WorldWideScience

Sample records for rdna primer specifity

  1. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  2. URPD: a specific product primer design tool.

    Science.gov (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  3. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  4. Design and evaluation of nematode 18S rDNA primers for PCR and denaturing gradient gel electrophoresis (DGGE) of soil community DNA

    NARCIS (Netherlands)

    Waite, I.S.; O'Donnell, A.G.; Harrison, A.; Davies, J.T.; Colvan, S.R.; Ekschmitt, K.; Dogan, H.; Wolters, V.; Bongers, A.M.T.; Bongers, M.; Bakonyi, G.; Nagy, P.; Papatheodorou, E.M.; Stamou, G.P.; Boström, S.

    2003-01-01

    Consensus nematode 185 ribosomal DNA primers were designed by aligning available 185 sequences and identifying a variable region flanked by highly conserved regions. These primers were then used to amplify nematode 18S rDNA from whole soil community DNA extracted from a range of European grassland

  5. MFEprimer: multiple factor evaluation of the specificity of PCR primers.

    Science.gov (United States)

    Qu, Wubin; Shen, Zhiyong; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2009-01-15

    We developed a program named MFEprimer for evaluating the specificity of PCR primers based on multiple factors, including sequence similarity, stability at the 3'-end of the primer, melting temperature, GC content and number of binding sites between the primer and DNA templates. MFEprimer can help the user to select more suitable primers before running either standard or multiplex PCR reactions. The cDNA and genomic DNA databases of 10 widely used species, as well as user custom databases, were used as DNA templates for analyzing primers specificity. Furthermore, we maintained a Primer3Plus server with a modified Primer3Manager for one-stop primer design and specificity checking.

  6. New specific primers for amplification of the Internal Transcribed Spacer region in Clitellata (Annelida).

    Science.gov (United States)

    Liu, Yingkui; Erséus, Christer

    2017-12-01

    Nuclear molecular evidence, for example, the rapidly evolving Internal Transcribed Spacer region (ITS), integrated with maternally inherited (mitochondrial) COI barcodes, has provided new insights into the diversity of clitellate annelids. PCR amplification and sequencing of ITS, however, are often hampered by poor specificity of primers used. Therefore, new clitellate-specific primers for amplifying the whole ITS region (ITS: 29F/1084R) and a part of it (ITS2: 606F/1082R) were developed on the basis of a collection of previously published ITS sequences with flanking rDNA coding regions. The specificity of these and other ITS primers used for clitellates were then tested in silico by evaluating their mismatches with all assembled and annotated sequences (STD, version r127) from EMBL, and the new primers were also tested in vitro for a taxonomically broad sample of clitellate species (71 specimens representing 11 families). The in silico analyses showed that the newly designed primers have a better performance than the universal ones when amplifying clitellate ITS sequences. In vitro PCR and sequencing using the new primers were successful, in particular, for the 606F/1082R pair, which worked well for 65 of the 71 specimens. Thus, using this pair for amplifying the ITS2 will facilitate further molecular systematic investigation of various clitellates. The other pair (29F/1084R), will be a useful complement to existing ITS primers, when amplifying ITS as a whole.

  7. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  8. Specific PCR product primer design using memetic algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2009-01-01

    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at http://bio.kuas.edu.tw/ma-pd/. 2009 American Institute of Chemical Engineers

  9. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  10. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    Riemerella anatipestifer (RA) infection is the main disease causing severe losses in duck production. Because RA is characterized more by the absence than by the presence of specific phenotypic properties and different scholar had the different results of biochemical detection, it can't always be identified quickly and correctly only by the phenotypic properties or biochemical characteristics. The research object was to develop a species specific PCR method for RA detection. Because of the conserved structure of rRNA and appropriate size of 16S rRNA, a multiple alignment of 16S rDNA (gene coding 16S rRNA) was processed among RA, Escherichia coli, Pasteurella multocida, Salmonella enteritidis and Salmonella gallinarum, which are the main bacteria causing duck diseases. A pair of species specific primers named 190f and 843r were selected from the variable regions of 16S rDNA depending on the result of multiple alignment. Using BLAST on NCBI website for a sequence similarity search, the results showed that this pair of primers had very high specificity, except for having a lower sequence similarity with some species of Flavobacterium and Chryseobacterium. A PCR assay was performed and the template was extracted using the bacteria genomic DNA extraction kit and boiling method respectively. A chelate resin named Chelex 100 was used in the boiling method at the same time. Under the annealing temperature of 60 degrees C, all the 26 RA strains, including 19 representative strains of serotypes 1 to approximately 19 and 7 domestic isolated strains, showed the same 654bp fragment after PCR, while there was no amplification with isolates of other bacterial species. Also a series of sensitivity experiments were performed and proved that the detection limit of this method was 50pg genomic DNA, 1.5 x 10(6) CFU/mL and 15 CFU/mL, when the template was prepared with genomic DNA extraction kit, only boiling method and boiling method with Chelex 100 respectively. 12 clinical cases

  11. Specific primers for the detection of the black-yeast fungus associated with lethargic crab disease (LCD).

    Science.gov (United States)

    Pie, Marcio R; Boeger, Walter A; Patella, Luciana; Vicente, Vânia A; Ribeiro, Raphael O; Ostrensky, Antonio

    2011-03-16

    Lethargic crab disease (LCD) is an emerging infirmity that has been causing extensive mortalities in populations of the mangrove land crab Ucides cordatus (Ocypodidae) along the Atlantic coast of Brazil. Previous studies have indicated that LCD is associated with a dematiaceous fungus, Exophiala cancerae de Hoog et al. In the present study, we sequenced the internal transcribed spacer (ITS) of the rDNA region of this black yeast species and developed species-specific PCR primers. Sensitivity tests indicated that the developed protocol is capable of detecting very small amounts of target DNA. Also, the application of the protocol to a variety of other dematiaceous fungi did not generate any false positives. The specific primers provided in the present study represent an important tool for rapidly surveying a large number of crab individuals, as well as environmental samples. Such knowledge will be instrumental in understanding the epidemiological dynamics of LCD.

  12. Specific amplification of Necator americanus or Ancylostoma duodenale DNA by PCR using markers in ITS-1 rDNA, and its implications.

    Science.gov (United States)

    Monti, J R; Chilton, N B; Qian, B Z; Gasser, R B

    1998-04-01

    Necator americanus and Ancylostoma duodenale are the two most important species of human hookworm, and occur in sympatry over much of their distribution. The specific diagnosis of hookworm infections is central to control. Diagnosis currently relies on the detection of hookworm eggs in human faeces and/or the specific identification of larvae by 'copro-culture' combined with microscopic examination. However, the eggs of the two species are morphologically indistinguishable, and the procedure of copro-culture is tedious and time-consuming to carry out. To work toward overcoming these limitations, a molecular approach utilizing genetic markers in the first internal transcribed spacer (ITS-1) of ribosomal DNA (rDNA) was established. The ITS-1 sequences of both hookworm species were determined, and specific oligonucleotide primers designed to regions of major sequence difference between the species were evaluated in polymerase chain reaction (PCR). Using a range of control samples, the primers allowed the specific identification of as little as 10 pg DNA of A. duodenale or N. americanus. The findings indicate clearly the potential for specific PCR to confirm the identity of eggs from faeces and larvae from the environment or host tissues. This should have important implications for studying fundamental aspects relating to anthelmintic efficacy and the epidemiology of hookworms.

  13. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  14. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    Science.gov (United States)

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.

  15. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  16. Development of genotype-specific primers for differentiation of genotypes A and B of Aichi viruses.

    Science.gov (United States)

    Pham, Ngan Thi Kim; Trinh, Quang Duy; Nguyen, Tuan Anh; Dey, Shuvra Kanti; Phan, Tung Gia; Hoang, Le Phuc; Khamrin, Pattara; Maneekarn, Niwat; Okitsu, Shoko; Mizuguchi, Masashi; Ushijima, Hiroshi

    2009-03-01

    A nested polymerase chain reaction method using genotype-specific primers based on the capsid gene was developed to differentiate between genotypes A and B of Aichi viruses. Results of the study showed that the PCR using newly designed genotype-specific primers could generate appropriate PCR products from all 17 samples tested, the newly developed primers could differentiate genotype A from genotype B, and all matched those obtained by nucleotide sequencing of the capsid regions. The nested PCR method using genotype-specific primers is useful and can be used for genotyping of Aichi viruses isolated from epidemiological studies.

  17. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  20. New specific primers for amplification of the Internal Transcribed Spacer region in Clitellata (Annelida)

    OpenAIRE

    Liu, Yingkui; Erséus, Christer

    2017-01-01

    Abstract Nuclear molecular evidence, for example, the rapidly evolving Internal Transcribed Spacer region (ITS), integrated with maternally inherited (mitochondrial) COI barcodes, has provided new insights into the diversity of clitellate annelids. PCR amplification and sequencing of ITS, however, are often hampered by poor specificity of primers used. Therefore, new clitellate‐specific primers for amplifying the whole ITS region (ITS: 29F/1084R) and a part of it (ITS2: 606F/1082R) were devel...

  1. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  2. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  3. GSP: a web-based platform for designing genome-specific primers in polyploids.

    Science.gov (United States)

    Wang, Yi; Tiwari, Vijay K; Rawat, Nidhi; Gill, Bikram S; Huo, Naxin; You, Frank M; Coleman-Derr, Devin; Gu, Yong Q

    2016-08-01

    The sequences among subgenomes in a polyploid species have high similarity, making it difficult to design genome-specific primers for sequence analysis. We present GSP, a web-based platform to design genome-specific primers that distinguish subgenome sequences in a polyploid genome. GSP uses BLAST to extract homeologous sequences of the subgenomes in existing databases, performs a multiple sequence alignment, and design primers based on sequence variants in the alignment. An interactive primers diagram, a sequence alignment viewer and a virtual electrophoresis are displayed as parts of the primer design result. GSP also designs specific primers from multiple sequences uploaded by users. GSP is a user-friendly and efficient web platform freely accessible at http://probes.pw.usda.gov/GSP Source code and command-line application are available at https://github.com/bioinfogenome/GSP CONTACTS: yong.gu@ars.usda.gov or devin.coleman-derr@ars.usda.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Discrimination of reproductive forms of Thrips tabaci (Thysanoptera: Thripidae) by PCR with sequence specific primers.

    Science.gov (United States)

    Kobayashi, Kazuya; Hasegawa, Eisuke

    2012-04-01

    In agriculture, although it is important to identify species of pest insects, the morphological identification is often difficult. DNA genotyping is useful for the identification of species in morphologically indiscriminable species. Thrips tabaci (Lindeman) can be divided into two reproductive forms (arrhenotoky and thelytoky, each of which different in pesticide resistance) but morphological discrimination is not possible. Here, we establish a simple method to discriminate the strains based on their mitochondrial DNA sequences. Phylogenetic analysis including the T. tabaci and congeneric species provided ancestor sequences of each strain of T tabaci. Based on the ancestor sequences, we developed a primer set that include strain specific primers on sense strand and common primer on anti sense strand. Using this primer set, the strains of 196 individuals of T. tabaci were successfully assigned to each ofgenotypic forms. As the phylogeny and ancestor sequences were based on worldwide samples, this method will work well on most populations around the world.

  5. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera, Susanna; Busk, Peter Kamp

    2011-01-01

    Background MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... settings. Results We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  6. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    Science.gov (United States)

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  7. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  8. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  9. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  10. Identification of sex in Cetaceans by multiplexing with three ZFX and ZFY specific primers

    NARCIS (Netherlands)

    Berube, M; Palsboll, P

    We sequenced 540 nucleotides of the last exon in the ZFY/ZFX gene in two males and two females for eight cetacean species; four odontocetes (toothed whales) and four mysticetes (baleen whales). Based upon the obtained nucleotide sequences, we designed two sets of oligonucleotide primers for specific

  11. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  12. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    Science.gov (United States)

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  13. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  14. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers.

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-Yue; Gao, Zi-Tong; Han, Jian-Ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  15. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  16. In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp.

    Directory of Open Access Journals (Sweden)

    Henriques Ana

    2012-11-01

    Full Text Available Abstract Background Bacterial vaginosis (BV is a common pathology of women in reproductive age that can lead to serious health complications, and is associated with shifts in the normal microflora from predominance of Lactobacillus spp. to a proliferation of other anaerobes such as G. vaginalis and A vaginae, which can be detected by PCR. The optimal PCR pathogen detection assay relies mainly on the specificity and sensitivity of the primers used. Findings Here we demonstrate that in silico analytical testing of primer specificity is not a synonym to in vitro analytical specificity by testing a range of published and newly designed primers with both techniques for the detection of BV-associated microorganisms. Conclusions By testing primer in vitro specificity with a sufficient range of bacterial strains, we were able to design primers with higher specificity and sensitivity. Also by comparing the results obtained for the newly designed primers with other previously published primers, we confirmed that in silico analysis is not sufficient to predict in vitro specificity. As such care must be taken when choosing the primers for a detection assay.

  17. Identification of species Leucochloridium paradoxum and L. perturbatum (Trematoda) based on rDNA sequences.

    Science.gov (United States)

    Zhukova, A; Prokhorova, E E; Tokmakova, A S; Tsymbalenko, N V; Ataev, G L

    2014-01-01

    The full nucleotide sequences of DNA ribosome cluster of Leucochloridium paradoxum Carus, 1835 and L. perturbatum Pojmanska, 1967 were obtained. rDNA was extracted from 40 isolates of Leucochloridium sp. and analyzed using specific primers. The intraspecific genetically identity of morphologically detected L. paradoxum and L. perturbatum sporocysts was proven. A noticeable interspecific divergence between L. paradoxum and L. perturbatum was indicated. Using rDNA genotyping a case of double infection of snail Succinea sp. with L. paradoxum and L. perturbatum sporocysts was detected.

  18. Degenerate PCR primer design for the specific identification of rhinovirus C.

    Science.gov (United States)

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    Science.gov (United States)

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing. © 2010 Blackwell Publishing Ltd.

  20. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. © 2015 John Wiley & Sons Ltd.

  1. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers.

    Science.gov (United States)

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-10-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. © 2013 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    constructed based on fungal ITS gene sequences obtained using fungal specific primer set ITS1F/ITS4. Topology was built using Mega v.5.03 from a ClustalW 1.83 alignment. Numbers below branches indicate bootstrap values (>50 %) from 1,000 replicates. New...S rDNA gene sequences obtained using universal fungal 18S rDNA primer set, NS1/NS2. Topology was built using Mega v.5.03 from a ClustalW 1.83 alignment. Numbers below branches indicate bootstrap values (>50 %) from 1,000 replicates. New sequence...

  3. PCR primers specific for the genus Tuber reveal the presence of several truffle species in a truffle-ground.

    Science.gov (United States)

    Zampieri, Elisa; Mello, Antonietta; Bonfante, Paola; Murat, Claude

    2009-08-01

    Truffles are hypogeous Ascomycete fungi belonging to the genus Tuber and forming fruiting bodies highly prized for their taste and aroma. The identification of the genus Tuber and its species is important to investigate their ecology and avoid fraud in the food market. As genus-specific primers are not available, the aims of this work were (1) to assess the usefulness of the beta-tubulin gene as a DNA barcoding region for designing Tuber genus-specific primers, (2) to test the primers on a range of fruiting bodies, representing a large part of truffle biodiversity and (3) to check their ecological usefulness, applying them to truffle-ground soil. The new primers designed on the beta-tubulin gene were specific to the Tuber genus in nested PCR. When applied to DNA from soils, they gave a positive signal for 23 of 32 soils. Phylogenetic analysis confirmed that the bands corresponded to Tuber and that at least five Tuber species were present in the truffle-ground. beta-tubulin was found to be a good barcoding region for designing Tuber genus-specific primers, detecting a high Tuber diversity in a natural environment. These primers will be useful for understanding truffle ecology and for practical needs in plantation management.

  4. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    by this method have been distributed to several labs and used successfully in published studies. Conclusions The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...

  5. Assessing the effects of primer specificity on eliminating numt coamplification in DNA barcoding: a case study from Orthoptera (Arthropoda: Insecta).

    Science.gov (United States)

    Moulton, Matthew J; Song, Hojun; Whiting, Michael F

    2010-07-01

    DNA barcoding is a diagnostic method of species identification based on sequencing a short mitochondrial DNA fragment of cytochrome oxidase I (COI), but its ability to correctly diagnose species is limited by the presence of nuclear mitochondrial pseudogenes (numts). Numts can be coamplified with the mitochondrial orthologue when using universal primers, which can lead to incorrect species identification and an overestimation of the number of species. Some researchers have proposed that using more specific primers may help eliminate numt coamplification, but the efficacy of this method has not been thoroughly tested. In this study, we investigate the taxonomic distribution of numts in 11 lineages within the insect order Orthoptera, by analysing cloned COI sequences and further test the effects of primer specificity on eliminating numt coamplification in four lineages. We find that numts are coamplified in all 11 taxa using universal (barcoding) primers, which suggests that numts may be widespread in other taxonomic groups as well. Increased primer specificity is only effective at reducing numt coamplification in some species tested, and only eliminates it in one species tested. Furthermore, we find that a number of numts do not have stop codons or indels, making it difficult to distinguish them from mitochondrial orthologues, thus putting the efficacy of barcoding quality control measures under question. Our findings suggest that numt coamplification is a serious problem for DNA barcoding and more quality control measures should be implemented to identify and eliminate numts prior to using mitochondrial barcodes for species diagnoses. © 2009 Blackwell Publishing Ltd.

  6. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    Science.gov (United States)

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  7. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  8. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    Science.gov (United States)

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

  9. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment

    Directory of Open Access Journals (Sweden)

    Petra Pjevac

    2017-08-01

    Full Text Available Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers (“comammox”, which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared

  10. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment.

    Science.gov (United States)

    Pjevac, Petra; Schauberger, Clemens; Poghosyan, Lianna; Herbold, Craig W; van Kessel, Maartje A H J; Daebeler, Anne; Steinberger, Michaela; Jetten, Mike S M; Lücker, Sebastian; Wagner, Michael; Daims, Holger

    2017-01-01

    Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers ("comammox"), which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants) and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm) detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared to canonical ammonia

  11. Hyper-variable regions in 18S rDNA of Strongyloides spp. as markers for species-specific diagnosis.

    Science.gov (United States)

    Hasegawa, Hideo; Hayashida, Shotaro; Ikeda, Yatsukaho; Sato, Hiroshi

    2009-03-01

    Four hyper-variable regions (HVR-I to -IV) found in 18S ribosomal DNA sequences were compared among 34 isolates of 15 species of the genus Strongyloides to evaluate their diagnostic value. HVR-I to -III were short, and plural species exhibit the same nucleotide arrangement. Meanwhile, HVR-IV had 23 to 39 nucleotides, showing species-specific arrangements, except Strongyloides ransomi and Strongyloides venezuelensis, which had the same nucleotide sequence in HVR-IV but were readily distinguished by the difference in HVR-I and -III. Isolates of Strongyloides stercoralis from humans of USA, Japan, and Philippines, chimpanzees, and dogs had an identical sequence in this region. Meanwhile, intraspecific polymorphism in HVR-IV nucleotide arrangement was observed among isolates of Strongyloides fuelleborni and Strongyloides callosciureus, presumably reflecting process of geographical dispersal and adaptation to the hosts.

  12. New primers for the class Actinobacteria: application to marine and terrestrial environments.

    Science.gov (United States)

    Stach, James E M; Maldonado, Luis A; Ward, Alan C; Goodfellow, Michael; Bull, Alan T

    2003-10-01

    In this study, we redesigned and evaluated primers for the class Actinobacteria. In silico testing showed that the primers had a perfect match with 82% of genera in the class Actinobacteria, representing a 26-213% improvement over previously reported primers. Only 4% of genera that displayed mismatches did so in the terminal three bases of the 3' end, which is most critical for polymerase chain reaction success. The primers, designated S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, amplified an approximately 640 bp stretch of the 16S rRNA gene from all actinobacteria tested (except Rubrobacter radiotolerans) up to an annealing temperature of 72 degrees C. An Actinobacteria Amplification Resource (http://microbe2.ncl.ac.uk/MMB/AAR.htm) was generated to provide a visual guide to aid the amplification of actinobacterial 16S rDNA. Application of the primers to DNA extracted from marine and terrestrial samples revealed the presence of actinobacteria that have not been described previously. The use of 16S rDNA similarity and DNA-DNA pairing correlations showed that almost every actinomycete clone represented either a new species or a novel genus. The results of this study reinforce the proposition that current culture-based techniques drastically underestimate the diversity of Actinobacteria in the environment and highlight the need to evaluate taxon-specific primers regularly in line with improvements in databases holding 16S rDNA sequences.

  13. Sensitive and specific detection of Xanthomonas campestris pv. vesicatoria by PCR using pathovar-specific primers based on rhs family gene sequences.

    Science.gov (United States)

    Park, Dong Suk; Shim, Jae Kyung; Kim, Jung Sun; Lim, Chun Keun; Shrestha, Rosemary; Hahn, Jang Ho; Kim, Hong Gi

    2009-01-01

    The present study describes PCR assay to detect bacterial spot caused by Xanthomonas campestris pv. vesicatoria in pepper and tomato. One set of PCR primer was developed to amplify gene required for an rhs family gene homologous to rhsA, cell envelope biogenesis, outer membrane. Only a PCR product of a 517bp was produced in PCR reaction with the Xanthomonas campestris pv. vesicatoria (XCVF/XCVR) primer set. A specific, and highly sensitive and rapid PCR assay for the detection of X. campestris pv. vesicatoria was achieved. The protocol can be used as a reliable diagnostic tool for specific detection of X. campestris pv. vesicatoria in pepper or tomato.

  14. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  15. Development of species-specific primers for identification of Biomphalaria arabica, the intermediate host of Schistosoma mansoni in Saudi Arabia.

    Science.gov (United States)

    Al-Quraishy, Saleh A; Bin Dajem, Saad M; Mostafa, Osama M; Ibrahim, Essam H; Al-Qahtani, Ahmed

    2014-01-01

    Schistosoma mansoni is mediated through the intermediate host Biomphalaria arabica which lives in Saudi Arabia. Molecular characterization and identification of this intermediate host are important for epidemiological studies of schistosomiasis. The present work aimed to determine the molecular variations among the populations of B. arabica found in Southern part of Saudi Arabia, and to develop species-specific primers for identification of these snails as a first step in the development of multiplex PCR for simultaneously identifying the snails and diagnosing its infections in a single step. Five populations of Saudi B. arabica snails were collected from freshwater bodies. Three populations were collected from Asser and two populations were collected from AL-Baha. Genomic DNA was extracted from snails and was amplified using five different RAPD-PCR primers. The banding patterns of amplified materials by primers P1 and P5 were identical in all populations. However, the rest primers displayed intra-specific differences among populations with variable degrees. Largest sizes of RAPD-PCR products were cloned into TA cloning vector as a preparatory step for DNA sequence analysis. After sequencing, similarity searches of obtained DNA sequences revealed that there are no similar sequences submitted to genebank data bases and its associated banks. The results obtained will be helpful in the development of simultaneous identification of B. arabica snails and diagnosis of S. mansoni infection within it in a single step by an implementation of multiplex PCR.

  16. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  17. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    Science.gov (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  18. A blocking primer increases specificity in environmental DNA detection of bull trout (Salvelinus confluentus)

    Science.gov (United States)

    Taylor M. Wilcox; Michael K. Schwartz; Kevin S. McKelvey; Michael K. Young; Winsor H. Lowe

    2014-01-01

    Environmental DNA (eDNA) is increasingly applied as a highly sensitive way to detect aquatic animals non-invasively. However, distinguishing closely related taxa can be particularly challenging. Previous studies of ancient DNA and genetic diet analysis have used blocking primers to enrich target template in the presence of abundant, non-target DNA. Here we apply a...

  19. Improvement of the repetitive sequence-based identification and genotyping of Candida albicans using ALT-specific primers.

    Science.gov (United States)

    Hattori, Hisao; Tanaka, Reiko; Chibana, Hiroji; Kawamoto, Fumihiko; Adachi, Hidesada; Shimizu, Kazue; Kanbe, Toshio

    2009-05-01

    The nucleotide sequences of the inner repeats of the repetitive sequence (RPS), termed ALTs, of Candida albicans and its related species C. albicans var. stellatoidea and C. dubliniensis, were analyzed. ALT sequences were grouped into 4 types for C. albicans (Aa, Ab, Ac and Ad) and C. albicans var. stellatoidea (Sa1, Sa2, Sb, Sc and Sd), and 3 types for C. dubliniensis (Da, Db and Dc). In addition to the primer set P-II (specific to RPS), 2 primer sets (AS-I and AiR-I) specific to the nucleotide sequences of C. albicans ALT were designed and tested for their potential for RPS-based identification/genotyping of C. albicans. PCRs using AS-I and AiR-I clearly distinguished C. albicans from both C. albicans var. stellatoidea and C. dubliniensis. Furthermore, the strains of C. albicans that showed similar electrophoretic patterns in the PCR using P-II were discriminated at the subtype level. These results indicate that the PCRs using RPS- and ALT-specific primer sets are useful as simple and rapid systems for the specific identification and genotyping of C. albicans.

  20. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    Science.gov (United States)

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Identification of Nile perch (Lates niloticus), grouper (Epinephelus guaza), and wreck fish (Polyprion americanus) fillets by PCR amplification of the 5S rDNA gene.

    Science.gov (United States)

    Asensio, L; González, I; Fernández, A; Céspedes, A; Rodríguez, M A; Hernández, P E; García, T; Martín, R

    2001-01-01

    Nile perch (Lates niloticus), grouper (Epinephelus guaza), and wreck fish (Polyprion americanus) were differentiated by polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene. The design of 3 species-specific primers complementary to the nontranscribed intergenic spacer region from the 5S rDNA molecule allowed amplification of clearly distinguishable gene fragments in each fish species. This approach is rapid and reliable and offers the potential to detect fraudulent or unintentional mislabeling of these species in routine seafood authentication analysis.

  2. Development of amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot.

    Science.gov (United States)

    Casasnovas, F; Fantini, E N; Palazzini, J M; Giaj-Merlera, G; Chulze, S N; Reynoso, M M; Torres, A M

    2013-06-01

    The objective of this work was to design an amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot (PBRR) in plant material and soil. Specific primers for the detection of the pathogen were designed based on an amplified region using AFLPs. The banding patterns by AFLPs showed that isolates from diseased roots were clearly distinguishable from others members of the F. solani species complex. Many bands were specific to F. solani PBRR, one of these fragments was selected and sequenced. Sequence obtained was used to develop specific PCR primers for the identification of pathogen in pure culture and in plant material and soil. Primer pair FS1/FS2 amplified a single DNA product of 175 bp. Other fungal isolates occurring in soil, included F. solani non-PBRR, were not detected by these specific primers. The assay was effective for the detection of pathogen from diseased root and infected soils. The designed primers for F. solani causing PBRR can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen. These diagnostic PCR primers will aid the detection of F. solani causing PBRR in diseased root and natural infected soils. The method developed could be a helpful tool for epidemiological studies and to avoid the spread of this serious disease in new areas. © 2013 The Society for Applied Microbiology.

  3. A set of plastid DNA-specific universal primers for flowering plants.

    Science.gov (United States)

    Haider, N; Wilkinson, M J

    2011-09-01

    MatKand rbcL are recommended as the official barcode loci for higher plants but there remains a need for additional universal markers. We generated a series of 84 new universal primers targeting 42 plastid loci that all yielded single amplicons when applied to DNA templates from 19 diverse higher plant families. Marker utility ultimately depends on sequence variability, with rapidly evolving loci being useful for barcoding or biogeographic applications and more conserved loci being better suited to deep phylogeny reconstruction. Whereas excessive size variation is undesirable for many applications, modest size variability caused by indels and the sequence variation frequently associated with indels are highly desirable. We therefore performed a quick screen of the markers for size and sequence variation using pooled DNA templates from 96 taxonomically diverse species. All markers produced little or no size variation (consistent with the presence of minor indels). The seven regions exhibiting most size variation in pooled (rpl23&rpl2.1, 16S, 23S, 4.5S&5S, petB&D, and rpl2, rpoCl and trnK introns) were then amplified for all species individually, confirming the pooled template results. When the most variable loci (introns of trnK and rpoC1) were sequenced for all 96 species, a high level of sequence variation (nucleotide substitutions and indels) was observed among congeneric species groups for both loci. Both markers therefore have potential as supplementary barcode markers.

  4. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    Directory of Open Access Journals (Sweden)

    Roger Meisal

    Full Text Available Sensitive and specific genotyping of human papillomaviruses (HPVs is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  5. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    OpenAIRE

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes fro...

  6. Detection and identification of Trypanosoma of African livestock through a single PCR based on internal transcribed spacer 1 of rDNA.

    Science.gov (United States)

    Desquesnes, M; McLaughlin, G; Zoungrana, A; Dávila, A M

    2001-05-01

    Primers hybridising with the rDNA cistron have previously been evaluated for PCR diagnosis specific for kinetoplastids, and shown to detect and differentiate the Trypanosoma brucei complex and Trypanosoma cruzi. Kin1 and Kin2 primers, amplifying internal transcribed spacer 1, were subsequently evaluated for the diagnosis of African livestock trypanosomosis. Based on the size of the PCR products obtained, Kin primers allowed detection and identification of three Trypanosoma congolense types (savannah, forest and Kenya Coast), with distinction among themselves and from the subgenus Trypanozoon (T. brucei spp., Trypanosoma evansi and Trypanosoma equiperdum), Trypanosoma vivax, Trypanosoma simiae and Trypanosoma theileri. These primers were shown to be suitable for the sensitive and type-specific diagnosis of African livestock trypanosome isolates through a single PCR even in the case of multi-taxa samples. With field samples (buffy-coat from cattle blood) sensitivity was close to the sensitivity observed in single reactions with the classical specific primers for the Trypanozoon subgenus and T. congolense-type savannah, but was lower for detection of T. vivax. Additional reaction, improvement of DNA preparation, and/or new primers design are necessary to improve the sensitivity for detection of T. vivax in field samples. However, these primers are suitable for isolate typing through a single PCR.

