?
Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo
2017-04-15
Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.
Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni
2012-03-20
For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA
Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud
2013-01-01
The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...
A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).
Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao
2017-01-01
In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.
2016-01-01
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...
rKnowledge: The Spatial Diffusion of rDNA Methods
Maryann Feldman; Dieter Kogler; David Rigby
2013-01-01
The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...
Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.
2008-01-01
Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Directory of Open Access Journals (Sweden)
Daniël O. Warmerdam
2016-03-01
Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.
Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P
2017-06-01
Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.
Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua
2004-01-01
In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.
Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H
2016-03-22
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.
2016-01-01
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded
Directory of Open Access Journals (Sweden)
Kaitlynn LeRiche
Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.
Dingman, Douglas W
2012-07-01
Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc
Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast
International Nuclear Information System (INIS)
Lin, Y.H.; Keil, R.L.
1991-01-01
HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination
Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region
Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela
2008-01-01
The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...
Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.
Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K
2016-07-29
A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.
Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti
2016-08-01
The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.
Ercolini, D; Moschetti, G; Blaiotta, G; Coppola, S
2001-03-01
Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (DGGE) was tested as a tool for differentiation of lactic acid bacteria commonly isolated from food. Variable V3 regions of 21 reference strains and 34 wild strains referred to species belonging to the genera Pediococcus, Enterococcus, Lactococcus, Lactobacillus, Leuconostoc, Weissella, and Streptococcus were analyzed. DGGE profiles obtained were species-specific for most of the cultures tested. Moreover, it was possible to group the remaining LAB reference strains according to the migration of their 16S V3 region in the denaturing gel. The results are discussed with reference to their potential in the analysis of LAB communities in food, besides shedding light on taxonomic aspects.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
Campo, Daniel; García-Vázquez, Eva
2012-01-01
The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).
Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.
Guo, Xiang; Han, Fangpu
2014-11-01
rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.
Regulation of rDNA stability by sumoylation
DEFF Research Database (Denmark)
Eckert-Boulet, Nadine; Lisby, Michael
2009-01-01
Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...
Vazquez-Martin, Alejandro; Cufí, Sílvia; Oliveras-Ferraros, Cristina; Menendez, Javier A
2011-09-15
Raptor is the key scaffolding protein that recruits mTOR substrates to rapamycin-sensitive mTOR complex 1 (mTORC1), a molecular integrator of mitogenic and nutrient/energy environmental inputs into protein translation and cell growth. Although Raptor phosphorylation on various sites is pivotal in the regulation of mTORC1 activity, it remains to be elucidated whether site-specific phosphorylation differentially distributes Raptor to unique subcellular compartments. When exploring the spatiotemporal cell cycle dynamics of six different phospho (P)-Raptor isoforms (Thr ( 706) , Ser ( 722) , Ser ( 863) , Ser ( 792) and Ser ( 877) ), a number of remarkable events differentially defined a topological resetting of P-RaptorThr706 on interphasic and mitotic chromosomes. In interphase nuclei, P-Raptor (Thr706) co-localized with fibrillarin, a component of the nucleolar small nuclear ribonucleoprotein particle, as well as with RNA polymerase I, the enzyme that transcribes nucleolar rRNA. Upon Actinomycin D-induced nucleolar segregation and disaggregation, P-RaptorThr706 was excluded from the nucleolus to accumulate at discrete nucleoplasmic bodies. During mitosis, CDK1 inhibition-induced premature assembly of nucleoli relocated fibrillarin to the surrounding regions of chromosomal-associated P-Raptor (Thr706) , suggesting that a subpopulation of mitotic P-Raptor (Thr706) remained targeted at chromosomal loops of rDNA or nuclear organizer regions (NORs). At the end of mitosis and cytokinesis, when reassembly of incipient nucleoli begins upon NORs activation of rDNA transcription, fibrillarin spatially reorganized with P-Raptor (Thr706) to give rise to daughter nucleoli. Treatment with IGF1 exclusively hyperactivated nuclear P-Raptor (Ser706) and concomitantly promoted Ser ( 2481) autophosphorylation of mTOR, which monitors mTORC1-associated catalytic activity. Nucleolar- and NOR-associated P-Raptor (Ser706) may physically link mTORC1 signaling to ever-growing nucleolus
Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane
2018-04-15
Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.
Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan
2014-01-01
Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.
Directory of Open Access Journals (Sweden)
Vanessa Bueno
2014-01-01
Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki
2014-07-01
In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés
2011-10-17
The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.
Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia
2017-10-01
Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia
2016-12-01
Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.
Directory of Open Access Journals (Sweden)
Georgina D Cepeda
Full Text Available Species of Oithona (Copepoda, Cyclopoida are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them.
The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).
Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M
2011-08-01
The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.
Directory of Open Access Journals (Sweden)
Xiao P Peng
2018-01-01
Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.
Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata
2015-08-01
Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.
Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species
DEFF Research Database (Denmark)
Nielsen, Henrik; Simon, E M; Engberg, J
1985-01-01
an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...
Cruz, V P; Oliveira, C; Foresti, F
2015-01-01
5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
Seligmann, Hervé
2016-07-01
Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.
Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.
Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly
2016-11-01
Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
R. K. Chahota
2011-11-01
Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.
Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.
Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří
2016-11-01
Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.
Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.
Bisht, M S; Mukai, Y
2000-12-01
Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.
Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš
2017-05-18
Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Directory of Open Access Journals (Sweden)
Elizabeth X. Kwan
2016-09-01
Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.
Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K
2016-09-08
The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.
Czech Academy of Sciences Publication Activity Database
Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.
2008-01-01
Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008
Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang
2012-05-01
The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.
Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability
International Nuclear Information System (INIS)
Tao Weitao; Budd, Martin; Campbell, Judith L.
2003-01-01
We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones
Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability
Energy Technology Data Exchange (ETDEWEB)
Tao Weitao; Budd, Martin; Campbell, Judith L
2003-11-27
We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.
Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti
2018-03-10
One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Clinorotation influences rDNA and NopA100 localization in nucleoli
Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.
The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.
Directory of Open Access Journals (Sweden)
Alison E Ringel
Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.
Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay
2016-08-01
The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Soltis Pamela S
2010-09-01
Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Directory of Open Access Journals (Sweden)
Shafipour1, M.
2014-11-01
Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.
[18S-25S rDNA variation in tissue culture of some Gentiana L. species].
Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A
2007-01-01
18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.
Mahelka, Václav; Kopecky, David; Baum, Bernard R
2013-09-01
We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.
Directory of Open Access Journals (Sweden)
Hong Long
Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.
Directory of Open Access Journals (Sweden)
Josiane Pacheco Menezes
2010-02-01
Full Text Available A análise de características morfológicas e culturais podem não ser suficientes para uma caracterização precisa das espécies de Trichoderma e Fusarium. Objetivou-se, neste trabalho, caracterizar a região do Espaço Interno Transcrito (ITS do rDNA dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma spp. utilizados no biocontrole de Fusarium oxysporum f. sp. chrysanthemi (isolado UFSMF6. A extração de DNA de cada isolado foi realizada a partir de micélio produzido em meio líquido Batata-Dextrose. As amostras de DNA genômico foram submetidas à Reação em Cadeia da Polimerase (PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4 e o produto gerado foi sequenciado. Os fragmentos gerados pela amplificação da PCR foram tratados com as enzimas de restrição HaeIII, HinfI e MboI. As regiões ITS1, ITS2 e 5.8S do rDNA desses isolados fúngicos foram amplificadas com sucesso. A região ITS dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma e o isolado UFSMF6 de Fusarium apresentaram uma banda simples com um fragmento de aproximadamente 600 pares de base (pb. As enzimas de restrição HaeIII, HinfI e MboI geraram polimorfismo de bandas entre os isolados. Com base nas análises da sequência de DNA, os isolados UFSMT15.1, UFSMT16, UFSMT17 e UFSMF6 apresentaram maior similaridade com as espécies Trichoderma koningiopsis, Hypocrea virens, Hypocrea lixii e Fusarium oxysporum, respectivamente.The analysis of morphological and cultural characteristics may not enough for the characterization of the species of Trichoderma and Fusarium. The aim of this work was to characterize the Internal Transcribed Spacer (ITS region of the rDNA of UFSMT15.1, UFSMT16 and UFSMT17 isolates of Trichoderma spp. used in the biocontrol of Fusarium oxysporum f. sp. chrysanthemi UFSMF6. DNA extraction of each isolate was accomplished starting from hyphae produced in liquid medium Potato-Dextrose-Agar. The samples of genomic DNA were submitted to
El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R
2013-07-01
Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.
Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA
International Nuclear Information System (INIS)
Yakura, Kimitaka; Tanifuji, Shigeyuki.
1983-01-01
EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)
Trichostrongylus colubriformis rDNA polymorphism associated with arrested development
Czech Academy of Sciences Publication Activity Database
Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej
2008-01-01
Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008
Directory of Open Access Journals (Sweden)
María Poggio
2011-05-01
Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.
2004-12-01
The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun
2015-03-13
The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.
Directory of Open Access Journals (Sweden)
Jinzhong FU
2009-04-01
Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.
Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley
DEFF Research Database (Denmark)
Pedersen, C.; Linde-Laursen, I.
1994-01-01
is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...
The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.
Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun
2015-12-03
The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
International Nuclear Information System (INIS)
Duan, Y.S.; Zhu, B.; Li, Z.Y.
2015-01-01
Atractylodes lancea (Thunb.) DC. in the Asteraceae family produces the atractylodes rhizome which is widely used as a traditional medicine in China. The subspecies A. lancea (Thunb.) DC subsp. Luotianensis distributed in mountainous Luotian and Yingshan regions in Hubei Province presented distinct morphology and superior medicinal quality. This study firstly reported the chromosome karyotype of this subspecies and the detection of 5S and 45S rDNA loci by fluorescent in situ hybridization. The karyotype was 2n=24=12m+12sm (2SAT). A single locus of 5S rDNA and two loci of 45S rDNA loci were identified and separated on different chromosomes. Its one pair of the satellited chromosomes rather than two pairs in other Atractylodes species yet still with 2n=24 occurred likely after its occupation of this geographic location. The evidence of karyotype differentiation of this subspecies native to the area is useful for elucidating the genome structure and identifying chromosomes. (author)
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Directory of Open Access Journals (Sweden)
Thomas Spaller
Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
Energy Technology Data Exchange (ETDEWEB)
Geuskens, M.; Alexandre, H. (Universite Libre de Bruxelles (Belgium). Dep. de Biologie Moleculaire)
1984-06-01
The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with (/sup 3/H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min (/sup 3/H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with (/sup 3/H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed.
International Nuclear Information System (INIS)
Geuskens, M.; Alexandre, H.
1984-01-01
The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with ( 3 H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min ( 3 H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with ( 3 H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed. (author)
Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.
2017-01-01
Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Directory of Open Access Journals (Sweden)
Raupach Michael J
2010-09-01
Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang
2010-09-13
The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca
2018-01-01
Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829
Directory of Open Access Journals (Sweden)
Sofia Mazzoleni
2018-01-01
Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.
Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang
2016-01-01
To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Highett, M.I.; Rawlins, D.J.; Shaw, P.J.
1993-01-01
We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Improving the Analysis of Dinoflagellate Phylogeny based on rDNA
DEFF Research Database (Denmark)
Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.
2005-01-01
Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...
Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana
2012-10-07
The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two
Directory of Open Access Journals (Sweden)
Merlo Manuel A
2012-10-01
Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not
Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid
2016-12-01
Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Directory of Open Access Journals (Sweden)
Juliano S. Cabral
2006-01-01
Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.
Effect of plant growth promoting rhizobia on seed germination and seedling traits in Acacia senegal
Directory of Open Access Journals (Sweden)
S.K. Singh
2011-11-01
Full Text Available Among arid zone tree species, Acacia senegal and Prosopis cineraria are the most important dryland resources of Western Rajasthan desert ecosystem. Due to ecological, biological and molecular similarities, they are often studied together. The climatic conditions in this region restrict the build-up of soil organic matter and soils are generally deficient in nitrogen. Studies were carried out to isolate and molecularly characterize the diverse group of plant growth promoting rhizobacteria from root nodules of native A. senegal and P. cineraria and their effect on seed germination and seedling traits in two genotypes of A. senegal. The direct sequencing of 16S rDNA region resulted in molecular identification of plant growth promoting rhizobacteria as Bacillus licheniformis, Sinorhizobium saheli isolated from root nodules of A. senegal and S. kostiense and S. saheli isolated from root nodules of P. cineraria. The partial sequences of 16S rDNA were assigned Gen accession numbers HQ738496, HQ738499, HQ738506 and HQ738508. Scarification treatment with sulphuric acid (98% for 15 minutes was able to break the exogenous seed dormancy and enhanced germination percentage in control treatment to 90% and 92.5% in A. senegal in genotypes CAZRI 113AS and CAZRI 35AS, respectively. The treatments with Bacillus licheniformis or S. kostiense, either inoculated individually or as coinoculants, had positive effect on phenotypic traits of germination. Two A. senegal genotypes exhibited significant differences with regard to all the phenotypic traits. On the other hand, treatments with S. saheli isolated from either A. senegal or P. cineraria had negative effects on germination and related phenotypic traits. Values of the coeffivient of determination (R2 over 80% for root length versus shoot length, root/shoot ratio and seedling weight respectively validate that the observed attributes are inter-dependable and linear progression trend can be predicted.
Plant rDNA database: ribosomal DNA loci information goes online
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Garnatje, T.; Kovařík, Aleš
2012-01-01
Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012
Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A
2017-01-01
The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary
Guerra, Marcelo; García, Miguel A
2004-02-01
Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.