  7. Sensitive and specific detection of Xanthomonas campestris pv campestris by PCR using species-specific primers based on hrpF gene sequences.

    Science.gov (United States)

    Park, Young Jin; Lee, Byoung Moo; Ho-Hahn, Jang; Lee, Gil Bok; Park, Dong Suk

    2004-01-01

    A sensitive and specific assay was developed to detect bacterial black rot of crucifers caused by Xanthomonas campestris pv. campestris (X. c. pv. campestris), in cabbage seed and plant. Primers XCF and XCR from hrpF homologous to nolX, host recognition protein, were used to amplify a 525 bp DNA fragment. PCR technique was applied to detect the pathogen in naturally infected seed and plant of cabbage. The PCR product was only produced from X. c. pv. campestris among 40 isolates of Xanthomonas strains, Escherichia coli (O157:H7), Pectobacterium carotovorum subsp. carotovorum, and other reference bacteria.

  8. Agronomically important thrips: development of species-specific primers in multiplex PCR and microarray assay using internal transcribed spacer 1 (ITS1) sequences for identification.

    Science.gov (United States)

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2015-02-01

    Thrips, the sole vector of plant Tospovirus, are major pests of many agricultural crops throughout the world. Molecular approaches have been applied in recent decades to identify these minute and morphologically difficult to distinguish insects. In this study, sequences of internal transcribed spacer 1 (ITS1) region of 15 agronomically important thrips, including several virus transmission species, have been analyzed in order to design species-specific primers for multiplex PCR and probes for microarray assay. That the ITS1 sequence distances within species were smaller than those among species suggests that the ITS1 fragment can be used for thrips species identification. The specificity and stability of these primers, combined with universal paired primers, were tested and verified in multiplex PCR. Using these specific primers as probes, microarray assay showed that PCR products of all thrips species hybridized consistently to their corresponding probes, though some signals were weak. We have demonstrated that multiplex PCR using specific primers based on ITS1 sequences is a simple, reliable, and cost-effective diagnostic tool for thrips species identification. Moreover, the DNA microarray assay is expected to extend into a reliable high-throughput screening tool for the vast numbers of thrips.

  9. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... 4ICARDA-INRA Collaborative Research Project, International Center for Agricultural research in the Dry Areas ... and suitable for the detection of HVA1 DNA by conventional and real-time PCR. ... considered as highly specific for the detection of both DNA and mRNA of the HVA1 by real-time PCR.

  10. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    Science.gov (United States)

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments.

  11. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    Science.gov (United States)

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  12. [Analysis of bacterial diversity of kefir grains by denaturing gradient gel electrophoresis and 16S rDNA sequencing].

    Science.gov (United States)

    Wang, Yin-Yu; Li, Hui-Rong; Jia, Shi-Fang; Wu, Zheng-Jun; Guo, Ben-Heng

    2006-04-01

    Kefir is an acidic, mildly alcoholic dairy beverage produced by the fermentation of milk with a grain-like starter culture. These grains usually contain a relatively stable and specific balance of microbes that exist in a complex symbiotic relationship. Kefir grains can be considered a probiotic source as it presents anti-bacterial, anti-mycotic, anti-neoplasic and immunomodulatory properties. The microorganisms in Kefir grains are currently identified by traditional methods such as growth on selective media, morphological and biochemical characteristics. However, the microorganisms that isolate by these methods can not revert to Kefir grains which indicate that there are some other bacteria that are not isolate from it. In this study, PCR-based Denaturing gradient gel electrophoresis(DGGE) and sequence analysis of 16S ribosomal RNA gene (16S rDNA) clone libraries was used for the rapid and accurate identification of microorganisms from Kefir grains. The PCR primers were designed from conserved nucleotide sequences on region V3 of 16S rDNA with GC rich clamp at the 5'-end. PCR was performed using the primers and genomic DNAs of Kefir grains bacteria. The generated region V3 of 16S rDNA fragments were separated by denaturing gel, and the dominant 16S rDNA bands were cloned, sequenced and subjected to an online similarity search. Research has shown that regions V3 of 16S rDNAs have eight evident bands on the DGGE gel. The sequence analysis of these eight bands has indicated that they belong to different four genera, among them three sequences are similar to Sphingobacterium sp. whose similarities with database sequences are over 98%, three sequences are similar to Lactobacillus sp. whose similarities with database sequences are over 96%, the other two sequence are similar to Enterobacter sp., and Acinetobacter sp. whose similarities with database sequences are over 99% respectively. Although the DGGE method may have a lower sensitivity than the ordinary PCR methods

  13. Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

    Science.gov (United States)

    Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

    2014-07-01

    In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Evaluation of strain-specific primers for identification of Lactobacillus rhamnosus GG.

    Science.gov (United States)

    Endo, Akihito; Aakko, Juhani; Salminen, Seppo

    2012-12-01

    Lactobacillus rhamnosus strain GG (ATCC 53103) is one of the most widely studied and commercialized probiotic strains, and thus strain-specific identification for the strain is highly valuable. In this study, two published PCR-based identification methods for strain GG, a transposase gene-targeting system and a phage-related gene-targeting system, were evaluated. The former produced amplicons from eight of the 41 strains tested and the phage-related system from five of the tested strains, including the strain GG. Fingerprinting analysis indicated that the strains LMG 18025, LMG 18030, and LMG 18038, which had an amplicon by the former system but none by the latter, were genetically distinguishable from L. rhamnosus GG at strain level. Strains LMG 23320, LMG 23325, LMG 23534, and LMG 25859 showed profiles very similar to that of the strain GG, suggesting that these strains might be identical to GG or derivative strains of it. The results here indicated that the phage-related gene-targeting system is a good tool for accurate identification of L. rhamnosus GG. This system would be able to detect both the original L. rhamnosus GG and its derivative strains. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. Use of specific PCR primers to identify three important industrial species of Saccharomyces genus: Saccharomyces cerevisiae, Saccharomyces bayanus and Saccharomyces pastorianus.

    Science.gov (United States)

    de Melo Pereira, G V; Ramos, C L; Galvão, C; Souza Dias, E; Schwan, R F

    2010-08-01

    To develop species-specific primers capable of distinguishing between three important yeast species in alcoholic fermentation: Saccharomyces bayanus, Saccharomyces cerevisiae and Saccharomyces pastorianus. Two sets of primers with sequences complementary to the HO genes from Saccharomyces sensu stricto species were used. The use of the ScHO primers produced a single amplificon of c. 400 or 300 bp with species S. cerevisiae and S. pastorianus, respectively. The second pair of primers (LgHO) was also constructed, within the HO gene, composed of perfectly conserved sequences common for S. bayanus species, which generate amplicon with 700 bp. No amplification product was observed in the DNA samples from non-Saccharomyces yeasts. Saccharomyces species have also been characterized via electrophoretic karyotyping using pulsed-field gel electrophoresis to demonstrate chromosomal polymorphisms and to determine the evolutionary distances between these species. We conclude that our novel species-specific primers could be used to rapidly and accurately identify of the Saccharomyces species most commonly involved in fermentation processes using a PCR-based assay. The method may be used for routine identification of the most common Saccharomyces sensu stricto yeasts involved in industrial fermentation processes in less than 3 h.

  16. Improved DNA barcoding method for Bemisia tabaci and related Aleyrodidae: development of universal and Bemisia tabaci biotype-specific mitochondrial cytochrome c oxidase I polymerase chain reaction primers.

    Science.gov (United States)

    Shatters, Robert G; Powell, Charles A; Boykin, Laura M; Liansheng, He; McKenzie, C L

    2009-04-01

    Whiteflies, heteropterans in the family Aleyrodidae, are globally distributed and severe agricultural pests. The mitochondrial cytochrome c oxidase I (mtCOI) sequence has been used extensively in whitefly phylogenetic comparisons and in biotype identification of the agriculturally important Bemisia tabaci (Gennadius) whitefly. Because of the economic importance of several whitefly genera, and the invasive nature of the B and the Q biotypes of Bemisia tabaci, mtCOI sequence data are continually generated from sampled populations worldwide. Routine phylogenetic comparisons and biotype identification is done through amplification and sequencing of an approximately 800-bp mtCOI DNA fragment. Despite its routine use, published primers for amplification of this region are often inefficient for some B. tabaci biotypes and especially across whitefly species. Through new sequence generation and comparison to available whitefly mtCOI sequence data, a set of polymerase chain reaction (PCR) amplification primers (Btab-Uni primers) were identified that are more efficient at amplifying approximately 748 bp of the approximately 800-bp fragment currently used. These universal primers amplify an mtCOI fragment from numerous B. tabaci biotypes and whitefly genera by using a single amplification profile. Furthermore, mtCOI PCR primers specific for the B, Q, and New World biotypes of B. tabaci were designed that allow rapid discrimination among these biotypes. These primers produce a 478-, 405-, and 303-bp mtCOI fragment for the B, New World, and Q biotypes, respectively. By combining these primers and using rapid PCR and electrophoretic techniques, biotype determination can be made within 3 h for up to 96 samples at a time.

  17. Visual System Homeobox 1 (VSX1) Gene Analysis in Keratoconus: Design of Specific Primers and DNA Amplification Protocols for Accurate Molecular Characterization.

    Science.gov (United States)

    Ng, Jun B; Poh, Rozaida Y Y; Lee, Kenneth R; Subrayan, Visvaraja; Deva, Jenny P; Lau, Amy Y L; Tan, Jin A M A

    2016-09-01

    Keratoconus is an ocular degeneration characterized by the thinning of corneal stroma that may lead to varying degrees of myopia and visual impairment. Genetic factors have been reported in the pathology of keratoconus where Asians have a higher incidence, earlier onset, and undergo earlier corneal grafts compared to Caucasians. The visual system homeobox 1 (VSX1) gene forms part of a paired-like homeodomain transcription factor which is responsible for ocular development. The gene was marked as a candidate in genetic studies of keratoconus in various populations. Single nucleotide polymorphisms (SNPs) in the VSX1 gene have been reported to be associated with keratoconus. The detection of the SNPs involves DNA amplification of the VSX1 gene followed by genomic sequencing. Thus, the objective of this study aims to establish sensitive and accurate screening protocols for the molecular characterization of VSX1 polymorphisms. Keratoconic (n = 74) and control subjects (n = 96) were recruited based on clinical diagnostic tests and selection criteria. DNA extracted from the blood samples was used to genotype VSX1 polymorphisms. In-house designed primers and optimization of PCR conditions were carried out to amplify exons 1 and 3 of the VSX1 gene. PCR conditions including percentage GC content, melting temperatures, and differences in melting temperatures of primers were evaluated to produce sensitive and specific DNA amplifications. Genotyping was successfully carried out in 4 exons of the VSX1 gene. Primer annealing temperatures were observed to be crucial in enhancing PCR sensitivity and specificity. Annealing temperatures were carefully evaluated to produce increased specificity, yet not allowing sensitivity to be compromised. In addition, exon 1 of the VSX1 gene was amplified using 2 different sets of primers to produce 2 smaller amplified products with absence of non-specific bands. DNA amplification of exons 1 and 3 consistently showed single band products which

  18. Sensitive and specific detection of Xanthomonas campestris pv. pelargonii with DNA primers and probes identified by random amplified polymorphic DNA analysis.

    Science.gov (United States)

    Manulis, S; Valinsky, L; Lichter, A; Gabriel, D W

    1994-11-01

    The random amplified polymorphic DNA method was used to distinguish strains of Xanthomonas campestris pv. pelargonii from 21 other Xanthomonas species and/or pathovars. Among the 42 arbitrarily chosen primers evaluated, 3 were found to reveal diagnostic polymorphisms when purified DNAs from compared strains were amplified by the PCR. The three primers revealed DNA amplification patterns which were conserved among all 53 strains tested of X. campestris pv. pelargonii isolated from various locations worldwide. The distinctive X. compestris pv. pelargonii patterns were clearly different from those obtained with any of 46 other Xanthomonas strains tested. An amplified 1.2-kb DNA fragment, apparently unique to X. campestris pv. pelargonii by these random amplified polymorphic DNA tests, was cloned and evaluated as a diagnostic DNA probe. It hybridized with total DNA from all 53 X. campestris pv. pelargonii strains tested and not with any of the 46 other Xanthomonas strains tested. The DNA sequence of the terminal ends of this 1.2-kb fragment was obtained and used to design a pair of 18-mer oligonucleotide primers specific for X. campestris pv. pelargonii. The custom-synthesized primers amplified the same 1.2-kb DNA fragment from all 53 X. campestris pv. pelargonii strains tested and failed to amplify DNA from any of the 46 other Xanthomonas strains tested. DNA isolated from saprophytes associated with the geranium plant also did not produce amplified DNA with these primers. The sensitivity of the PCR assay using the custom-synthesized primers was between 10 and 50 cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  20. High-Affinity LNA-DNA Mixmer Probes for Detection of Chromosome-Specific Polymorphisms of 5S rDNA Repeats in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Probst, Aline V

    2018-01-01

    Fluorescence in situ hybridization is a standard technique to visualize specific DNA sequences by hybridization with fluorescent probes and, most commonly, relies on DNA probes generated by nick translation. In this chapter, we describe the use of directly labeled LNA-DNA mixmer probes for the rapid detection of repetitive sequences on Arabidopsis thaliana nuclei spreads. We further demonstrate that due to the high thermal stability of the heteroduplexes and the resulting elevated binding affinity of LNA-DNA mixmer probes for their target DNA, these probes can be used to discriminate between repetitive sequences differing by only a few single nucleotide polymorphisms.

  1. Accurate Estimation of Fungal Diversity and Abundance through Improved Lineage-Specific Primers Optimized for Illumina Amplicon Sequencing.

    Science.gov (United States)

    Taylor, D Lee; Walters, William A; Lennon, Niall J; Bochicchio, James; Krohn, Andrew; Caporaso, J Gregory; Pennanen, Taina

    2016-12-15

    While high-throughput sequencing methods are revolutionizing fungal ecology, recovering accurate estimates of species richness and abundance has proven elusive. We sought to design internal transcribed spacer (ITS) primers and an Illumina protocol that would maximize coverage of the kingdom Fungi while minimizing nontarget eukaryotes. We inspected alignments of the 5.8S and large subunit (LSU) ribosomal genes and evaluated potential primers using PrimerProspector. We tested the resulting primers using tiered-abundance mock communities and five previously characterized soil samples. We recovered operational taxonomic units (OTUs) belonging to all 8 members in both mock communities, despite DNA abundances spanning 3 orders of magnitude. The expected and observed read counts were strongly correlated (r = 0.94 to 0.97). However, several taxa were consistently over- or underrepresented, likely due to variation in rRNA gene copy numbers. The Illumina data resulted in clustering of soil samples identical to that obtained with Sanger sequence clone library data using different primers. Furthermore, the two methods produced distance matrices with a Mantel correlation of 0.92. Nonfungal sequences comprised less than 0.5% of the soil data set, with most attributable to vascular plants. Our results suggest that high-throughput methods can produce fairly accurate estimates of fungal abundances in complex communities. Further improvements might be achieved through corrections for rRNA copy number and utilization of standardized mock communities. Fungi play numerous important roles in the environment. Improvements in sequencing methods are providing revolutionary insights into fungal biodiversity, yet accurate estimates of the number of fungal species (i.e., richness) and their relative abundances in an environmental sample (e.g., soil, roots, water, etc.) remain difficult to obtain. We present improved methods for high-throughput Illumina sequencing of the species

  2. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  3. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  4. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    National Research Council Canada - National Science Library

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L.A.I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; Diepeningen, A.D. van; Dolatabadi, S; Moreno, L.F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M.P; Deng, S; Groenewald, J.Z; Boekhout, T; Beer, Z.W. de; Barnes, I; Duong, T.A; Wingfield, M.J; Hoog, G.S. de; Crous, P.W; Lewis, C.T; Hambleton, S; Moussa, T.A.A; Al-Zahrani, H.S; Almaghrabi, O.A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; Vries, M. de; Robert, V

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode...

  5. rDNA Loci Evolution in the Genus Glechoma (Lamiaceae).

    Science.gov (United States)

    Jang, Tae-Soo; McCann, Jamie; Parker, John S; Takayama, Koji; Hong, Suk-Pyo; Schneeweiss, Gerald M; Weiss-Schneeweiss, Hanna

    2016-01-01

    Glechoma L. (Lamiaceae) is distributed in eastern Asia and Europe. Understanding chromosome evolution in Glechoma has been strongly hampered by its small chromosomes, constant karyotype and polyploidy. Here phylogenetic patterns and chromosomal variation in Glechoma species are considered, using genome sizes, chromosome mapping of 5S and 35S rDNAs by fluorescence in situ hybridisation (FISH), and phylogenetic analyses of internal transcribed spacers (nrITS) of 35S rDNA and 5S rDNA NTS sequences. Species and populations of Glechoma are tetraploid (2n = 36) with base chromosome number of x = 9. Four chromosomes carry pericentric 5S rDNA sites in their short arms in all the species. Two to four of these chromosomes also carry 35S rDNA in subterminal regions of the same arms. Two to four other chromosomes have 35S rDNA sites, all located subterminally within short arms; one individual possessed additional weak pericentric 35S rDNA signals on three other chromosomes. Five types of rDNA locus distribution have been defined on the basis of 35S rDNA variation, but none is species-specific, and most species have more than one type. Glechoma hederacea has four types. Genome size in Glechoma ranges from 0.80 to 0.94 pg (1C), with low levels of intrapopulational variation in all species. Phylogenetic analyses of ITS and NTS sequences distinguish three main clades coinciding with geographical distribution: European (G. hederacea-G. hirsuta), Chinese and Korean (G. longituba), and Japanese (G. grandis). The paper presents the first comparative cytogenetic analyses of Glechoma species including karyotype structure, rDNA location and number, and genome size interpreted in a phylogenetic context. The observed variation suggests that the genus is still in genomic flux. Genome size, but not rDNA loci number and distribution, provides a character for species delimitation which allows better inferences of interspecific relationships to be made, in the absence of well

  6. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  7. Development of species-specific diagnostic primers for Zoophthora radicans and Pandora blunckii; two co-occurring fungal pathogens of the diamondback moth, Plutella xylostella.

    Science.gov (United States)

    Guzmán-Franco, Ariel W; Atkins, Simon D; Alderson, Peter G; Pell, Judith K

    2008-10-01

    Species-specific primers for Zoophthora radicans and Pandora bluckii were developed. To achieve this, partial sequences of DNA that encode for rRNA, more specifically, the ITS region (rDNA-ITS) were obtained from different isolates and analysed. Seven Z. radicans isolates (four from P. xylostella, and three from other lepidopteran hosts) and one P. blunckii isolate (from P. xylostella) were used. These isolates were selected based on PCR-RFLP patterns obtained from 22 isolates of P. blunckii and 39 isolates of Z. radicans. All P. blunckii isolates were from the same host (P. xylostella); 20 isolates were from Mexico, one from the Philippines, and one from Germany. The Z. radicans isolates were more diverse in geographical origin (Mexico, Kenya, Japan, New Zealand, Australia, Taiwan, Philippines, Malaysia, Uruguay, France, USA, Poland, Indonesia, Switzerland, Israel, China, and Denmark) and host origin (Lepidoptera, Hemiptera, Hymentoptera, and Diptera). Using conventional PCR, each pair of species-specific primers successfully detected each species of fungus from DNA extracted from infected host larvae either single- or dual-inoculated with both fungal species. The PCR-RFLP analysis also showed that Z. radicans was genetically more diverse than P. blunckii, although only a limited number of P. blunckii isolates from one country were considered. There was no direct relationship between genetic diversity and host or geographical origin. The relationship between genetic variation within both fungal species and host specificity or ecological adaptation is discussed.

  8. Improving PCR detection of prey in molecular diet studies: importance of group-specific primer set selection and extraction protocol performances.

    Science.gov (United States)

    Zarzoso-Lacoste, Diane; Corse, Emmanuel; Vidal, Eric

    2013-01-01

    While the morphological identification of prey remains in predators' faeces is the most commonly used method to study trophic interactions, many studies indicate that this method does not detect all consumed prey. Polymerase chain reaction-based methods are increasingly used to detect prey DNA in the predator food bolus and have proven efficient, delivering highly accurate results. When studying complex diet samples, the extraction of total DNA is a critical step, as polymerase chain reaction (PCR) inhibitors may be co-extracted. Another critical step involves a careful selection of suitable group-specific primer sets that should only amplify DNA from the targeted prey taxon. In this study, the food boluses of five Rattus rattus and seven Rattus exulans were analysed using both morphological and molecular methods. We tested a panel of 31 PCR primer pairs targeting bird, invertebrate and plant sequences; four of them were selected to be used as group-specific primer pairs in PCR protocols. The performances of four DNA extraction protocols (QIAamp(®) DNA stool mini kit, DNeasy(®) mericon food kit and two of cetyltrimethylammonium bromide-based methods) were compared using four variables: DNA concentration, A(260) /A(280) absorbance ratio, food compartment analysed (stomach or faecal contents) and total number of prey-specific PCR amplification per sample. Our results clearly indicate that the A(260) /A(280) absorbance ratio, which varies between extraction protocols, is positively correlated to the number of PCR amplifications of each prey taxon. We recommend using the DNeasy(®) mericon food kit (QIAGEN), which yielded results very similar to those achieved with the morphological approach. © 2012 Blackwell Publishing Ltd.

  9. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and the identification of commonly expressed haplotypes using sequence specific low- and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Fink, Dorte Rosenbek; Jungersen, Gregers

    individual. Therefore analyses of the prevalence of SLA alleles in a population are fundamental to employ pathogen-specific subunits or peptides in novel vaccines or immune diagnostics. In this study we present the use of low- and high-resolution PCR-based typing methods to identify individual and commonly...... expressed SLA class I alleles in Danish outbred swine. A total of 108 animals from eight different production herds were tested, and with low resolution sequence specific primer (SSP)-PCR typing the top five most commonly expressed SLA class I allele groups were found to be SLA-3*04XX, SLA-1*08XX, SLA-1......*07XX, SLA-2*04XX, and SLA-1*04XX, respectively. Furthermore, customized high resolution primers were designed and used to identify specific alleles within the above mentioned allele groups and within the SLA-2*05XX group. In conclusion our studies suggest the most common haplotype in Danish pigs...

  10. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    IJ. Bechara

    Full Text Available The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae. We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3' as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  11. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality.

    Directory of Open Access Journals (Sweden)

    Elvina Lee

    Full Text Available Next generation sequencing (NGS has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers, providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination.

  12. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality.

    Science.gov (United States)

    Lee, Elvina; Khurana, Maninder S; Whiteley, Andrew S; Monis, Paul T; Bath, Andrew; Gordon, Cameron; Ryan, Una M; Paparini, Andrea

    2017-01-01

    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination.

  13. Testing the Specificity of Primers to Environmental Ammonia Monooxygenase (amoA) Genes in Groundwater Treated with Urea to Promote Calcite Precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, S.; Reed, D.W.; Fujita, Y.

    2006-01-01

    Bacterial ammonia monooxygenase (amoA) genes in DNA isolated from microorganisms in groundwater were characterized by amplification of amoA DNA using polymerase chain reaction (PCR), Restriction Fragment Length Polymorphism (RFLP) analysis, and sequencing. The amoA gene is characteristic of ammonia oxidizing bacteria (AOB). The DNA extracts were acquired from an experiment where dilute molasses and urea were sequentially introduced into a well in the Eastern Snake River Plain Aquifer (ESRPA) in Idaho to examine whether such amendments could stimulate enhanced ureolytic activity. The hydrolysis of urea into ammonium and carbonate serves as the basis for a potential remediation technique for trace metals and radionuclide contaminants that can co-precipitate in calcite. The ammonium ion resulting from ureolysis can promote the growth of AOB. The goal of this work was to investigate the effectiveness of primers designed for quantitative PCR of environmental amoA genes and to evaluate the effect of the molasses and urea amendments upon the population diversity of groundwater AOB. PCR primers designed to target a portion of the amoA gene were used to amplify amoA gene sequences in the groundwater DNA extracts. Following PCR, amplified gene products were cloned and the clones were characterized by RFLP, a DNA restriction technique that can distinguish different DNA sequences, to gauge the initial diversity. Clones exhibiting unique RFLP patterns were subjected to DNA sequencing. Initial sequencing results suggest that the primers were successful at specific detection of amoA sequences and the RFLP analyses indicated that the diversity of detected amoA sequences in the ESRPA decreased with the additions of molasses and urea.

  14. Serotype specific primers and gel-based RT-PCR assays for 'typing' African horse sickness virus: identification of strains from Africa.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available African horse sickness is a devastating, transboundary animal disease, that is 'listed' by the Office International des Epizooties (OIE. Although attenuated, inactivated and subunit vaccines have been developed for African horse sickness virus (AHSV, these are serotype-specific and their effective deployment therefore relies on rapid and reliable identification of virus type. AHSV serotype is controlled by the specificity of interactions between neutralising antibodies, and components of the outer-capsid, particularly protein VP2 (encoded by AHSV genome segment 2 (Seg-2. We report the development and evaluation of novel gel based reverse transcription-PCR (RT-PCR assays targeting AHSV Seg-2, which can be used to very significantly increase the speed and reliability of detection and identification (compared to virus neutralisation tests of the nine serotypes of AHSV. Primer sets were designed targeting regions of Seg-2 that are conserved between strains within each of the AHSV serotype (types 1 to 9. These assays were evaluated using multiple AHSV strains from the orbivirus reference collection at IAH (www.reoviridae.org/dsRNA_virus_proteins/ReoID/AHSV-isolates.htm. In each case the Seg-2 primers showed a high level of specificity and failed to cross-amplify the most closely related heterologous AHSV types, or other related orbiviruses (such as bluetongue virus (BTV, or equine encephalosis virus (EEV. The assays are rapid and sensitive, and can be used to detect and type viral RNA in blood, tissue samples, or cultivated viral suspensions within 24 h. They were used to identify AHSV strains from recent outbreaks in sub-Saharan African countries. These methods also generate cDNAs suitable for sequencing and phylogenetic analyses of Seg-2, identifying distinct virus lineages within each virus-type and helping to identify strain movements/origins. The RT-PCR methods described here provide a robust and versatile tool for rapid and specific detection

  15. Multi-functional roles of a soldier-specific volatile as a worker arrestant, primer pheromone and an antimicrobial agent in a termite.

    Science.gov (United States)

    Mitaka, Yuki; Mori, Naoki; Matsuura, Kenji

    2017-07-26

    Division of labour in eusocial insects is characterized by efficient communication systems based on pheromones. Among such insects, termites have evolved specialized sterile defenders, called soldiers. Because they are incapable of feeding themselves, it has been suggested that soldiers are sustained by workers and emit the pheromone arresting workers. However, such a soldier pheromone has not been identified in any termite species, and the details of the soldier-worker interaction remain to be explored. Here, we identified a soldier-specific volatile sesquiterpene as a worker arrestant, which also acts as a primer pheromone regulating soldier differentiation and fungistatic agent in a termite Reticulitermes speratus Chemical analyses revealed that (-)-β-elemene is the major component of soldier extract, and its authentic standard exhibited arrestant activity to workers and inhibited the differentiation from workers to soldiers. This compound also showed fungistatic activity against entomopathogenic fungi. These suggest that (-)-β-elemene secreted by soldiers acts not only as a worker arrestant but also as one component of inhibitory primer pheromone and an anti-pathogenic agent. Our study provides novel evidence supporting the multi-functionality of termite soldier pheromone and provides new insights into the role of soldiers and the evolutionary mechanisms of pheromone compounds. © 2017 The Author(s).

  16. Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains

    Directory of Open Access Journals (Sweden)

    Espinola Emilio E

    2006-05-01

    Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.

  17. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  18. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  19. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    Science.gov (United States)

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

  20. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    choosing the most efficient way to design a new specific-primer by applying current publicly available links and Web services. Also, the purpose here is to provide general recommendations for the design and use of PCR primers. Key words: Bio-computing, primer design, web-based resources. INTRODUCTION. In the last ...

  1. Differentiation of Plum pox virus isolates by single-strand conformation polymorphism and low-stringency single specific primer PCR analysis of HC-Pro genome region.

    Science.gov (United States)

    Gadiou, S; Safárová, D; Navrátil, M

    2009-01-01

    Single-strand conformation polymorphism (SSCP) and low-stringency single specific primer (LSSP)-PCR were assessed for suitability and reliability in genotyping of Plum pox virus (PPV) isolates. Examined PPV isolates included 16 PPV-D, 12 PPV-M, and 14 PPV-Rec isolates collected in Czech Republic. The analysis was performed on the helper component protease (HC-Pro) region of the PPV genome. SSCP and LSSP-PCR allowed the differentiation of PPV strain, but SSCP was not able to distinguish isolates within the same strain. The individual genotyping of each PPV isolate was obtained by LSSP-PCR. Nevertheless, both SSCP and LSSP-PCR techniques are suitable for preliminary screening of genetic variability of plant RNA viruses.

  2. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  3. Genotyping system of GBV-C/HGV type 1 to type 4 by the polymerase chain reaction using type-specific primers and geographical distribution of viral genotypes.

    Science.gov (United States)

    Naito, H; Abe, K

    2001-01-01

    Based on variation in nucleotide sequence of 5'-untranslated region, GB virus type C (GBV-C) and hepatitis G virus (HGV) can be classified into three major genotypes. In addition to this classification, a novel genotype of GBV-C/HGV was identified and designated type 4. However, genotyping of GBV-C/HGV has been hampered by the lack of suitable assays. In this study, a simple and precise genotyping system based on PCR using the type-specific primers was developed for the determination of genotypes 1, 2, 3, and 4 of GBV-C/HGV. A total of 235 serum samples obtained from 11 different countries were tested by our PCR genotyping system of GBV-C/HGV. The results revealed that type 1 was prevalent mainly in Ghana, type 2 was prevalent in the USA, Spain, Egypt, Nepal and Myanmar, type 3 was prevalent in Japan and Bolivia, and type 4 was prevalent in Vietnam and Myanmar among the countries investigated in the present study. To confirm the specificity of the results of genotyping by PCR, phylogenetic analysis in the 5'-untranslated region of GBV-C/HGV was undertaken in 99 serum samples. By this analysis, the specificity of the genotyping system by PCR was confirmed. This assay system may be useful for rapid typing of GBV-C/HGV RNA when either epidemiological or transmission studies of this agent are carried out.

  4. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  5. COI barcode based species-specific primers for identification of five species of stored-product pests from genus Cryptolestes (Coleoptera: Laemophloeidae).

    Science.gov (United States)

    Varadínová, Z; Wang, Y J; Kučerová, Z; Stejskal, V; Opit, G; Cao, Y; Li, F J; Li, Z H

    2015-04-01

    Flat grain beetles of the genus Cryptolestes (Coleoptera: Laemophloeidae) are one of the economically most important stored-product pests which feed on many kinds of agricultural products, especially grains. Nine of more than 40 described Cryptolestes species are recognized as stored-product pests and two of the pest species have a cosmopolitan distribution. Given the rapid growth in global trade of food products, ecological barriers to the spread of pests are easily overcome. Therefore, development of reliable systems for routine quarantine inspection and early infestation detection is vital. In the present study, we established a new rapid and accurate cytochrome c oxidase subunit I-based system for molecular identification of five common stored-product Cryptolestes species, namely, Cryptolestes capensis, Cryptolestes ferrugineus, Cryptolestes pusilloides, Cryptolestes pusillus and Cryptolestes turcicus. Five species-specific primer pairs for traditional uniplex polymerase chain reaction assay are described and their specificity and sensitivity for the identification process is evaluated using larval samples of 12 different populations from three continents (Asia, Europe and North America).

  6. Development of specific PCR assays for the detection of Cryptocaryon irritans

    OpenAIRE

    Chen, W.; Sun, H. Y.; Xie, M. Q.; Bai, J. S.; Zhu, X. Q.; Li, A. X.

    2008-01-01

    Cryptocaryon irritans is one of the most important protozoan pathogens of marine fish, causing the ?white spot? disease and posing a significant problem to marine aquaculture. In the present study, a C. irritans-specific reverse primer (S15) was designed based on the published sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA (rDNA) of C. irritans and used together with the conserved forward primer P1 to develop a specific polymerase chain reaction (PCR) assay for di...

  7. [Isolation of DNA from museum exhibits of butterflies (Lepidoptera, Papilionidae) and PCR analysis with random and universal genes-specific primers].

    Science.gov (United States)

    Zakharov, E V; Chelomina, G N; Zhuravlev, Iu N

    2000-09-01

    The effect of the duration of storage of entomological material on DNA preservation was estimated. The results of the optimization of conditions for the analysis of random amplified polymorphic DNA in a polymerase chain reaction (RAPD-PCR) are presented as applied to the DNA of lepidopterans of the family Papilionidae. RAPD patterns are shown for the first time in Atrophaneura alcinous and four species of the genus Parnassius (sensu lata). The applicability of museum specimens of butterflies for RAPD analysis was demonstrated. The results of PCR analysis using DNA obtained from different collection specimens stored for up to five years were compared. The authenticity of DNA obtained from collection specimens was proved using PCR with universal primers, which are specific to the COI and COII cytochrome genes of mitochondrial DNA (mt DNA). The lengths of individuals gene fragments obtained by the amplification of both museum and live specimens were 800 and 1600 bp. The conservative regions of mitochondrial genome were shown to be slightly different in two A. alcinous subspecies.

  8. Sensitive and specific detection of Xanthomonas campestris pv. pelargonii with DNA primers and probes identified by random amplified polymorphic DNA analysis.

    OpenAIRE

    Manulis, S; Valinsky, L; Lichter, A; Gabriel, D. W.

    1994-01-01

    The random amplified polymorphic DNA method was used to distinguish strains of Xanthomonas campestris pv. pelargonii from 21 other Xanthomonas species and/or pathovars. Among the 42 arbitrarily chosen primers evaluated, 3 were found to reveal diagnostic polymorphisms when purified DNAs from compared strains were amplified by the PCR. The three primers revealed DNA amplification patterns which were conserved among all 53 strains tested of X. campestris pv. pelargonii isolated from various loca...

  9. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  10. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    Science.gov (United States)

    2012-01-01

    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  12. DNA barcoding in autotrophic euglenids: evaluation of COI and 18s rDNA.

    Science.gov (United States)

    Łukomska-Kowalczyk, Maja; Karnkowska, Anna; Krupska, Małgorzata; Milanowski, Rafał; Zakryś, Bożena

    2016-12-01

    Autotrophic euglenids (Euglenophyceae) are a common and abundant group of microbial eukaryotes in freshwater habitats. They have a limited number of features, which can be observed using light microscopy, thus species identification is often problematic. Establishing a barcode for this group is therefore an important step toward the molecular identification of autotrophic euglenids. Based on the literature, we selected verified species and used a plethora of available methods to validate two molecular markers: COI and 18S rDNA (the whole sequence and three fragments separately) as potential DNA barcodes. Analyses of the COI gene were performed based on the data set of 43 sequences (42 obtained in this study) representing 24 species and the COI gene was discarded as a DNA barcode mainly due to a lack of universal primer sites. For 18S rDNA analyses we used a data set containing 263 sequences belonging to 86 taxonomically verified species. We demonstrated that the whole 18S rDNA is too long to be a useful marker, but from the three shorter analyzed variable regions we recommend variable regions V2V3 and V4 of 18S rDNA as autotrophic euglenid barcodes due to their high efficiency (above 95% and 90%, respectively). © 2016 Phycological Society of America.

  13. Length and sequence heterogeneity in 5S rDNA of Populus deltoides.

    Science.gov (United States)

    Negi, Madan S; Rajagopal, Jyothi; Chauhan, Neeti; Cronn, Richard; Lakshmikumaran, Malathi

    2002-12-01

    The 5S rRNA genes and their associated non-transcribed spacer (NTS) regions are present as repeat units arranged in tandem arrays in plant genomes. Length heterogeneity in 5S rDNA repeats was previously identified in Populus deltoides and was also observed in the present study. Primers were designed to amplify the 5S rDNA NTS variants from the P. deltoides genome. The PCR-amplified products from the two accessions of P. deltoides (G3 and G48) suggested the presence of length heterogeneity of 5S rDNA units within and among accessions, and the size of the spacers ranged from 385 to 434 bp. Sequence analysis of the non-transcribed spacer (NTS) revealed two distinct classes of 5S rDNA within both accessions: class 1, which contained GAA trinucleotide microsatellite repeats, and class 2, which lacked the repeats. The class 1 spacer shows length variation owing to the microsatellite, with two clones exhibiting 10 GAA repeat units and one clone exhibiting 16 such repeat units. However, distance analysis shows that class 1 spacer sequences are highly similar inter se, yielding nucleotide diversity (pi) estimates that are less than 0.15% of those obtained for class 2 spacers (pi = 0.0183 vs. 0.1433, respectively). The presence of microsatellite in the NTS region leading to variation in spacer length is reported and discussed for the first time in P. deltoides.

  14. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  15. [DNA amplification using PCR with abutting primers].

    Science.gov (United States)

    Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Vakhitov, V A; Chemeris, A V

    2015-01-01

    DNA analysis of ñîmplex biological objects (wastewater, soil, archaeological and forensic samples, etc.) is currently of great interest. DNA of these objects is characterized by low suitability for research due to the violation of its integrity and chemical structure; thus, the detection of specific nucleic acid fragments can be achieved by PCR with contiguous primers. In this paper, we present the results that clarify the specific characteristics of PCR with abutting primers. The 3'-ends of these primers are annealed at adjacent nucleotides of complementary chains of DNA target. It has been shown that the proximity of primers enables the formation of specific reaction products with a higher sensitivity and less reaction time. Using artificially damaged DNA and DNA from the soil we demonstrated that the abutting primers provide assured detection of specific DNA fragments. The results of this work may be taken into account in PCR with degraded (fragmented) DNA.

  16. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    Directory of Open Access Journals (Sweden)

    Suwannasri Payiarat

    2009-12-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV. To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer, several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program

  17. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  18. Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

    Science.gov (United States)

    Asvapathanagul, P; Olson, B H

    2017-01-01

    To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10(2) to 5 × 10(6) copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10(6) copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10(6) copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10(6) M. bovis: 10(2) N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

  19. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  20. Primer3Plus, an enhanced web interface to Primer3

    NARCIS (Netherlands)

    Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M.

    2007-01-01

    Here we present Primer3Plus, a new web interface to the popular Primer3 primer design program as an enhanced alternative for the CGI- scripts that come with Primer3. Primer3 consists of a command line program and a web interface. The web interface is one large form showing all of the possible

  1. Evaluation of the sensitivity and specificity of primer pairs and the efficiency of RNA extraction procedures to improve noroviral detection from oysters by nested reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Lee, Cheonghoon; Cheong, Sooryun; Lee, Hee-Jung; Kwon, Miye; Kang, Ilnam; Oh, Eun-Gyoung; Yu, Hong-Sik; Shin, Soon-Bum; Kim, Sang-Jong

    2010-10-01

    Noroviruses (NoV) are the key cause of acute epidemic gastroenteritis, and oysters harvested from NoV-polluted sea areas are considered as the significant vectors of viral transmission. To improve NoV detection from oyster using nested reverse transcription-polymerase chain reaction (RT-PCR), we evaluated the sensitivity and specificity of previously published primer pairs and the efficiency of different RNA extraction procedures. Among the primer pairs used for RT-PCR, the sensitivity of GIF1/GIR1-GIF2/GIR1 and GIIF1/GIIR1-GIIF2/GIIR1 was higher than that of other primer pairs used in nested RT-PCR for the detection of NoV genogroup I (NoV GI) and NoV GII from both NoV-positive stool suspension and NoV-seeded oyster concentrates, respectively; the resulting products showed neither unspecific bands in the positive samples nor false-positive bands in the negative controls. The extraction of NoV RNA from oyster samples using a QIAamp® Viral RNA Mini kit with a QIAshredder™ Homogenizer pretreatment afforded more efficient recovery (mean recovery for NoV GI and GII, 6.4%) and the procedure was less time consuming (oysters, which is an indicator of possible public health risks.

  2. The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

    Science.gov (United States)

    Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

    2003-06-01

    A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

  3. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  4. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Science.gov (United States)

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  5. 5S rDNA characterization in twelve Sciaenidae fish species (Teleostei, Perciformes: depicting gene diversity and molecular markers

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2008-01-01

    Full Text Available In order to extend the genetic data on the Sciaenidae fish family, the present study had the purpose to characterize PCR-generated 5S rDNA repeats of twelve species of this group through PAGE (Polyacrylamide Gel Electrophoresis analysis. The results showed the occurrence of at least two different 5S rDNA size classes in all the species. Moreover, 5S rDNA repeats of one of the studied species - Isopisthus parvipinnis - were cloned and subjected to nucleotide sequencing and Southern blot membrane hybridization analyses, which permitted to confirm the existence of two major 5S rDNA classes. Phylogenetic analysis based on the nucleotide sequences of different 5S rDNA repeats of I. parvipinnis lead to their separation into two major clusters. These results may reflect the high dynamism that rules the evolution rate of 5S rDNA repeats. The obtained data suggest that 5S rDNA can be useful in genetic analyses to identify species-specific markers and determine relationships among species of the Sciaenidae group.

  6. [Comparative analysis between diatom nitric acid digestion method and plankton 16S rDNA PCR method].

    Science.gov (United States)

    Han, Jun-ge; Wang, Cheng-bao; Li, Xing-biao; Fan, Yan-yan; Feng, Xiang-ping

    2013-10-01

    To compare and explore the application value of diatom nitric acid digestion method and plankton 16S rDNA PCR method for drowning identification. Forty drowning cases from 2010 to 2011 were collected from Department of Forensic Medicine of Wenzhou Medical University. Samples including lung, kidney, liver and field water from each case were tested with diatom nitric acid digestion method and plankton 16S rDNA PCR method, respectively. The Diatom nitric acid digestion method and plankton 16S rDNA PCR method required 20 g and 2 g of each organ, and 15 mL and 1.5 mL of field water, respectively. The inspection time and detection rate were compared between the two methods. Diatom nitric acid digestion method mainly detected two species of diatoms, Centriae and Pennatae, while plankton 16S rDNA PCR method amplified a length of 162 bp band. The average inspection time of each case of the Diatom nitric acid digestion method was (95.30 +/- 2.78) min less than (325.33 +/- 14.18) min of plankton 16S rDNA PCR method (P plankton 16S rDNA PCR method was both 80%, higher than 40% and 30% of diatom nitric acid digestion method (P plankton 16S rDNA PCR method has practice values with such advantages as less quantity of samples, huge information and high specificity.

  7. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    Science.gov (United States)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/.

  8. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  9. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection.

    Science.gov (United States)

    Mastan, Shaik G; Sudheer, Pamidimarri D V N; Rahman, Hifzur; Reddy, Muppala P; Chikara, Jitendra

    2012-01-01

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies.

  10. Development of specific PCR assays for the detection of Cryptocaryon irritans.

    Science.gov (United States)

    Chen, W; Sun, H Y; Xie, M Q; Bai, J S; Zhu, X Q; Li, A X

    2008-07-01

    Cryptocaryon irritans is one of the most important protozoan pathogens of marine fish, causing the "white spot" disease and posing a significant problem to marine aquaculture. In the present study, a C. irritans-specific reverse primer (S15) was designed based on the published sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA (rDNA) of C. irritans and used together with the conserved forward primer P1 to develop a specific polymerase chain reaction (PCR) assay for direct, rapid, and specific detection of C. irritans. The specificity of these primers was tested with both closely and distantly related ciliates (Pseudokeroronpsis rubra, Pseudokeroronpsis carnae, Euplotes sp. 1, Ichthyophthirius multifiliis, Pseudourostyla cristata, and Paramecium caudaium), and only C. irritans was detected and no product was amplified from any other ciliates examined in this study using the specific primer set P1-S15. The specific PCR assay was able to detect as low as 45 pg of C. irritans DNA and a nested PCR assay using two primer sets (P1/NC2, P1/S15) increased the sensitivity, allowing the detection of a single C. irritans. The species-specific PCR assays should provide useful tools for the diagnosis, prevention, and molecular epidemiological investigations of C. irritans infection in marine fish.

  11. Residues in the alphaH and alphaI helices of the HIV-1 reverse transcriptase thumb subdomain required for the specificity of RNase H-catalyzed removal of the polypurine tract primer.

    Science.gov (United States)

    Powell, M D; Beard, W A; Bebenek, K; Howard, K J; Le Grice, S F; Darden, T A; Kunkel, T A; Wilson, S H; Levin, J G

    1999-07-09

    During retrovirus replication, reverse transcriptase (RT) must specifically interact with the polypurine tract (PPT) to generate and subsequently remove the RNA primer for plus-strand DNA synthesis. We have investigated the role that human immunodeficiency virus-1 RT residues in the alphaH and alphaI helices in the thumb subdomain play in specific RNase H cleavage at the 3'-end of the PPT; an in vitro assay modeling the primer removal step was used. Analysis of alanine-scanning mutants revealed that a subgroup exhibits an unusual phenotype in which the PPT is cleaved up to seven bases from its 3'-end. Further analysis of alphaH mutants (G262A, K263A, N265A, and W266A) with changes in residues in or near a structural motif known as the minor groove binding track showed that the RNase H activity of these mutants is more dramatically affected with PPT substrates than with non-PPT substrates. Vertical scan mutants at position 266 were all defective in specific RNase H cleavage, consistent with conservation of tryptophan at this position among lentiviral RTs. Our results indicate that residues in the thumb subdomain and the minor groove binding track in particular, are crucial for unique interactions between RT and the PPT required for correct positioning and precise RNase H cleavage.

  12. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  13. Geographical clustering of Trypanosoma cruzi I groups from Colombia revealed by low-stringency single specific primer-PCR of the intergenic regions of spliced-leader genes.

    Science.gov (United States)

    Mejía-Jaramillo, Ana María; Arboleda-Sánchez, Sair; Rodríguez, Ingrid Bibiana; Cura, Carolina; Salazar, Alexander; Del Mazo, Jesús; Triana-Chávez, Omar; Schijman, Alejandro Gabriel

    2009-01-01

    A low-stringency single-primer polymerase chain reaction (LSSP-PCR) typing procedure targeted to the intergenic regions of spliced-leader genes (SL) was designed to profile Trypanosoma cruzi I stocks from endemic regions of Colombia. Comparison between SL-LSSP-PCR profiles of parasite DNA from vector faeces and cultures isolated from those faeces showed more conservative signatures than profiles using LSSP-PCR targeted to the minicircle variable regions (kDNA). This was also observed by analysing 15 parasite clones from one stock as well as serial samples of a same stock after in vitro culturing or inoculation into mice. Thus, SL-LSSP-PCR appears more appropriate than kDNA-LSSP-PCR for reliable typing of major T. cruzi I groups from in vitro cultured stocks and triatomine faeces. SL-LSSP-PCR grouped 46 of 47 T. cruzi I Colombian stocks according to their geographical procedences in four clusters: Cluster Cas from Casanare Department, Cluster Mg from Northern Magdalena department, Cluster Mom from Momposina Depression in Southern Magdalena and finally Cluster NW from northwestern Colombia, including Sucre, Chocó, Córdoba and Antioquia departments. Sequence analysis identified punctual mutations among amplicons from each cluster. Within Cluster Mg, sequence polymorphism allowed association with different sylvatic vector species. Novel SL sequences and LSSP-PCR profiles are reported from T. cruzi I infecting Eratyrus cuspidatus, Panstrongylus geniculatus and Rhodnius pallescens vectors.

  14. Development of SCAR primers for the detection of the postharvest pathogens of kiwifruit and pome fruit Cadophora luteo-olivacea and C. malorum

    Directory of Open Access Journals (Sweden)

    DAVIDE SPADARO

    2012-01-01

    Full Text Available 800x600 Normal 0 14 false false false IT X-NONE X-NONE MicrosoftInternetExplorer4 In recent years a postharvest disease of kiwifruit, characterized by skin pitting appearing after 3 or more months of storage, and caused by C. luteo-olivacea, has been reported in most Italian packinghouses. Forty-four strains isolated from kiwifruit harvested in Italy during the period 2001-2009 were tested for their pathogenicity on kiwifruit, apple and pear. The pathogenicity tests showed that different isolates of C. luteo-olivacea were pathogenic on the three fruit species stored at 1°C for 120 days with various degree of virulence. A PCR-based method to identify the pathogen species in kiwifruit was developed. Sequencing of the internal transcribed spacer (ITS1, 5.8S gene and ITS2 region of the rDNA (ITS showed high similarity with the species C. malorum, agent of side rot of apples and pears. Variation within the ITS was used to design one reverse primer common to both species and two species specific forward primers to specifically identify isolates of C. luteo-olivacea and C. malorum. Both SCAR (sequence characterized amplified region primer pairs showed to be specific for either Cadophora species when cross-tested and assessed on other species of Cadophora or on species of typical postharvest pathogens of kiwifruit, apple and pear.

  15. Quelling targets the rDNA locus and functions in rDNA copy number control

    Directory of Open Access Journals (Sweden)

    Cecere Germano

    2009-02-01

    Full Text Available Abstract Background RNA silencing occurs in a broad range of organisms. Although its ancestral function is probably related to the genome defense mechanism against repetitive selfish elements, it has been found that RNA silencing regulates different cellular processes such as gene expression and chromosomal segregation. In Neurospora crassa, a RNA silencing mechanism, called quelling, acts to repress the expression of transgenes and transposons, but until now no other cellular functions have been shown to be regulated by this mechanism. Results Here, we detected by northern blotting endogenous short interfering RNA (siRNAs from the repetitive ribosomal DNA locus (rDNA that are loaded onto the argonaute protein QDE-2. Moreover, we found a bidirectional transcription that can generate double strand RNA (dsRNA molecules. Interestingly, quelling mutants have a reduced rDNA gene copy number. Conclusion Our finding could suggest a new biological function for RNA silencing in the maintenance of the integrity and stability of the Neurospora rDNA locus.

  16. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida).

    Science.gov (United States)

    Lv, Jizhou; Wu, Shaoqiang; Zhang, Yongning; Chen, Yan; Feng, Chunyan; Yuan, Xiangfen; Jia, Guangle; Deng, Junhua; Wang, Caixia; Wang, Qin; Mei, Lin; Lin, Xiangmei

    2014-03-03

    The 5' region of cytochrome oxidase I (COI) is the standard marker for DNA barcoding. However, COI has proved to be of limited use in identifying some species, and for some taxa, the coding sequence is not efficiently amplified by PCR. These deficiencies lead to uncertainty as to whether COI is the most suitable barcoding fragment for species identification of ticks. In this study, we directly compared the relative effectiveness of COI, 16S ribosomal DNA (rDNA), nuclear ribosomal internal transcribed spacer 2 (ITS2) and 12S rDNA for tick species identification. A total of 307 sequences from 84 specimens representing eight tick species were acquired by PCR. Besides the 1,834 published sequences of 189 tick species from GenBank and the Barcode of Life Database, 430 unpublished sequences representing 59 tick species were also successfully screened by Bayesian analyses. Thereafter, the performance of the four DNA markers to identify tick species was evaluated by identification success rates given by these markers using nearest neighbour (NN), BLASTn, liberal tree-based or liberal tree-based (+threshold) methods. Genetic divergence analyses showed that the intra-specific divergence of each marker was much lower than the inter-specific divergence. Our results indicated that the rates of correct sequence identification for all four markers (COI, 16S rDNA, ITS2, 12S rDNA) were very high (> 96%) when using the NN methodology. We also found that COI was not significantly better than the other markers in terms of its rate of correct sequence identification. Overall, BLASTn and NN methods produced higher rates of correct species identification than that produced by the liberal tree-based methods (+threshold or otherwise). As the standard DNA barcode, COI should be the first choice for tick species identification, while 16S rDNA, ITS2, and 12S rDNA could be used when COI does not produce reliable results. Besides, NN and BLASTn are efficient methods for species identification

  17. The internal transcribed spacer rDNA specific markers for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... Genus Zanthoxylum which has significant medical importance belongs to the family Rutaceae. This investigation was aimed to identify total internal transcribed spacer (ITS) regions among the nuclear ribosomal DNA (nrDNA) to distinguish Zanthoxylum piperitum from Zanthoxylum sichinifolium. The.

  18. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    Science.gov (United States)

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  19. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  20. Novel set of real-time PCR primers for simultaneous detection of Liberibacter species associated with citrus Huanglongbing

    Directory of Open Access Journals (Sweden)

    Ingrid Georgina Orce

    2015-06-01

    Full Text Available Huanglongbing (HLB, a devastating citrus disease caused by the bacterium “Candidatus Liberibacter spp.”, is now responsible for significant economic losses worldwide. Yet, no effective disease control has been found, and the non-cultivability of the bacterium has severely hampered studies on the pathogen. The 16S rDNA gene is a well-characterized sequence, essential for cell survival, and is used for bacterial identification or assignment of close relationships at the genus and species levels. Quantitative Real-Time PCR (qPCR assays based on 16S rDNA genes are widely used in the detection of “Ca. Liberibacter spp.” in multiplex reactions. We have developed for the first time a set of qPCR primers based on the conserved 16S rDNA gene, which specifically and simultaneously detects in a singleplex reaction, all three bacterial species associated with HLB, and can differentiateCa.Liberibacter asiaticus or africanus from americanus by their characteristic melting curves. The assay is very sensitive, and it was possible to amplify expected DNA fragments with an efficiency of 98 % using the Syber Green system and a Ct value lower than tested methods for HLB diagnosis. The application of this fast, simple and efficient detection methodology could also be important in the detection of all species of HLB-associated Liberibacters and could contribute to early pathogen detection, a crucial step in the development of preventive strategies aimed at avoiding the dissemination of this devastating disease in HLB-free areas.

  1. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  2. Evolution of Ribosomal DNA (Rdna) Genetic Structure in Colonial Californian Populations of Avena Barbata

    Science.gov (United States)

    Cluster, P. D.; Allard, R. W.

    1995-01-01

    DNA samples from 980 plants of Avena barbata from 48 ecologically diverse sites in California and Oregon were assayed to determine their genotype for two duplicated loci governing rDNA variants. More than 40 different rDNA genotypes were observed among which 5 made up 96% of our sample in environmentally homogeneous sites; predominant genotypes were less frequent and recombinant genotypes were more frequent in environmentally heterogeneous sites. The spatial distribution of each predominant rDNA genotype was nearly an exact overlay on both macro- and microgeographical scales of a distinctive habitat and also of the distribution of an eight-locus morphological-allozyme variant genotype. In all, seven different habitat-genotype combinations (ecotypes) were distinguishable on the basis of their morphological-allozyme-rDNA genotypes. None of these seven genotypes has been found in ancestral Spanish populations; thus the above predominant multilocus genotypes (ecotypes) of the colonial populations evidently evolved subsequent to the recent introduction (within 150-200 generations) of A. barbata to California. The precise associations of specific alleles and genotypes of the morphological allozyme and rDNA loci with different specifiable habitats leads us to the conclusion that natural selection favoring particular multilocus combinations of alleles in different habitats was the main guiding force in shaping the internal genetic structure of local populations as well as the overall adaptive landscape of A. barbata over California and Oregon. PMID:7713443

  3. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  4. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  5. ANL supplement to the UNICOS primer

    Energy Technology Data Exchange (ETDEWEB)

    Wiley, M.S. (ed.); Karlovsky, S.R.

    1991-06-01

    The ANL Supplement to the UNICOS Primer (ANL/TM 460) introduces the Cray X-MP interactive and batch services available at Argonne National Laboratory. It serves as a companion to the UNICOS Primer (Cray publication SG-2010 6.0). Whereas the UNICOS Primer discusses standard Unix issues of Cray computing, this manual discusses those issues specific to Cray computing at ANL. If this is your first experience on a Unix-based system, we assume that you have read at least Chapters 1 through 3 of the UNICOS Primer. The Glossary at the back of the UNICOS Primer will also be useful to you. If you are already familiar with a Unix system, it should suffice to keep the UNICOS Primer handy as you use this document. To learn about Unix programming in greater detail, we recommend A Practical Guide to the Unix System, by Mark G. Sobell. This manual and all other sources referred to in this document are available for purchase at the Document Distribution Counter in Building 221, Room A-134. We assume that you have already read the Guide to Computing at ANL (ANL/TM 336) to get an overview of all the computing facilities and services available at Argonne National Laboratory. You should also refer to Recommended Documentation for Computer Users at ANL (ANL/TM 379) for additional guidance in selecting available documentation that will best fill your particular computing needs.

  6. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  7. Identification of ISSR Primers

    African Journals Online (AJOL)

    leaf preferred by consumers. These genotypes ... plants, primers that work for one may not work for another. Hence .... Naidoo, Madhupa and Dr Bayo Shittu for access to laboratory facilities, training in different techniques and editing of manuscript. This work was made possible by a fellowship for Female. Academic Staff ...

  8. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  9. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  10. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  11. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  12. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  13. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Jungersen, Gregers; Sørensen, Maria Rathmann

    2014-01-01

    The swine major histocompatibility complex (MHC) genomic region (SLA) is extremely polymorphic comprising high numbers of different alleles, many encoding a distinct MHC class I molecule, which binds and presents endogenous peptides to circulating T cells of the immune system. Upon recognition...... of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly...... occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular...

  14. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    This review intends to provide a guide to choosing the most efficient way to design a new specific-primer by applying current publicly available links and Web services. Also, the purpose here is to provide general recommendations for the design and use of PCR primers. (African Journal of Biotechnology: 2003 2(5): 91-95) ...

  15. Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe

    Directory of Open Access Journals (Sweden)

    Jia Renyong

    2010-02-01

    Full Text Available Abstract Background Anatid herpesvirus 1 (AHV-1 is known for the difficulty of monitoring and controlling, because it has a long period of asymptomatic carrier state in waterfowls. Furthermore, as a significant essential agent for viral attachment, release, stability and virulence, gC (UL44 gene and its protein product (glycoprotein C may play a key role in the epidemiological screening. The objectives of this study were to rapidly, sensitively, quantitatively detect gC gene of AHV-1 and provide the underlying basis for further investigating pcDNA3.1-gC DNA vaccine in infected ducks by TaqMan™ fluorescent quantitative real-time PCR assay (FQ-PCR with pcDNA3.1-gC plasmid. Results The repeatable and reproducible quantitative assay was established by the standard curve with a wide dynamic range (eight logarithmic units of concentration and very good correlation values (1.000. This protocol was able to detect as little as 1.0 × 101 DNA copies per reaction and it was highly specific to AHV-1. The TaqMan™ FQ-PCR assay successfully detected the gC gene in tissue samples from pcDNA3.1-gC and AHV-1 attenuated vaccine (AHV-1 Cha strain inoculated ducks respectively. Conclusions The assay offers an attractive method for the detection of AHV-1, the investigation of distribution pattern of AHV-1 in vivo and molecular epidemiological screening. Meanwhile, this method could expedite related AHV-1 and gC DNA vaccine research.