Hou, Xiao-qiang; Guo, Shun-xing
2014-09-01
The endophytic fungi with plant growth promoting effects were screened by co-culture of each endophytic fungus and seedlings of Dendrobium officinale. Anatomical features of the inoculated roots were studied by paraffin sectioning. Morphological characteristics and rDNA ITS1-5. 8S-ITS2 sequences were applied for the taxonomy of endophytic fungi. The results showed that 8 strains inoculated to D. officinale seedlings greatly enhanced plant height, stem diameter, new roots number and biomass. According to the anatomical features of the inoculated roots, each fungus could infect the velamina of seedlings. The hyphae or pelotons were existed in the exodermis passage cells and cortex cells. The effective fungi could not infect the endodermis and vascular bundle sheath, but which was exception for other fungi with harmful to seedlings. Combined with classic morphologic classification, 2 effective strains were identified which were subjected to Pestalotiopsis and Eurotium. Six species of fungi without conidiophore belonged to Pyrenochaeta, Coprinellus, Pholiota, Alternaria, Helotiales, which were identified by sequencing the PCR-amplified rDNA ITS1-5. 8S-ITS2 regions. The co-culture technology of effective endophytic fungi and plant can apply to cultivate the seedlings of D. officinale. It is feasible to shorten growth cycle of D. officinale and increase the resource of Chinese herbs.
Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R
2018-01-01
The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Directory of Open Access Journals (Sweden)
Haishan Wang
Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.
He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun
2012-01-01
Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M
1996-07-01
Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.
Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre
2016-01-01
Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Harpke, Doerte; Peterson, Angela
2008-05-01
The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
Directory of Open Access Journals (Sweden)
Garcia Sònia
2012-06-01
Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F
2014-01-01
Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.
Altered gravity influences rDNA and NopA100 localization in nucleoli
Sobol, M. A.; Kordyum, E. L.
Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo
2013-01-01
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
Directory of Open Access Journals (Sweden)
Andrew Macrae
2000-06-01
Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Directory of Open Access Journals (Sweden)
Gamal Mohamedin Hassan
2016-01-01
Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
GRAbB : Selective Assembly of Genomic Regions, a New Niche for Genomic Research
Brankovics, Balázs; Zhang, Hao; van Diepeningen, Anne D; van der Lee, Theo A J; Waalwijk, Cees; de Hoog, G Sybren
GRAbB (Genomic Region Assembly by Baiting) is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
DEFF Research Database (Denmark)
Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.
2001-01-01
supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...
Modulation of immune response to rDNA hepatitis B vaccination by psychological stress
L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)
1996-01-01
textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels
International Nuclear Information System (INIS)
Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.
1990-01-01
The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
NoRC Recruitment by H2A.X Deposition at rRNA Gene Promoter Limits Embryonic Stem Cell Proliferation
Directory of Open Access Journals (Sweden)
Boris Eleuteri
2018-05-01
Full Text Available Summary: Embryonic stem cells (ESCs display an abbreviated cell cycle, resulting in a short doubling time and rapid proliferation. The histone variant H2A.X is critical for proliferation of stem cells, although mechanistic insights have remained obscure. Here, we show that H2A.X defines the rate of mouse ESC proliferation independently of the DNA damage response pathway, and it associates with three major chromatin-modifying complexes. Our functional and biochemical analyses demonstrate that H2A.X-associated factors mediate the H2A.X-dependent effect on ESC proliferation and involve the nucleolar remodeling complex (NoRC. A specific H2A.X deposition at rDNA promoters determines the chromatin recruitment of the NoRC, histone modifications, the rRNA transcription, and the rate of proliferation. Collectively, our results suggest that NoRC assembly by H2A.X deposition at rRNA promoters silences transcription, and this represents an important regulatory component for ESC proliferation. : Histone variant H2A.X defines the rate of embryonic stem cell proliferation. Eleuteri et al. identify H2A.X-interacting proteins, and they show that H2A.X deposition at rDNA promoters assembles the NoRC, which represses rRNA transcription and determines the rate of self-renewal. Keywords: ribosomal biogenesis, rRNA, rDNA, stem cells, TIP5, SNF2H, SPT16, BRG1, H2A.X, G1, cell cycle, cell cycle arrest, proliferation
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Li, Ping; Jin, Hui; Yu, Hong-Guo
2014-01-01
During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240
Directory of Open Access Journals (Sweden)
Érico Leandro da Silveira
2006-10-01
Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi
Directory of Open Access Journals (Sweden)
Nomar Espinosa Waminal
Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.
Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L
2009-02-05
The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.
Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi
2015-09-21
Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China.
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells
Directory of Open Access Journals (Sweden)
Youjin Hu
2013-01-01
Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.
Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA
Directory of Open Access Journals (Sweden)
Zhongai Li
2015-01-01
Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.
Atibalentja, N; Noel, G R; Ciancio, A
2004-03-01
For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Directory of Open Access Journals (Sweden)
Aboubaker M. Garbaj
2016-11-01
Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.
Czech Academy of Sciences Publication Activity Database
Bartošová, Pavla; Fiala, Ivan; Hypša, Václav
2009-01-01
Roč. 53, č. 1 (2009), s. 81-93 ISSN 1055-7903 R&D Projects: GA AV ČR KJB600960701; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : myxosporea * phylogeny * LBA * LSU rDNA * 28S * SSU rDNA * 18S * D domains Subject RIV: EG - Zoology Impact factor: 3.556, year: 2009
2011-01-01
Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815
Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio
2008-11-01
The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.
International Nuclear Information System (INIS)
Satchanska, G.; Golovinsky, E.; Selenska-Pobell, S.
2004-01-01
Bacterial diversity was studied in a soil sample collected from a uranium mining waste pile situated near the town of Johanngeorgenstadt, Germany. As estimated by ICP-MS analysis the studied sample was highly contaminated with Fe, Al, Mn, Zn, As, Pb and U. The 16S rDNA retrieval, applied in this study, demonstrated that more than the half of the clones of the constructed 16S rDNA library were represented by individual RFLP profiles. This indicates that the composition of the bacterial community in the sample was very complex. However, several 16S rDNA RFLP groups were found to be predominant and they were subjected to a sequence analysis. The most predominant group, which represented about 13% of the clones of the 16S rDNA library, was affiliated with the Holophaga/Acidobacterium phylum. Significant was also the number of the proteobacterial sequences which were distributed in one predominant α-proteobacterial cluster representing 11% of the total number of clones and in two equal-sized β- and γ-proteobacterial clusters representing each 6% of the clones. Two smaller groups representing both 2% of the clones were affiliated with Nitrospira and with the novel division WS3. Three of the analysed sequences were evaluated as a novel, not yet described lineage and one as a putative chimera. (authors)
Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai
2014-05-01
To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Directory of Open Access Journals (Sweden)
Luiz Carlos Correa
2003-04-01
Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will
Directory of Open Access Journals (Sweden)
Chao Xu
Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K
1999-03-01
Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.
Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi
2015-01-01
Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants
Czech Academy of Sciences Publication Activity Database
Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří
2015-01-01
Roč. 81, č. 2 (2015), s. 198-209 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo
2004-06-15
The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.
Li, Chun-Xiang; Yang, Qun
2003-03-01
DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.
John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.
2015-01-01
The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
DEFF Research Database (Denmark)
Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva
2004-01-01
Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Cibik, R; Lepage, E; Talliez, P
2000-06-01
For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.
Directory of Open Access Journals (Sweden)
Carla C. Lange
2011-01-01
Full Text Available O objetivo deste trabalho foi identificar espécies de Staphylococcus (n=100 isoladas de mastite em rebanhos bovinos do Estado de Minas Gerais. Para esta finalidade foram utilizadas reações de PCR empregando oligonucleotídeos iniciadores descritos anteriormente para amplificar genes específicos de S. aureus (femA, S. intermedius (rDNA 16S e S. hyicus (rDNA 16S-23S e o sequenciamento do rDNA 16S. De acordo com as reações de PCR, 83 isolados foram identificados como S. aureus, 13 isolados como S. intermedius, dois como S. hyicus e dois isolados não foram identificados. Foram submetidos ao sequenciamento do rDNA 16S seis isolados identificados como S. aureus e os 17 restantes. Os seis isolados identificados como S. aureus confirmaram essa identificação. Dos outros 17 isolados, 13 foram identificados como S. chromogenes e quatro como S. hyicus, com similaridade igual ou superior a 99%. Baseando-se nos resultados da reação de PCR do gene femA e do sequenciamento do rDNA 16S, foram identificados 83 S. aureus, 13 S. chromogenes e quatro S. hyicus. Neste estudo os oligonucleotídeos iniciadores empregados na reação de PCR para S. intermedius não foram específicos, pois amplificaram também S. chromogenes; e os empregados na reação de PCR para S. hyicus não foram sensíveis, pois falharam na identificação de dois isolados de S. hyicus. A identificação definitiva das duas últimas espécies somente foi possível pelo sequenciamento do rDNA 16S.
Sum, Jia-Siang; Lee, Wenn-Chyau; Amir, Amirah; Braima, Kamil A; Jeffery, John; Abdul-Aziz, Noraishah M; Fong, Mun-Yik; Lau, Yee-Ling
2014-07-03
Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population.
da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana
2016-01-01
Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.
Hoy, Marshal S.; Rodriguez, Rusty J.
2013-01-01
Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.
Energy Technology Data Exchange (ETDEWEB)
Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)
2015-09-18
The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.
Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T
2007-08-01
The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Gregory M. Bonito; Andrii P. Gryganskyi; James M. Trappe; Rytas. Vilgalys
2010-01-01
Truffles (Tuber) are ectomycorrhizal fungi characterized by hypogeous fruitbodies. Their biodiversity, host associations and geographical distributions are not well documented. ITS rDNA sequences of Tuber are commonly recovered from molecular surveys of fungal communities, but most remain insufficiently identified making it...
Discrimination of Shark species by simple PCR of 5S rDNA repeats
Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP
2008-01-01
Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
Directory of Open Access Journals (Sweden)
Iole Di Capua
Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.
Fu, Rao; Gong, Jun
2017-11-01
Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
DEFF Research Database (Denmark)
Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik
2006-01-01
Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...
2014-01-01
Background Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Methods Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. Results A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Conclusion Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population. PMID:24993022
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
Directory of Open Access Journals (Sweden)
Eliane Mariza Dortas Maffei
2004-01-01
Full Text Available The aim of this study was to describe mitotic and meiotic chromosomes of Cycloneda sanguinea using C-banding, fluorescent in situ hybridization (FISH rDNA probes, and sequential FISH/Ag-NOR staining. The chromosome number was 2n = 18 + XX for females and 2n = 18 + Xy for males. The X chromosome was metacentric and the Y chromosome was very small. During meiosis, the karyotypic meioformula was n = 9 + Xy p, and sex chromosomes configured a parachute at metaphase I. At the beginning of pachytene, bivalents were still individualized, and sex chromosomes were associated end-to-end through the heteropycnotic region of the X chromosome. Later in pachytene, further condensation led to the formation of a pseudo-ring by the sex bivalent. All chromosomes showed pericentromeric heterochromatin. FISH and sequential FISH/Ag-NOR staining evidenced the location of the nucleolar organizer region in one pair of autosomes (at spermatogonial metaphase. During meiosis, these genes were mapped to a region outside the sex vesicle by FISH, although Xy p was deeply stained with silver at metaphase I. These results suggest that these argyrophilic substances are of a nucleolar protein nature, and seem to be synthesized by a pair of autosomes and imported during meiosis (prophase I to the sex pair, during the association of the sex chromosomes.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Directory of Open Access Journals (Sweden)
ARYANE C. REIS
2016-01-01
Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís
2012-12-01
The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales
2010-08-16
In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Directory of Open Access Journals (Sweden)
LIU Ze-ping
2018-02-01
Full Text Available Plant growth-promoting rhizobacteria(PGPRcan secrete the growth hormone and promote soil nutrient cycling, thus, is an important germplasm resource of bio -fertilizer. In this study, the PGPR was isolated from the rice rhizosphere. According to 16S rDNA sequences, 10 strains were identifed, including 4 organic phosphorus bacteria (Bacillus pumilus LZP02, Bacillus aryabhattai LZP08, Staphylococcus epidermidis LZP10, Bacillus ginsengisoli LZP05, 3 inorganic phosphorus bacteria(Bacillus megaterium LZP03, Bacillus oryzaecorticis LZP04, Bacillus ginsengisoli LZP07and 3 potassium bacteria(Bacillus aryabhattai LZP01, Bacillus subtilis LZP06, Bacillus licheniformis LZP09. The results from nutrient conversion analysis showed that Bacillus aryabhattai LZP01 and Bacillus subtilis LZP06 performed better on the potassium releasing ability. Bacillus pumilus LZP02 and Bacillus huizhouensis LZP05 performed better on the function of organic phosphorus. Bacillus megaterium LZP03 and Bacillus ginsengisoli LZP07 performed better on the function of inorganic phosphorus. Further, the hormone secretion capacity was measured for these 6 strains. The results showed that all 6 strains could produce auxin and gibberellin, and had the ability to synthesize iron carrier. Moreover, the results showed that Bacillus megaterium LZP03, Bacillus huizhouensis LZP05 and Bacillus subtilis LZP06 had stronger ability to promote the nutrient conversion and hormone secretion. Systematically, we believe that these three strains have great potential application on microbial fertilizer.