  16. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  17. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  18. Characteristics of Primer of High Performance Bismaleimide Resin

    Directory of Open Access Journals (Sweden)

    LI Hong-feng

    2016-06-01

    Full Text Available A primer of the bismaleimide resin toughened with block copolymer was prepared. The properties of the primer, such as adhesion, pencil hardness, impact resistance, environment resistant, ageing resistant performance and etc. meet the requirements of the technical specifications of GJB1388. The thermal property of the primer was characterized by differential scanning calorimeter (DSC, thermal gravity analysis (TG, and dynamic mechanical analysis (DMA. The results show that the primer possesses good heat resistance, the glass transition temperature of the primer reach 238℃, 5% mass heat lost temperature is 384℃ after 200℃ cured, and the glass transition temperature of the primer reach 268℃, 5% mass heat lost temperature is 407℃ after 230℃ heat treatment respectively. Bonding strength will increase when the bismaleimide primer doubled with bismaleimide film adhesive, when the primer doubled with J-188 bismaleimide film adhesive, peel strength increases to 107%, the room temperature shear strength and high temperature shear strength increase by 10%.The primer can also be used with other bismaleimide film structural adhesives, which are suitable for the bonding between metals or bismaleimide composites with metals.

  19. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  20. Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing

    Science.gov (United States)

    Huang, Julie; Moazed, Danesh

    2003-01-01

    Silencing within the yeast rDNA repeats inhibits hyperrecombination, represses transcription from foreign promoters, and extends replicative life span. rDNA silencing is mediated by a Sir2-containing complex called RENT (regulator of nucleolar silencing and telophase exit). We show that the Net1 (also called Cfi1) and Sir2 subunits of RENT localize primarily to two distinct regions within rDNA: in one of the nontranscribed spacers (NTS1) and around the Pol I promoter, extending into the 35S rRNA coding region. Binding to NTS1 overlaps the recombination hotspot and replication fork barrier elements, which have been shown previously to require the Fob1 protein for their activities. In cells lacking Fob1, silencing and the association of RENT subunits are abolished specifically at NTS1, while silencing and association at the Pol I promoter region are unaffected or increased. We find that Net1 and Sir2 are physically associated with Fob1 and subunits of RNA polymerase I. Together with the localization data, these results suggest the existence of two distinct modes for the recruitment of the RENT complex to rDNA and reveal a role for Fob1 in rDNA silencing and in the recruitment of the RENT complex. Furthermore, the Fob1-dependent associations of Net1 and Sir2 with the recombination hotspot region strongly suggest that Sir2 acts directly at this region to carry out its inhibitory effect on rDNA recombination and accelerated aging. PMID:12923057

  1. Universal primers for rapid detection of hytrosaviruses.

    Science.gov (United States)

    Abd-Alla, Adly M M; Salem, Tamer Z; Parker, Andrew G; Wang, Yongjie; Jehle, Johannes A; Vreysen, Marc J B; Boucias, Drion

    2011-01-01

    Hytrosaviridae is a proposed virus family encompassing viruses that cause salivary gland hypertrophy (SGH) syndrome in infected insects and reduce the fertility in their dipteran insect hosts. They contain a large, double stranded DNA genome of 120-190 kbp. To date, these viruses have been detected only in adult Diptera. These include hytrosaviruses detected in various tsetse fly species (Glossina spp.), the narcissus bulb fly Merodon equestris and the house fly Musca domestica. The limited number of hytrosaviruses reported to date may be a reflection of the frequent absence of external symptoms in infected adult flies and the fact that the virus does not cause rapid mortality. Based on the complete genome sequence of Glossinia pallidipes (GpSGHV) and Musca domestica (MdSGHV) salivary gland hypertrophy viruses, a PCR based methodology was developed to detect the viruses in these species. To be able to detect hytrosaviruses in other Diptera, five degenerate primer pairs were designed and tested on GpSGHV and MdSGHV DNA using gradient PCR with annealing temperatures from 37 to 61°C. Two pairs of primers were selected from p74, two pairs from PIF-1 and one pair from ODV-e66 homologous proteins. Four primer pairs generated a virus specific PCR product on both MdSGHV and GpSGHV at all tested annealing temperatures, while the ODV-e66 based primers did not generate a virus specific product with annealing temperatures higher that 47°C. No non-specific PCR product was found when using genomic DNA of infected flies as template DNA. These results offer new sets of primers that could be used to detect hytrosaviruses in other insects. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae

    Directory of Open Access Journals (Sweden)

    Débora Diniz

    2009-01-01

    Full Text Available The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH. The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features.

  3. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  4. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. [FISH analysis of 45S rDNA and 5S rDNA genes in Triticum polonicum L. and T. turgidum L. cv. Ailanmai].

    Science.gov (United States)

    Liao, Jin-Qiu; Yang, Rui-Wu; Zhou, Yong-Hong; Tsujimoto, Hisashi

    2007-04-01

    Using the method of double color fluorescence in situ hybridization (FISH), we had analyzed Triticum polonicum L. and T. turgidum L. cv. Ailanmai with the probes of 45S rDNA and 5S rDNA. The results indicated that there were highly consistent in T. polonicum L. High and T. turgidum L. cv. Ailanmai, both having four 45S rDNA loci and six 5S rDNA loci. In T. polonicum L. Dwarf, there were also four 45S rDNA loci, the same as that in T. polonicum L. High and T. turgidum L. cv. Ailanmai, but there were eight 5S rDNA loci. At the same time, we discussed the reason of interspecific and intraspecific variation of the two types of rDNA in locus number and location between T. polonicum L. and T. turgidum L. cv. Ailanmai.

  6. Best Development Practices: A Primer for Smart Growth

    Science.gov (United States)

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  7. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    OpenAIRE

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, Fran?ois; Taberlet, Pierre; Coissac, Eric

    2011-01-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experime...

  8. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    Science.gov (United States)

    Sochorová, Jana; Coriton, Olivier; Kuderová, Alena; Lunerová, Jana; Chèvre, Anne-Marie; Kovařík, Aleš

    2017-01-01

    Background and aims Brassica napus (AACC, 2n = 38, oilseed rape) is a relatively recent allotetraploid species derived from the putative progenitor diploid species Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18). To determine the influence of intensive breeding conditions on the evolution of its genome, we analysed structure and copy number of rDNA in 21 cultivars of B. napus, representative of genetic diversity. Methods We used next-generation sequencing genomic approaches, Southern blot hybridization, expression analysis and fluorescence in situ hybridization (FISH). Subgenome-specific sequences derived from rDNA intergenic spacers (IGS) were used as probes for identification of loci composition on chromosomes. Key Results Most B. napus cultivars (18/21, 86 %) had more A-genome than C-genome rDNA copies. Three cultivars analysed by FISH (‘Darmor’, ‘Yudal’ and ‘Asparagus kale’) harboured the same number (12 per diploid set) of loci. In B. napus ‘Darmor’, the A-genome-specific rDNA probe hybridized to all 12 rDNA loci (eight on the A-genome and four on the C-genome) while the C-genome-specific probe showed weak signals on the C-genome loci only. Deep sequencing revealed high homogeneity of arrays suggesting that the C-genome genes were largely overwritten by the A-genome variants in B. napus ‘Darmor’. In contrast, B. napus ‘Yudal’ showed a lack of gene conversion evidenced by additive inheritance of progenitor rDNA variants and highly localized hybridization signals of subgenome-specific probes on chromosomes. Brassica napus ‘Asparagus kale’ showed an intermediate pattern to ‘Darmor’ and ‘Yudal’. At the expression level, most cultivars (95 %) exhibited stable A-genome nucleolar dominance while one cultivar (‘Norin 9’) showed co-dominance. Conclusions The B. napus cultivars differ in the degree and direction of rDNA homogenization. The prevalent direction of gene conversion (towards the A-genome) correlates

  9. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus.

    Science.gov (United States)

    Sochorová, Jana; Coriton, Olivier; Kuderová, Alena; Lunerová, Jana; Chèvre, Anne-Marie; Kovařík, Aleš

    2017-01-01

    Brassica napus (AACC, 2n = 38, oilseed rape) is a relatively recent allotetraploid species derived from the putative progenitor diploid species Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18). To determine the influence of intensive breeding conditions on the evolution of its genome, we analysed structure and copy number of rDNA in 21 cultivars of B. napus, representative of genetic diversity. We used next-generation sequencing genomic approaches, Southern blot hybridization, expression analysis and fluorescence in situ hybridization (FISH). Subgenome-specific sequences derived from rDNA intergenic spacers (IGS) were used as probes for identification of loci composition on chromosomes. Most B. napus cultivars (18/21, 86 %) had more A-genome than C-genome rDNA copies. Three cultivars analysed by FISH ('Darmor', 'Yudal' and 'Asparagus kale') harboured the same number (12 per diploid set) of loci. In B. napus 'Darmor', the A-genome-specific rDNA probe hybridized to all 12 rDNA loci (eight on the A-genome and four on the C-genome) while the C-genome-specific probe showed weak signals on the C-genome loci only. Deep sequencing revealed high homogeneity of arrays suggesting that the C-genome genes were largely overwritten by the A-genome variants in B. napus 'Darmor'. In contrast, B. napus 'Yudal' showed a lack of gene conversion evidenced by additive inheritance of progenitor rDNA variants and highly localized hybridization signals of subgenome-specific probes on chromosomes. Brassica napus 'Asparagus kale' showed an intermediate pattern to 'Darmor' and 'Yudal'. At the expression level, most cultivars (95 %) exhibited stable A-genome nucleolar dominance while one cultivar ('Norin 9') showed co-dominance. The B. napus cultivars differ in the degree and direction of rDNA homogenization. The prevalent direction of gene conversion (towards the A-genome) correlates with the direction of expression dominance indicating that gene activity may be needed for

  10. Chromosomal localization of rDNA genes and genomic organization ...

    Indian Academy of Sciences (India)

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis ... Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed ...

  11. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t...

  12. Specific PCR-based detection of Alternaria helianthi: the cause of blight and leaf spot in sunflower.

    Science.gov (United States)

    Udayashankar, A C; Chandra Nayaka, S; Archana, B; Anjana, G; Niranjana, S R; Mortensen, C N; Lund, Ole S; Prakash, H S

    2012-11-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method was developed with species-specific primers designed based on the sequence data of a region consisting of the 5.8S RNA gene and internal transcribed spacers-ITS 1 and ITS 2 of nuclear ribosomal RNA gene (rDNA) repeats of A. helianthi. The specificity of the primer pairs AhN1F and AhN1R designed was verified by PCR analysis of DNA from 18 Alternaria helianthi strains isolated from India, 14 non-target Alternaria spp. and 11 fungal isolates of other genera. A single amplification product of 357-bp was detected from DNA of A. helianthi isolates. No cross-reaction was observed with any of the other isolates tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification of A. helianthi. This is the first report of an A. helianthi-specific primer set.

  13. [Refinement of taxonomic position of Lactobacillus genus probiotic strains by 16S rDNA and rpoA gene sequencing].

    Science.gov (United States)

    Voronina, O L; Kunda, M S; Bondarenko, V M; Shabanova, N A; Lunin, V G

    2012-01-01

    Revision of the species identification of collection lactobacilli strains based on 16S rDNA and rpoA gene sequencing. 52 lactobacilli cultures that present mostly Gamaleya Research Institute of Epidemiology and Microbiology (GIMC) collection were studied. 16S rDNA gene fragments were amplified by using Lb16a, Lb16b, 16S-midford, 16S-midrev primers. 2 different reverse primers were used for the analysis of rpoA gene depending on lactobacilli species. DNA fragments sequencing was performed with 3130 Genetic Analyzer (Applied Biosystems/Hitachi) with primers used for amplification. The effectiveness of sequencing of 2 targets for differentiation of species within lactobacilli phylogenetic groups was shown. Species diversity was demonstrated for GIMC lactobacilli strain collection that includes members of 9 species. All the strains marked previously as L. acidophilus were determined to belong to L. helveticus. Strains belonging to recently discovered L. farraginis species that has promising application in agriculture were detected. Genetic passports of original strains of 9 species of lactobacilli that are promising for further research.

  14. Increased sensitivity and specificity of Borrelia burgdorferi 16S ribosomal DNA detection.

    Science.gov (United States)

    Lee, Sin Hang; Vigliotti, Veronica S; Vigliotti, Jessica S; Jones, William; Pappu, Suri

    2010-04-01

    The DNA of Borrelia burgdorferi spirochetes extracted by ammonium hydroxide was used as the template for nested polymerase chain reaction (PCR) amplification of the species-specific 16S ribosomal DNA (rDNA). The primers were those well known to be specific for signature sequence amplification of the B burgdorferi sensu lato 16S ribosomal RNA gene. The positive 293-base-pair nested PCR amplicon was subjected to routine direct automated Sanger sequencing. A 50-base sequence excised randomly from the sequencing electrophoretogram between the 2 nested PCR primer binding sites was sufficient for the Basic Local Alignment Search Tool (BLAST) analysis to validate the B burgdorferi sensu lato 16S rDNA without a reasonable doubt. Nested PCR increased the sensitivity of DNA detection by 100- to 1,000-fold. DNA sequence validation based on BLAST algorithms using the GenBank database practically eliminates any possibility of false-positive results due to molecular misidentification. This technology may be a valuable supplement to the current serologic tests for Lyme disease.

  15. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Directory of Open Access Journals (Sweden)

    Weiguo He

    Full Text Available Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100 × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48 were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC and only class IV from their male parent (TC. Triploid hybrids inherited class II and class III from their female parent (RCC and class IV from their male parent (TC. Tetraploid hybrids gained class II and class III from their female parent (RCC, and generated a new 5S rDNA sequence (designated class I-N. The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  16. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  17. Sirt7 stabilizes rDNA heterochromatin through recruitment of DNMT1 and Sirt1.

    Science.gov (United States)

    Ianni, Alessandro; Hoelper, Soraya; Krueger, Marcus; Braun, Thomas; Bober, Eva

    2017-10-21

    Maintenance of highly compact heterochromatin at ribosomal DNA (rDNA) segments is essential to prevent homologous recombination between rDNA repeats and for preserving genomic stability and nucleolar architecture. Here, we investigated the role of Sirtuin 7 (Sirt7) in the regulation of rDNA chromatin structure, rDNA repeat stability and nucleolar organization. We found that Sirt7 mediates heterochromatin formation at rRNA genes through recruitment of DNA methyltransferase 1 and another member of the sirtuin family, Sirt1. Lack of Sirt7 leads to nucleolar fragmentation associated with hypomethylation of rDNA and hyperacetylation of histones at rDNA loci resulting in rDNA and genomic instability. Our findings suggest a novel role of Sirt7 in preventing cellular transformation by mediating maintenance of rDNA repeats and nucleolar integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    DNA extraction and primer choice have a large effect on the observed community structure in all phylogenetic analyses. Although the biases are well known, no comprehensive analysis have been conducted in activated sludge communities. In this study we investigated the effect of bead beating...... intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...

  19. Molecular differentiation of three loach species (Pisces, Cobitidae) based on the nuclear 5S rDNA marker.

    Science.gov (United States)

    Kirtiklis, Lech; Boroń, Alicja; Ptasznik, Piotr; Lusková, Vera; Lusk, Stanislav

    2011-01-01

    The diversity of the 5S rDNA fragment among three loach species: Cobitis taenia, C. elongatoides and Sabanejewia aurata was investigated using universal PCR primers for this gene. Three amplification products were obtained: 220 bp length for C. taenia and C. elongatoides, and 330 bp for S. aurata. Two amplicons with the same length (in Cobitis) were digested with TaqI restriction endonuclease. This enzyme found one restriction site T/CGA in the C. elongatoides fragment, while in the case of C. taenia no cleavage effect was observed. On this basis we constructed an easy and cheap method for loach species discrimination. It seems adequate for effective support of conservation initiatives for endangered loaches.

  20. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  1. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  2. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  4. Use of Single-enzyme PCR-restriction Digestion Barcode Targeting the Internal Transcribed Spacers (ITS rDNA) to Identify Dermatophyte Species.

    Science.gov (United States)

    Rezaei-Matehkolaei, A; Makimura, K; Shidfar, Mr; Zaini, F; Eshraghian, Mr; Jalalizand, N; Nouripour-Sisakht, S; Hosseinpour, L; Mirhendi, H

    2012-01-01

    Dermatophytes are the most common causative agents of superficial mycoses. Species identification of these fungi is important from therapeutic and epidemiological point of wive. Traditional approaches for identification of dermatophytes at the species level, relying on macroscopic and microscopic features of the colonies, usually are time-consuming and unreliable in many circumstances. Recently a broad varieties of rapid and accurate DNA-based techniques were successfuly utilized for species delineation of dermatophytes. The ITS1-5.8S-ITS2 region of rDNA from various reference strains of dermatophyte species were amplified using the universal fungal primers ITS1 and ITS4.The PCR products were digested by a single restriction enzyme, MvaI. The enzyme was evaluated in both in silico and practical PCR-RFLP assay to find the exact differentiating restriction profiles for each species. To validate the standardized PCR-RFLP system, all tested strains were subjected to sequencing and sequence analysis. The obtained RFLP patterns were specific for many species including T. interdigitale, T. rubrum, T. violaceum, M. persicolor, M. audouinii, M. nanum (A. obtusum) and E. floccosum but were similar for some closely related species such as M. canis / M. ferrugineum. Sequencing of the ITS1-5.8S-ITS2 fragment from all type strains affirmed the RFLP findings. It was practically revealed that the ITS-PCR followed by MvaI-RFLP is a useful and reliable schema for identification and differentiation of several pathogenic species and can be used for rapid screening of even closely related species of dermatophytes in clinical and epidemiological settings.

  5. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).

    Science.gov (United States)

    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L

    2015-07-01

    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases. © 2014 Her Majesty the Queen in Right of Canada Molecular Ecology Resources © 2014 John Wiley & Sons Ltd.

  6. USER-derived cloning methods and their primer design.

    Science.gov (United States)

    Salomonsen, Bo; Mortensen, Uffe H; Halkier, Barbara A

    2014-01-01

    Uracil excision-based cloning through USER™ (Uracil-Specific Excision Reagent) is an efficient ligase-free cloning technique that comprises USER cloning, USER fusion, and USER cassette-free (UCF) USER fusion. These USER-derived cloning techniques enable seamless assembly of multiple DNA fragments in one construct. Though governed by a few simple rules primer design for USER-based fusion of PCR fragments can prove time-consuming for inexperienced users. The Primer Help for USER (PHUSER) software is an easy-to-use primer design tool for USER-based methods. In this chapter, we present a PHUSER software protocol for designing primers for USER-derived cloning techniques.

  7. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Wang Nian

    2009-03-01

    Full Text Available Abstract Background Citrus Huanglongbing (HLB is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. Results We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Conclusion Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  8. An assessment of potential diatom "barcode" genes (cox1, rbcL, 18S and ITS rDNA) and their effectiveness in determining relationships in Sellaphora (Bacillariophyta).

    Science.gov (United States)

    Evans, Katharine M; Wortley, Alexandra H; Mann, David G

    2007-07-01

    Due to limited morphological differentiation, diatoms can be very difficult to identify and cryptic speciation is widespread. There is a need for a narrower species concept if contentious issues such as diatom biodiversities and biogeographies are to be resolved. We assessed the effectiveness of several genes (cox1, rbcL, 18S and ITS rDNA) to distinguish cryptic species within the model 'morphospecies', Sellaphora pupula agg. This is the first time that the suitability of cox1 as an identification tool for diatoms has been assessed. A range of cox1 primers was tested on Sellaphora and various outgroup taxa. Sequences were obtained for 34 isolates belonging to 22 Sellaphora taxa and three others (Pinnularia, Eunotia and Tabularia). Intraspecific divergences ranged from 0 to 5bp (=0.8%) and interspecific levels were at least 18bp (=c. 3%). Cox1 divergence was usually much greater than rbcL divergence and always much more variable than 18S rDNA. ITS rDNA sequences were more variable than cox1, but well-known problems concerning intragenomic variability caution against its use in identification. More information and less sequencing effort mean that cox1 can be a very useful aid in diatom identification. The usefulness of cox1 for determining phylogenetic relationships among Sellaphora species was also assessed and compared to rbcL. Tree topologies were very similar, although support values were generally lower for cox1.

  9. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  10. Neural Networks: A Primer

    Science.gov (United States)

    1991-05-01

    second neuron (N1) adjusts its weights likewise (using W, to compute its error). This whole process utilizes the chain rule of derivatives to perform...or determinants. / / 3. Devop a specific funcional model. / 4. Egslmne or trIn the model to known 5. Evaktat toe statistical significance of the

  11. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  12. Establishment and Optimization of Microbial 16S rDNA PCR Reaction Conditions in Fermentation Bed Padding Material

    Directory of Open Access Journals (Sweden)

    DU Dong-xia

    2014-10-01

    Full Text Available In order to study the influence of several potential factors on 16S rDNA PCR reaction conditions in fermentation bed padding mate- rial, five factors(Mg 2+, dNTP, primer, Taq DNA polymerase and DNA templatewere optimized by single factor experiment at 5 concentration levels. Annealing temperatures and amplification cycle numbers were also optimized. The results showed that the optimum 25 μL reaction system comprised 10×PCR buffer 25 μL, MgCl 2 2.0 mmol· L -1, dNTP 0.2 mmol· L -1, primer 0.2 μmol· L -1, Taq DNA polymerase 0.5 U and DNA template 50 ng; and the optimum PCR procedure was as an initial pre-denaturing at 94 ℃ for 4 min, which preceded 25 cycles of dena-turing at 94 ℃ for 45 s, annealing at 53.7 ℃ for 30 s, and extension at 72 ℃ for 90 s, with a final extension at 72 ℃ for 10 min.

  13. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  14. [Comparative analysis of rDNA distribution in metaphase chromosomes of Cucurbitaceae species].

    Science.gov (United States)

    Xu, Yan-Hao; Yang, Fei; Cheng, You-Lin; Ma, Lu; Wang, Jian-Bo; Li, Li-Jia

    2007-05-01

    Fluorescence in situ hybridization (FISH) and double FISH experiments were carried out to ascertain the chromosomal distribution patterns of the 45S and 5S ribosomal DNAs in the three species of Cucurbitaceae. Five pairs of 45S rDNA loci and two pairs of 5S rDNA signals were detected on chromosomes of Cucurbita moschata Duch. Luffa cylindrical Roem. contained five pairs of 45S rDNA loci and one pair of 5S rDNA loci. In Benincasa hispida Cogn., two pairs of 45S rDNA sites and one pair of 5S rDNA site were detected. In this species, 5S rDNA and one pair of the 45S loci were collocated closely in chromosome 7S. 45S rDNA chromosomal distribution patterns were highly conserved among the three species, althoufh their number varied markedly. The 5S rDNA sites on chromosomes among the three species were highly polymorphic. We further discussed differentially evolutionary processes of 45S and 5S rDNA in plant genomes.

  15. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  16. Emulsion primers, their contribution to bonding

    OpenAIRE

    González Sburlati, Rubén Osmar; Sapei, José

    2014-01-01

    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  17. PCR-mediated Detection of Xanthomonas oryzae pv. oryzae by Amplification of the 16S-23S rDNA Spacer Region Sequence

    OpenAIRE

    Naoto, Adachi; Takashi, OKU; Ishikawa Agriculture Research Center; Hiroshima Prefectural University, School of Bioresources

    2000-01-01

    A detection method specific for Xanthomonas oryzae pv. oryzae, the pathogen responsible for bacterial blight of rice, was based on the polymerase chain reaction (PCR) and designed by amplifying the 16S-23S rDNA apacer region from this bacterium. The nucleotide sequence of the spacer region between the 16S and 23S rDNA, consisting of approximately 580-bp, from X. oryzae pv. oryzae, X. campestris pv. alfalfae, X. campestris pv. campestris, X. campestris pv. cannabis, X. campestris pv. citri, X....

  18. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  19. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  20. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  1. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C0t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C0t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  2. Karyotype of asparagus by physical mapping of 45S and 5S rDNA ...

    Indian Academy of Sciences (India)

    Karyotype of asparagus by physical mapping of 45S and 5S rDNA by FISH. Chuan-Liang Deng Rui-Yun Qin Ning-Na Wang Ying Cao Jun Gao Wu-Jun Gao Long-Dou Lu. Research Note Volume 91 Issue 2 August 2012 ... Keywords. Asparagus; fluorescence in situ hybridization; 45S rDNA; 5S rDNA; Asparagus officinalis L.

  3. IDP physics primer

    Energy Technology Data Exchange (ETDEWEB)

    Lockwood, E H

    1958-05-01

    In this document it is proposed to describe the plant site and to outline the nature of the pile in order to show the specific design and layout requirements for the production of plutonium by nuclear synthesis. The selection of the plant site involved a number of special considerations. An essential requirement was a large dependable supply of relatively pure water that remains at a fairly low temperature throughout the year. A large source of power was required to circulate the tremendous quantities of water. The potential dangers connected with the high energies of the nuclear reaction and the formation of a large quantity of radioactive by- products required large distances between each operating section of the plant, and between the plant and main rail and highway routes. The plant site layout and reactor areas are discussed in the first part of the chapter, followed by a functional description of the more essential pile components. The chapter concludes with a discussion of reactor instrumentation. 24 figs., 2 tabs.

  4. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    OpenAIRE

    Lobo, Jorge; Costa, Pedro M; Teixeira, Marcos AL; Ferreira, Maria SG; Costa, Maria H; Costa, Filipe O

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called ?universal? primers have been relatively successful, they still f...

  5. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  6. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-02-07

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Recovery of partial 16S rDNA sequences suggests the presence of Crenarchaeota in the human digestive ecosystem.

    Science.gov (United States)

    Rieu-Lesme, Françoise; Delbès, Céline; Sollelis, Lauriane

    2005-11-01

    Human feces collected from 10 healthy teenagers was analyzed for the presence of Crenarchaeota. After a first polymerase chain reaction (PCR) with Archaea-specific primers, a nested real-time PCR was performed using Crenarchaeota-specific primers. Real-time Crenarchaeotal PCR products detected from four subjects were cloned and the sequencing revealed that most of the partial 16S rRNA gene sequences were highly similar (> or = 97% homology) to sequences affiliated to the Sulfolobus group of the Crenarchaeota phylum. Our findings suggest for the first time that Crenarchaeota might be present in the microbiota of the human digestive ecosystem in which this phylum has never been found yet.

  9. Detection of transient bacteraemia following dental extractions by 16S rDNA pyrosequencing: a pilot study.

    Directory of Open Access Journals (Sweden)

    Alfonso Benítez-Páez

    Full Text Available OBJECTIVE: The current manuscript aims to determine the prevalence, duration and bacterial diversity of bacteraemia following dental extractions using conventional culture-dependent methods and 16S rDNA pyrosequencing. METHODS: The study group included 8 patients undergoing dental extractions under general anaesthesia. Peripheral venous blood samples were collected at baseline, 30 seconds and 15 minutes after the dental extractions. Blood samples were analysed for bacteraemia applying conventional microbiological cultures under aerobic and anaerobic conditions as well as pyrosequencing using universal bacterial primers that target the 16S ribosomal DNA gene. RESULTS: Transient bacteremia was detected by culture-based methods in one sample at baseline time, in eight samples at 30 seconds, and in six samples at 15 minutes after surgical procedure; whereas bacteraemia was detected only in five blood samples at 30 seconds after dental extraction by using pyrosequencing. By applying conventional microbiological methods, a single microbial species was detected in six patients, and Streptococcus viridans was the most frequently cultured identified bacterium. By using pyrosequencing approaches however, the estimated blood microbial diversity after dental extractions was 13.4±1.7 bacterial families and 22.8±1.1 genera per sample. CONCLUSION: The application of 16S rDNA pyrosequencing underestimated the prevalence and duration of bacteraemia following dental extractions, presumably due to not reaching the minimum DNA required for PCR amplification. However, this molecular technique, unlike conventional culture-dependent methods, revealed an extraordinarily high bacterial diversity of post-extraction bacteraemia. We propose that microorganisms recovered by culture may be only the tip of an iceberg of a really diverse microbiota whose viability and potential pathogenicity should be further studied.

  10. Evaluation of a new universal primer for ceramics and alloys.

    Science.gov (United States)

    Azimian, Farhad; Klosa, Karsten; Kern, Matthias

    2012-06-01

    To evaluate in vitro the effect of using a universal primer on the resin bond strength to ceramics (silicate and zirconia) and two noble alloys for metal-ceramic restorations. Disk-like specimens made of four dental restoration materials (silicate ceramic, zirconia ceramic, gold-based alloy and palladium-based alloy) were ground with abrasive paper, prepared for bonding (silicate ceramic: etching with 5% hydrofluoric acid for 60 s; the other materials: air abrasion with 50-µm Al2O3 at 2.5 bar) and ultrasonically cleaned in 96% isopropanol. Eight specimens of each material were primed with a universal primer, 8 specimens were primed with a well-established material-specific method (silicate ceramic: silanization; zirconia ceramic: phosphate monomer-containing primer; alloys: sulfuric monomer-containing primer). Plexiglas tubes filled with a composite resin were bonded to the specimens using an alignment apparatus and a composite luting resin. After storage in 37°C tap water for three days, or 167 days with additional thermocycling, tensile bond strength (TBS) was measured in a universal testing machine at a crosshead speed of 2 mm/min. After 167 days of storage, median TBS values for each material were (well-established method/universal primer) 40 MPa/37 MPa (silicate ceramic), 41 MPa/41 MPa (zirconia ceramic), 20 MPa/17 MPa (gold-based alloy), and 20 MPa/19 MPa (palladium-based alloy). Statistical analysis revealed no statistically significant differences among control groups and test groups. The universal primer seems to be a promising alternative compared to using three different primers for alloys, silicate and zirconia ceramics.

  11. Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes

    OpenAIRE

    Mudassar Anisoddin Kazi; Reddy, C. R. K.; Bhavanath Jha

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa ...