Morphology and rDNA phylogeny of a Mediterranean Coolia monotis (Dinophyceae strain from Greece
Directory of Open Access Journals (Sweden)
Nicolas P. Dolapsakis
2006-03-01
Full Text Available Sequences of LSU and SSU ribosomal RNA genes and phylogeny have not been widely investigated for the dinoflagellate Coolia monotis Meunier, and no information is available on the small and large rDNA subunits of Mediterranean strains. A strain isolated from the Thermaikos Gulf in northern Greece was identified as C. monotis—a new record for the Greek algal flora—using thecal morphology by light, epifluorescence and scanning electron microscopy. The small subunit and partial (D1/D2 large subunit sequences were analyzed and compared to other strains of C. monotis and dinoflagellates from various regions. Thecal architecture showed that the Greek strain of C. monotis was phenotypically similar, but not identical, to other strains reported in literature. The partial LSU sequence (700 bp was found to vary by 113 bp positions (16% from the C. monotis strain from New Zealand, whereas the SSU (1757 bp had 15 bp differences (0.85% from the strain from Norway. Phylogenetic tree construction showed that the Greek strain fell within the Coolia clade and had a close relationship with the families Ostreopsidaceae and Goniodomaceae of the order Gonyaulacales. Preliminary findings suggest the existence of different genotype strains of C. monotis with large intraspecific genetic variability and minimal morphological differentiation (similar phenotypes. Certain ecological and evolutionary implications of these findings are discussed.
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.
Zhao, Ya-E; Hu, Li; Ma, Jun-Xian
2013-11-01
Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.
[Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].
Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A
2004-01-01
18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Evolutionary dynamics of rDNA clusters on chromosomes of moths and butterflies (Lepidoptera)
Czech Academy of Sciences Publication Activity Database
Nguyen, Petr; Sahara, K.; Yoshido, A.; Marec, František
2010-01-01
Roč. 138, č. 3 (2010), s. 343-354 ISSN 0016-6707 R&D Projects: GA ČR GA206/06/1860; GA AV ČR IAA600960925 Grant - others:Student Grant Agency of the Faculty of Science, University of South Bohemia(CZ) SGA2006/01; Japan Society for the Promotion of Science(JP) 18380037; Japan Society for the Promotion of Science(JP) 191114; GA ČR(CZ) 521/08/H042 Institutional research plan: CEZ:AV0Z50070508 Keywords : ribosomal DNA * nucleolar organizer region * chromosome fusion Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.358, year: 2010
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Zhao, Ya-E; Wu, Li-Ping
2012-09-01
To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.
Directory of Open Access Journals (Sweden)
Ann L Griffen
2011-04-01
Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be
Ji, Sang Hye; Gururani, Mayank Anand; Chun, Se-Chul
2014-01-20
We have isolated 576 endophytic bacteria from the leaves, stems, and roots of 10 rice cultivars and identified 12 of them as diazotrophic bacteria using a specific primer set of nif gene. Through 16S rDNA sequence analysis, nifH genes were confirmed in the two species of Penibacillus, three species of Microbacterium, three Bacillus species, and four species of Klebsiella. Rice seeds treated with these plant growth-promoting bacteria (PGPB) showed improved plant growth, increased height and dry weight and antagonistic effects against fungal pathogens. In addition, auxin and siderophore producing ability, and phosphate solubilizing activity were studied for the possible mechanisms of plant growth promotion. Among 12 isolates tested, 10 strains have shown higher auxin producing activity, 6 isolates were confirmed as strains with high siderophore producing activity while 4 isolates turned out to have high phosphate-solubilizing activity. These results strongly suggest that the endophytic diazotrophic bacteria characterized in this study could be successfully used to promote plant growth and inducing fungal resistance in plants. Copyright © 2013 Elsevier GmbH. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Vitales, D.; D'Ambrosio, U.; Galvez, F.; Kovařík, Aleš; Garcia, S.
2017-01-01
Roč. 303, č. 8 (2017), s. 1115-1121 ISSN 0378-2697 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * ribosomal-rna genes * 5s rdna Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.239, year: 2016
Iwanowicz, Luke R; Iwanowicz, Deborah D; Pote, Linda M; Blazer, Vicki S; Schill, William B
2008-02-01
Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 +/- 0.3 microm (range 15.7-20.3) in length, and 5.4 +/- 0.1 microm (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 +/- 1.1 microm (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 +/- 0.1 microm (range 5.48-7.06), while the shorter is 5.7 +/- 0.1 microm (range 4.8-6.4) in length. Polar capsule width is 1.2 +/- 0.03 microm (range 1.0-1.54). The total length of the spore is 60.9 +/- 1.2 microm (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus.
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Satoh, T; Yamamoto, K; Miura, K F; Sofuni, T
2004-01-01
A human diploid lung fibroblast cell strain, TIG-7, has a heteromorphic chromosome 15 with an extra short arm carrying a homogeneously staining region (15p+hsr). We demonstrated previously that the 15p+hsr consists of an inactive and G+C-rich rDNA cluster characterized by fluorescence in situ hybridization (FISH) and various chromosome banding techniques. Thus, it was suggested that the region could contain highly methylated DNA. To observe methylation status on the target region directly under the microscope, we used a demethylating agent, 5-azacytidine (5-azaC), to induce decondensation of the chromatin containing methylated DNA. At 24 h after treatment with 0.5 microM 5-azaC, marked decondensation of the 15p+hsr was observed in almost all of the metaphases. Furthermore, we observed micronuclei, which were equivalent to the rDNA of the 15p+hsr demonstrated by FISH in the same preparation. In contrast, the DNA cross-linking agent mitomycin C (MMC) preferentially induced 15p+hsr-negative micronuclei. These findings indicated that chromatin decondensation and subsequent DNA strand breakage induced by the demethylating effect of 5-azaC led specifically to 15p+hsr-positive micronuclei. Copyright 2003 S. Karger AG, Basel
GRAbB: Selective Assembly of Genomic Regions, a New Niche for Genomic Research.
Directory of Open Access Journals (Sweden)
Balázs Brankovics
2016-06-01
Full Text Available GRAbB (Genomic Region Assembly by Baiting is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often neglected or poorly assembled, although they contain interesting information from phylogenetic or epidemiologic perspectives, but also single copy regions can be assembled. The program is capable of targeting multiple regions within a single run. Furthermore, GRAbB can be used to extract specific loci from NGS data, based on homology, like sequences that are used for barcoding. To make the assembly specific, a known part of the region, such as the sequence of a PCR amplicon or a homologous sequence from a related species must be specified. By assembling only the region of interest, the assembly process is computationally much less demanding and may lead to assemblies of better quality. In this study the different applications and functionalities of the program are demonstrated such as: exhaustive assembly (rDNA region and mitochondrial genome, extracting homologous regions or genes (IGS, RPB1, RPB2 and TEF1a, as well as extracting multiple regions within a single run. The program is also compared with MITObim, which is meant for the exhaustive assembly of a single target based on a similar query sequence. GRAbB is shown to be more efficient than MITObim in terms of speed, memory and disk usage. The other functionalities (handling multiple targets simultaneously and extracting homologous regions of the new program are not matched by other programs. The program is available with explanatory documentation at https://github.com/b-brankovics/grabb. GRAbB has been tested on Ubuntu (12.04 and 14.04, Fedora (23, CentOS (7.1.1503 and Mac OS X (10.7. Furthermore, GRAbB is available as a docker repository: brankovics/grabb (https://hub.docker.com/r/brankovics/grabb/.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun
2013-11-23
Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David
2006-05-25
We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.
Czech Academy of Sciences Publication Activity Database
Kráľová-Hromadová, I.; Tietz, David František; Shinn, A.; Špakulová, M.
2003-01-01
Roč. 56, č. 2 (2003), s. 141-145 ISSN 0165-5752 R&D Projects: GA ČR GA524/01/1314 Grant - others:GA SR(SK) VEGA2/1020/21; GA SR(SK) VEGA2/3212/23 Institutional research plan: CEZ:AV0Z6022909 Keywords : Acanthocephala * ITS rDNA sequence * taxonomy Subject RIV: EG - Zoology Impact factor: 0.642, year: 2003
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.
Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna
2018-02-01
Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Directory of Open Access Journals (Sweden)
Jacqueline Abrunhosa
2017-11-01
Full Text Available Abstract This study provides morphological and molecular data of a new parasite species found in the muscle layer of the intestinal tract of the South American silver catfish, Rhamdia quelen from Marajó Island region (Pará State, Brazil, an important fishery resource with recognized potential for fish farming. The morphology of these parasites was reanalyzed and phylogenetic analyses were run on their 18S rDNA gene sequences. The spores were morphologically distinct from those of other Myxobolus species described previously. The obtained partial sequence of the 18S rDNA gene sequences of the new species were compared to those of 24 other Myxobolus and Henneguya species available in GenBank. The results of morphological and molecular analyses indicated clearly the existence of a new species, Myxobolus marajoensis sp. n.
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry
2005-08-01
In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.
Czech Academy of Sciences Publication Activity Database
Symonová, R.; Ocalewicz, K.; Kirtiklis, L.; Delmastro, G. B.; Pelikánová, Šárka; Garcia, S.; Kovařík, Aleš
2017-01-01
Roč. 18, č. 391 (2017), č. článku 391. ISSN 1471-2164 R&D Projects: GA ČR GA14-02940S; GA ČR GBP501/12/G090 Institutional support: RVO:67985904 ; RVO:68081707 Keywords : rDNA * evolution * chromosome Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 3.729, year: 2016
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš
2010-01-01
Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010
Fibrillarin methylates H2A in RNA polymerase I trans-active promoters in Brassica oleracea
Directory of Open Access Journals (Sweden)
lloyd eLoza-Muller
2015-11-01
Full Text Available Fibrillarin is a well conserved methyltransferase involved in several if not all of the more than 100 methylations sites in rRNA which are essential for proper ribosome function. It is mainly localized in the nucleoli and Cajal bodies inside the cell nucleus where it exerts most of its functions. In plants, fibrillarin binds directly the guide RNA together with Nop56, Nop58 and 15.5ka proteins to form a snoRNP complex that selects the sites to be methylated in pre-processing of ribosomal RNA. Recently, the yeast counterpart NOP1 was found to methylate histone H2A in the nucleolar regions. Here we show that plant fibrillarin can also methylate histone H2A. In Brassica floral meristem cells the methylated histone H2A is mainly localized in the nucleolus but unlike yeast or human cells it also localize in the periphery of the nucleus. In specialized transport cells the pattern is altered and it exhibits a more diffuse staining in the nucleus for methylated histone H2A as well as for fibrillarin. Here we also show that plant fibrillarin is capable of interacting with H2A and carry out its methylation in the rDNA promoter.
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
The Relationship Between Human Nucleolar Organizer Regions and Nucleoli, Probed by 3D-ImmunoFISH.
van Sluis, Marjolein; van Vuuren, Chelly; McStay, Brian
2016-01-01
3D-immunoFISH is a valuable technique to compare the localization of DNA sequences and proteins in cells where three-dimensional structure has been preserved. As nucleoli contain a multitude of protein factors dedicated to ribosome biogenesis and form around specific chromosomal loci, 3D-immunoFISH is a particularly relevant technique for their study. In human cells, nucleoli form around transcriptionally active ribosomal gene (rDNA) arrays termed nucleolar organizer regions (NORs) positioned on the p-arms of each of the acrocentric chromosomes. Here, we provide a protocol for fixing and permeabilizing human cells grown on microscope slides such that nucleolar proteins can be visualized using antibodies and NORs visualized by DNA FISH. Antibodies against UBF recognize transcriptionally active rDNA/NORs and NOP52 antibodies provide a convenient way of visualizing the nucleolar volume. We describe a probe designed to visualize rDNA and introduce a probe comprised of NOR distal sequences, which can be used to identify or count individual NORs.
Hagenfeld, Daniel; Koch, Raphael; Jünemann, Sebastian; Prior, Karola; Harks, Inga; Eickholz, Peter; Hoffmann, Thomas; Kim, Ti-Sun; Kocher, Thomas; Meyle, Jörg; Kaner, Doğan; Schlagenhauf, Ulrich; Ehmke, Benjamin; Harmsen, Dag
2018-01-01
Empiric antibiotics are often used in combination with mechanical debridement to treat patients suffering from periodontitis and to eliminate disease-associated pathogens. Until now, only a few next generation sequencing 16S rDNA amplicon based publications with rather small sample sizes studied the effect of those interventions on the subgingival microbiome. Therefore, we studied subgingival samples of 89 patients with chronic periodontitis (solely non-smokers) before and two months after therapy. Forty-seven patients received mechanical periodontal therapy only, whereas 42 patients additionally received oral administered amoxicillin plus metronidazole (500 and 400 mg, respectively; 3x/day for 7 days). Samples were sequenced with Illumina MiSeq 300 base pairs paired end technology (V3 and V4 hypervariable regions of the 16S rDNA). Inter-group differences before and after therapy of clinical variables (percentage of sites with pocket depth ≥ 5mm, percentage of sites with bleeding on probing) and microbiome variables (diversity, richness, evenness, and dissimilarity) were calculated, a principal coordinate analysis (PCoA) was conducted, and differential abundance of agglomerated ribosomal sequence variants (aRSVs) classified on genus level was calculated using a negative binomial regression model. We found statistically noticeable decreased richness, and increased dissimilarity in the antibiotic, but not in the placebo group after therapy. The PCoA revealed a clear compositional separation of microbiomes after therapy in the antibiotic group, which could not be seen in the group receiving mechanical therapy only. This difference was even more pronounced on aRSV level. Here, adjunctive antibiotics were able to induce a microbiome shift by statistically noticeably reducing aRSVs belonging to genera containing disease-associated species, e.g., Porphyromonas, Tannerella, Treponema, and Aggregatibacter, and by noticeably increasing genera containing health
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
Directory of Open Access Journals (Sweden)
Dinka eMandakovic
2016-05-01
Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.