  12. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis.

    Science.gov (United States)

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric

    2011-11-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: http://www.grenoble.prabi.fr/trac/ecoPrimers.

  13. Organization, differential expression and methylation of rDNA in artificial Solanum allopolyploids

    NARCIS (Netherlands)

    Komarova, N.Y.; Grabe, T.; Huigen, D.J.; Hemleben, V.; Volkov, R.A.

    2004-01-01

    Uniparental activity of ribosomal RNA genes (rDNA) in interspecific hybrids is known as nucleolar dominance (ND). To see if difference in rDNA intergenic spacers (IGS) might be correlated with ND, we have used artificial Solanum allopolyploids and back-crossed lines. Combining fluorescence in situ

  14. Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb.

    Science.gov (United States)

    Wang, Wencai; Ma, Lu; Becher, Hannes; Garcia, Sònia; Kovarikova, Alena; Leitch, Ilia J; Leitch, Andrew R; Kovarik, Ales

    2016-09-01

    In all eukaryotes, the highly repeated 35S ribosomal DNA (rDNA) sequences encoding 18S-5.8S-26S ribosomal RNA (rRNA) typically show high levels of intragenomic uniformity due to homogenisation processes, leading to concerted evolution of 35S rDNA repeats. Here, we compared 35S rDNA divergence in several seed plants using next generation sequencing and a range of molecular and cytogenetic approaches. Most species showed similar 35S rDNA homogeneity indicating concerted evolution. However, Cycas revoluta exhibits an extraordinary diversity of rDNA repeats (nucleotide sequence divergence of different copies averaging 12 %), influencing both the coding and non-coding rDNA regions nearly equally. In contrast, its rRNA transcriptome was highly homogeneous suggesting that only a minority of genes ( T substitutions located in symmetrical CG and CHG contexts which were also highly methylated. Both functional genes and pseudogenes appear to cluster on chromosomes. The extraordinary high levels of 35S rDNA diversity in C. revoluta, and probably other species of cycads, indicate that the frequency of repeat homogenisation has been much lower in this lineage, compared with all other land plant lineages studied. This has led to the accumulation of methylation-driven mutations and pseudogenisation. Potentially, the reduced homology between paralogs prevented their elimination by homologous recombination, resulting in long-term retention of rDNA pseudogenes in the genome.

  15. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    A poorly designed primer can result in little or no product due to non-specific ... There are several online tools devoted to serving molecular biologist design effective ... This review intends to provide a guide to choosing the most efficient way to ...

  16. Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep.

    Science.gov (United States)

    Amarante, M R V; Bassetto, C C; Neves, J H; Amarante, A F T

    2014-12-01

    Agricultural ruminants usually harbour mixed infections of gastrointestinal nematodes. A specific diagnosis is important because distinct species can differ significantly in their fecundity and pathogenicity. Haemonchus spp. and Cooperia spp. are the most important gastrointestinal nematodes infecting ruminants in subtropical/tropical environments. In Brazil, C. punctata is more adapted to cattle than sheep. Additionally, C. spatulata appears to be more adapted to cattle, whereas C. curticei is more adapted to sheep. However, infection of sheep with C. punctata is common when cattle and sheep share the same pasture. Although morphological analyses have been widely used to identify nematodes, molecular methods can overcome technical limitations and help improve species-specific diagnoses. Genetic markers in the first and second internal transcribed spacers (ITS-1 and ITS-2, respectively) of nuclear ribosomal DNA (rDNA) have been used successfully to detect helminths. In the present study, the ITS-1 region was analysed and used to design a species-specific oligonucleotide primer pair to identify C. curticei. The polymerase chain reaction (PCR) product was sequenced and showed 97% similarity to C. oncophora partial ITS-1 clones and 99% similarity to the C. curticei sequence JF680982. The specificity of this primer pair was corroborated by the analysis of 17 species of helminths, including C. curticei, C. punctata and C. spatulata. Species-specific diagnosis, which has implications for rapid and reliable identification, can support studies on the biology, ecology and epidemiology of trichostrongylid nematodes in a particular geographical location.

  17. Hosts, distribution and genetic divergence (16S rDNA) of Amblyomma dubitatum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, Santiago; Venzal, José M; Labruna, Marcelo B; Mastropaolo, Mariano; González, Enrique M; Mangold, Atilio J; Guglielmone, Alberto A

    2010-08-01

    We supply information about hosts and distribution of Amblyomma dubitatum. In addition, we carry out an analysis of genetic divergence among specimens of A. dubitatum from different localities and with respect to other Neotropical Amblyomma species, using sequences of 16S rDNA gene. Although specimens of A. dubitatum were collected on several mammal species as cattle horse, Tapirus terrestris, Mazama gouazoubira, Tayassu pecari, Sus scrofa, Cerdocyon thous, Myocastor coypus, Allouata caraya, Glossophaga soricina and man, most records of immature and adult stages of A. dubitatum were made on Hydrochoerus hydrochaeris, making this rodent the principal host for all parasitic stages of this ticks. Cricetidae rodents (Lundomys molitor, Scapteromys tumidus), opossums (Didelphis albiventris) and vizcacha (Lagostomus maximus) also were recorded as hosts for immature stages. All findings of A. dubitatum correspond to localities of Argentina, Brazil, Paraguay and Uruguay, and they were concentrated in the Biogeographical provinces of Pampa, Chaco, Cerrado, Brazilian Atlantic Forest, Parana Forest and Araucaria angustifolia Forest. The distribution of A. dubitatum is narrower than that of its principal host, therefore environmental variables rather than hosts determine the distributional ranges of this tick. The intraspecific genetic divergence among 16S rDNA sequences of A. dubitatum ticks collected in different localities from Argentina, Brazil and Uruguay was in all cases lower than 0.8%, whereas the differences with the remaining Amblyomma species included in the analysis were always bigger than 6.8%. Thus, the taxonomic status of A. dubitatum along its distribution appears to be certain at the specific level.

  18. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study.

    Science.gov (United States)

    Janz, V; Schoon, J; Morgenstern, C; Preininger, B; Reinke, S; Duda, G; Breitbach, A; Perka, C F; Geissler, S

    2018-01-01

    The objective of this study was to develop a test for the rapid (within 25 minutes) intraoperative detection of bacteria from synovial fluid to diagnose periprosthetic joint infection (PJI). The 16s rDNA test combines a polymerase chain reaction (PCR) for amplification of 16s rDNA with a lateral flow immunoassay in one fully automated system. The synovial fluid of 77 patients undergoing joint aspiration or primary or revision total hip or knee surgery was prospectively collected. The cohort was divided into a proof-of-principle cohort (n = 17) and a validation cohort (n = 60). Using the proof-of-principle cohort, an optimal cut-off for the discrimination between PJI and non-PJI samples was determined. PJI was defined as detection of the same bacterial species in a minimum of two microbiological samples, positive histology, and presence of a sinus tract or intra-articular pus. The 16s rDNA test proved to be very robust and was able to provide a result in 97% of all samples within 25 minutes. The 16s rDNA test was able to diagnose PJI with a sensitivity of 87.5% and 82%, and a specificity of 100% and 89%, in the proof-of-principle and validation cohorts, respectively. The microbiological culture of synovial fluid achieved a sensitivity of 80% and a specificity of 93% in the validation cohort. The 16s rDNA test offers reliable intraoperative detection of all bacterial species within 25 minutes with a sensitivity and specificity comparable with those of conventional microbiological culture of synovial fluid for the detection of PJI. The 16s rDNA test performance is independent of possible blood contamination, culture time and bacterial species. Cite this article : V. Janz, J. Schoon, C. Morgenstern, B. Preininger, S. Reinke, G. Duda, A. Breitbach, C. F. Perka, S. Geissler. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study. Bone Joint Res 2018;7:12-19. DOI: 10

  20. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    Science.gov (United States)

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  2. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  3. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; hide

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  4. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  5. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  6. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    Science.gov (United States)

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  7. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  8. Development of an improved species specific PCR test for detection of Haemophilus parasuis

    DEFF Research Database (Denmark)

    Angen, Øystein; Oliveira, Simone; Ahrens, Peter

    2007-01-01

    A PCR test for identification of Haemophilus parasuis was optimized using the 16S rDNA sequences of the 15 serotype reference strains of H. parasuis. The test was evaluated on a collection of 218 Danish field isolates as well as on 81 representatives of 27 other species, including genetically...... affiliated species within Pasteurellaceae. In addition, DNA preparations from 56 H. parasuis isolates from North America were included. To obtain a test that was specific for H. parasuis, a multiplex PCR using 3 different primers was developed. The PCR test produced an amplicon of approximately 1090 bp only...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...

  9. Optimisation of 16S rDNA amplicon sequencing protocols for microbial community profiling of anaerobic digesters

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; McIlroy, Simon Jon; Larsen, Poul

    integrity, with optimal parameters involving four times harsher lysis conditions than recommended for the commercial kit, and appeared to be similar for both the mesophilic and thermophilic reactor biomass samples. The community profiling was found to be greatly influenced by the selected PCR primers......RNA gene amplicon sequencing is rapid, cheap, high throughput, and has high taxonomic resolution. However, biases are introduced in multiple steps of this approach, including non-representative DNA extraction and uneven taxonomic coverage of selected PCR primers, potentially giving a skewed view...... of the community composition. As such sample specific optimisation and standardisation of DNA extraction, as well PCR primer selection, are essential to minimising the potential for such biases. The aim of this study was to develop a protocol for optimized community profiling of anaerobic digesters. The Fast...

  10. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  11. RUCS: rapid identification of PCR primers for unique core sequences.

    Science.gov (United States)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online.

  12. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    the C-banding pattern, which enabled unequivocal chromosome identification. This study suggests that gene mapping accuracy may be improved by using probes with well-characterized and narrow hybridization sites as cytological markers which are situated close to the gene locus. One of the rDNA loci...... is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  13. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    . In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible...... explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis....

  14. Analysis of intergenic spacer transcripts suggests ‘read-around’ transcription of the extrachromosomal circular rDNA in Euglena gracilis

    Science.gov (United States)

    Greenwood, Spencer J.; Schnare, Murray N.; Cook, James R.; Gray, Michael W.

    2001-01-01

    We report here the sequence of the 1743 bp intergenic spacer (IGS) that separates the 3′-end of the large subunit ribosomal RNA (rRNA) gene from the 5′-end of the small subunit (SSU) rRNA gene in the circular, extrachromosomal ribosomal DNA (rDNA) of Euglena gracilis. The IGS contains a 277 nt stretch of sequence that is related to a sequence found in ITS 1, an internal transcribed spacer between the SSU and 5.8S rRNA genes. Primer extension analysis of IGS transcripts identified three abundant reverse transcriptase stops that may be analogous to the transcription initiation site (TIS) and two processing sites (A′ and A0) that are found in this region in other eukaryotes. Features that could influence processing at these sites include an imperfect palindrome near site A0 and a sequence near site A′ that could potentially base pair with U3 small nucleolar RNA. Our identification of the TIS (verified by mung bean nuclease analysis) is considered tentative because we also detected low-abundance transcripts upstream of this site throughout the entire IGS. This result suggests the possibility of ‘read-around’ transcription, i.e. transcription that proceeds multiple times around the rDNA circle without termination. PMID:11353089

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. 18S rDNA sequences and the holometabolous insects.

    Science.gov (United States)

    Carmean, D; Kimsey, L S; Berbee, M L

    1992-12-01

    The Holometabola (insects with complete metamorphosis: beetles, wasps, flies, fleas, butterflies, lacewings, and others) is a monophyletic group that includes the majority of the world's animal species. Holometabolous orders are well defined by morphological characters, but relationships among orders are unclear. In a search for a region of DNA that will clarify the interordinal relationships we sequenced approximately 1080 nucleotides of the 5' end of the 18S ribosomal RNA gene from representatives of 14 families of insects in the orders Hymenoptera (sawflies and wasps), Neuroptera (lacewing and antlion), Siphonaptera (flea), and Mecoptera (scorpionfly). We aligned the sequences with the published sequences of insects from the orders Coleoptera (beetle) and Diptera (mosquito and Drosophila), and the outgroups aphid, shrimp, and spider. Unlike the other insects examined in this study, the neuropterans have A-T rich insertions or expansion regions: one in the antlion was approximately 260 bp long. The dipteran 18S rDNA evolved rapidly, with over 3 times as many substitutions among the aligned sequences, and 2-3 times more unalignable nucleotides than other Holometabola, in violation of an insect-wide molecular clock. When we excluded the long-branched taxa (Diptera, shrimp, and spider) from the analysis, the most parsimonious (minimum-length) trees placed the beetle basal to other holometabolous orders, and supported a morphologically monophyletic clade including the fleas+scorpionflies (96% bootstrap support). However, most interordinal relationships were not significantly supported when tested by maximum likelihood or bootstrapping and were sensitive to the taxa included in the analysis. The most parsimonious and maximum-likelihood trees both separated the Coleoptera and Neuroptera, but this separation was not statistically significant.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    National Research Council Canada - National Science Library

    Lobo, Jorge; Costa, Pedro M; Teixeira, Marcos A L; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O

    2013-01-01

    Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g...

  18. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome

    National Research Council Canada - National Science Library

    Griffen, Ann L; Beall, Clifford J; Firestone, Noah D; Gross, Erin L; Difranco, James M; Hardman, Jori H; Vriesendorp, Bastienne; Faust, Russell A; Janies, Daniel A; Leys, Eugene J

    2011-01-01

    Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest...

  19. Assessment of rDNA IGS as a molecular marker in the Simulium damnosum complex.

    Science.gov (United States)

    Morales-Hojas, R; Post, R J; Cheke, R A; Wilson, M D

    2002-12-01

    For five cytospecies of the Simulium damnosum Theobald complex of blackflies (Diptera: Simuliidae) from West Africa, both ends of the intergenic spacer region (IGS) of the rDNA have been sequenced with the aim of developing specific molecular markers. No specific differences in these two regions were detected between Simulium sanctipauli V. & D., Simulium sirbanum V. & D., Simulium soubrense V. & D., Simulium squamosum Enderlein and Simulium yahense V. & D., except in the number of A subrepeats at the 5' end of the IGS (two in S. squamosum and four or five in the others) and in position 310 of the 3' end (a C in S. squamosum and a G in the others). However, genetic distances within and between species overlapped. These DNA sequences had no strong phylogenetic signal, and the trees obtained were mostly unresolved. Although most sequences from S. squamosum clustered together, a few of them were more similar to those in other cytospecies. These results could be explained either by hybridization with genetic introgression or by ancestral polymorphism and recent speciation.

  20. Are "universal" DNA primers really universal?

    Science.gov (United States)

    Sharma, Pranay; Kobayashi, Tsuyoshi

    2014-11-01

    "Universal" DNA primers LCO 1490 and HCO 2198 were originally designed from three coding and six anticoding strands by comparing highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across 15 taxa. These primers have been successful in amplifying a 710-bp fragment of highly conserved regions of the COI gene for more than 80 invertebrate species from 11 phyla. In the present study, 130,843 variations were reviewed in the primer region of mitochondrial molecular markers by comparing 725 COI sequences from the kingdom Animalia. It was found that, for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions, compared to 12 in the original study. For ascidians, fungi and vertebrates, it showed approximately 50 % conserved regions, dropping to one conserved region for echinoderms. However, the reverse primer (HCO 2198) was highly conserved across 725 COI primer sequences. A similar pattern was observed in amino acid distributions. There was a significant difference in the means of base pair differences from the level of family, genus and species for LCO 1490 [analysis of variance (ANOVA), F 6,188 = 8.193, P primers from reference sequences belonging to the level of order (maximum 5 bp differences), family (maximum 6 bp differences) or genus (maximum 1 bp difference). Reverse primers can be designed from the level of family (maximum 5 bp differences) or genus (maximum 2 bp differences).

  1. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites....... While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown......Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...

  2. Inaccurate identification of rotavirus genotype G9 as genotype G3 strains due to primer mismatch

    Directory of Open Access Journals (Sweden)

    Mitui Marcelo

    2012-08-01

    Full Text Available Abstract Reverse transcription (RT-PCR is now the standard method for typing group A rotaviruses (RVA to monitor the circulating genotypes in a population. Selection of primers that can accurately type the circulating genotypes is crucial in the context of vaccine introduction and correctly interpreting the impact of vaccination on strain distribution. To our knowledge this study is the first report from Asia of misidentification of genotype G9 as G3 due to a primer-template mismatch. We tested two published G-genotype specific primers sets, designed by Gouvea and colleagues (Set A and Iturriza‐Gomara and colleagues (Set B on RVA from Hong Kong and Sri Lanka. Among 52 rotaviruses typed as G3 by set A primers, 36 (69.2% were identified as G9 by nucleotide sequencing and set B primers. Moreover, of 300 rotaviruses tested, 28.3% were untypable by set A primers whereas only 12.3% were untypable by set B primers. Our findings reinforce the need to periodically monitor the primers used for RVA genotyping.

  3. Inaccurate identification of rotavirus genotype G9 as genotype G3 strains due to primer mismatch.

    Science.gov (United States)

    Mitui, Marcelo Takahiro; Chandrasena, Tga Nilmini; Chan, Paul Ks; Rajindrajith, Shaman; Nelson, E Anthony S; Leung, Ting Fan; Nishizono, Akira; Ahmed, Kamruddin

    2012-08-03

    Reverse transcription (RT)-PCR is now the standard method for typing group A rotaviruses (RVA) to monitor the circulating genotypes in a population. Selection of primers that can accurately type the circulating genotypes is crucial in the context of vaccine introduction and correctly interpreting the impact of vaccination on strain distribution. To our knowledge this study is the first report from Asia of misidentification of genotype G9 as G3 due to a primer-template mismatch. We tested two published G-genotype specific primers sets, designed by Gouvea and colleagues (Set A) and Iturriza-Gomara and colleagues (Set B) on RVA from Hong Kong and Sri Lanka. Among 52 rotaviruses typed as G3 by set A primers, 36 (69.2%) were identified as G9 by nucleotide sequencing and set B primers. Moreover, of 300 rotaviruses tested, 28.3% were untypable by set A primers whereas only 12.3% were untypable by set B primers. Our findings reinforce the need to periodically monitor the primers used for RVA genotyping.

  4. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  5. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  6. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  7. Incomplete sequence homogenization in 45S rDNA multigene families: intermixed IGS heterogeneity within the single NOR locus of the polyploid species Medicago arborea (Fabaceae).

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-08-01

    Ribosomal sequences have become the classical example of the genomic homogenization of nuclear multigene families. Despite theoretical advantages and modelling predictions that support concerted evolution of the 45S rDNA, several reports have found intragenomic polymorphisms. However, the origins and causes of these rDNA polymorphisms are difficult to assess because seed plants show a wide range of 45S rDNA loci number variation, especially in polyploids. Medicago arborea is a tetraploid species that has a single 45S rDNA locus. This feature makes this species a suitable case study to assess the fate of ribosomal IGS homogenization in polyploid species showing nucleolus organizer region (NOR) reduction. The intergenic spacer (IGS) region was amplified by long PCR and the fragments were cloned and sequenced by a primer-walking strategy. The physical mapping of the whole and partial IGS variants was assessed by fluorescent in situ hybridization (FISH) and fibre-FISH methods on mitotic chromosomes and extended DNA fibres, respectively. Two IGS fragments of 4·8 and 3·5 kb were obtained showing structural features of functional sequences. The shorter variant appears to be a truncated copy of the 4·8 kb fragment that lacks the duplication of the transcription initiation site region and the entire D region. The physical localization of the two IGS variants on metaphase chromosomes and extended DNA fibres using FISH corroborated their joint presence within the same locus. In addition, no spatial structure of the two variants was detected within the NOR. The results suggest that full sequence homogenization is not operating within the NOR locus of M. arborea. The structure of the NOR locus reported here departs from the models of IGS heterogeneity present in plants and caution against assuming the widespread belief that intragenomic ribosomal heterogeneity is mainly due to sequence variation between paralogous loci. © The Author 2014. Published by Oxford University

  8. Development of a multiplexed polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay to identify common members of the Subgenera Culex (Culex) and Culex (Phenacomyia) in Guatemala

    National Research Council Canada - National Science Library

    Kent, Rebekah J; Deus, Stephen; Williams, Martin; Savage, Harry M

    2010-01-01

    .... (Cux.) nigripalpus/Cx. (Cux.) thriambus, and Cx. (Phc.) lactator were identified directly with a multiplexed primer cocktail comprising a conserved forward primer and specific reverse primers targeting ribosomal DNA (rDNA...

  9. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  10. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  11. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    Science.gov (United States)

    Kazi, Mudassar Anisoddin; Reddy, C R K; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters.

  12. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  13. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    Directory of Open Access Journals (Sweden)

    Mudassar Anisoddin Kazi

    Full Text Available The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2 phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters.

  14. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  15. Ribosomal DNA stability is supported by many 'buffer genes'-introduction to the Yeast rDNA Stability Database.

    Science.gov (United States)

    Kobayashi, Takehiko; Sasaki, Mariko

    2017-01-01

    The ribosomal RNA gene (rDNA) is the most abundant gene in yeast and other eukaryotic organisms. Due to its heavy transcription, repetitive structure and programmed replication fork pauses, the rDNA is one of the most unstable regions in the genome. Thus, the rDNA is the best region to study the mechanisms responsible for maintaining genome integrity. Recently, we screened a library of ∼4800 budding yeast gene knockout strains to identify mutants defective in the maintenance of rDNA stability. The results of this screen are summarized in the Yeast rDNA Stability (YRS) Database, in which the stability and copy number of rDNA in each mutant are presented. From this screen, we identified ∼700 genes that may contribute to the maintenance of rDNA stability. In addition, ∼50 mutants had abnormally high or low rDNA copy numbers. Moreover, some mutants with unstable rDNA displayed abnormalities in another chromosome. In this review, we introduce the YRS Database and discuss the roles of newly identified genes that contribute to rDNA maintenance and genome integrity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  17. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  18. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  19. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  20. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  1. Budding Yeast Rif1 Controls Genome Integrity by Inhibiting rDNA Replication.

    Science.gov (United States)

    Shyian, Maksym; Mattarocci, Stefano; Albert, Benjamin; Hafner, Lukas; Lezaja, Aleksandra; Costanzo, Michael; Boone, Charlie; Shore, David

    2016-11-01

    The Rif1 protein is a negative regulator of DNA replication initiation in eukaryotes. Here we show that budding yeast Rif1 inhibits DNA replication initiation at the rDNA locus. Absence of Rif1, or disruption of its interaction with PP1/Glc7 phosphatase, leads to more intensive rDNA replication. The effect of Rif1-Glc7 on rDNA replication is similar to that of the Sir2 deacetylase, and the two would appear to act in the same pathway, since the rif1Δ sir2Δ double mutant shows no further increase in rDNA replication. Loss of Rif1-Glc7 activity is also accompanied by an increase in rDNA repeat instability that again is not additive with the effect of sir2Δ. We find, in addition, that the viability of rif1Δ cells is severely compromised in combination with disruption of the MRX or Ctf4-Mms22 complexes, both of which are implicated in stabilization of stalled replication forks. Significantly, we show that removal of the rDNA replication fork barrier (RFB) protein Fob1, alleviation of replisome pausing by deletion of the Tof1/Csm3 complex, or a large deletion of the rDNA repeat array all rescue this synthetic growth defect of rif1Δ cells lacking in addition either MRX or Ctf4-Mms22 activity. These data suggest that the repression of origin activation by Rif1-Glc7 is important to avoid the deleterious accumulation of stalled replication forks at the rDNA RFB, which become lethal when fork stability is compromised. Finally, we show that Rif1-Glc7, unlike Sir2, has an important effect on origin firing outside of the rDNA locus that serves to prevent activation of the DNA replication checkpoint. Our results thus provide insights into a mechanism of replication control within a large repetitive chromosomal domain and its importance for the maintenance of genome stability. These findings may have important implications for metazoans, where large blocks of repetitive sequences are much more common.

  2. Budding Yeast Rif1 Controls Genome Integrity by Inhibiting rDNA Replication.

    Directory of Open Access Journals (Sweden)

    Maksym Shyian

    2016-11-01

    Full Text Available The Rif1 protein is a negative regulator of DNA replication initiation in eukaryotes. Here we show that budding yeast Rif1 inhibits DNA replication initiation at the rDNA locus. Absence of Rif1, or disruption of its interaction with PP1/Glc7 phosphatase, leads to more intensive rDNA replication. The effect of Rif1-Glc7 on rDNA replication is similar to that of the Sir2 deacetylase, and the two would appear to act in the same pathway, since the rif1Δ sir2Δ double mutant shows no further increase in rDNA replication. Loss of Rif1-Glc7 activity is also accompanied by an increase in rDNA repeat instability that again is not additive with the effect of sir2Δ. We find, in addition, that the viability of rif1Δ cells is severely compromised in combination with disruption of the MRX or Ctf4-Mms22 complexes, both of which are implicated in stabilization of stalled replication forks. Significantly, we show that removal of the rDNA replication fork barrier (RFB protein Fob1, alleviation of replisome pausing by deletion of the Tof1/Csm3 complex, or a large deletion of the rDNA repeat array all rescue this synthetic growth defect of rif1Δ cells lacking in addition either MRX or Ctf4-Mms22 activity. These data suggest that the repression of origin activation by Rif1-Glc7 is important to avoid the deleterious accumulation of stalled replication forks at the rDNA RFB, which become lethal when fork stability is compromised. Finally, we show that Rif1-Glc7, unlike Sir2, has an important effect on origin firing outside of the rDNA locus that serves to prevent activation of the DNA replication checkpoint. Our results thus provide insights into a mechanism of replication control within a large repetitive chromosomal domain and its importance for the maintenance of genome stability. These findings may have important implications for metazoans, where large blocks of repetitive sequences are much more common.

  3. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  4. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  5. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  6. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  7. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  8. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...... is capable of effectively improving the specificity of PCR amplification and enriching the yield of target DNA fragments; it offers a new avenue for closing gaps left by current sequencing methods...

  10. Electrochemical primer extension for the detection of single nucleotide polymorphisms in the cardiomyopathy associated MYH7 gene.

    Science.gov (United States)

    Debela, A M; Thorimbert, S; Hasenknopf, B; O'Sullivan, C K; Ortiz, M

    2016-01-14

    We report the labelling of dideoxy nucleotides (ddNTPs) for use in electrochemical array based primer extension for the detection of single nucleotide polymorphisms (SNPs). The results confirm the extension of the immobilised primers for each of the four ddNTPs, representing a significant advance in achieving a cost-effective platform for screening of disease-specific SNPs.

  11. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  12. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  13. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  14. Internal phylogeny of the Chilopoda (Myriapoda, Arthropoda) using complete 18S rDNA and partial 28S rDNA sequences.

    Science.gov (United States)

    Giribet, G; Carranza, S; Riutort, M; Baguñà, J; Ribera, C

    1999-01-29

    The internal phylogeny of the 'myriapod' class Chilopoda is evaluated for 12 species belonging to the five extant centipede orders, using 18S rDNA complete gene sequence and 28S rDNA partial gene sequence data. Equally and differentially weighted parsimony, neighbour-joining and maximum-likelihood were used for phylogenetic reconstruction, and bootstrapping and branch support analyses were performed to evaluate tree topology stability. The results show that the Chilopoda constitute a monophyletic group that is divided into two lines, Notostigmophora (= Scutigeromorpha) and Pleurostigmophora, as found in previous morphological analyses. The Notostigmophora are markedly modified for their epigenic mode of life. The first offshoot of the Pleurostigmophora are the Lithobiomorpha, followed by the Craterostigmomorpha and by the Epimorpha s. str. (= Scolopendromorpha + Geophilomorpha), although strong support for the monophyly of the Epimorpha s. lat. (= Craterostigmomorpha + Epimorpha s. str.) is only found in the differentially weighted parsimony analysis.

  15. rDNA amplification in previtellogenic and vitellogenic oocytes of symphylans (Arthropoda, Myriapoda).

    Science.gov (United States)

    Jabłońska, A; Szklarzewicz, T; Jankowska, W; Kukiełka, M; Biliński, S M

    2002-01-01

    Tube-shaped ovaries of symphylans house numerous developing oocytes that are accompanied by somatic follicular cells. Oocyte nuclei (germinal vesicles) are relatively large and ovoid. During early previtellogenesis they contain compact spherical bodies and lampbrush chromosomes immersed in a translucent karyoplasm. Fluorescent labeling with DAPI and propidium iodide has revealed the presence of both DNA and RNA in the spherical bodies. As previtellogenesis advances, small RNA- and AgNOR-positive nucleoli bud off from these bodies. Full-grown nucleoli consist of coarse-granular material and comprise electron-transparent vacuoles. Our results suggest that in symphylan germinal vesicles amplification of rDNA genes takes place, and that the spherical bodies represent accumulations of extrachromosomal rDNA (rDNA bodies) after commencement of transcriptional activity.

  16. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  17. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  18. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  19. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  20. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  1. PCR bias associated with conserved primer binding sites, used to determine genotype diversity within Citrus tristeza virus populations.

    Science.gov (United States)

    Read, David Alan; Pietersen, Gerhard

    2016-11-01

    Citrus tristeza virus (CTV) is present in almost all of the major citrus production areas where it continues to reduce the profitability of citriculture. The accurate characterisation of CTV populations, which are usually made up of a number of disparate strains, requires the use of robust PCR protocols. Mismatches between primers and their corresponding binding sites may introduce primer-associated bias during amplification. The primer-associated bias of four sets of CTV specific primers, targeting the A and F regions and the p33 and p23 genes, were evaluated. This was done through the amplification of defined templates followed by their characterisation using the sequencing of multiple clones, as well as Illumina next generation sequencing. High levels of bias were found to be associated with the primer pairs targeting the A and F regions. The p33 gene primers were found to be biased against two genotypes and suggestions for preventing this apparent bias are discussed. The primer pair targeting the conserved p23 gene was found to have very little associated bias. Primers should undergo rigorous screening before being used to characterize virus populations that are known to exhibit high levels of variation, especially within primer binding sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  3. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  4. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... Fusarium species is comprised of pathogens, parasites and saprophytes, and occur on all vegetative and ... Potato dextrose agar (PDA) was used to revive the Fusarium cultures received from IMTECH. Small piece from the .... 658 bp. F. solani. (Fig.1). 40 cycles; 94°C for 1 min,. 58°C for 1 min, and 72°C for.