Directory of Open Access Journals (Sweden)
R. Gholamalizadeh
2017-08-01
Full Text Available ABSTRACT The application of beneficial bacteria has recently been used for sustainable agriculture. In current research, 71 bacterial isolates were obtained from rice plant and the rhizosphere soil of different paddy fields in Guilan province, Iran. After primitive investigation, 40 bacteria with typical predominant characteristics were selected. By PCR-RFLP of their 16S r-DNA gene, 8 Operational Taxonomic Units (OTUs totally consisted of 33 isolates were obtained. From all of them, 8 isolates were selected for rice seed germination experiment, then, effective isolates were used for pot experiment to evaluate their ability for promoting rice growth. All of them were able to increase rice growth and yield, but in different potential. These tested isolates were identified as Alcaligenes faecalis (DEp8, O1R4, Pantoea ananatis (AEn1, Bacillus vietnamensis (MR5, Bacillus idriensis (MR2 and Stenotrophomonas maltophilia by partial sequencing of their 16S r-DNA gene. Among them, AEn1 and MR5 produced indole-3- acetic acid (IAA in larger amounts than the other isolates and the isolates AEn1 and O1R4 were able to solubilize phosphate in higher amounts. According to the results obtained, it can be concluded that AEn1, O1R4 and MR5 can be considered as bacterial inoculants to use as alternatives for chemical fertilizers.
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai
2012-08-01
On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Directory of Open Access Journals (Sweden)
Matthias Sipiczki
Full Text Available Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).
Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro
2016-03-01
We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting
Directory of Open Access Journals (Sweden)
Cleidson Nogueira Dias
2014-12-01
Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
Directory of Open Access Journals (Sweden)
Ana Maria Queijeiro Lopez
2010-08-01
Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C
Noemi M. Fernandes; Inácio D. da Silva Neto
2013-01-01
Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequen...
Directory of Open Access Journals (Sweden)
Svetlana V Kostyuk
Full Text Available Hypermethylation is observed in the promoter regions of suppressor genes in the tumor cancer cells. Reactivation of these genes by demethylation of their promoters is a prospective strategy of the anticancer therapy. Previous experiments have shown that symmetric dimeric bisbenzimidazoles DBP(n are able to block DNA methyltransferase activities. It was also found that DBP(n produces a moderate effect on the activation of total gene expression in HeLa-TI population containing epigenetically repressed avian sarcoma genome.It is shown that DBP(n are able to penetrate the cellular membranes and accumulate in breast carcinoma cell MCF-7, mainly in the mitochondria and in the nucleus, excluding the nucleolus. The DBP(n are non-toxic to the cells and have a weak overall demethylation effect on genomic DNA. DBP(n demethylate the promoter regions of the tumor suppressor genes PTEN and RARB. DBP(n promotes expression of the genes RARB, PTEN, CDKN2A, RUNX3, Apaf-1 and APC "silent" in the MCF-7 because of the hypermethylation of their promoter regions. Simultaneously with the demethylation of the DNA in the nucleus a significant increase in the methylation level of rRNA genes in the nucleolus was detected. Increased rDNA methylation correlated with a reduction of the rRNA amount in the cells by 20-30%. It is assumed that during DNA methyltransferase activity inhibition by the DBP(n in the nucleus, the enzyme is sequestered in the nucleolus and provides additional methylation of the rDNA that are not shielded by DBP(n.It is concluded that DBP (n are able to accumulate in the nucleus (excluding the nucleolus area and in the mitochondria of cancer cells, reducing mitochondrial potential. The DBP (n induce the demethylation of a cancer cell's genome, including the demethylation of the promoters of tumor suppressor genes. DBP (n significantly increase the methylation of ribosomal RNA genes in the nucleoli. Therefore the further study of these compounds is needed
Atibalentja, N; Noel, G R; Domier, L L
2000-03-01
A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.
da Silva, J F; Barbosa, R R; de Souza, A N; da Motta, O V; Teixeira, G N; Carvalho, V S; de Souza, A L S R; de Souza Filho, G A
2015-11-30
Each year, approximately 170 million metric tons of chemical fertilizer are consumed by global agriculture. Furthermore, some chemical fertilizers contain toxic by-products and their long-term use may contaminate groundwater, lakes, and rivers. The use of plant growth-promoting bacteria may be a cost-effective strategy for partially replacing conventional chemical fertilizers, and may become an integrated plant nutrient solution for sustainable crop production. The main direct bacteria-activated mechanisms of plant growth promotion are based on improvement of nutrient acquisition, siderophore biosynthesis, nitrogen fixation, and hormonal stimulation. The aim of this study was to isolate and identify bacteria with growth-promoting activities from sugarcane. We extracted the bacterial isolate SCB4789F-1 from sugarcane leaves and characterized it with regard to its profile of growth-promoting activities, including its ability to colonize Arabidopsis thaliana. Based on its biochemical characteristics and 16S rDNA sequence analysis, this isolate was identified as Pantoea ananatis. The bacteria were efficient at phosphate and zinc solubilization, and production of siderophores and indole-3-acetic acid in vitro. The isolate was characterized by Gram staining, resistance to antibiotics, and use of carbon sources. This is the first report on zinc solubilization in vitro by this bacterium, and on plant growth promotion following its inoculation into A. thaliana. The beneficial effects to plants of this bacterium justify future analysis of inoculation of economically relevant crops.
Directory of Open Access Journals (Sweden)
Joyce Doyle
2016-11-01
achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.
Directory of Open Access Journals (Sweden)
Noemi M. Fernandes
2013-02-01
Full Text Available Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequences of Spirostomum teres Claparède & Lachmann, 1858 and Spirostomum minus Roux, 1901, isolated from a sewage treatment plant and a freshwater lake in the city of Rio de Janeiro, Brazil, respectively. For the morphological descriptions of S. teres and S. minus, living cells were observed using bright-field and differential interference contrast (DIC microscopy, the total infraciliature and nuclear apparatus were revealed by staining with protargol, and ciliary patterns were observed also with scanning electron microscopy (SEM. The complete sequences of the 18S rDNA of S. teres and S. minus were obtained using eukaryotic universal primers, and then compared with sequences of other species and populations of Spirostomum deposited in the GenBank database. Living S. minus measured 400-800 µm in length and 55-115 µm in width, with the following characteristics: adoral zone of membranelles approximately 112 µm long; inconspicuous paroral kinety; 30-40 kineties in somatic ciliature; moniliform macronucleus with 9-25 nodes, approximately 12 micronuclei; single and posterior contractile vacuole; and yellow-brown cytoplasm. Living and fully extended S. teres measured approximately 250 µm in length and 65 ìm in width, with the following characteristics: adoral zone of membranelles approximately 92 µm long; approximately 30 somatic kineties; compact macronucleus, approximately five micronuclei; macronuclear groove present; single and posterior contractile vacuole
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Czech Academy of Sciences Publication Activity Database
Matyášek, Roman; Tate, J. A.; Lim, Y.K.; Šrubařová, Hana; Koh, J.; Leitch, A.R.; Soltis, D.E.; Soltis, P.S.; Kovařík, Aleš
2007-01-01
Roč. 176, č. 4 (2007), s. 2509-2519 ISSN 0016-6731 R&D Projects: GA ČR(CZ) GA204/05/0687; GA ČR(CZ) GA521/07/0116; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA silencing * nucleolar dominance * allopolyploidy Subject RIV: BO - Biophysics Impact factor: 4.001, year: 2007
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
Directory of Open Access Journals (Sweden)
Stephanie E Hesselson
2009-09-01
Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
Directory of Open Access Journals (Sweden)
Sarah Röhrig
2016-10-01
Full Text Available The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR, we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold. Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.
Röhrig, Sarah; Schröpfer, Susan; Knoll, Alexander; Puchta, Holger
2016-10-01
The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR), we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold). Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.
El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel
2018-04-05
Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup
2018-03-01
Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.
Martelli, Luisa; Venegoni, Mauro
2013-06-01
Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.
Matoba, Hideyuki; Mizutani, Takayuki; Nagano, Katsuya; Hoshi, Yoshikazu; Uchiyama, Hiroshi
2007-12-01
In this study, in addition to the karyotype analysis, the chromosomal distributions of 5 S and 18 S rDNAs, and the Arabidopsis-type (T3AG3) telomeric sequences were detected by means of fluorescence in situ hybridization (FISH) to promote the information of chromosomal organization and evolution in the cultivated lettuce and its wild relatives, L. sativa, L. serriola, L. saligna and L. virosa. The karyotype analysis revealed the dissimilarity between L. virosa and the remaining species. In all four Lactuca species studied, one 5 S rDNA and two 18 S rDNA loci were detected. The simultaneous FISH of 5 S and 18 S rDNAs revealed that both rDNA loci of L. sativa, L. serriola and L. saligna were identical, however, that of L. virosa was different from the other species. These analyses indicate the closer relationships between L. sativa/L. serriola and L. saligna rather than L. virosa. Arabidopsis-type telomeric sequences were detected at both ends of their chromatids of all chromosomes not in the other regions. This observation suggests the lack of telomere-mediated chromosomal rearrangements among the Lactuca chromosomes.
International Nuclear Information System (INIS)
Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto
2014-01-01
Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA
International Nuclear Information System (INIS)
Gillen, V.A.
1990-09-01
The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy
Cabral, Juliano S.; Felix, Leonardo P.; Guerra, Marcelo
2006-01-01
We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana) in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA) and 4'-6-diamidino-2-phenylindole (DAPI) fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH). The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5...
J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)
2010-01-01
textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded
Plant growth promotion and Penicillium citrinum
Directory of Open Access Journals (Sweden)
Choo Yeon-Sik
2008-12-01
Full Text Available Abstract Background Endophytic fungi are known plant symbionts. They produce a variety of beneficial metabolites for plant growth and survival, as well as defend their hosts from attack of certain pathogens. Coastal dunes are nutrient deficient and offer harsh, saline environment for the existing flora and fauna. Endophytic fungi may play an important role in plant survival by enhancing nutrient uptake and producing growth-promoting metabolites such as gibberellins and auxins. We screened roots of Ixeris repenes (L. A. Gray, a common dune plant, for the isolation of gibberellin secreting endophytic fungi. Results We isolated 15 endophytic fungi from the roots of Ixeris repenes and screened them for growth promoting secondary metabolites. The fungal isolate IR-3-3 gave maximum plant growth when applied to waito-c rice and Atriplex gemelinii seedlings. Analysis of the culture filtrate of IR-3-3 showed the presence of physiologically active gibberellins, GA1, GA3, GA4 and GA7 (1.95 ng/ml, 3.83 ng/ml, 6.03 ng/ml and 2.35 ng/ml, respectively along with other physiologically inactive GA5, GA9, GA12, GA15, GA19, GA20 and, GA24. The plant growth promotion and gibberellin producing capacity of IR-3-3 was much higher than the wild type Gibberella fujikuroi, which was taken as control during present study. GA5, a precursor of bioactive GA3 was reported for the first time in fungi. The fungal isolate IR-3-3 was identified as a new strain of Penicillium citrinum (named as P. citrinum KACC43900 through phylogenetic analysis of 18S rDNA sequence. Conclusion Isolation of new strain of Penicillium citrinum from the sand dune flora is interesting as information on the presence of Pencillium species in coastal sand dunes is limited. The plant growth promoting ability of this fungal strain may help in conservation and revegetation of the rapidly eroding sand dune flora. Penicillium citrinum is already known for producing mycotoxin citrinin and cellulose digesting
Energy Technology Data Exchange (ETDEWEB)
Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.
2012-11-01
The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Directory of Open Access Journals (Sweden)
Priscilla C Silva
Full Text Available Henochilus wheatlandii, the only species of this genus, is critically endangered and was considered extinct for over a century. The rediscovery of this fish in 1996 made it possible to study its phylogenetic relationships with other species in the subfamily Bryconinae. The aim of this study was to characterise the karyotype of H. wheatlandii. Standard staining, C-positive heterochromatin and nucleolar organiser region (NOR banding, chromomycin A(3 staining, and fluorescent in situ hybridisation (FISH using 5S rDNA and 18S rDNA probes were conducted on nineteen specimens collected in the Santo Antonio River, a sub-basin of the Doce River in Ferros municipality, Minas Gerais State, Brazil. Henochilus wheatlandii shared the same diploid number and chromosome morphology as other species of Bryconinae. However, its heterochromatin distribution patterns, NOR localisation, and FISH patterns revealed a cytogenetic profile unique among Neotropical Bryconinae, emphasizing the evolutionary uniqueness of this threatened species.
Sandoval-Denis, M.; Guarnaccia, V.; Polizzi, G.; Crous, P.W.
2018-01-01
The diversity of fusaria in symptomatic Citrus trees in Greece, Italy and Spain was evaluated using morphological and molecular multi-locus analyses based on fragments of the calmodulin (CAM), intergenic spacer region of the rDNA (IGS), internal transcribed spacer region of the rDNA (ITS), large
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Mangan, Hazel; Gailín, Michael Ó; McStay, Brian
2017-12-01
Nucleoli are the sites of ribosome biogenesis and the largest membraneless subnuclear structures. They are intimately linked with growth and proliferation control and function as sensors of cellular stress. Nucleoli form around arrays of ribosomal gene (rDNA) repeats also called nucleolar organizer regions (NORs). In humans, NORs are located on the short arms of all five human acrocentric chromosomes. Multiple NORs contribute to the formation of large heterochromatin-surrounded nucleoli observed in most human cells. Here we will review recent findings about their genomic architecture. The dynamic nature of nucleoli began to be appreciated with the advent of photodynamic experiments using fluorescent protein fusions. We review more recent data on nucleoli in Xenopus germinal vesicles (GVs) which has revealed a liquid droplet-like behavior that facilitates nucleolar fusion. Further analysis in both XenopusGVs and Drosophila embryos indicates that the internal organization of nucleoli is generated by a combination of liquid-liquid phase separation and active processes involving rDNA. We will attempt to integrate these recent findings with the genomic architecture of human NORs to advance our understanding of how nucleoli form and respond to stress in human cells. © 2017 Federation of European Biochemical Societies.