  5. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucle...

  6. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Detection of Fusarium solani causal agent of wilt and rots in many plant species are difficult if based only on morphological characteristics. Beside this, morphological discrimination requires special skill and the expertise of taxonomists or specialists. To simplify the detection and discrimination of F. solani from other ...

  7. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  8. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Directory of Open Access Journals (Sweden)

    Henrique F Santos

    Full Text Available BACKGROUND: Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. CONCLUSIONS

  9. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool.

    Directory of Open Access Journals (Sweden)

    Bin Zou

    Full Text Available An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA genes by polymerase chain reaction (PCR. However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3 and the SILVA database (v119 for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples.

  10. Development of a species-specific PCR assay for identification of the strictly anaerobic bacterium Selenomonas lacticifex found in biofilm-covered surfaces in brewery bottling halls.

    Science.gov (United States)

    Felsberg, J; Jelínková, M; Kubizniaková, P; Matoulková, D

    2014-11-01

    In recent years, beer-spoilage cases from strictly anaerobic bacteria have risen in frequency, in connection with the production of non-pasteurized, non-alcohol and low-alcoholic beers and with the lowering of dissolved oxygen in the packaged beer. Selenomonas lacticifex, found in brewer's yeast and in biofilms covering some surfaces in brewery bottling area, is considered to be a beer-spoilage organism. This study aims to develop S. lacticifex-specific PCR assay. The objective of this study was also evaluation of the specificity and reproducibility of the developed PCR assay in real brewery samples. Three primers (one forward and two reverse) were designed for identification of the strictly anaerobic bacterium S. lacticifex on the basis of the species-specific sequences of the 16S rDNA region. The specificity of the primers was tested against 44 brewery-related non-target micro-organisms that could potentially occur in the same brewery specimens. None of the primer pairs amplified DNA from any of the non-S. lacticifex strains tested including genera from the same family (Pectinatus, Megasphaera, Zymophilus) and the closely related species Selenomonas ruminantium, showing thus 100% specificity. The PCR assay developed in this study enables the detection of the strictly anaerobic bacterium S. lacticifex in real brewery samples including pitching yeast. Selenomonas lacticifex-specific PCR assay developed in this study allows for the extension of the spectra of detected beer-spoilage micro-organisms in brewing laboratories and thus lowering the risk of contamination of the final product. © 2014 The Society for Applied Microbiology.

  11. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  12. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  13. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  14. Physical mapping of 5S and 45S rDNA in Chrysanthemum and ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 91; Issue 2. Physical mapping of 5S and 45S rDNA in Chrysanthemum and related genera of the Anthemideae by FISH, and species relationships. Magdy Hussein Abd El-Twab Katsuhiko Kondo. Research Note Volume 91 Issue 2 August 2012 pp 245-249 ...

  15. Physical mapping of 5S and 45S rDNA in Chrysanthemum and ...

    Indian Academy of Sciences (India)

    2012-08-09

    Aug 9, 2012 ... [Abd El-Twab M. H. and Kondo K. 2012 Physical mapping of 5S and 45S rDNA in Chrysanthemum and related genera of the Anthemideae by FISH, and species relationships. J. Genet. 91, 245–249]. Introduction. The present study has shown that fluorescence in situ hybridization (FISH) physical mapping ...

  16. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...

  17. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  18. Chromosomal localization of rDNA and DAPI bands in solanaceous ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia. Home; Journals; Journal of Genetics; Volume 89; Issue 4. Chromosomal localization of rDNA and DAPI bands in solanaceous medicinal plant Hyoscyamus niger L. Umesh C. Lavania Jyotsna ...

  19. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    Science.gov (United States)

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process.

  20. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination.

    Directory of Open Access Journals (Sweden)

    Kamilla Mundbjerg

    2015-12-01

    Full Text Available Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2 and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3 display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3 in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time.

  1. Population distribution of 45S and 5S rDNA in golden mahseer, Tor ...

    Indian Academy of Sciences (India)

    But FISH data showed significant difference between the populations, four of the five populations showed six 18S (three pairs) and two 5S (one pair) signals with positional polymorphism, while one population showed eight 18S and four 5S signals, respectively. Southern blot data confirms that 5S rDNA clusters present on ...

  2. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    Science.gov (United States)

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization.

  3. Species‐specific oligonucleotide probes for the detection and identification of Lactobacillus isolated from mouse faeces

    National Research Council Canada - National Science Library

    Park, S.H; Itoh, K

    2005-01-01

    .... Methods and Results:  The specificity of oligonucleotide probes was evaluated by dot blot hybridization to 16S rDNA and 23S rDNA amplified by PCR from 12 Lactobacillus type strains and 100 strains of Lactobacillus isolated from mouse faeces...

  4. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  5. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  6. Modified Epoxy Adhesives and Primers

    Science.gov (United States)

    1992-06-30

    examine quantitatively the factors which are responsible for the magnitude of V , but the authors conclude that the thermal history and the magnitude of...34free volumen The specific volume(V) was obtained from density measurements, and its temperature dependence determined by thermomechanical analysis (TNA...but the magnitude of the change depends on the geometry of the joint. The improvement is greatest for low temperature-cured systems. 9. The reduced rate

  7. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  8. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    OpenAIRE

    Cannon, M.V.; Hester, J; Shalkhauser, A.; Chan, E. R.; Logue, K.; S. T. Small; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40?mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pa...

  9. Wet-lab tested microRNA assays for qPCR studies with SYBR®Green and DNA primers in pig tissues

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Skovgaard, Kerstin; Córdoba, Sarai

    2014-01-01

    have previously developed two useful tools in the field of microRNA quantitative real time PCR (qPCR): 1) a very specific, sensitive and simple qPCR method based on DNA primers, MiR-specific qPCR; and 2) the free primer-design software miRprimer. The present study integrates in a publicly accessible...

  10. Evaluation of 16S rRNA gene primer pairs for monitoring microbial community structures showed high reproducibility within and low comparability between datasets generated with multiple archaeal and bacterial primer pairs

    Directory of Open Access Journals (Sweden)

    Martin Alexander Fischer

    2016-08-01

    Full Text Available The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community

  11. Issues Primer. EEE708 Negotiated Study Program.

    Science.gov (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  12. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  13. A Primer on the Functional Equation

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 10. A Primer on the Functional Equation: f(x+y) = f(x) + f(y). Kaushal Verma. General Article Volume 22 Issue 10 October 2017 pp 935-941. Fulltext. Click here to view fulltext PDF. Permanent link:

  14. A Primer on Policies for Jobs

    OpenAIRE

    Bhattacharya, Rwitwika; Griffith, Breda; Chen, Derek H. C.; Nallari, Raj; Andriamananjara, Soamiely; Wang, Yidan

    2012-01-01

    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  15. Reforming Science Instruction in California: A Primer

    Science.gov (United States)

    EdSource, 2017

    2017-01-01

    As schools across the state implement the Next Generation Science Standards, this EdSource primer provides an easy-to-read guide for parents and other community members to understand the rationale for the standards and their potential to affect science instruction in California schools. California adopted the Next Generation Science Standards, or…

  16. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    Directory of Open Access Journals (Sweden)

    Wentao Xu

    Full Text Available In this study, a novel universal primer-multiplex-PCR (UP-M-PCR method adding a universal primer (UP in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP. PCR products were analyzed on sequencing gel electrophoresis (SGE which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  17. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  18. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  19. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers.

    Science.gov (United States)

    Robeson, Michael S; Costello, Elizabeth K; Freeman, Kristen R; Whiting, Jeremy; Adams, Byron; Martin, Andrew P; Schmidt, Steve K

    2009-12-11

    The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms.Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in a variety of soils.

  20. Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes.

    Science.gov (United States)

    Park, So Yeon; Lee, Young Sun; Koh, Young Jin; Hur, Jae-Sun; Jung, Jae Sung

    2010-10-01

    Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards.

  1. Molecular subtyping of Blastocystis spp. using a new rDNA marker from the mitochondria-like organelle genome.

    Science.gov (United States)

    Poirier, P; Meloni, D; Nourrisson, C; Wawrzyniak, I; Viscogliosi, E; Livrelli, V; Delbac, F

    2014-04-01

    Blastocystis spp. are common anaerobic intestinal protozoa found in both human and animals. They are characterized by a high genetic diversity with at least 17 subtypes (STs) that have been described on the basis of a 600 bp 'barcoding region' from the 18S rDNA gene. However, analysis of the recently sequenced genome of a Blastocystis ST7 isolate (strain B) revealed the presence of multiple variable copies of the 18S rDNA gene, with 17 completely assembled copies. Comparison of the barcoding region from these 17 copies allowed us to classify the 18S rDNA sequences into 6 clusters, each cluster containing identical sequences. Surprisingly, 4 of these clusters had the highest homology with 18S rDNA sequences from 2 other Blastocystis ST7 isolates referred as QQ98-4 and H. These results suggest that the 18S rDNA gene is not the marker of choice to discriminate between strains within STs. In the present study, we identified a single-copy subtyping rDNA marker in the genome of the mitochondria-like organelles (MLOs). Using a partial sequence of the MLO rDNA, we successfully subtyped 66 isolates from both human and animals belonging to Blastocystis ST1 to ST10. Our results also indicate that this mitochondrial marker could be useful to detect co-infections by different isolates of a same ST.

  2. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  3. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  4. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    Science.gov (United States)

    2017-03-01

    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

  6. New primers for adhesive bonding of aluminum alloys

    Science.gov (United States)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  7. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  8. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  9. A simple and rapid PCR-based method to isolate complete small macronuclear minichromosomes from hypotrich ciliates: 5S rDNA and S26 ribosomal protein gene of Oxytricha (Sterkiella) nova.

    Science.gov (United States)

    Callejas, Sergio; Gutiérrez, Juan Carlos

    2002-06-01

    Hypotrich ciliates present a macronuclear genome consisting of gene-sized instead of chromosome-sized DNA molecules. Exploiting this unique eukaryotic genome feature, we introduce, for the first time in ciliates, a rapid and easy PCR method using telomeric primers to isolate small complete macronuclear DNA molecules or minichromosomes. Two presumably abundant macronuclear DNA molecules, containing ribosomal genes, were amplified from the Oxytricha (Sterkiella) nova complete genome after using this method, and then were cloned and sequenced. The 5S rDNA sequence of O. (S.) nova is the third one reported among hypotrich ciliates; its primary and secondary structure is compared with other eukaryotic 5S rRNAs. The ribosomal protein S26 gene is the first one reported among ciliates. This "End-End-PCR" method might be useful to obtain similar gene-sized macronuclear molecules from other hypotrich ciliates, and, therefore, to increase our knowledge on ribosomal genes in these eukaryotic microorganisms.

  10. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  11. Chromosomal distribution of rDNA in Pan paniscus, Gorilla gorilla beringei, and Symphalangus syndactylus: comparison to related primates

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, A.S.; Atwood, K.C.; Warburton, D.

    1976-01-01

    Hybridization in situ was used to identify rDNA in chromosomes of the pygmy chimpanzee, mountain gorilla, and siamang gibbon. In contrast to other Pongids, and man, the gorilla has only two pairs of rDNA-containing chromosomes. The single pair in the siamang bears no resemblance to the nucleolar chromosome of the closely related lar gibbon. Pan paniscus and P. troglodytes have the same rDNA distribution, and similar karyotypes except in the structure of chromosome 23p. Grain counts over unbanded preparations show that the human, orangutan, and both chimpanzees have about the same total rDNA multiplicity.

  12. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas.

    Science.gov (United States)

    Taylor, D Lee; McCormick, Melissa K

    2008-01-01

    Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora-Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples.

  14. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Directory of Open Access Journals (Sweden)

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  15. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    Directory of Open Access Journals (Sweden)

    D. FULGIONE

    2006-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  16. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    Science.gov (United States)

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N2O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  17. methBLAST and methPrimerDB: web-tools for PCR based methylation analysis

    Directory of Open Access Journals (Sweden)

    Herzog Robert

    2006-11-01

    Full Text Available Abstract Background DNA methylation plays an important role in development and tumorigenesis by epigenetic modification and silencing of critical genes. The development of PCR-based methylation assays on bisulphite modified DNA heralded a breakthrough in speed and sensitivity for gene methylation analysis. Despite this technological advancement, these approaches require a cumbersome gene by gene primer design and experimental validation. Bisulphite DNA modification results in sequence alterations (all unmethylated cytosines are converted into uracils and a general sequence complexity reduction as cytosines become underrepresented. Consequently, standard BLAST sequence homology searches cannot be applied to search for specific methylation primers. Results To address this problem we developed methBLAST, a sequence similarity search program, based on the original BLAST algorithm but querying in silico bisulphite modified genome sequences to evaluate oligonucleotide sequence similarities. Apart from the primer specificity analysis tool, we have also developed a public database termed methPrimerDB for the storage and retrieval of validated PCR based methylation assays. The web interface allows free public access to perform methBLAST searches or database queries and to submit user based information. Database records can be searched by gene symbol, nucleotide sequence, analytical method used, Entrez Gene or methPrimerDB identifier, and submitter's name. Each record contains a link to Entrez Gene and PubMed to retrieve additional information on the gene, its genomic context and the article in which the methylation assay was described. To assure and maintain data integrity and accuracy, the database is linked to other reference databases. Currently, the database contains primer records for the most popular PCR-based methylation analysis methods to study human, mouse and rat epigenetic modifications. methPrimerDB and methBLAST are available at http

  18. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    Science.gov (United States)

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  19. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata.

    Science.gov (United States)

    Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin

    2012-04-12

    Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic

  20. Cytogenetic study on antlions (Neuroptera, Myrmeleontidae: first data on telomere structure and rDNA location

    Directory of Open Access Journals (Sweden)

    Valentina G. Kuznetsova

    2016-11-01

    Full Text Available Myrmeleontidae, commonly known as “antlions”, are the most diverse family of the insect order Neuroptera, with over 1700 described species (in 191 genera of which 37 species (in 21 genera have so far been studied in respect to standard karyotypes. In the present paper we provide first data on the occurrence of the “insect-type” telomeric repeat (TTAGGn and location of 18S rDNA clusters in the antlion karyotypes studied using fluorescence in situ hybridization (FISH. We show that males of Palpares libelluloides (Linnaeus, 1764 (Palparinae, Acanthaclisis occitanica (Villers, 1789 (Acanthaclisinae and Distoleon tetragrammicus (Fabricius, 1798 (Nemoleontinae have rDNA clusters on a large bivalent, two last species having an additional rDNA cluster on one of the sex chromosomes, most probably the X. (TTAGGn - containing telomeres are clearly characteristic of P. libelluloides and A. occitanica; the presence of this telomeric motif in D. tetragrammicus is questionable. In addition, we detected the presence of the (TTAGGn telomeric repeat in Libelloides macaronius (Scopoli, 1763 from the family Ascalaphidae (owlflies, a sister group to the Myrmeleontidae. We presume that the “insect” motif (TTAGGn was present in a common ancestor of the families Ascalaphidae and Myrmeleontidae within the neuropteran suborder Myrmeleontiformia.

  1. Cytogenetic study on antlions (Neuroptera, Myrmeleontidae): first data on telomere structure and rDNA location.

    Science.gov (United States)

    Kuznetsova, Valentina G; Khabiev, Gadzhimurad N; Anokhin, Boris A

    2016-01-01

    Myrmeleontidae, commonly known as "antlions", are the most diverse family of the insect order Neuroptera, with over 1700 described species (in 191 genera) of which 37 species (in 21 genera) have so far been studied in respect to standard karyotypes. In the present paper we provide first data on the occurrence of the "insect-type" telomeric repeat (TTAGG) n and location of 18S rDNA clusters in the antlion karyotypes studied using fluorescence in situ hybridization (FISH). We show that males of Palpares libelluloides (Linnaeus, 1764) (Palparinae), Acanthaclisis occitanica (Villers, 1789) (Acanthaclisinae) and Distoleon tetragrammicus (Fabricius, 1798) (Nemoleontinae) have rDNA clusters on a large bivalent, two last species having an additional rDNA cluster on one of the sex chromosomes, most probably the X. (TTAGG) n - containing telomeres are clearly characteristic of Palpares libelluloides and Acanthaclisis occitanica ; the presence of this telomeric motif in Distoleon tetragrammicus is questionable. In addition, we detected the presence of the (TTAGG) n telomeric repeat in Libelloides macaronius (Scopoli, 1763) from the family Ascalaphidae (owlflies), a sister group to the Myrmeleontidae. We presume that the "insect" motif (TTAGG) n was present in a common ancestor of the families Ascalaphidae and Myrmeleontidae within the neuropteran suborder Myrmeleontiformia.

  2. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  3. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  4. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    McKinney, Nancy (Decatur, GA)

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  5. Dead element replicating: degenerate R2 element replication and rDNA genomic turnover in the Bacillus rossius stick insect (Insecta: Phasmida).

    Science.gov (United States)

    Martoni, Francesco; Eickbush, Danna G; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara

    2015-01-01

    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5' end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution.

  6. ALG11--a new variable DNA marker for sponge phylogeny: comparison of phylogenetic performances with the 18S rDNA and the COI gene.

    Science.gov (United States)

    Belinky, Frida; Szitenberg, Amir; Goldfarb, Itay; Feldstein, Tamar; Wörheide, Gert; Ilan, Micha; Huchon, Dorothée

    2012-06-01

    Phylogenetic relationships within sponge classes are highly debated. The low phylogenetic signal observed with some current molecular data can be attributed to the use of few markers, usually slowly-evolving, such as the nuclear rDNA genes and the mitochondrial COI gene. In this study, we conducted a bioinformatics search for a new molecular marker. We sought a marker that (1) is likely to have no paralogs; (2) evolves under a fast evolutionary rate; (3) is part of a continuous exonic region; and (4) is flanked by conserved regions. Our search suggested the nuclear ALG11 as a potential suitable marker. We next demonstrated that this marker can indeed be used for solving phylogenetic relationships within sponges. Specifically, we successfully amplified the ALG11 gene from DNA samples of representatives from all four sponge classes as well as from several cnidarian classes. We also amplified the 18S rDNA and the COI gene for these species. Finally, we analyzed the phylogenetic performance of ALG11 to solve sponge relationships compared to and in combination with the nuclear 18S rDNA and the COI mtDNA genes. Interestingly, the ALG11 marker seems to be superior to the widely-used COI marker. Our work thus indicates that the ALG11 marker is a relevant marker which can complement and corroborate the phylogenetic inferences observed with nuclear ribosomal genes. This marker is also expected to contribute to resolving evolutionary relationships of other apparently slow-evolving animal phyla, such as cnidarians. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Obtencao de marcadores moleculares 5S rDNA para populaces nativas e introduzidas de Cichla , do Brasil

    National Research Council Canada - National Science Library

    De Oliveira, Viviane Fatima; De Oliveira, Alessandra Valeria; Prioli, Alberto Jose; Alves Pinto Prioli, Sonia Maria

    2008-01-01

    .... O objetivo desse trabalho foi padronizar a metodologia de amplificacao de regioes nao-transcritas da familia multigenica rDNA 5S de Cichla e obter marcadores especificos para as especies parentais...

  8. Phylogenetic assessment of heterotrophic bacteria from a water distribution system using 16S rDNA sequencing

    National Research Council Canada - National Science Library

    Tokajian, Sima T; Hashwa, Fuad A; Hancock, Ian C; Zalloua, Pierre A

    2005-01-01

    .... The present study had to use phylogenetic analysis, which was simplified by determining and using the first 500-bp sequence of the 16S rDNA, to successfully identify the type and species of bacteria...

  9. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  10. Novel Approach to Designing Primers for Identification and Distinction of the Human Pathogenic Fungi Coccidioides immitis and Coccidioides posadasii by PCR Amplification

    OpenAIRE

    Umeyama, Takashi; Sano, Ayako; Kamei, Katsuhiko; Niimi, Masakazu; Nishimura, Kazuko; Uehara, Yoshimasa

    2006-01-01

    We developed a pair of primers that specifically identifies Coccidioides species, etiologic agents of the human fungal disease coccidioidomycosis. These primers could be used for distinguishing Coccidioides immitis and Coccidioides posadasii by simply comparing the amplicon sizes on an agarose gel.

  11. Novel approach to designing primers for identification and distinction of the human pathogenic fungi Coccidioides immitis and Coccidioides posadasii by PCR amplification.

    Science.gov (United States)

    Umeyama, Takashi; Sano, Ayako; Kamei, Katsuhiko; Niimi, Masakazu; Nishimura, Kazuko; Uehara, Yoshimasa

    2006-05-01

    We developed a pair of primers that specifically identifies Coccidioides species, etiologic agents of the human fungal disease coccidioidomycosis. These primers could be used for distinguishing Coccidioides immitis and Coccidioides posadasii by simply comparing the amplicon sizes on an agarose gel.

  12. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products

    National Research Council Canada - National Science Library

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf...

  13. Development and Use of tuf GeneBased Primers for the Multiplex PCR Detection of Lactobacillus acidophilus, Lactobacillus casei Group, Lactobacillus delbrueckii, and Bifidobacterium longum in Commercial Dairy Products

    National Research Council Canada - National Science Library

    Sheu, Sen-Je; Hwang, Wen-Zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf...

  14. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans.

    Science.gov (United States)

    Lobo, Jorge; Costa, Pedro M; Teixeira, Marcos A L; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O

    2013-09-10

    Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called "universal" primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first-time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory.

  15. RTPrimerDB: the real-time PCR primer and probe database, major update 2006.

    Science.gov (United States)

    Pattyn, Filip; Robbrecht, Piet; De Paepe, Anne; Speleman, Frank; Vandesompele, Jo

    2006-01-01

    The RTPrimerDB (http://medgen.ugent.be/rtprimerdb) project provides a freely accessible data retrieval system and an in silico assay evaluation pipeline for real-time quantitative PCR assays. Over the last year the number of user submitted assays has grown to 3500. Data conveyance from Entrez Gene by establishing an assay-to-gene relationship enables the addition of new primer assays for one of the 1.5 million different genes from 2300 species stored in the system. Easy access to the primer and probe data is possible by using multiple search criteria. Assay reports contain gene information, assay details (such as oligonucleotide sequences, detection chemistry and reaction conditions), publication information, users' experimental evaluation feedback and submitter's contact details. Gene expression assays are extended with a scalable assay viewer that provides detailed information on the alignment of primer and probe sequences on the known transcript variants of a gene, along with Single Nucleotide Polymorphisms (SNP) positions and peptide domain information. Furthermore, an mfold module is implemented to predict the secondary structure of the amplicon sequence, as this has been reported to impact the efficiency of the PCR. RTPrimerDB is also extended with an in silico analysis pipeline to streamline the evaluation of custom designed primer and probe sequences prior to ordering and experimental evaluation. In a secured environment, the pipeline performs automated BLAST specificity searches, mfold secondary structure prediction, SNP or plain sequence error identification, and graphical visualization of the aligned primer and probe sequences on the target gene.

  16. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  17. Synchrotron FTIR characterisation of automotive primer surfacer paint coatings for forensic purposes.

    Science.gov (United States)

    Maric, Mark; van Bronswijk, Wilhelm; Lewis, Simon W; Pitts, Kari

    2014-01-01

    Synchrotron FTIR microspectroscopy was used to characterise and assess the chemical diversity of electrocoat primer, primer surfacer and basecoats of automotive paint samples from 75 vehicles representing a range of international car manufacturers. Significant diversity was found in the synchrotron FTIR data from the primer surfacer coats. Classification using principal component analysis revealed 14 discrete groups, which could be associated with the country of manufacture, the specific manufacturer and manufacturing plant, the year of manufacture of the vehicle and in some instances the number of layers in the paint system. The model generated from the primer surfacer was significantly more discriminating than a previous model generated from FTIR analysis of clear coats of the same vehicles. Analysis of the primer surfacer also avoids issues of possible environmental degradation and component migration seen with FTIR analysis of automotive clear coats. Providing such information concerning vehicle origin would aid in the development of investigative leads from the analysis of questioned automotive paint samples located at the scene of a crime or on the body/clothing of a hit and run victim. © 2013 Published by Elsevier B.V.

  18. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  19. Length heterogeneity of amplified circular rDNA molecules in oocytes of the house cricket Acheta domesticus (Orthoptera: Gryllidae).

    Science.gov (United States)

    Cave, M D

    1979-02-13

    Amplification of the genes coding for rRNA occurs in the oocytes of a wide variety of organisms. The amplification process appears to be mediated through a rolling-circle mechanism. The approximate molecular weight of the smallest rDNA circles is equivalent to the estimated combined molecular weight of DNA which codes for a single ribosomal RNA precursor molecule and an associated non-transcribed spacer DNA sequence. RNA-DNA hybridization studies carried out on oocytes of the house cricket, Acheta domesticus, suggest that DNA coding for rRNA accounts for only a small fraction of the rDNA satellite, all of which is amplified in the oocyte. In order to test the possibility that the remainder of the amplified rDNA represents spacer and to determine whether a rolling-circle mechanism might also be involved in amplification in A. domesticus oocytes, rDNA was isolated from ovaries of A. domesticus and spread for electron microscopy. A large proportion of the rDNA isolated from ovaries is circular, while main-band DNA and rDNA prepared from other tissues demonstrates few if any circles. The mean size of the smallest rDNA circles is approximately 8 times longer than the length estimated for DNA which codes for 18S and 28 S rRNA. Denaturation mapping shows the rDNA circles to contain two major readily denaturing regions located about equidistant from one another on the circle. Each readily denaturing region accounts for 4--6% of the total DNA in the circle. The fact that only 12% of the average molecule is required to code for A. domesticus 18S and 28S rRNA is consistent with the hybridization data. Considerable size heterogeneity exists in the length of the smallest class of rDNA molecules. In the rDNA of other species such heterogeneity has been shown to reside in the non-transcribed spacer.

  20. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  3. A higher sensitivity and efficiency of common primer multiplex PCR assay in identification of meat origin using NADH dehydrogenase subunit 4 gene.

    Science.gov (United States)

    Hanapi, Ummi Kalthum; Desa, Mohd Nasir Mohd; Ismail, Amin; Mustafa, Shuhaimi

    2015-07-01

    A Common Primer Multiplex PCR (CP-M-PCR) was developed to detect meat origin of four groups of animal (pig, ruminant, avian and rabbit). This method demonstrated higher sensitivity and efficiency than the conventional multiplex PCR. In this approach, a common forward primer was designed in the 5' end of a homologous region of mitochondrial NADH dehyrogenase subunit 4 (Nad 4) gene sequences of all the animal groups. Specific adapter reverse primers were designed by adding an adapter sequence at the 5' end. The same adapter sequence was used as the common adapter reverse primer. The primers generated specific fragments of 267, 370, 504, and 548 bp lengths for pig, ruminant, avian and rabbit meats, respectively. The use of adapter sequence at the 5' end of the common adapter reverse primers increased the efficiency of the amplification and the application of a common forward primer solved the complexity in multiplex PCR system. Bands of specific amplification can be detected in the PCR assays containing as low as 10(-6) μM of adapter reverse primer. This result indicated that the sensitivity was tremendously increased as compared to the conventional multiplex PCR (10(-3) μM). CP-M-PCR detection limit of the DNA samples was 0.1 ng for the four groups of meats. CP-M-PCR has greatly improved the sensitivity and efficiency of the PCR system for a more reliable and accurate outcome than conventional multiplex PCR system.

  4. Molecular analysis of the genus Mitragyna existing in Thailand based on rDNA ITS sequences and its application to identify a narcotic species: Mitragyna speciosa.

    Science.gov (United States)

    Sukrong, Suchada; Zhu, Shu; Ruangrungsi, Nijsiri; Phadungcharoen, Thatree; Palanuvej, Chanida; Komatsu, Katsuko

    2007-07-01

    In Thailand, there are four Mitragyna species; M. speciosa, M. hirsuta, M. diversifolia, and M. rotundifolia. One, M. speciosa, is a narcotic plant and has medicinal importance for its opium-like effect. Since the use of M. speciosa has been forbidden in Thailand, the leaves of M. diversifolia or others are frequently used as substitutes but are not considered as effective. Therefore, accurate authentication of M. speciosa is essential for both medicinal and forensic purposes. The nucleotide sequences of internal transcribed spacers (ITS) and the 5.8S coding region of nuclear ribosomal DNA (rDNA) of the Mitragyna species were analyzed. The whole length of ITS1-5.8S-ITS2 region was 608 bp in M. speciosa, 607 bp in the other species. Nineteen sites of nucleotide substitutions and 3 sites of 1-bp indels were observed, and M. speciosa showed specific sequence differed from the others. Based on the ITS sequences, a distinctive site recognized by a restriction enzyme XmaI in M. speciosa was found and then PCR-restriction fragment length polymorphism (RFLP) analysis was established to differentiate M. speciosa from the others. By the method, a 409-bp PCR fragment of ITS1-5.8S (partial) rDNA region from M. speciosa was cleaved into two fragments of 119 bp and 290 bp while the other species remained undigested. This method provides an effective and accurate identification of M. speciosa.

  5. Determination of fruit origin by using 26S rDNA fingerprinting of yeast communities by PCR-DGGE: preliminary application to Physalis fruits from Egypt.

    Science.gov (United States)

    El Sheikha, Aly Farag; Condur, Ana; Métayer, Isabelle; Nguyen, Doan Duy Le; Loiseau, Gérard; Montet, Didier

    2009-10-01

    The determination of geographical origin is a demand of the traceability system of import-export food products. One hypothesis for tracing the source of a product is by global analysis of the microbial communities of the food and statistical linkage of this analysis to the geographical origin of the food. For this purpose, a molecular technique employing 26S rDNA profiles generated by PCR-DGGE was used to detect the variation in yeast community structures of three species of Physalis fruit (Physalis ixocarpa Brat, Physalis pubescens L, Physalis pruinosa L) from four Egyptian regions (Qalyoubia, Minufiya, Beheira and Alexandria Governments). When the 26S rDNA profiles were analysed by multivariate analysis, distinct microbial communities were detected. The band profiles of Physalis yeasts from different Governments were specific for each location and could be used as a bar code to discriminate the origin of the fruits. This method is a new traceability tool which provides fruit products with a unique biological bar code and makes it possible to trace back the fruits to their original location.

  6. Distribution of ammonia-oxidizing bacteria in sewage activated sludge: analysis based on 16S rDNA sequence.

    Science.gov (United States)

    Limpiyakorn, T; Shinohara, Y; Kurisu, F; Yagi, O

    2004-01-01

    This study carried out analysis of ammonia-oxidizing bacteria (AOB) communities in 12 sewage activated sludge systems standing in eight sewage treatment plants located in Tokyo. The systems were different in the treatment process configuration: anaerobic/anoxic/aerobic (A20), anaerobic/aerobic (AO), and conventional activated sludge (AS) processes. AOB communities were analyzed by sequences of 16S rDNA amplicons, which were separated by denaturing gradient gel eletrophoresis (DGGE) after specific polymerase chain reaction (PCR) amplification. The results demonstrated that low ammonium concentrations in the influents of the 12 sewage activated sludge systems resulted in the dominance of Nitrosomonas oligotropha-like sequences. Further, Nitrosomonas europaea- and Nitrosomonas cryotolerans-like sequences were recovered from only one A20 system of which the influent contained higher ammonium and chloride concentrations than those of other systems. Nitrosomonas communis-like sequences were found in every A20 and AO system, but mostly not found in every AS system. In summary, influent characteristics and treatment process configuration affected the AOB communities in the 12 sewage activated sludge systems.

  7. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  8. Development of polymerase chain reaction primers to detect Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Artiushin, S; Stipkovits, L; Minion, F C

    1993-10-01

    Mycoplasma hyopneumoniae (Mhp) is the etiologic agent of mycoplasma pneumonia in swine. The purpose of this study was to develop a species-specific polymerase chain reaction (PCR)-based diagnostic reagent for the identification of Mhp. Based upon DNA sequence analysis of a cloned fragment of Mhp DNA, PCR primers were constructed and tested against different strains of Mhp, Mycoplasma flocculare, other mycoplasma species, and non-Mollicute micro-organisms which commonly inhabit the respiratory tracts of swine. A total of 40 field isolates from Mhp and four field isolates of M. flocculare have been examined. Positive signals were obtained in PCR with Mhp reference strains and all 40 Mhp field isolates, but not with other Mollicutes micro-organisms.

  9. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    Penicillium simplicissimum is a broadly circumscribed taxon often encountered on soil community lists and in biotechnological reports. Phylogenetic analysis of the ITS1- 5.8S-ITS2 rDNA region indicated that P. simplicissimum s.l. includes several species. Recognition of these species is further...... the P. simplicissimum group, here referred to as Penicillium spp. I, II and III. The name P. simplicissimum should be used only for isolates which closely match the neotype and NRRL 902 in all characters....

  10. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    OpenAIRE

    Li, Zhongai; Chen, Xin; Li, Suoping; Wang, Zicheng

    2015-01-01

    Background: In recent years, nickel (Ni) has been widely applied in industrial and agricultural production and has become a kind of environmental pollution. In this study, the effect of nickel chloride (NiCl2) with different concentrations on Arabidopsis genomic stability and DNA methylation has been demonstrated. The nucleolus variation and 18S rDNA methylation after NiCl2 treatment have been analyzed. Results: The results are as follows: (1) The NiCl2 could result in heritable genomic me...

  11. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    DEFF Research Database (Denmark)

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.

    2005-01-01

    Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution...... that may not closely fit the data. We constructed and examined alignments of SSU and partial LSU rRNA along with a concatenated alignment of the two molecules. The alignments showed several characteristics that may confound phylogeny reconstruction: paired helix (stem) regions that contain non...

  12. Intraspecific polymorphism of rDNA among five Nosema bombycis isolates from different geographic regions in China.

    Science.gov (United States)

    Liu, Handeng; Pan, Guoqing; Luo, Bo; Li, Tian; Yang, Qiong; Vossbrinck, Charles R; Debrunner-Vossbrinck, Bettina A; Zhou, Zeyang

    2013-05-01

    The microsporidian Nosema bombycis is the causative agent of pébrine, a highly infectious disease of the silkworm Bombyx mori. Three regions of the multicopy rDNA gene were examined in order to investigate the relationships among five Nosema isolates from various regions of China. Ribosomal DNA alleles are present on each of the 18 chromosomes of N. bombycis and show a high degree of variation. In this study the small subunit (SSU) rDNA, internal transcribed spacer (ITS) and intergenic spacer (IGS) regions for up to 10 different rDNA copies from each N. bombycis isolate were cloned and sequenced. As expected we see greater polymorphism in the ITS region (88 variable sites in 179 nucleotides) and IGS (200 variable sites in 279 nucleotides) than in the SSU rDNA (24 variable sites in 1232 nucleotides). Phylogenetic analysis shows greater differences between alleles within an isolate than between the same alleles from different isolates. The data reveal two very different groups, one from the Sichuan province and the other with a broad distribution including four provinces in southeast China and Japan. The Sichuan isolate does not have any rDNA alleles with sequences identical to those in the other isolates, implying that it is a separate, non-intermixing, population or perhaps a separate species from the other isolates. In light of the polymorphic nature of the rDNA alleles in N. bombycis and their presence on every chromosome, the rDNA gene may be useful for understanding the movement and ultimately the source of pébrine infections. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure

    Directory of Open Access Journals (Sweden)

    Zaman Khalequz

    2005-03-01

    Full Text Available Abstract Background Rotavirus genotyping is performed by using reverse transcription PCR with type-specific-primers. Because the high rotavirus mutation rate generates an extensive genomic variation, different G-type-specific primer sets are applied in different geographical locations. In Bangladesh, a significant proportion (36.9% of the rotavirus strains isolated in 2002 could not be G-typed using the routinely used primer set. To investigate the reason why the strains were untypeable, nucleotide sequencing of the VP7 genes was performed. Results Four nucleotide substitutions at the G1 primer-binding site of the VP7 gene of Bangladeshi G1 rotaviruses rendered a major proportion of circulating strains untypeable using the routine primer set. Using an alternative primer set, we could identify G1 rotaviruses as the most prevalent genotype (44.8%, followed by G9 (21.7%, G2 (15.0% and G4 (13.8%. Conclusion Because of the natural variation in the rotaviral gene sequences, close monitoring of rotavirus genotyping methods is important.

  14. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  15. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  16. Screening of rapd primer for teak (Tectona grandis

    Directory of Open Access Journals (Sweden)

    Imas Cintamulya

    2016-04-01

    Full Text Available Identification of DNA polymorphisms in teak is important. It is a first step to determine the presence of genetic varia-tion in teak. The information of genetic variation is needed for teak breeding development. RAPD is one of method which can be used for identification of DNA polymorphism. This study aim to get the RAPD primer which can detect the DNA polymorphism in teak. Benefits of this study are provide information about primer which can detect the DNA polymorphism in teak, DNA polymorphism data can be used for genetic variation analysis which needed for teak breeding development. The primers which used in this study shown the DNA polymorphism in teak. The primer are OPF6 (5'-GGGAATTCGG-3 ', OPF8 (5'-GGGATATCGC-3', and OPF11 (5'-TTGGTACCCC-3 '. The highest DNA poly-morphism is shown in DNA which amplified with OPF-8 primer. Keywords: RAPD, Primer, Polymorphism, DNA, Tectona grandis

  17. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2006-03-01

    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  18. Temperature-dependent regulation of rDNA condensation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Shen, Donglai; Skibbens, Robert V

    2017-06-03

    Chromatin condensation during mitosis produces detangled and discrete DNA entities required for high fidelity sister chromatid segregation during mitosis and positions DNA away from the cleavage furrow during cytokinesis. Regional condensation during G1 also establishes a nuclear architecture through which gene transcription is regulated but remains plastic so that cells can respond to changes in nutrient levels, temperature and signaling molecules. To date, however, the potential impact of this plasticity on mitotic chromosome condensation remains unknown. Here, we report results obtained from a new condensation assay that wildtype budding yeast cells exhibit dramatic changes in rDNA conformation in response to temperature. rDNA hypercondenses in wildtype cells maintained at 37°C, compared with cells maintained at 23°C. This hypercondensation machinery can be activated during preanaphase but readily inactivated upon exposure to lower temperatures. Extended mitotic arrest at 23°C does not result in hypercondensation, negating a kinetic-based argument in which condensation that typically proceeds slowly is accelerated when cells are placed at 37°C. Neither elevated recombination nor reduced transcription appear to promote this hypercondensation. This heretofore undetected temperature-dependent hypercondensation pathway impacts current views of chromatin structure based on conditional mutant gene analyses and significantly extends our understanding of physiologic changes in chromatin architecture in response to hypothermia.

  19. 16S-23S rDNA internal transcribed spacer regions in four Proteus species.

    Science.gov (United States)

    Cao, Boyang; Wang, Min; Liu, Lei; Zhou, Zhemin; Wen, Shaoping; Rozalski, Antoni; Wang, Lei

    2009-04-01

    Proteus is a Gram-negative, facultative anaerobic bacterium. In this study, 813 Proteus 16S-23S rDNA internal transcribed spacer (ITS) sequences were determined from 46 Proteus strains, including 388 ITS from 22 P. mirabilis strains, 211 ITS from 12 P. vulgaris strains, 169 ITS from 10 P. penneri strains, and 45 ITS from 2 P. myxofaciens strains. The Proteus strains carry mainly two types of ITS, ITS(Glu) (containing tRNA(Glu (UUC)) gene) and ITS(Ile+Ala) (containing tRNA(Ile (GAU)) and tRNA(Ala (UGC)) gene), and are in the forms of 28 variants with 25 genomic origins. The ITS sequences are a mosaic-like structure consisting of three conservative regions and two variable regions. The nucleotide identity of ITS subtypes in strains of the same species ranges from 96.2% to 100%. The divergence of Proteus ITS divergence was most likely due to intraspecies recombinations or horizontal transfers of sequence blocks. The phylogenetic relationship deduced from the second variable region of ITS sequences of the three facultative human pathogenic species P. mirabilis, P. vulgaris and P. penneri is similar with that based on 16S rDNA sequences, but has higher resolution to differentiate closely related P. vulgaris and P. penneri. This study is the first comprehensive study of ITS in four Proteus species and laid solid foundation for the development of high-throughput technology for quick and accurate identification of the important foodborne and nosocomial pathogens.

  20. Thoracic empyema caused by Prevotella spp. diagnosed using 16S rDNA sequence analysis.

    Science.gov (United States)

    Zhou, Hua; Shen, Yihong; Shen, Qian; Zhou, Jianying

    2015-01-01

    We describe a case of thoracic empyema in a 76-year-old male with complication of diabetes mellitus and hypertension. His chief complaints were fever and chest pain. The patient was diagnosed as pleural infection according to the pulmonary computed tomography (CT) scan and laboratory results. The patient had persistent fever after the treatment of continuous percutaneous drainage and 1 week of intravenous moxifloxacin. He was then misdiagnosed as tuberculous pleuritis and still had fever after the treatment of 2 weeks' antituberculosis drugs. Repeated cultures of sputum, blood, bronchoalveolar lavage fluid and pleural fluid were all negative. A gram-negative bacillus was found in the pleural pus Gram stain, and it was identified as Prevotella spp. by 16S ribosomal DNA (rDNA) sequence analysis. The patient recovered after further treatment, including CT-induced pleural drain and intravenous imipenem. Totally, he received 2-week imipenem and 1-month metronidazole therapy from the day he was diagnosed with empyema to the termination of treatment. On the subsequent 2-month and 6-month follow-up visits, no recurrence has been reported for this patient. Routine microbiological methods are important in diagnosis of pleural infection, but they have limitations in some cases, especially for anaerobe. Molecular assay based on 16S rDNA is helpful in detecting causative organisms of thoracic empyema. © 2014 John Wiley & Sons Ltd.

  1. [25S rDNA genotype and antifungal susceptibility of vaginal Candida albicans].

    Science.gov (United States)

    Zhang, X; Liu, Z H

    2016-04-25

    To investigate 25S rDNA genotype distribution of vaginal Candida albicans and its relationship with antifungal susceptibility. A total of 954 isolates of Candida albicans were subjected to genotype analysis according to the presence and the size of transposable group Ⅰ intron in 25S rDNA with PCR; 156 isolates were enrolled to detect their antifungal susceptibility of 5 antifungal agents with the M27-A3 broth microdilution method. Totally 876 isolates were determined to be intronless genotype A(91.8%, 876/954); 58(6.1%, 58/954)and 20 isolates(2.1%, 20/954)were introncontaining genotype B and genotype C, respectively. The minimal inhibitory concentrations(MIC)of itraconazole and fluconazole against the intron-containing group were significantly higher than those of the intronless group(0.25 versus 0.125 μg/ml, PCandida albicans to itraconazole of the intron-containing group was significantly higher than that of the intronless group[24%(19/78)versus 3%(2/78), PCandida albicans might be important in affecting itraconazole, fluconazole and nystatin susceptibility.

  2. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    Directory of Open Access Journals (Sweden)

    Julie M. Allen

    2016-07-01

    Full Text Available Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura. We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain.

  3. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    Science.gov (United States)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  4. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR.

    Science.gov (United States)

    Choi, Hoseong; Cho, Won Kyong; Yu, Jisuk; Lee, Jong-Seung; Kim, Kook-Hyung

    2013-03-01

    To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  7. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  8. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  9. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  10. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  11. Non increased neuron-specific enolase concentration in cerebrospinal fluid during first febrile seizures and a year follow-up in pediatric patients No incrementos en la concentración de enolasa específica de neurona en el líquido cefalorraquídeo durante el primer ataque febril y al año en pacientes pediátricos

    Directory of Open Access Journals (Sweden)

    ALBERTO J. DORTA-CONTRERAS

    1998-09-01

    Full Text Available Febrile seizures are the commonest acute neurological disorder of early childhood. Studies suggested that febrile seizures are previous acute events from a more serious neurological problem. Due to neuron-specific enolase is generally accepted as a marker for neuropathological processes in the brain, 16 pediatric patients were studied during their first seizures and a year after it. Neuron-specific enolase in cerebrospinal fluid and blood were analysed by an immune enzyme assay. Non pathological neuron-specific enolase values were obtained in both periods in the group of patients. There were no significative differences when paired series statistics test was performed with 95% of confidence. Neuron-specific enolase appears not to be a marker for febrile seizures because its concentration not be increased in cerebrospinal fluid in this group of patients.Los ataques febriles constituyen el trastorno neurológico agudo más común en la infancia temprana. Existen estudios que sugieren que los ataques febriles son eventos agudos previos a problemas neurológicos más severos. Debido a que la enolasa específica de neurona está aceptada generalmente como marcador de procesos neuropatológicos en el cerebro, se estudiaran 16 pacientes pediátricos durante su primer ataque y al año de este. La enolasa específica de neurona en el líquido cefalorraquídeo y sangre fue analizada por una prueba inmunoenzimática. No se obtuvieron valores patológicos de enolasa específica de neurona en ambos períodos en el grupo de pacientes. No hubo diferencias significativas al aplicar el test de series apareadas con un 95% de confianza. La enolasa específica de neurona parece no ser un marcador para ataques febriles porque su concentración no se incrementa en este grupo de pacientes.

  12. Evaluation of a New Primer In Comparison With Microscopy for the Detection of Giardia lamblia Infection in Stool Samples

    Directory of Open Access Journals (Sweden)

    Amir BAIRAMI

    2016-03-01

    Full Text Available Background: Among the most important parasitic disease, causing diarrhea, Gi­ardia lamblia is noteworthy. Nowadays detection methods for these parasites in­clude parasitological methods such as microscopic examination. The sensitivity of these methods relies on the expertise and experience of examiners. In contrast, molecular methods such as PCR are less dependent on the expertise of the exam­iner. Here we developed a PCR for the detection of G. lamblia genome in stool samples in comparison with microscopy, which is the gold standard.Methods:  For the evaluation of primers, 22 positive samples and 47 negative samples were used. QIAamp DNA Stool Mini Kit (QIAGEN, Germany was used for DNA extraction from feces. Primers for PCR were designed using Primer-BLAST which uses Primer 3 to designing specific primers (NCBI/ Primer-BLAST. Results: Sensitivity of the PCR was done with 100% (95%CI: 84.56-100 for the detection of G. lamblia DNA isolated from patients stool samples which were posi­tive for G. lamblia cysts and/or trophozoites using microscopy as gold standard. In comparison with microscopy, PCR had showed the specificity of 97.87% (95%CI: 88.71-99.95.Conclusion: We designed new primers for the Giardia, and PCR method for the rapid and accurate identification of Giardia parasites established. With considera­tion to the routine diagnosis techniques in medical parasitology and their limita­tions such as time consuming, laborious, less sensitivity etc. This G. lamblia PCR is a sensitive and specific application for the diagnosis of G. lamblia and provides us a reliable method in the routine intestinal parasitic infection laboratory diagnosis.

  13. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    Transduction of primer binding site-impaired Akv murine leukemia virus-based retroviral vectors from the murine packaging cell lines psi-2 and omega E was studied. The efficiency of transduction of the neo marker of all mutated constructs was found to decrease by 5 to 6 orders of magnitude compared...... with that of the wild-type vector. Thirty-two of 60 transduced proviruses analyzed harbored a primer binding site sequence matching a glutamine tRNA primer. Sequence analysis of the regions flanking the glutamine tRNA primer binding site revealed a distinct pattern of nucleotide differences from the Akv-based vector......, suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...

  14. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Neospora caninum in bovine fetuses of Minas Gerais, Brazil: genetic characteristics of rDNA Neospora caninum em fetos bovinos de Minas Gerais, Brasil: características genéticas do rDNA

    Directory of Open Access Journals (Sweden)

    Domingos Sávio dos Santos

    2011-12-01

    Full Text Available Neosporosis is an important cause of abortion in cattle and information on their genetics and host parasite relationships are desirable. Neospora caninum samples obtained from 24 bovine fetuses from Minas Gerais, were genetically analyzed in part of the rDNA region, coding for rRNAs. Previously, brain, heart, liver, skeletal muscle, lung, kidney, spleen, thymus, lymph nodes, ovary or testis, uterus and skin of the ear were analyzed by conventional histopathology and immunohistochemistry. Of these, eight had lesions compatible in the brain and heart and two also in skeletal muscle and liver. Three brains showed antigen identification in immunohistochemistry. Brain and heart tissues were subjected to DNA extraction for PCR, whose product of 588 bp of ITS-1 region was sequenced in three samples. We obtained 96% similarity with dozens of sequences N. caninum deposited in GenBank. The phylogenetic tree showed great conservation among isolates of N. caninum in this study and those deposited in GenBank, while well-defined and specific branches were generated against other Apicomplexa. PCR for this region is useful as a diagnosis, with good analytical specificity, but the ITS-1 region is not suitable for genetic differentiation intra species because the sequences obtained were identical to the others analyzed.A neosporose é uma importante causa de abortos em bovinos, e informações sobre sua genética e relação parasito-hospedeiro são desejáveis. Amostras de Neospora caninum, obtidas de 24 conceptos bovinos oriundos de Minas Gerais, foram analisadas geneticamente em parte da região rDNA, codificadora de rRNAs. Previamente, cérebro, coração, fígado, músculo esquelético, pulmão, rim, baço, timo, linfonodos, ovário ou testículo, útero e pele da orelha foram analisados por histopatologia convencional e imuno-histoquímica. Dessas, oito apresentaram lesões compatíveis no encéfalo e coração e dois também no músculo esquelético e f

  16. Adhesive primers for bonding cobalt-chromium alloy to resin.

    Science.gov (United States)

    Yoshida, K; Kamada, K; Atsuta, M

    1999-06-01

    This study evaluated the effect of five adhesive primers on the shear bond strength of a self-curing resin to cobalt-chromium (Co-Cr) alloy. The adhesive primers Acryl Bond (AB, Shofu), Cesead Opaque Primer (COP, Kuraray), Metacolor Opaque Bonding Liner (MOBL, Sun-Medical), Metal PrimerII (MPII, GC) and MR. Bond (MRB, Tokuyama) were used. A brass ring which was placed over the casting alloy disk surface non-primed or primed with each primer was filled with the self-curing MMA-PMMA resin. The specimens were stored in water at 37 degrees C for 24 h and then immersed alternately in water baths at 4 C and 60 degrees C for 1 min each for up to 50000 thermal cycles before shear mode testing at a crosshead speed of 0.5 mm/min. All of the primers examined, except MOBL, improved the shear bond strength between the resin and Co-Cr alloy compared with nonprimed specimens prior to thermal cycling. Regardless of which primer was used, the shear bond strength significantly differed between thermal cycles 0 and 50000. However, after 50000 thermal cycles, the bond strengths of resin to Co-Cr alloy primed with COP or MPII were significantly greater than those of specimens primed with AB, MOBL or MRB and non-primed controls. This study indicated that COP and MPII are effective primers to obtain higher bond strength between resin and Co-Cr alloy.

  17. Marketing Information Products and Services: A Primer for Librarians ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services: A Primer for Librarians and Information Professionals. Book cover Marketing Information Products and Services: A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao, and S. Sreenivas Rao. Maison(s) d'édition : Tata McGraw-Hill, IDRC.

  18. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  19. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... RAPD primers GLC-07 and GLB-11. PCR amplification using primer GLC-07 produced single band of ... PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using .... Isolation of recombinants involving barley arms 3HL and 6HL. Theor. Appl. Genet. 83:489-494.

  20. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  1. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  2. Biodiversity Study of Black Coral (Order: Antipatharia Collected from Manado, Indonesia based on rDNA Internal Transcribed Spacer (ITS Sequences Analysis

    Directory of Open Access Journals (Sweden)

    HAPRY FRED NICO LAPIAN

    2009-01-01

    Full Text Available Biodiversity of black coral (order Antipatharia collected from the Bunaken Marine Park (Manado Sea, Indonesia has been studied based on the sequence of the Internal Transcribed Spacers (ITS region of rDNA gene. The results of the study showed that the 18 species of Antipatharia were considered to be separated in two family groups, family Myriopathidae and Antipathidae-Aphanipathida. A significant species-specific signal has been detected among the families of Antipathidae and Aphanipathida. However, more studies-on different species were required to be clearly interpreted. The new species Pseudocirrhipates mapia, the new genus Reticulopathes, and possibly a new taxon of the family Myriopathidae has been recognized based on ITS sequence data.

  3. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  4. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  5. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    Science.gov (United States)

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  6. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    Science.gov (United States)

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  8. New mitochondrial and nuclear primers for the Mediterranean marine bivalve Pinna nobilis

    OpenAIRE

    Sanna, D.; G.L. DEDOLA; Scarpa, F.; Lai, T.; Cossu, P.; Curini-Galletti, M.; Francalacci, P.; Casu, M

    2014-01-01

    Pinna nobilis is the largest endemic Mediterranean marine bivalve. During past centuries, various human activities led to the regression of its populations. As a consequence of stringent standards of protection, demographic expansions are currently reported in many sites. We designed a set of four mitochondrial- and two nuclear- specific PCR-primers with the aim to provide molecular tools to gather new insights into the genetic variability of this species. A total of 54 specimens were sampled...

  9. Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers

    OpenAIRE

    Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

    2017-01-01

    The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitoc...

  10. Primers on molecular pathways--caspase pathway.

    Science.gov (United States)

    Lomberk, Gwen; Urrutia, Raul

    2009-01-01

    Apoptosis, or programmed cell death, is a physiological process of cellular autodestruction, or cell suicide. This process is strictly controlled in response to integrity of pro-death signaling and plays critical roles in development, maintenance of homeostasis and host defense in multicellular organisms. As pancreatologists, apoptosis plays a central role in the pancreas and its disease states, from diabetes to pancreatitis to pancreatic cancer. In pancreatic beta-cells, apoptotic cell death is involved in the pathogenesis of diabetes, as signals from death receptors and DNA damage have been widely accepted as being triggers of apoptosis in beta-cells. During acute pancreatitis, this common clinical condition is of variable severity in which some patients experience mild, self-limited attacks while others manifest a severe, highly morbid, and frequently lethal attack. However, recent research in this area has demonstrated the importance of acinar cell death in the form of apoptosis and necrosis as a determinant of pancreatitis severity. In pancreatic cancer, various survival mechanisms have been shown to act in the prevention of cell death to result in promotion of tumor growth and metastasis. Thus, resistance of pancreatic cancer to apoptosis is the key factor preventing responses to therapies. Thus, it is for these reasons that in the current 'Primers on Molecular Pathways,' we take a closer look at the pathway cascade that is triggered during apoptosis. Copyright 2008 S. Karger AG, Basel and IAP.

  11. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  12. Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers.

    Science.gov (United States)

    Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

    2017-01-01

    The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration.

  13. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  14. [Database establishment of the whole rDNA ITS region of Dendrobium species of "fengdou" and authentication by analysis of their sequences].

    Science.gov (United States)

    Ding, Xiao-yu; Wang, Zheng-tao; Xu, Hong; Xu, Luo-san; Zhou, Kai-ya

    2002-07-01

    To establish the whole rDNA ITS region sequence database of various Dendrobium species of "Fengdou" and to authenticate exactly the inspected species of "Fengdou". The rDNA ITS regions of various Dendrobium species of "Fengdou" were amplified and sequenced. The database of their rDNA ITS regions was established in order to authenticate the inspected species by means of the softwares of CLUSTRAL and MEGA which were used to analyze the rDNA ITS region. A database of the rDNA ITS sequences of 21 species of Dendrobium has been established. The notable and stable differences of the interspecies of the rDNA ITS regions have been demonstrated. The numbers of transitions and transversions among 21 species are 11-122. The variable sites are 341 while the informative sites are 195. The ITS sequence differences between the outgroup species (Pholidota yunnanensis) and species of "Fengdou" are obvious. The numbers of transitions and transversions are 131-161. The population differences of the rDNA ITS region of various species of "Fengdou" are very small (0-6). On the basis of the database of various Dendrobium species of "Fengdou" and two genetics software, the botanical origin of the inspected species of "Fengdou" has been authenticated successfully by sequencing the rDNA ITS regions.

  15. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Bulani, S

    2012-05-01

    Full Text Available In this study, a novel rDNA based plasmid was developed for display of heterologous proteins on the cell surface of Yarrowia lipolytica using the C- terminal end of the glycosylphosphatidylinositol (GPI) anchored Y. lipolytica cell wall protein 1...

  16. Identification of organic matter sources in sulfidic late Holocene Antarctic fjord sediments from fossil rDNA sequence analysis

    NARCIS (Netherlands)

    Coolen, M.J.L.; Volkman, J.K.; Abbas, B.; Muyzer, G.; Schouten, S.; Sinninghe Damsté, J.S.

    2007-01-01

    The 18S ribosomal DNA (rDNA) isolated from sulfidic Holocene sediments and particulate organic matter in the water column of the stratified Small Meromictic Basin (SMB) in Ellis Fjord (eastern Antarctica) was analyzed to identify possible biological sources of organic matter. Previous work had shown

  17. Radiolaria divided into Polycystina and Spasmaria in combined 18S and 28S rDNA phylogeny.

    Directory of Open Access Journals (Sweden)

    Anders K Krabberød

    Full Text Available Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria and Spasmaria (Acantharia+Taxopodida. Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis.