Identification of EhTIF-IA: The putative E. histolytica orthologue of the ...
Indian Academy of Sciences (India)
2016-02-04
Feb 4, 2016 ... We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within ..... a putative EhTIF-IA with e-value (3e−25). Comparison of .... some biogenesis is correlated with altered rates of rDNA transcription ..... ylation by CK2 facilitates rDNA transcription by promoting dissociation of ...
Promoting regional energy co-operation in South Asia
International Nuclear Information System (INIS)
Srivastava, Leena; Misra, Neha
2007-01-01
Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs
DEFF Research Database (Denmark)
Manteca, Angel; Pelaez, Ana Isabel; del Mar Garcia-Suarez, Maria
2009-01-01
A Streptomyces sp. isolated from a patient who had had breast reconstruction after a mastectomy was identified at the species level by comparative sequence analysis of 16S ribosomal DNA (rDNA) and the hypervariable alpha-region of the 16S rDNA.......A Streptomyces sp. isolated from a patient who had had breast reconstruction after a mastectomy was identified at the species level by comparative sequence analysis of 16S ribosomal DNA (rDNA) and the hypervariable alpha-region of the 16S rDNA....
PICH promotes mitotic chromosome segregation
DEFF Research Database (Denmark)
Nielsen, Christian Thomas Friberg; Hickson, Ian D
2016-01-01
PICH is an SNF2-family DNA translocase that appears to play a role specifically in mitosis. Characterization of PICH in human cells led to the initial discovery of "ultra-fine DNA bridges" (UFBs) that connect the 2 segregating DNA masses in the anaphase of mitosis. These bridge structures, which...... further the role of PICH in the timely segregation of the rDNA locus....
The actin family protein ARP6 contributes to the structure and the function of the nucleolus
Energy Technology Data Exchange (ETDEWEB)
Kitamura, Hiroshi [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoka-ku, Sendai 981-8555 (Japan); Matsumori, Haruka [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Kalendova, Alzbeta; Hozak, Pavel [Department of Biology of the Cell Nucleus, Institute of Molecular Genetics of the Academy of Sciences of the Czech Republic, v.v.i., Vídeňská 1083, 142 20 Prague (Czech Republic); Goldberg, Ilya G. [Image Informatics and Computational Biology Unit, Laboratory of Genetics, National Institute on Aging, National Institutes of Health, 251 Bayview Boulevard, Suite 100, Baltimore, MD 21224 (United States); Nakao, Mitsuyoshi [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, Tokyo 102-0076 (Japan); Saitoh, Noriko [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Harata, Masahiko, E-mail: mharata@biochem.tohoku.ac.jp [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoka-ku, Sendai 981-8555 (Japan)
2015-08-21
The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. - Highlights: • ARP6, an actin related protein, is important for nucleolar function and structure. • A population of ARP6 is localized in the center of nucleolus. • Depletion of ARP6 resulted in aberrant shape of the nucleolus. • ARP6 maintains the active rDNA transcription under high glucose. • ARP6 is required for the repression of rDNA transcription under starvation.
The actin family protein ARP6 contributes to the structure and the function of the nucleolus
International Nuclear Information System (INIS)
Kitamura, Hiroshi; Matsumori, Haruka; Kalendova, Alzbeta; Hozak, Pavel; Goldberg, Ilya G.; Nakao, Mitsuyoshi; Saitoh, Noriko; Harata, Masahiko
2015-01-01
The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. - Highlights: • ARP6, an actin related protein, is important for nucleolar function and structure. • A population of ARP6 is localized in the center of nucleolus. • Depletion of ARP6 resulted in aberrant shape of the nucleolus. • ARP6 maintains the active rDNA transcription under high glucose. • ARP6 is required for the repression of rDNA transcription under starvation
Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D
PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine
A single-copy galK promoter cloning vector suitable for cloning strong promoters
DEFF Research Database (Denmark)
Dandanell, Gert; Court, Donald L.; Hammer, Karin
1986-01-01
We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...
Directory of Open Access Journals (Sweden)
Enrique Yamil Alul González
2010-12-01
Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
International Nuclear Information System (INIS)
Khan, I.A.; Khan, A.; Asif, H.; Azim, M.K.; Muhlbach, H.P.
2014-01-01
A broad range of microorganisms are involved in various mango plant diseases such as fungi, algae and bacteria. In order to study the role of bacteria in mango dieback, a survey of infected mango plants in southern Pakistan was carried out. A number of bacterial isolates were obtained from healthy looking and infected mango trees, and their characterization was undertaken by colony PCR and subsequent sequence analysis of 16S rDNA. These analyses revealed the presence of various genera including Acinetobacter, Bacillus, Burkholderia, Cronobacter, Curtobacterium, Enterobacter, Erwinia, Exiguobacterium, Halotelea, Lysinibacillus, Micrococcus, Microbacterium, Pantoea, Pseudomonas, Salmonella and Staphylococcus. It is noteworthy that several members of these genera have been reported as plant pathogens. The present study provided baseline information regarding the phytopathogenic bacteria associated with mango trees in southern Pakistan. (author)
Dalitz, Camila de Araújo; Porsani, Mariana Vieira; Figel, Izabel Cristina; Pimentel, Ida C; Dalzoto, Patrícia R
Actinobacteria occur in many environments and have the capacity to produce secondary metabolites with antibiotic potential. Identification and taxonomy of actinobacteria that produce antimicrobial substances is essential for the screening of new compounds, and sequencing of the 16S region of ribosomal DNA (rDNA), which is conserved and present in all bacteria, is an important method of identification. Melanized fungi are free-living organisms, which can also be pathogens of clinical importance. This work aimed to evaluate growth inhibition of melanized fungi by actinobacteria and to identify the latter to the species level. In this study, antimicrobial activity of 13 actinobacterial isolates from the genus Streptomyces was evaluated against seven melanized fungi of the genera Exophiala, Cladosporium, and Rhinocladiella. In all tests, all actinobacterial isolates showed inhibitory activity against all isolates of melanized fungi, and only one actinobacterial isolate had less efficient inhibitory activity. The 16S rDNA region of five previously unidentified actinobacterial isolates from Ilha do Mel, Paraná, Brazil, was sequenced; four of the isolates were identified as Streptomyces globisporus subsp. globisporus, and one isolate was identified as Streptomyces aureus. This work highlights the potential of actinobacteria with antifungal activity and their role in the pursuit of novel antimicrobial substances. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.
2014-01-01
To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.
Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores
2009-12-03
Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix
Kamala, Th; Devi, S Indira; Sharma, K Chandradev; Kennedy, K
2015-01-01
Towards assessing the genetic diversity and occurrence of Trichoderma species from the Indian region of Indo-Burma Biodiversity hotspot, a total of 193 Trichoderma strains were isolated from cultivated soils of nine different districts of Manipur comprising 4 different agroclimatic zones. The isolates were grouped based on the morphological characteristics. ITS-RFLP of the rDNA region using three restriction digestion enzymes: Mob1, Taq1, and Hinf1, showed interspecific variations among 65 isolates of Trichoderma. Based on ITS sequence data, a total of 22 different types of representative Trichoderma species were reported and phylogenetic analysis showed 4 well-separated main clades in which T. harzianum was found to be the most prevalent spp. among all the Trichoderma spp. Combined molecular and phenotypic data leads to the development of a taxonomy of all the 22 different Trichoderma spp., which was reported for the first time from this unique region. All these species were found to produce different extrolites and enzymes responsible for the biocontrol activities against the harmful fungal phytopathogens that hamper in food production. This potential indigenous Trichoderma spp. can be targeted for the development of suitable bioformulation against soil and seedborne pathogens in sustainable agricultural practice.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM
Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the
Wada, H; Satoh, N
1994-01-01
Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885
Czech Academy of Sciences Publication Activity Database
Scholz, Tomáš; de Chambrier, A.; Shimazu, T.; Ermolenko, A.; Waeschenbach, A.
2017-01-01
Roč. 66, č. 1 (2017), s. 871-883 ISSN 1383-5769 R&D Projects: GA ČR(CZ) GBP505/12/G112 Institutional support: RVO:60077344 Keywords : taxonomy * morphology * 16S rDNA * 18S rDNA * 28S rDNA * coxl * Proteocephalidae * Nemacheilidae * Cobitidae * Palaearctic Region Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 1.744, year: 2016
Wang, Hai-Feng; Zhu, Wei-Yun; Yao, Wen; Liu, Jian-Xin
2007-01-01
The effect of feeding whole crop rice (WCR) to growing-finishing pigs at three levels 0 (Control), 10% and 20% on bacterial communities in colon content and feces was analyzed using 16S rDNA-based techniques. Amplicons of the V6-V8 variable regions of bacterial 16S rDNA were analyzed by denaturing gradient gel electrophoresis (DGGE), cloning and sequencing. The total number of DGGE bands and Shannon index of diversity for feces samples were higher in the pigs fed WCR-containing diets compared with the control, while a decrease trend was observed in these two parameters for colon content samples with the inclusion of WCR in the diets, although statistical differences were not significant. In general, the intestinal bacterial communities were prone to form the cluster for pig fed the same diet. Feeding of WCR induced the presence of special DGGE band with the sequence showing 99% similarity to that of Lactobacillus reuteri (DSM 20016T). The sequences of seven amplicons in total nine clones showed less than 97% similarity with those of previously identified or unidentified bacteria, suggesting that most bacteria in gastrointestinal tracts have not been cultured or identified. The results suggest that the diet containing WCR did not affect the major groups of bacteria, but stimulated the growth of L. reuteri-like species.
South Asia's health promotion kaleidoscope.
Mukhopadhyay, Alok
2007-01-01
South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Directory of Open Access Journals (Sweden)
L. Minieri
2010-04-01
Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan
2013-01-01
On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
Directory of Open Access Journals (Sweden)
Joydeep Banerjee
Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.
Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D
2013-07-01
The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.
Arbefeville, S; Harris, A; Ferrieri, P
2017-09-01
Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU rDNA
DEFF Research Database (Denmark)
Bergholtz, Trine; Daugbjerg, Niels; Moestrup, Øjvind
2006-01-01
An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species of Karlo......An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species...... of Karlodinium (K. micrum (Leadbeater et Dodge) J. Larsen) by lacking rows of amphiesmal plugs, a feature presently considered to be a characteristic of Karlodinium. In K. armiger, an outer membrane is underlain by a complex system of cisternae and vacuoles. The pigment profile of K. armiger revealed...... sequence, differed in only 0.3% of 1438 bp. We consider the two taxa to belong to the same species. This necessitates a change of name for the most widely found species, K. micrum, to K. veneficum. The three genera Karlodinium, Takayama, and Karenia constitute a separate evolutionary lineage, for which...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Directory of Open Access Journals (Sweden)
Gauri A. Achari
2014-01-01
Full Text Available Eggplant (Solanum melongena L. is one of the solanaceous crops of economic and cultural importance and is widely cultivated in the state of Goa, India. Eggplant cultivation is severely affected by bacterial wilt caused by Ralstonia solanacearum that colonizes the xylem tissue. In this study, 167 bacteria were isolated from the xylem of healthy eggplant, chilli, and Solanum torvum Sw. by vacuum infiltration and maceration. Amplified rDNA restriction analysis (ARDRA grouped these xylem residing bacteria (XRB into 38 haplotypes. Twenty-eight strains inhibited growth of R. solanacearum and produced volatile and diffusible antagonistic compounds and plant growth promoting substances in vitro. Antagonistic strains XB86, XB169, XB177, and XB200 recorded a biocontrol efficacy greater than 85% against BW and exhibited 12%–22 % increase in shoot length in eggplant in the greenhouse screening. 16S rRNA based identification revealed the presence of 23 different bacterial genera. XRB with high biocontrol and plant growth promoting activities were identified as strains of Staphylococcus sp., Bacillus sp., Streptomyces sp., Enterobacter sp., and Agrobacterium sp. This study is the first report on identity of bacteria from the xylem of solanaceous crops having traits useful in cultivation of eggplant.
Leeflang, P.; Smit, E.; Glandorf, D.C.M.; Van Hannen, E.J.; Wernars, K.
2002-01-01
We measured effects of Pseudomonas putida WCS358r and its genetically modified phenazine producing derivative on the Fusarium population in the soil of a wheat field in the Netherlands. We used 18S rDNA analysis to study the Fusarium population through a strategy based on screening clone libraries
Directory of Open Access Journals (Sweden)
Yang Haishui
2012-04-01
Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. Results We defined 305 ITS virtual taxa (ITS-VTs among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. Conclusion The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity
Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin
2012-04-12
Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the ...
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
Shim, Jaehong; Babu, A Giridhar; Velmurugan, Palanivel; Shea, Patrick J; Oh, Byung-Taek
2014-01-01
A bacterial strain (JH 70-4) exhibiting plant growth promoting characteristics (indoleacetic acid production and 1-aminocyclopropane-1-carboxylate deaminase activity), as well as heavy metal(loid) (HM) tolerance and Pb precipitation, was isolated from HM-contaminated soil at an abandoned mine site. The bacterium was identified as Pseudomonas fluorescens based on 16S rDNA sequencing. The JH 70-4 strain induced precipitation of Pb as PbS nanoparticles, confirmed by X-ray diffraction. Solution pH, incubation time, and Pb concentration influenced removal and PbS formation. Inoculating contaminated soil with JH 70-4 decreased Pb availability; exchangeable Pb decreased while organic- and sulphide-bound Pb increased. The toxicity characteristic leaching procedure showed a 65% decrease in Pb in leachate 60 d after inoculating soil with JH 70-4. Shoot and root lengths of Sudan grass grown in the inoculated soil were greater than in the uninoculated soil. Findings suggest that microbial Pb fixation is a viable strategy for remediating soil and promoting plant growth for phytostabilization of contaminated sites.
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product
Fanguin, Pauline
2014-05-01
Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.
Directory of Open Access Journals (Sweden)
Anna Maria Fiore-Donno
Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.
Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact
Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.
2014-01-01
The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300
Localization and regulation of bacteriophage Mu promoters
International Nuclear Information System (INIS)
Stoddard, S.F.; Howe, M.M.
1989-01-01
Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified
Directory of Open Access Journals (Sweden)
Xiemin Qi
2016-07-01
Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.
Tamura, Naoki; Ochi, Morio; Miyakawa, Hiroshi; Nakazawa, Futoshi
2013-01-01
To analyze and characterize the predominant bacterial flora associated with peri-implantitis by using culture techniques under obligate anaerobic conditions and 16S rDNA gene sequences. Subgingival bacterial specimens were taken from 30 patients: control (n = 15), consisting of patients with only healthy implants; and test (n = 15), consisting of patients with peri-implantitis. In both groups, subgingival bacterial specimens were taken from the deepest sites. An anaerobic glove box system was used to cultivate bacterial strains. The bacterial strains were identified by 16S rDNA genebased polymerase chain reaction and comparison of the gene sequences. Peri-implantitis sites had approximately 10-fold higher mean colony forming units (per milliliter) than healthy implant sites. A total of 69 different bacterial species were identified in the peri-implantitis sites and 53 in the healthy implant sites. The predominant bacterial species in the peri-implantitis sites were Eubacterium nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, Parascardovia denticolens, Prevotella intermedia, Fusobacterium nucleatum, Porphyromonas gingivalis, Centipeda periodontii, and Parvimonas micra. The predominant bacteria in healthy implant sites apart from Streptococcus were Pseudoramibacter alactolyticus, Veillonella species, Actinomyces israelii, Actinomyces species, Propionibacterium acnes, and Parvimonas micra. These results suggest that the environment in the depths of the sulcus showing peri-implantitis is well suited for growth of obligate anaerobic bacteria. The present study demonstrated that the sulcus around oral implants with peri-implantitis harbors high levels of asaccharolytic anaerobic gram-positive rods (AAGPRs) such as E. nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, and gram-negative anaerobic rods, suggesting that conventional periodontopathic bacteria are not the only periodontal pathogens active in peri-implantitis, and that AAGPRs
Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription
Energy Technology Data Exchange (ETDEWEB)
Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)
2013-03-15
Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.
Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription
International Nuclear Information System (INIS)
Grierson, Patrick M.; Acharya, Samir; Groden, Joanna
2013-01-01
Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription
Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing
Directory of Open Access Journals (Sweden)
Soares-Ramos Juliana R.L.
2003-01-01
Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.
Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.
Lobuglio, Katherine Frances
1990-01-01
Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four
Molecular cytogenetic of the Amoy croaker, Argyrosomus amoyensis (Teleostei, Sciaenidae)
Liao, Mengxiang; Zheng, Jiao; Wang, Zhiyong; Wang, Yilei; Zhang, Jing; Cai, Mingyi
2017-08-01
The family Sciaenidae is remarkable for its species richness and economic importance. However, the cytogenetic data available in this fish group are still limited, especially those obtained using fluorescence in situ hybridization (FISH). In the present study, the chromosome characteristics of a sciaenid species, Argyrosomus amoyensis, were examined with several cytogenetic methods, including dual-FISH with 18S and 5S rDNA probes, and a self-genomic in situ hybridization procedure (Self-GISH). The karyotype of A. amoyensis comprised 2n=48 acrocentric chromosomes. A single pair of nucleolar organizer regions (NORs) was located at the proximal position of chromosome 1, which was positive for silver nitrate impregnation (AgNO3) staining and denaturation-propidium iodide (DPI) staining but negative for Giemsa staining and 4',6-diamidino-2-phenylindole (DAPI) staining, and was confirmed by FISH with 18S rDNA probes. The 5S rDNA sites were located at the centromeric region of chromosome 3. Telomeric FISH signals were detected at all chromosome ends with different intensities, but internal telomeric sequences (ITSs) were not found. Self-GISH resulted in strong signals distributed at the centromeric regions of all chromosomes. C-banding revealed not only centromeric heterochromatin, but also heterochromatin that located on NORs, in interstitial and distal telomeric regions of specific chromosomes. These results suggest that the karyotype of Amoy croaker was relatively conserved and primitive. By comparison with the reported cytogenetic data of other sciaenids, it can be deduced that although the karyotypic macrostructure and chromosomal localization of 18S rDNA are conserved, the distribution of 5S rDNA varies dynamically among sciaenid species. Thus, the 5S rDNA sites may have different evolutionary dynamics in relation to other chromosomal regions, and have the potential to be effective cytotaxonomic markers in Sciaenidae.
Directory of Open Access Journals (Sweden)
Dongkyoon Kim
2017-12-01
Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.
Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae
Directory of Open Access Journals (Sweden)
Douzery Emmanuel JP
2011-05-01
Full Text Available Abstract Background Recent advances in comparative genomics have considerably improved our knowledge of the evolution of mammalian karyotype architecture. One of the breakthroughs was the preferential localization of evolutionary breakpoints in regions enriched in repetitive sequences (segmental duplications, telomeres and centromeres. In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. The target model was the genus Mus which exhibits a high rate of karyotypic change, a large fraction of which involves centromeres. Results The chromosomal distribution of rDNA clusters was determined by in situ hybridization of mouse probes in 19 species. Using a molecular-based reference tree, the phylogenetic distribution of clusters within the genus was reconstructed, and the temporal association between rDNA clusters, breakpoints and centromeres was tested by maximum likelihood analyses. Our results highlighted the following features of rDNA cluster dynamics in the genus Mus: i rDNA clusters showed extensive diversity in number between species and an almost exclusive pericentromeric location, ii a strong association between rDNA sites and centromeres was retrieved which may be related to their shared constraint of concerted evolution, iii 24% of the observed breakpoints mapped near an rDNA cluster, and iv a substantial rate of rDNA cluster change (insertion, deletion also occurred in the absence of chromosomal rearrangements. Conclusions This study on the dynamics of rDNA clusters within the genus Mus has revealed a strong evolutionary relationship between rDNA clusters and centromeres. Both of these genomic structures coincide with breakpoints in the genus Mus, suggesting that the accumulation of a large number of repeats in the centromeric region may contribute to the high level of chromosome
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
Sarkar, Anumita; Ghosh, Pallab Kumar; Pramanik, Krishnendu; Mitra, Soumik; Soren, Tithi; Pandey, Sanjeev; Mondal, Monohar Hossain; Maiti, Tushar Kanti
2018-01-01
Agricultural productivity is proven to be hampered by the synthesis of reactive oxygen species (ROS) and production of stress-induced ethylene under salinity stress. One-aminocyclopropane-1-carboxylic acid (ACC) is the direct precursor of ethylene synthesized by plants. Bacteria possessing ACC deaminase activity can use ACC as a nitrogen source preventing ethylene production. Several salt-tolerant bacterial strains displaying ACC deaminase activity were isolated from rice fields, and their plant growth-promoting (PGP) properties were determined. Among them, strain P23, identified as an Enterobacter sp. based on phenotypic characteristics, matrix-assisted laser desorption ionization-time of flight mass spectrometry data and the 16S rDNA sequence, was selected as the best-performing isolate for several PGP traits, including phosphate solubilization, IAA production, siderophore production, HCN production, etc. Enterobacter sp. P23 was shown to promote rice seedling growth under salt stress, and this effect was correlated with a decrease in antioxidant enzymes and stress-induced ethylene. Isolation of an acdS mutant strain enabled concluding that the reduction in stress-induced ethylene content after inoculation of strain P23 was linked to ACC deaminase activity. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
The Digital North Denmark Programme -Promoting Regional Change?
DEFF Research Database (Denmark)
Østergaard, Christian Richter
2007-01-01
The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...
Czech Academy of Sciences Publication Activity Database
Crhák Khaitová, Lucie; Werlemark, G.; Nybom, H.; Kovařík, Aleš
2010-01-01
Roč. 104, č. 1 (2010), s. 113-120 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA521/07/0116; GA MŠk(CZ) LC06004; GA ČR(CZ) GD204/09/H002 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polyploidy * rDNA genes * Rosaceae Subject RIV: BO - Biophysics Impact factor: 4.569, year: 2010
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Directory of Open Access Journals (Sweden)
Gian Luigi Corinto
2016-05-01
The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.
Sreevidya, M.; Gopalakrishnan, S.; Kudapa, H.; Varshney, R.K.
2016-01-01
The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40) but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40), hydrocyanic acid (except VAI-7 and VAI-40), indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea. PMID:26887230
Directory of Open Access Journals (Sweden)
M. Sreevidya
2016-03-01
Full Text Available Abstract The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40 but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40, hydrocyanic acid (except VAI-7 and VAI-40, indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea.
Kamala, Th.; Devi, S. Indira; Sharma, K. Chandradev; Kennedy, K.
2015-01-01
Towards assessing the genetic diversity and occurrence of Trichoderma species from the Indian region of Indo-Burma Biodiversity hotspot, a total of 193 Trichoderma strains were isolated from cultivated soils of nine different districts of Manipur comprising 4 different agroclimatic zones. The isolates were grouped based on the morphological characteristics. ITS-RFLP of the rDNA region using three restriction digestion enzymes: Mob1, Taq1, and Hinf1, showed interspecific variations among 65 isolates of Trichoderma. Based on ITS sequence data, a total of 22 different types of representative Trichoderma species were reported and phylogenetic analysis showed 4 well-separated main clades in which T. harzianum was found to be the most prevalent spp. among all the Trichoderma spp. Combined molecular and phenotypic data leads to the development of a taxonomy of all the 22 different Trichoderma spp., which was reported for the first time from this unique region. All these species were found to produce different extrolites and enzymes responsible for the biocontrol activities against the harmful fungal phytopathogens that hamper in food production. This potential indigenous Trichoderma spp. can be targeted for the development of suitable bioformulation against soil and seedborne pathogens in sustainable agricultural practice. PMID:25699268
Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P
2008-06-06
The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Hawley, D K; McClure, W R
1983-01-01
The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.
Directory of Open Access Journals (Sweden)
Steven E Weicksel
Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.
Synthetic promoter libraries for Corynebacterium glutamicum
DEFF Research Database (Denmark)
Rytter, Jakob Vang; Helmark, Søren; Chen, Jun
2014-01-01
The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G
2005-10-01
The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.
An apparent Acanthamoeba genotype is the product of a chimeric 18S rDNA artifact.
Corsaro, Daniele; Venditti, Danielle
2018-02-01
Free-living amoebae of the genus Acanthamoeba are potentially pathogenic protozoa widespread in the environment. The detection/diagnosis as well as environmental survey strategies is mainly based on the identification of the 18S rDNA sequences of the strains that allow the recovery of various distinct genotypes/subgenotypes. The accurate recording of such data is important to better know the environmental distribution of distinct genotypes and how they may be preferentially associated with disease. Recently, a putative new acanthamoebal genotype T99 was introduced, which comprises only environmental clones apparently with some anomalous features. Here, we analyze these sequences through partial treeing and BLAST analyses and find that they are actually chimeras. Our results show that the putative T99 genotype is very likely formed by chimeric sequences including a middle fragment from acanthamoebae of genotype T13, while the 5'- and 3'-end fragments came from a nematode and a cercozoan, respectively. Molecular phylogenies of Acanthamoeba including T99 are consequently erroneous as genotype T99 does not exist in nature. Careful identification of Acanthamoeba genotypes is therefore critical for both phylogenetic and diagnostic applications.
Energy Technology Data Exchange (ETDEWEB)
Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)
2015-12-04
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
International Nuclear Information System (INIS)
Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji
2015-01-01
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
user
2011-03-07
Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.
Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho
2010-01-01
Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver
International Nuclear Information System (INIS)
Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.
2007-01-01
It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes
Directory of Open Access Journals (Sweden)
Vassilis MONASTIRIOTIS
2010-12-01
Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.
Directory of Open Access Journals (Sweden)
Riccardo Castiglia
2011-06-01
Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.
Constructing a State Policy To Promote Regionalism in School Government.
Zukowsky, Jerome; And Others.
This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…
International Nuclear Information System (INIS)
Sheng Xiafang; Xia Juanjuan; Jiang Chunyu; He Linyan; Qian Meng
2008-01-01
Two lead (Pb)-resistant endophytic bacteria were isolated from rape roots grown in heavy metal-contaminated soils and characterized. A pot experiment was conducted for investigating the capability of the two isolates to promote the growth and Pb uptake of rape from Pb-amended soil. The two isolates were identified as Pseudomonas fluorescens G10 and Microbacterium sp. G16 based on the 16S rDNA gene sequence analysis. Strains G10 and G16 exhibited different multiple heavy metal and antibiotic resistance characteristics and increased water-soluble Pb in solution and in Pb-added soil. Root elongation assays demonstrated increases in root elongation of inoculated rape seedlings compared to the control plants. Strain G16 produced indole acetic acid, siderophores and 1-aminocyclopropane-1-carboxylate deaminase. Increases in biomass production and total Pb uptake in the bacteria-inoculated plants were obtained compared to the control. The two strains could colonize the root interior and rhizosphere soil of rape after root inoculation. - Heavy metal-resistant endophytic bacteria from rape have the potential of promoting the growth and lead uptake of rape
Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A
2014-01-01
The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Margheri, Maria C; Piccardi, Raffaella; Ventura, Stefano; Viti, Carlo; Giovannetti, Luciana
2003-05-01
Genotypic diversity of several cyanobacterial strains mostly isolated from marine or brackish waters, belonging to the genera Geitlerinema and Spirulina, was investigated by amplified 16S ribosomal DNA restriction analysis and compared with morphological features and response to salinity. Cluster analysis was performed on amplified 16S rDNA restriction profiles of these strains along with profiles obtained from sequence data of five Spirulina-like strains, including three representatives of the new genus Halospirulina. Our strains with tightly coiled trichomes from hypersaline waters could be assigned to the Halospirulina genus. Among the uncoiled strains, the two strains of hypersaline origin clustered together and were found to be distant from their counterparts of marine and freshwater habitat. Moreover, another cluster, formed by alkali-tolerant strains with tightly coiled trichomes, was well delineated.
Regional analysis of potential polychlorinated biphenyl degrading bacterial strains from China
Directory of Open Access Journals (Sweden)
Jianjun Shuai
Full Text Available ABSTRACT Polychlorinated biphenyls (PCBs, the chlorinated derivatives of biphenyl, are one of the most prevalent, highly toxic and persistent groups of contaminants in the environment. The objective of this study was to investigate the biodegradation of PCBs in northeastern (Heilongjiang Province, northern (Shanxi Province and eastern China (Shanghai municipality. From these areas, nine soil samples were screened for PCB-degrading bacteria using a functional complementarity method. The genomic 16S rDNA locus was amplified and the products were sequenced to identify the bacterial genera. Seven Pseudomonas strains were selected to compare the capacity of bacteria from different regions to degrade biphenyl by HPLC. Compared to the biphenyl content in controls of 100%, the biphenyl content went down to 3.7% for strain P9-324, 36.3% for P2-11, and 20.0% for the other five strains. These results indicate that a longer processing time led to more degradation of biphenyl. PCB-degrading bacterial strains are distributed differently in different regions of China.
The actin family protein ARP6 contributes to the structure and the function of the nucleolus.
Kitamura, Hiroshi; Matsumori, Haruka; Kalendova, Alzbeta; Hozak, Pavel; Goldberg, Ilya G; Nakao, Mitsuyoshi; Saitoh, Noriko; Harata, Masahiko
2015-08-21
The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. Copyright © 2015 Elsevier Inc. All rights reserved.
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Directory of Open Access Journals (Sweden)
Pekevski Siniša
2008-01-01
Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.
CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA
Directory of Open Access Journals (Sweden)
L. Pouyaud
2016-10-01
Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from mitochondrial gene, a new episode of speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between Schilbeidae and Pangasiidae occurred in the Early Miocene.
Directory of Open Access Journals (Sweden)
Eva Hřibová
2011-03-01
Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.
Comparative analyses of bidirectional promoters in vertebrates
Directory of Open Access Journals (Sweden)
Taylor James
2008-05-01
Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Umarov, Ramzan
2017-02-03
Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.
Promoters active in interphase are bookmarked during mitosis by ubiquitination
Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.
2012-01-01
We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662
Genome-wide analysis of promoter architecture in Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Energy Technology Data Exchange (ETDEWEB)
Bizer, Kilian; Bossmeyer, Christoph
2012-07-01
Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.
Directory of Open Access Journals (Sweden)
Hossein ALAEI
2013-01-01
Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.
Directory of Open Access Journals (Sweden)
Eva\tDHIMITRI
2015-12-01
Full Text Available Local governance is a broad concept and is defined as the formulation and execution of collective action at the local level. The purpose of local government is to ensure effective and efficient use of public resources and service delivery at the level closest to citizens. Regional development is a new concept that aims to stimulate and diversify the economic activity of a country (region, to encourage investment in the private sector, to create a new jobs vacancy and improves living standards of the country. Regional development policies are a number of measures designed and promoted by the central and local administration, but the cooperation undertaken at the actors are in a different one, which included the private sector and civil society. At the center of these regional policies or practices is the use of efficient potential of each region, being particularly focused on business, means promoting the development of the new enterprises, promoting labor market and investment, improve the quality of environment, health , education and culture. Traditional objective of regional development policies is the reduction of territorial disparities for achieving a relative balance between economic and social levels of development in different areas in the national territory. Regional development is the actual task of local government units in Albania, and is one of the tasks and challenges of the future. Currently it takes a special importance in the context of European Union integration. Reforms have begun to change the system in 1990 in order to implement local democracy and decentralization principles that are present today. Inequalities that exist within the region and between them indicate that in some regions the economic potential is not being fully utilized, and that it reduces the overall performance in national level.
Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.
Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R
2009-01-01
Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.
Liu, Tianhao; Yang, Zhongshan; Zhang, Xiaomei; Han, Niping; Yuan, Jiali; Cheng, Yu
2017-12-01
This study aims to explore the effect of FMT on regulations of dysbacteriosis of pulmonary and intestinal flora in rats with 16S rDNA sequencing technology. A total of 27 SPF rats (3-4 weeks old) were randomly divided into three groups: normal control group (K), model control group (MX), and fecal microbiota transplantation group (FMT); each group contained nine rats. The OTU values of the pulmonary and intestinal flora of the MX group decreased significantly compared with the normal control group. After FMT, the OTU value of pulmonary flora increased, while the value of OTU in intestinal flora declined. At the phylum level, FMT down-regulated Proteobacteria , Firmicutes , and Bacteroidetes in the pulmonary flora. At the genus level, FMT down-regulated Pseudomonas , Sphingobium , Lactobacillus , Rhizobium , and Acinetobacter , thus maintaining the balance of the pulmonary flora. Moreover, FMT could change the structure and diversity of the pulmonary and intestinal flora by positively regulating the pulmonary flora and negatively regulating intestinal flora. This study may provide a scientific basis for FMT treatment of respiratory diseases.
Directory of Open Access Journals (Sweden)
Aghil Habibi Sola
2007-10-01
Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Rhizobacterial characterization for quality control of eucalyptus biogrowth promoter products
Directory of Open Access Journals (Sweden)
Talyta Galafassi Zarpelon
Full Text Available Abstract Plant growth-promoting rhizobacteria strains from special formulations have been used to optimize eucalyptus cutting production. To undertake quality control for the formulated products, the rhizobacterial strains should be characterized to assess their purity and authentication. In the present study, we characterized nine strains of rhizobacteria, including three Bacillus subtilis (S1, S2 and 3918, two Pseudomonas sp. (MF4 and FL2, P. putida (MF2, P. fulva (Ca, Frateuria aurantia (R1, and Stenotrophomonas maltophilia (CIIb. The strains were differentiated by colony morphology after 24 h of incubation in three different solid state culture media (glucose-nutritive agar, 523 medium and yeast extract-mannitol agar, sensitivity to a panel of 28 antibiotics (expressed according to the formation of inhibition halos of bacterial growth in the presence of antibiotics, and PCR-RFLP profiles of the 16S rDNA gene produced using nine restriction enzymes. It was possible to differentiate all nine strains of rhizobacteria using their morphological characteristics and sensitivity to antibiotics. The molecular analysis allowed us to separate the strains CIIb, FL2 and R1 from the strains belonging to the genera Bacillus and Pseudomonas. By using these three methods concomitantly, we were able to determine strain purity and perform the authentication.
Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.
Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S
2015-01-01
Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.
Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences
Directory of Open Access Journals (Sweden)
Shailendra Yadav
2015-01-01
Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.
Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta
2011-05-01
Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Elena V. Ignatieva
2014-03-01
Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Institute of Scientific and Technical Information of China (English)
R. B. Singh; D. K. Mishra
2004-01-01
In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human
2013-06-24
other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
76 FR 68067 - United States-Peru Trade Promotion Agreement
2011-11-03
... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Engineered Promoters for Potent Transient Overexpression.
Directory of Open Access Journals (Sweden)
Dan Y Even
Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen
2016-09-16
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Directory of Open Access Journals (Sweden)
Mauro Nirchio
2007-01-01
Full Text Available The karyotype and chromosomal characteristics of the characid fish Triportheus venezuelensis were investigated using differential staining techniques (C-banding, Ag-NOR staining and fluorescent in situ hybridization (FISH with an 18S rDNA probe. The diploid chromosome number (2n = 52, karyotype composition and sex chromosome determination system of the ZZ/ZW type were the same as previously described in other species of the genus Triportheus. However, extensive variation regarding nucleolus organizer regions (NOR different from other species was observed. 18S rDNA sequences were distributed on nine chromosome pairs, but the number of chromosomes with Ag-NORs was usually lower, reaching a maximum of four chromosomes. When sequential staining experiments were performed, it was demonstrated that: 1. active NORs usually corresponded to segments with 18S rDNA genes identified in FISH experiments; 2. several 18S rDNA sequences were not silver-stained, suggesting that they do not correspond to active NORs; and 3. some chromosomes with silver-stained regions did not display any 18S rDNA signals. These findings characterize an extensive polymorphism associated with the NOR-bearing chromosomes of T. venezuelensis and emphasize the importance of combining traditional and molecular techniques in chromosome studies.
Directory of Open Access Journals (Sweden)
Alexandru NEDELEA
2009-06-01
Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.
Cooperative monitoring and its role in regional security
Energy Technology Data Exchange (ETDEWEB)
Biringer, K.; Olsen, J.; Lincoln, R.; Wehling, F. [and others
1997-03-01
Cooperative monitoring systems can play an important part in promoting the implementation of regional cooperative security agreements. These agreements advance the national security interests of the United States in a post Cold War environment. Regional issues as widely varying as nuclear nonproliferation, trade and environmental pollution can be the source of tensions which may escalate to armed conflict which could have global implications. The Office of National Security Policy Analysis at the US Department of Energy (DOE) has an interest in seeking ways to promote regional cooperation that can reduce the threats posed by regional conflict. DOE technologies and technical expertise can contribute to developing solutions to a wide variety of these international problems. Much of this DOE expertise has been developed in support of the US nuclear weapons and arms control missions. It is now being made available to other agencies and foreign governments in their search for regional security and cooperation. This report presents two examples of interest to DOE in which monitoring technologies could be employed to promote cooperation through experimentation. The two scenarios include nuclear transparency in Northeast Asia and environmental restoration in the Black Sea. Both offer the potential for the use of technology to promote regional cooperation. The issues associated with both of these monitoring applications are presented along with examples of appropriate monitoring technologies, potential experiments and potential DOE contributions to the scenarios.
Regions and the Territorial Cohesion
Directory of Open Access Journals (Sweden)
Ioan Ianos
2013-08-01
Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.
Directory of Open Access Journals (Sweden)
John A Capra
2010-07-01
Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.
7 CFR 1205.319 - Cotton-producing region.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...
Golczyk, Hieronim; Hasterok, Robert; Szklarczyk, Marek
2010-12-01
High- and low-stringency FISH and base-specific fluorescence were performed on the permanent translocation heterozygote Rhoeo spathacea (2n = 12). Our results indicate that 45S rDNA arrays, rDNA-related sequences and other GC-rich DNA fraction(s) are located within the pericentromeric regions of all twelve chromosomes, usually colocalizing with the chromomycin A(3)-positive bands. Homogenization of the pericentromeric regions appears to result from the concerted spread of GC-rich sequences, with differential amplification likely. We found new 5S rDNA patterns, which suggest a variability in the breakpoints and in the consequent chromosome reorganizations. It was found that the large 5S rDNA locus residing on each of the 8E and 9E arms consisted of two smaller loci. On each of the two chromosome arms 3b and 4b, in addition to the major subtelomeric 5S rDNA locus, a new minor locus was found interstitially about 40% along the arm length. The arrangement of cytotogenetic landmarks and chromosome arm measurements are discussed with regard to genome repatterning in Rhoeo.
Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng
2016-07-01
Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.
Directory of Open Access Journals (Sweden)
Qiang Sun
Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated
Regional Innovation Policies in MERCOSUR : Obstacles and ...
International Development Research Centre (IDRC) Digital Library (Canada)
... review existing regional cooperation initiatives, identify sectors with strong potential for regional cooperation, review other experiences in regional cooperation for innovation (European Union - EU, North American Free Trade Agreement - NAFTA), and propose institutional arrangements for promoting innovation among ...
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Directory of Open Access Journals (Sweden)
Larissa A. Medeiros
Full Text Available ABSTRACT Baryancistrus xanthellus is a species from the Ancistrini tribe known commonly as "amarelinho " or "golden nugget pleco". It is one of the most popular and valued ornamental fishes due to its color pattern. Also, it is an endemic species from the Xingu River occurring from Volta Grande do Xingu, region where the Belo Monte Hydropower Dam is being built, to São Félix do Xingu. The current study aimed to cytogenetically characterize B. xanthellus . Results point to the maintenance of 2n=52, which is considered the most common condition for the tribe, and a single nucleolus organizer region (NOR. Mapping of the 18S rDNA confirmed the NOR sites, and the 5S rDNA was mapped in the interstitial position of a single chromosome pair. The 18S and 5S rDNA located in different pairs constitute an apomorphy in Loricariidae. Large blocks of heterochromatin are present in pairs 1 and 10 and in the regions equivalent to NOR and the 5S rDNA. Data obtained in this study corroborated with the currently accepted phylogenetic hypothesis for the Ancistrini and demonstrate evidence that the genus Baryancistrus occupies a basal position in the tribe.
International Nuclear Information System (INIS)
Ananiev, E.; Abdulova, G.; Grozdanov, P.; Karagyozov, L.
2003-01-01
High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32 P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)
Regional planning and urban infrastructure development in the ...
African Journals Online (AJOL)
Regional planning and urban infrastructure development in the Gongola region, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... In North-eastern Nigeria, the Gongola region has been one of the least developed since independence.
Directory of Open Access Journals (Sweden)
Chinnusamy Viswanathan
2010-04-01
Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908
Directory of Open Access Journals (Sweden)
Nasseri Negin
2009-01-01
Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect
International Nuclear Information System (INIS)
Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour
2009-01-01
Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of
Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep
2016-03-01
Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.
Regional cooperative agreement for the Asia and Pacific region
International Nuclear Information System (INIS)
Anon.
1981-01-01
Among the means available to the International Atomic Energy Agency to promote cooperative efforts in the nuclear field is the Regional Cooperative Agreement (RCA) for Research, Development, and Training related to Nuclear Science and Technology for the Asia and Pacific Region. Under the terms of this agreement, which came into force on June 12, 1972, participating countries aim to promote and coordinate research, development, and training projects in nuclear fields through collaborative efforts among relevant national institutions in the region. The Agency's role is to provide organizational, administrative, advisory, technical, and financial assistance when needed to secure successful execution of the projects undertaken within the framework of the RCA. Although this presentation deals primarily with the benefits of regional cooperation under the agreement, a review of the RCA would be somewhat imbalanced without a mention of its shortcomings. One of the principal impediments to more rapid progress, as is the case in many other areas, is financing. There is no stable source of funding outside the research contract program and, the likelihood of large-scale UNDP support notwithstanding, a greater willingness on the part of participating Member States to support the program along with the development of a greater sense of common purpose are called for. In this connection serious consideration is being given to the possibility of establishing an Asian Centre for Research and Training, an institute that would bring together scientists from the region to collaborate on problems common to the RCA countries. A study group has already been convened to investigate the feasibility of this proposal
Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.
2014-01-01
The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713
Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing
Directory of Open Access Journals (Sweden)
Planý Matej
2016-06-01
Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Asia-Pacific Regional Economic Integration: Coopetition vs. Conflict
Directory of Open Access Journals (Sweden)
YuJane Chen
2016-04-01
Full Text Available In the era of economic globalization, promoting regional trade agreements or regional cooperation has become a plausible strategy to attract foreign direct investment and to promote national competitiveness at a global level. Nonetheless, facing the differential national economic interests and the needs of protection of domestic industries, as well as the diverse levels of economic liberalization domestically, the involvement of FTA negotiation in every country is universally in the situation of struggling between securing economic sovereignty and national economic development. Countries in the Asia-Pacific region are in the same situation. This article analyzes how countries balance between securing economic sovereignty and promoting national economic development when they are involved in TPP and RCEP negotiations. By confirming the appropriate linkage between each participating countries’ decision for balancing between domestic economic sovereignty and further integrating into regional economic cooperation institutions the validity of the proposition for this research project can be verified.
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.
Directory of Open Access Journals (Sweden)
Yoichiro Shinohara
Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C
2000-09-01
Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group
Golczyk, Hieronim; Hasterok, Robert; Joachimiak, Andrzej J
2005-02-01
Fluorescence in situ hybridization (FISH) using 25S rDNA, 5S rDNA, and telomere sequences as probes was carried out in the complex permanent heterozygote Rhoeo spathacea. Telomere sites were exclusively terminal. All 10 25S rDNA loci were located distally and appeared transcriptionally active after silver staining. Six distal and 2 interstitial 5S rDNA sites were detected; 2 of the distal sites strictly colocalized with 25S rDNA loci. The 2 intercalary 5S rDNA loci occurred in short arms of 2 chromosomes that conjoined at meiosis. Chromosomes differed as to the amount of AT-rich centric heterochromatin, suggesting involvement of pericentromeric regions in translocations. The possibility of Robertsonian-like rearrangements was discussed. Double target FISH with ribosomal probes along with DAPI fluorescence gave the basis for full chromosome identification in mitosis. The 2 Renner complexes are structurally balanced, both having 5 25S and 4 5S rDNA sites. Centromere clustering, telomere association, a high number of NOR sites, and a strong tendency for formation of joint nucleoli contribute to the preservation of highly polarized Rabl arrangement at interphase. These findings were discussed in relation to meiotic catenation in Rhoeo.
Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N
2016-04-01
Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.
Singh, S P; Gaur, R
2016-08-01
To evaluate the potential of chitinolytic endophytic Actinomycetes isolated from medicinal plants in order to diminish the collar rot infestation induced by Sclerotium rolfsii in chickpea. Sixty-eight chitinolytic endophytic Actinomycetes were recovered from various medicinal plants and evaluated for their chitinase activity. Among these isolates, 12 were screened for their plant growth promoting abilities and antagonistic potential against Sc. rolfsii. Further, these isolates were validated in vivo for their ability to protect chickpea against Sc. rolfsii infestation under greenhouse conditions. The isolates significantly (P plant mortality (42-75%) of chickpea. On the basis of 16S rDNA profiling, the selected antagonistic strains were identified as Streptomyces diastaticus, Streptomyces fradiae, Streptomyces olivochromogenes, Streptomyces collinus, Streptomyces ossamyceticus and Streptomyces griseus. This study is the first report of the isolation of endophytic Actinomycetes from various medicinal plants having antagonistic and plant growth promoting abilities. The isolated species showed potential for controlling collar rot disease on chickpea and could be useful in integrated control against diverse soil borne plant pathogens. Our investigation suggests that endophytic Actinomycetes associated with medicinal plants can be used as bioinoculants for developing safe, efficacious and environment-friendly biocontrol strategies in the near future. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Jinquan Chen
Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.
Directory of Open Access Journals (Sweden)
Mateus Mondin
2007-01-01
Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).
Hilu, K W; Johnson, J L
1992-04-01
Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.
Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto
2005-02-01
We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Directory of Open Access Journals (Sweden)
Dan Wu
Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)
2012-02-17
Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
International Nuclear Information System (INIS)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming
2012-01-01
Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.
Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen
2015-01-01
Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.
Health promotion capacity building in South Africa.
Wills, Jane; Rudolph, Michael
2010-09-01
Health promotion in South Africa is in its early stages and while there is some institutional development and capacity building for managers, there has been relative disregard and lack of attention of the wider health promotion workforce who carry out community-based health promotion activities. This article describes one regional education and training programme for health promoters as well as the limited available evidence on the impact of the project on learners and organizations. Marked differences before and after the implementation of the training activities were reported in relation to behaviour change communication and project planning, in addition to self-reported positive change in knowledge, confidence and a high level of participant satisfaction. Investment in individual skills development needs to be accompanied by wider workforce development with organizational/institutional development and recognised competencies frameworks.
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Directory of Open Access Journals (Sweden)
Jukka S Alasaari
Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional
Directory of Open Access Journals (Sweden)
Christoph Aluttis
2014-04-01
Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
DEFF Research Database (Denmark)
Okane, Izumi; Srikitikulchai, Prasert; Toyama, Kyoko
2008-01-01
to reveal the diversity and taxonomy of endophytes and the relationships between those endophytes and saprobic Xylariaceae in Thailand that have been recorded according to fruit-body formation on decayed plant materials. Analysis of 28S rDNA D1/D2 sequences revealed 21 xylariaceous species inhabiting......A study of the diversity, taxonomy, and ecology of endophytic Xylariaceae (Ascomycota) was carried out. In this study, we obtained isolates of Xylariaceae from healthy, attached leaves and teleomorphic stromata on decayed plant materials in a permanent plot at Khao Yai National Park (Thailand......). In addition, strains deposited beforehand were selected in which both endophytic strains isolated from living plant tissues and saprobic strains from fruit bodies were included. Consequently, 405 strains of Xylariaceae (273 endophytic and 132 saprobic strains, including identified strains) were studied...
Importance of ARCAL Programme to promote technical cooperation in Latin America
International Nuclear Information System (INIS)
Dieguez, Jose Antonio Diaz
1996-01-01
The ARCAL Programme aims to promote regional co-operation and integration in the nuclear field and to solve common technological problems in Latin America and Caribbean. Emphasis has been given to technicians and researches training through experts interchange, courses, seminars and workshops, making use of the existing infrastructure in the region. During the eleven years of implementation, the ARCAL Programme allowed the training of thousands of professionals and technicians in the various aspects of the nuclear energy for peaceful purposes. Another indisputable achievement of the ARCAL has been the promotion of common knowledge and the link between experts in the region working on similar subjects. (author)
Electrochemical promotion of sulfur dioxide catalytic oxidation
DEFF Research Database (Denmark)
Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm
2000-01-01
investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...
Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel
2014-12-01
Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.
Systematic search for the Cra-binding promoters using genomic SELEX system.
Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira
2005-09-01
Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.
18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment
Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.
2010-01-01
Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that
Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.
Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene
2017-02-01
Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Mexico's four economies reflect regional differences, challenges
Canas, Jesus; Gutierrez, Emily
2015-01-01
The economic potential of Mexico’s four regions is defined by their industrial makeup, income per capita and how much of the labor force operates outside the formal economy. Recent government reforms could promote growth and reduce regional inequality.
Chauhan, Ankit Kumar; Maheshwari, Dinesh Kumar; Kim, Kangmin; Bajpai, Vivek K
2016-10-01
Bacillus strains were isolated from termitarium soil and screened for their antifungal activity through the production of diffusible and volatile metabolites. Further, the bacterial strains that showed antifungal activity were evaluated for their biocontrol potential on the basis of their plant-growth-promoting attributes. Termitarium-inhabiting Bacillus strains TSH42 and TSH77 significantly reduced the growth of pathogenic fungus Fusarium solani, controlled the symptoms of rhizome rot in turmeric (Curcuma longa L.), and demonstrated various plant-growth-promoting traits in different in vitro assays. On the basis of morphological, physiological, biochemical, and 16S rDNA characteristics, isolates TSH42 and TSH77 were identified as Bacillus endophyticus (KT379993) and Bacillus cereus (KT379994), respectively. Through liquid chromatography - mass spectrometry analysis, acidified cell-free culture filtrate (CFCF) of B. cereus TSH77 was shown to contain surfactin and fengycin, while CFCF of B. endophyticus TSH42 contained iturin in addition to surfactin and fengycin. Treatment of the turmeric (C. longa L.) plants with TSH42 and TSH77 significantly reduced the percentage incidence of rhizome rot disease caused by F. solani. The same treatment also increased the fresh rhizome biomass and plant growth in greenhouse conditions.
Direct and indirect effects in the regulation of overlapping promoters
DEFF Research Database (Denmark)
Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt
2011-01-01
promoter database we found that ~14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used......Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion...
Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J
2008-01-01
To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Modeling promoter grammars with evolving hidden Markov models
DEFF Research Database (Denmark)
Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben
2008-01-01
MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...
Effective Feature Selection for Classification of Promoter Sequences.
Directory of Open Access Journals (Sweden)
Kouser K
Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.
Healthy Cities in a global and regional context
Lawrence, Roderick J.; Fudge, Colin
2017-01-01
Since the beginning of the WHO European Healthy Cities Network in 1987, the global and regional contexts for the promotion of health and well-being have changed in many ways. First, in 2000, the United Nations Millennium Goals explicitly and implicitly addressed health promotion and prevention at the global and regional levels. Second, the concern for sustainable development at the Rio Conference in 1992 was confirmed at the World Summit in Johannesburg in 2002. During the same period, in man...
Dynamic usage of transcription start sites within core promoters
DEFF Research Database (Denmark)
Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro
2006-01-01
BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Wine routes as an element of the regional development of borderline regions
Directory of Open Access Journals (Sweden)
Vladimir Drozg
1993-12-01
Full Text Available The article examines the role of winw routes in promoting the development of wine-growing regions. It focuses both on the criteria for tracing wine routes (landscape value of a region, distribution of tourist supply settlements and events, natural and cultural monuments, existing road netivorks and transport accessibility, supplemenlary activities along the wine routes and on the impact that wine exert on the landscape/region (an increased income of individual households, better infrastructure equipment, recuttivation ol desert land lots, decreasing depopulalion and development of supplementary activities. The wine route through the Svečinske gorice region is presented as an example of countryside regulation.
International Nuclear Information System (INIS)
Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi
2014-01-01
Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)
Directory of Open Access Journals (Sweden)
Francesca Lessi
2010-11-01
Full Text Available We have previously shown that serum/glucocorticoid regulated kinase 1 (SGK1 is down-regulated in colorectal cancers (CRC with respect to normal tissue. As hyper-methylation of promoter regions is a well-known mechanism of gene silencing in cancer, we tested whether the SGK1 promoter region was methylated in colonic tumour samples.We investigated the methylation profile of the two CpG islands present in the promoter region of SGK1 in a panel of 5 colorectal cancer cell lines by sequencing clones of bisulphite-treated DNA samples. We further confirmed our findings in a panel of 10 normal and 10 tumour colonic tissue samples of human origin. We observed CpG methylation only in the smaller and more distal CpG island in the promoter region of SGK1 in both normal and tumour samples of colonic origin. We further identified a single nucleotide polymorphism (SNP, rs1743963 which affects methylation of the corresponding CpG.Our results show that even though partial methylation of the promoter region of SGK1 is present, this does not account for the different expression levels seen between normal and tumour tissue.
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.