  18. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  19. GLOBAL PHYLOGEOGRAPHY IN THE COSMOPOLITAN SPECIES CLADOPHORA-VAGABUNDA (CHLOROPHYTA) BASED ON NUCLEAR RDNA INTERNAL TRANSCRIBED SPACER SEQUENCES

    NARCIS (Netherlands)

    BAKKER, FT; OLSEN, JL; STAM, WT

    Phylogeographic relationships were inferred from nuclear rDNA internal transcribed spacer (ITS) sequences among ten biogeographic isolates of the cosmopolitan green alga Cladophora vagabunda from the Atlantic and Pacific Oceans as well as the Red Sea and SW Australia. Representatives of the closely

  20. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  1. Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467 Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467

    Directory of Open Access Journals (Sweden)

    Sônia Maria Alves Pinto Prioli

    2008-03-01

    been intercrossing and forming viable hybrids, with greater genetic variability. The objective of this work was to standardize the amplification methodology for the non-transcribed regions of 5S rDNA multigenic family of Cichla, and to obtain specific markers for parent species that could also be identified in the hybrids. Sixty-five specimens of Cichla collected from the Upper Paraná River and Amazon basins were analyzed. Although molecular markers that could be useful in the identification of hybrids were not obtained, genetic molecular 5S rDNA species-specific markers for Cichla temensis that can be employed to identify of this species, as well population markers that can be useful in population genetic variability studies, were obtained

  2. Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil = Obtenção de marcadores moleculares 5S rDNA para populações nativas e introduzidas de Cichla (Perciformes – Cichlidae, do Brasil

    Directory of Open Access Journals (Sweden)

    Viviane Fátima de Oliveira

    2008-01-01

    Full Text Available The 5S rDNA gene is informative and has high conservation rates along the eukaryotic genome, having unique hereditary characteristics. Molecular studies with the 5S rDNA gene have been carried out with several groups, including some species of fish, aiming at solving phylogenetic relationship problems, ancestral patterns and geneticdiversity among groups in natural populations. Species of the Cichla genus, introduced in the upper Paraná river basin, present some genetic polymorphisms detected by RAPD and SPAR analyses. These species have been intercrossing and forming viable hybrids, withgreater genetic variability. The objective of this work was to standardize the amplification methodology for the non-transcribed regions of 5S rDNA multigenic family of Cichla, and to obtain specific markers for parent species that could also be identified in the hybrids. Sixty-five specimens of Cichla collected from the upper Paraná river and Amazon basins were analyzed. Although molecular markers that could be useful in the identification of hybrids were not obtained, genetic molecular 5S rDNA species-specific markers for Cichla temensis that can be employed to identify of this species, as well population markers that can be useful in population genetic variability studies, were obtained.O gene DNAr 5S é informativo e possui altas taxas de conservação ao longo do genoma dos eucariotos, possuindo características únicas que são hereditárias. Estudos moleculares do gene DNAr 5S vem sendo realizados com diversos grupos, inclusive em algumas espécies de peixes, com o intuito de solucionar problemas de relações filogenéticas, padrão de ancestralidade e diversidade genética, entre grupos de populações naturais. Espécies do gênero Cichla, introduzidas na bacia do alto rio Paraná, apresentam polimorfismos genéticos, detectados por análise de RAPD e SPAR. Essas espécies estão intercruzando-se e formando híbridos viáveis, com maior variabilidade

  3. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  4. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database.

    Science.gov (United States)

    Garcia, Sònia; Kovařík, Ales; Leitch, Andrew R; Garnatje, Teresa

    2017-03-01

    The online resource http://www.plantrdnadatabase.com/ stores information on the number, chromosomal locations and structure of the 5S and 18S-5.8S-26S (35S) ribosomal DNAs (rDNA) in plants. This resource was exploited to study relationships between rDNA locus number, distribution, the occurrence of linked (L-type) and separated (S-type) 5S and 35S rDNA units, chromosome number, genome size and ploidy level. The analyses presented summarise current knowledge on rDNA locus numbers and distribution in plants. We analysed 2949 karyotypes, from 1791 species and 86 plant families, and performed ancestral character state reconstructions. The ancestral karyotype (2n = 16) has two terminal 35S sites and two interstitial 5S sites, while the median (2n = 24) presents four terminal 35S sites and three interstitial 5S sites. Whilst 86.57% of karyotypes show S-type organisation (ancestral condition), the L-type arrangement has arisen independently several times during plant evolution. A non-terminal position of 35S rDNA was found in about 25% of single-locus karyotypes, suggesting that terminal locations are not essential for functionality and expression. Single-locus karyotypes are very common, even in polyploids. In this regard, polyploidy is followed by subsequent locus loss. This results in a decrease in locus number per monoploid genome, forming part of the diploidisation process returning polyploids to a diploid-like state over time. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  5. Comparing the Potential for Identification of Lactobacillus spp. of 16S rDNA Variable Regions

    Directory of Open Access Journals (Sweden)

    Diego Mauricio Riaño-Pachón

    2013-07-01

    Full Text Available 0 0 1 248 1368 Universidad de los Andes 11 3 1613 14.0 Normal 0 21 false false false ES-TRAD JA X-NONE 16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline and RDP (Ribosomal Database Project multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP, however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species using STAP and the region V5V8 in RDP (genus.The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples  COMPARACIÓN ENTRE EL POTENCIAL DE LAS REGIONES VARIABLES DEL 16S rDNA PARA LA IDENTIFICACIÓN DE Lactobacillus spp (LactobacilliaceaeEl 16s rDNA es utilizado para la identificación bacteriana dada su tasa de variaci

  6. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  7. Variabilidade genética na região its do rDNA de isolados de trichoderma spp. (Biocontrolador e Fusarium oxysporum f. sp. Chrysanthemi Genetic variability in rDNA ITS region of Trichoderma spp. (biocontrole agent and Fusarium oxysporum f. sp. chrysanthemi isolates

    Directory of Open Access Journals (Sweden)

    Josiane Pacheco Menezes

    2010-02-01

    Full Text Available A análise de características morfológicas e culturais podem não ser suficientes para uma caracterização precisa das espécies de Trichoderma e Fusarium. Objetivou-se, neste trabalho, caracterizar a região do Espaço Interno Transcrito (ITS do rDNA dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma spp. utilizados no biocontrole de Fusarium oxysporum f. sp. chrysanthemi (isolado UFSMF6. A extração de DNA de cada isolado foi realizada a partir de micélio produzido em meio líquido Batata-Dextrose. As amostras de DNA genômico foram submetidas à Reação em Cadeia da Polimerase (PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4 e o produto gerado foi sequenciado. Os fragmentos gerados pela amplificação da PCR foram tratados com as enzimas de restrição HaeIII, HinfI e MboI. As regiões ITS1, ITS2 e 5.8S do rDNA desses isolados fúngicos foram amplificadas com sucesso. A região ITS dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma e o isolado UFSMF6 de Fusarium apresentaram uma banda simples com um fragmento de aproximadamente 600 pares de base (pb. As enzimas de restrição HaeIII, HinfI e MboI geraram polimorfismo de bandas entre os isolados. Com base nas análises da sequência de DNA, os isolados UFSMT15.1, UFSMT16, UFSMT17 e UFSMF6 apresentaram maior similaridade com as espécies Trichoderma koningiopsis, Hypocrea virens, Hypocrea lixii e Fusarium oxysporum, respectivamente.The analysis of morphological and cultural characteristics may not enough for the characterization of the species of Trichoderma and Fusarium. The aim of this work was to characterize the Internal Transcribed Spacer (ITS region of the rDNA of UFSMT15.1, UFSMT16 and UFSMT17 isolates of Trichoderma spp. used in the biocontrol of Fusarium oxysporum f. sp. chrysanthemi UFSMF6. DNA extraction of each isolate was accomplished starting from hyphae produced in liquid medium Potato-Dextrose-Agar. The samples of genomic DNA were submitted to

  8. cutPrimers: A New Tool for Accurate Cutting of Primers from Reads of Targeted Next Generation Sequencing.

    Science.gov (United States)

    Kechin, Andrey; Boyarskikh, Uljana; Kel, Alexander; Filipenko, Maxim

    2017-11-01

    Cutting of primers from reads is an important step of processing targeted amplicon-based next generation sequencing data. Existing tools are adapted for cutting of one or several primer/adapter sequences from reads and removing all of their occurrences. Also most of the existing tools use kmers and may cut only part of primers or primers with studied sequence of gene. Because of this, use of such programs leads to incorrect trimming, reduction of coverage, and increase in the number of false-positive and/or false-negative results. We have developed a new tool named cutPrimers for accurate cutting of any number of primers from reads. Using sequencing reads that were obtained during study of BRCA1/2 genes, we compared it with cutadapt, AlienTrimmer, and BBDuk. All of them trimmed reads in such a way that coverage of at least two amplicons decreased to unacceptable level (cut all occurrences of primer sequences, so the length of the remaining reads was less than prospective.

  9. A Psicologia Latinoamericana: El Primer Medio Siglo

    Directory of Open Access Journals (Sweden)

    Rubén Ardila

    2004-01-01

    Full Text Available Se presentan los principales desarrollos de la psicología en América Latina, desde el contexto de la psicología interamericana. La Sociedad Interamericana de Psicología (SIP fue fundada el 17 de diciembre de 1951 en Ciudad de México. El primer Congreso Interamericano de Psicología se llevó a cabo en Santo Domingo (República Dominicana entre el 10 y el 20 de diciembre de 1953. Este medio siglo ha marcado un acelerado proceso de desarrollo en la psicología en América Latina, en todo el continente americano, y en el mundo en general. Se han creado programas de formación profesional a lo largo y ancho del continente, y podemos afirmar que hoy existen psicólogos profesionales en todos los países de las Américas El papel del psicólogo en la sociedad ha logrado tener importancia y relevancia habiendo partido de comienzos muy modestos. Se está llevando a cabo investigación científica de alto nivel, especialmente en algunos países líderes, como son México y Brasil, pero también en Perú, Venezuela, Argentina, Cuba, Chile, Colombia, y en general en América Latina. La falta de originalidad que señalaba Alarcón en su libro Orientaciones Teóricas de la Psicología en América Latina, en 1997, ha comenzado a dar paso a trabajos originales y a investigaciones pioneras. Los siguientes 50 años de la psicología en este contexto cultural probablemente van a continuar con estos desarrollos, y seguramente llevarán a integrar la psicología latinoamericana al contexto internacional

  10. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  11. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  12. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Directory of Open Access Journals (Sweden)

    Matthieu Leray

    Full Text Available Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1 evaluate the cutting frequency of commercially available restriction enzymes and 2 design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  13. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  14. A new set of primers for COI amplification from freshwater microcrustaceans.

    Science.gov (United States)

    Prosser, Sean; Martínez-Arce, Arely; Elías-Gutiérrez, Manuel

    2013-11-01

    Despite the contribution of DNA barcoding towards understanding the biodiversity and distribution of species, the success of COI amplification has been quite variable when it comes to freshwater zooplankton (Elías-Gutiérrez & Valdez-Moreno 2008; Jeffery et al. 2011). Some genera of microcrustaceans seem to be more difficult to amplify than others. For example, Macrothrix, Scapholeberis, Diaphanosoma and cyclopoids have yielded limited results. Among several possible reasons for the inability to barcode freshwater microcrustaceans is that there does not exist a specific set of primers for COI amplification. To this end, we developed a zooplankton - specific set of primers, which significantly increased average amplification success (20% increase). With these primers, we observed an overall success of over 70% for Sididae and Chydoridae, and more than 80% for Daphniidae, Moinidae, Bosminidae, Macrothricidae, Ilyocryptidae and Diaptomidae. We also demonstrate a simple alteration to a common specimen fixation method that increases the overall recovery of barcodes from freshwater zooplankton. Collectively, we believe our results will greatly aid the recovery of barcodes from these difficult groups. © 2013 John Wiley & Sons Ltd.

  15. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling

    Science.gov (United States)

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-01-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  16. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics

    OpenAIRE

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Background Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challeng...

  17. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  18. Development and characterization of microsatellite primers in Pogostemon cablin (Lamiaceae).

    Science.gov (United States)

    Sandes, S S; Pinheiro, J B; Zucchi, M I; Monteiro, M; Arrigoni-Blank, M F; Blank, A F

    2013-08-08

    Microsatellite primers were developed and optimized for patchouli (Pogostemon cablin) to characterize the patchouli Active Germplasm Bank of Universidade Federal de Sergipe. Creation of a genomic library for patchouli enabled the design of 12 microsatellite primers. Six of these microsatellites were polymorphic, revealing two well-defined groups of individuals that possess exclusive alleles. The data allowed us to characterize the patchouli active Germplasm Bank, identify its genetic diversity, and provide new information for researching this species.

  19. Karakterisasi Unjuk Kerja Pompa Sistem Pendingin Primer Reaktor Triga 2000

    OpenAIRE

    Soekodijat, B

    2002-01-01

    KARAKTERISASI UNJUK KERJA POMPA SISTEM PENDINGIN PRIMER REAKTOR TRIGA 2000. Pompa sistem pendingin primer adalah salah satu komponen utama pada sistem pendingin Reaktor TRIGA 2000. Karakteristik unjuk kerja pompa sangat penting diketahui agar pompa dapat dioperasikan dengan baik dan aman. Penelitian dilakukan dengan cara memverifikasi kurva kinerja pompa yang diberikan oleh pabrik. Proses verifikasi dilakukan dengan mengubah-ubah laju alir pompa (dengan cara mengatur besar kecilnya pembukaan ...

  20. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

    Science.gov (United States)

    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

    2016-04-01

    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. An electrochemical study of corrosion protection by primer-topcoat systems on 4130 steel with ac impedance and dc methods

    Science.gov (United States)

    Mendrek, M. J.; Higgins, R. H.; Danford, M. D.

    1988-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac impedance method is applied to six systems of primer coated and primer topcoated 4130 steel. Two primers were used: a zinc-rich epoxy primer and a red lead oxide epoxy primer. The epoxy-polyamine topcoat was used in four of the systems. The EG and G-PARC Model 368 ac impedance measurement system, along with dc measurements with the same system using the polarization resistance method, were used to monitor changing properties of coated 4230 steel disks immersed in 3.5 percent NaCl solutions buffered at pH 5.4 over periods of 40 to 60 days. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for the resistors and capacitors, that can be assigned in the equivalent circuit following a least-squares analysis of the data, describe changes that occur on the corroding metal surface and in the protective coatings. Two equivalent circuits have been determined that predict the correct Bode phase and magnitude of the experimental sample at different immersion times. The dc corrosion current density data are related to equivalent circuit element parameters. Methods for determining corrosion rate with ac impedance parameters are verified by the dc method.

  2. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  3. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys.

    Science.gov (United States)

    Geller, J; Meyer, C; Parker, M; Hawk, H

    2013-09-01

    DNA barcoding is a powerful tool for species detection, identification and discovery. Metazoan DNA barcoding is primarily based upon a specific region of the cytochrome c oxidase subunit I gene that is PCR amplified by primers HCO2198 and LCO1490 ('Folmer primers') designed by Folmer et al. (Molecular Marine Biology and Biotechnology, 3, 1994, 294). Analysis of sequences published since 1994 has revealed mismatches in the Folmer primers to many metazoans. These sequences also show that an extremely high level of degeneracy would be necessary in updated Folmer primers to maintain broad taxonomic utility. In primers jgHCO2198 and jgLCO1490, we replaced most fully degenerated sites with inosine nucleotides that complement all four natural nucleotides and modified other sites to better match major marine invertebrate groups. The modified primers were used to amplify and sequence cytochrome c oxidase subunit I from 9105 specimens from Moorea, French Polynesia and San Francisco Bay, California, USA representing 23 phyla, 42 classes and 121 orders. The new primers, jgHCO2198 and jgLCO1490, are well suited for routine DNA barcoding, all-taxon surveys and metazoan metagenomics. © 2013 John Wiley & Sons Ltd.

  4. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  5. Determining the specific microbial populations and their spatial distribution within the stromatolite ecosystem of Shark Bay.

    Science.gov (United States)

    Goh, Falicia; Allen, Michelle A; Leuko, Stefan; Kawaguchi, Tomohiro; Decho, Alan W; Burns, Brendan P; Neilan, Brett A

    2009-04-01

    The stromatolites at Shark Bay, Western Australia, are analogues of some of the oldest evidence of life on Earth. The aim of this study was to identify and spatially characterize the specific microbial communities associated with Shark Bay intertidal columnar stromatolites. Conventional culturing methods and construction of 16S rDNA clone libraries from community genomic DNA with both universal and specific PCR primers were employed. The estimated coverage, richness and diversity of stromatolite microbial populations were compared with earlier studies on these ecosystems. The estimated coverage for all clone libraries indicated that population coverage was comprehensive. Phylogenetic analyses of stromatolite and surrounding seawater sequences were performed in ARB with the Greengenes database of full-length non-chimaeric 16S rRNA genes. The communities identified exhibited extensive diversity. The most abundant sequences from the stromatolites were alpha- and gamma-proteobacteria (58%), whereas the cyanobacterial community was characterized by sequences related to the genera Euhalothece, Gloeocapsa, Gloeothece, Chroococcidiopsis, Dermocarpella, Acaryochloris, Geitlerinema and Schizothrix. All clones from the archaeal-specific clone libraries were related to the halophilic archaea; however, no archaeal sequence was identified from the surrounding seawater. Fluorescence in situ hybridization also revealed stromatolite surfaces to be dominated by unicellular cyanobacteria, in contrast to the sub-surface archaea and sulphate-reducing bacteria. This study is the first to compare the microbial composition of morphologically similar stromatolites over time and examine the spatial distribution of specific microorganismic groups in these intertidal structures and the surrounding seawater at Shark Bay. The results provide a platform for identifying the key microbial physiology groups and their potential roles in modern stromatolite morphogenesis and ecology.

  6. Specific detection and analysis of a probiotic Bifidobacterium strain in infant feces

    NARCIS (Netherlands)

    Kok, RG; DeWaal, A; Schut, F; Welling, GW; Weenk, G; Hellingwerf, KJ

    1996-01-01

    For specific detection of the probiotic Bifidobacterium sp. strain LW420 in infant feces and for rapid quality control of this strain in culture, three strain-specific 16S rRNA gene-targeted primers have been developed. These primers allow specific detection of the organism via PCR. Specificity of

  7. 45S rDNA external transcribed spacer organization reveals new phylogenetic relationships in Avena genus.

    Science.gov (United States)

    Rodrigues, Joana; Viegas, Wanda; Silva, Manuela

    2017-01-01

    The genus Avena comprises four distinct genomes organized in diploid (AA or CC), tetraploid (AABB or AACC) and hexaploid species (AACCDD), constituting an interesting model for phylogenetic analysis. The aim of this work was to characterize 45S rDNA intergenic spacer (IGS) variability in distinct species representative of Avena genome diversity-A. strigosa (AA), A. ventricosa (CvCv), A. eriantha (CpCp), A. barbata (AABB), A. murphyi (AACC), A. sativa (AACCDD) and A. sterilis (AACCDD) through the assessment of the 5' external transcribed spacer (5'-ETS), a promising IGS region for phylogenetic studies poorly studied in Avena genus. In this work, IGS length polymorphisms were detected mainly due to distinct 5'-ETS sequence types resulting from major differences in the number and organization of repeated motifs. Although species with A genome revealed a 5'-ETS organization (A-organization) similar to the one previously described in A. sativa, a distinct organization was unraveled in C genome diploid species (C-organization). Interestingly, such new organization presents a higher similarity with other Poaceae species than A-genome sequences, supporting the hypothesis of C-genome being the ancestral Avena genome. Additionally, polyploid species with both genomes mainly retain the A-genome 5'-ETS organization, confirming the preferential elimination of C-genome sequences in Avena polyploid species. Moreover, 5'-ETS sequences phylogenetic analysis consistently clustered the species studied according to ploidy and genomic constitution supporting the use of ribosomal genes to highlight Avena species evolutive pathways.

  8. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  9. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  10. The 18S rDNA sequences support polyphyly of the Hypsibiidae (Eutardigrada

    Directory of Open Access Journals (Sweden)

    Hartmut GREVEN

    2007-09-01

    Full Text Available To extend data on 18S rDNA gene phylogeny within the Eutardigrada and to provide additional information on unclear taxonomic status of a glacier tardigrade Hypsibius klebelsbergi, gene sequences from seven tardigrade species of the family Hypsibiidae (Hypsibius klebelsbergi, Hypsibius cf. convergens 1, Hypsibius cf. convergens 2, Hypsibius scabropygus, Hebensuncus conjungens, Isohypsibius cambrensis, Isohypsibius granulifer were analysed together with previously published sequences from ten further eutardigrade species or species groups. Three distinctly separated clades within the Hypsibiidae, 1 the Ramazzottius - Hebesuncus clade, 2 the Isohypsibius clade (Isohypsibius, Halobiotus, Thulinius, and 3 the Hypsibius clade (Hypsibius spp. have been obtained in each of four phylogenetic trees recovered by Maximum Parsimony, Neighbour Joining, Minimum Evolution and UPGMA. Hybsibius klebelsbergi has been located always within the Hypsibius clade. The detailed sister group relationship was not resolved adequately, but there is robust support for a sister group relationship between the Hypsibius clade and the remaining clades. We cannot exclude that the Ramazzottius - Hebesuncus clade is a sister group of the Macrobiotus clade. Our findings suggest polyphyly of the Hypsibiidae, and thus multiple evolutions of some structures currently applied as diagnostic characters (e.g., claws, buccal apophyses.

  11. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  12. Characterization of cucumber fermentation spoilage bacteria by enrichment culture and 16S rDNA cloning.

    Science.gov (United States)

    Breidt, Fred; Medina, Eduardo; Wafa, Doria; Pérez-Díaz, Ilenys; Franco, Wendy; Huang, Hsin-Yu; Johanningsmeier, Suzanne D; Kim, Jae Ho

    2013-03-01

    Commercial cucumber fermentations are typically carried out in 40000 L fermentation tanks. A secondary fermentation can occur after sugars are consumed that results in the formation of acetic, propionic, and butyric acids, concomitantly with the loss of lactic acid and an increase in pH. Spoilage fermentations can result in significant economic loss for industrial producers. The microbiota that result in spoilage remain incompletely defined. Previous studies have implicated yeasts, lactic acid bacteria, enterobacteriaceae, and Clostridia as having a role in spoilage fermentations. We report that Propionibacterium and Pectinatus isolates from cucumber fermentation spoilage converted lactic acid to propionic acid, increasing pH. The analysis of 16S rDNA cloning libraries confirmed and expanded the knowledge gained from previous studies using classical microbiological methods. Our data show that Gram-negative anaerobic bacteria supersede Gram-positive Fermincutes species after the pH rises from around 3.2 to pH 5, and propionic and butyric acids are produced. Characterization of the spoilage microbiota is an important first step in efforts to prevent cucumber fermentation spoilage. An understanding of the microorganisms that cause commercial cucumber fermentation spoilage may aid in developing methods to prevent the spoilage from occurring. © 2013 Institute of Food Technologists®

  13. The frequency of rDNA variants within individuals provides evidence of population history and gene flow across a grasshopper hybrid zone.

    Science.gov (United States)

    Keller, Irene; Veltsos, Paris; Nichols, Richard A

    2008-04-01

    In the grasshopper Podisma pedestris, units of the ribosomal DNA (rDNA) multigene family are not identical, but comprise multiple genetic variants. We surveyed this variation using a novel pyrosequencing approach. The history of the study populations is well characterized as the pattern of colonization can be inferred from the distribution of two chromosomal races that invaded from different directions after the last glacial maximum and finally met to form a hybrid zone. This knowledge of the populations' ancestry allows us to draw inferences about the rate of change in rDNA composition. The rDNA data have, in turn, been revealing about the populations' ancestry, indicating a previously unsuspected route of postglacial colonization. The two chromosomal races were found to have genetically distinctive rDNA composition, demonstrating the persistence of differences for thousands of generations. It follows that the hybrid zone represents a natural experiment in which repeated crossing and backcrossing between these different rDNA lineages has occurred for over 8000 generations. The association between chromosomal race and rDNA composition has been broken down within the zone. It therefore appears that rDNA variants move freely across the zone and are not under opposing selection pressures in the two races, as had previously been suspected.

  14. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Florian Barbi

    Full Text Available Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5 and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2, active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may

  15. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  16. A study of variation in rDNA ITS regions shows that two haplotypes coexist within a single aphid genome.

    Science.gov (United States)

    Fenton, B; Malloch, G; Germa, F

    1998-06-01

    We report variation in the rDNA internal transcribed spacers (ITSs) of aphid species, the first for these insects. Variation at 6 sites within ITS1 sequences of the green peach aphid, Myzus persicae, identified two haplotypes coexisting within the same individuals, indicating that molecular drive has not homogenised different copies of rDNA. During this study, we found that PCR can cause a precise 58-bp loss in the amplified copies of an ITS haplotype (type 1). This occurs in all detectable copies under routine PCR conditions, at different annealing temperatures and with Pfu and Taq polymerases. In addition, "hot-start" PCR exclusively copied a different, rare haplotype (type 2). These observations have important considerations for using PCR, as large deletions in PCR products may not reflect real deletions in the genome, and changes in PCR conditions may be needed to copy cryptic haplotypes.

  17. 16S rDNA sequence diversity of a culture-accessible part of an anaerobic digestor bacterial community.

    Science.gov (United States)

    Delbès, C; Godon, J J; Moletta, R

    1998-12-01

    A bacterial culture-based inventory with 16S rDNA identification of the isolates was carried out on an anaerobic digestor microbial ecosystem to compare to the 16S rDNA sequences directly retrieved from the ecosystem by a molecular inventory previously made in our laboratory. Twenty OTUs (Operational Taxonomic Units) belonging to five of the major bacterial groups were identified from 338 isolated colonies. The sequences of 13 of the 20 OTUs were not closely related to any hitherto published sequences (less than 96% sequence identity). Six OTUs out of 20 were found to have sequences similar to sequences of the molecular inventory. Despite the biases expected to be associated with the molecular and culture-based methods, the distribution of the isolated OTUs into the different bacterial phyla was similar to that of the molecular OTUs.

  18. Differentiating sex chromosomes of the dioecious Spinacia oleracea L. (spinach) by FISH of 45S rDNA.

    Science.gov (United States)

    Lan, T; Zhang, S; Liu, B; Li, X; Chen, R; Song, W

    2006-01-01

    Spinacia oleracea L. (spinach) is a dioecious species with both male and female plants having 2n = 2x = 12 chromosomes, consisting of two large metacentrics, two long subtelocentrics, two short subtelocentrics, two acrocentrics, and four submetacentrics. The location of 45S rDNA was investigated on metaphase chromosomes using fluorescence in situ hybridization (FISH). The numbers of 45S rDNA foci in diploid sets of chromosomes from females was six and from males was five. All the fluorescent foci lay in secondary constrictions and the satellites. Our results indicate that an XY-type sex chromosome system could be present in spinach where the Y chromosome lacks a 45S RNA focus. Copyright (c) 2006 S. Karger AG, Basel.

  19. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    -ITS2 regions and in the D1/D2 domain of 26S rDNA using primers designed for this study. A total of 133 blood isolates previously identified as C. glabrata were examined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and the peptide nucleic acid-fluorescent in situ...... hybridization (PNA-FISH) method. The size of ITS1 allowed differentiation between C. glabrata (483), C. nivariensis (361) and C. bracarensis (385), whereas the ITS2 region was of similar size in C. nivariensis (417) and C. glabrata (418). Sequence analysis of the ITS region suggested that many restriction...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C...

  20. Differentiation among three species of bovine Thelazia (Nematoda: Thelaziidae) by polymerase chain reaction-restriction fragment length polymorphism of the first internal transcribed spacer ITS-1 (rDNA).

    Science.gov (United States)

    Otranto, D; Tarsitano, E; Traversa, D; Giangaspero, A; De Luca, F; Puccini, V

    2001-12-01

    Thelazia gulosa, Thelazia rhodesi and Thelazia skrjabini are nematodes transmitted by some species of Musca (Diptera: Muscidae) which cause ocular infestations in bovines. Differences in the rDNA of these species were determined by a PCR using different sets of relatively conserved oligonucleotide primers. PCR on the first internal transcribed spacer (ITS-1) revealed differences in size in Thelazia species (437 bp for T. gulosa, 370 bp for T. rhodesi and 506 bp for T. skrjabini) while the DNA control of Musca spp. was not amplified. The ITS-1 amplicons of the three species were sequenced and then analysed. The GC contents ranged from 26 to 36% and the level of differences in the nucleotide sequences of ITS-1 was lower between T. skrjabini and T. gulosa (39%) than the latter and T. rhodesi (49-56%). Restriction fragment length polymorphism (RFLP) of ITS-1 amplicons was also carried out and the restriction profiles compared. Clear genetic differences among the three Thelazia examined were demonstrated by using the enzymes HpaII, CpoI and SspI. This PCR-RFLP for the delineation of T. gulosa, T. rhodesi and T. skrjabini offers prospects as a molecular epidemiological tool to study parasite transmission patterns and prevalence.

  1. GENETIC DIFFERENTIATION BETWEEN NOBLE CRAYFISH, ASTACUS ASTACUS (L., POPULATIONS DETECTED BY MICROSATELLITE LENGTH VARIATION IN THE RDNA ITS1 REGION

    Directory of Open Access Journals (Sweden)

    EDSMAN L.

    2002-07-01

    Full Text Available The Internal Transcribed Spacer (ITS region of the nuclear ribosomal repeat was investigated in the search for a suitable genetic marker for population studies of the noble crayfish Astacus astacus (L.. DNA sequencing revealed the presence of two microsatellite insertions in ITS1. By designing highly specific PCR primers, adjacent to one of the insertions, we were able to use fragment analysis to explore the variation of the insertion in 642 specimens from 17 populations of crayfish from Sweden and former Yugoslavia. A new statistical test, the Population Divergence Test, was developed to assess statistical significance of divergence between populations. This test does not assume Mendelian inheritance. Our results demonstrate that different populations often produce characteristic fragment patterns, and that most, but not all, populations are genetically distinct, with high significance. The populations that cannot be significantly differentiated are situated in close geographic proximity to each other and belong to the same main river system, probably reflecting that these populations have had recent contact and that gene flow has occurred.

  2. Chromosomal location of heterochromatin and 45S rDNA sites in four South American triatomines (Heteroptera: Reduviidae)

    OpenAIRE

    Bardella, V. B. [UNESP; Gaeta, M.L.; Vanzela, A.L.L.; Oliveira, Maria Tercília Vilela de Azeredo

    2010-01-01

    The Triatominae are distributed in Brazilian regions and are the vector of Chagas disease. This group is also characterized by lower karyotype variability, occurrence of holokinetic chromosomes and inverted meiosis of the sex chromosomes. In this study, we determined the karyotype of four species of the genus Triatoma Laporte, 1832 using chromosome measurement, chromosome banding and FISH with a 45S rDNA probe. All samples showed 2n = 20A+XY with chromosomes sorted by size in decreasing order...

  3. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    Science.gov (United States)

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  4. A Telecommunications Industry Primer: A Systems Model.

    Science.gov (United States)

    Obermier, Timothy R.; Tuttle, Ronald H.

    2003-01-01

    Describes the Telecommunications Systems Model to help technical educators and students understand the increasingly complex telecommunications infrastructure. Specifically looks at ownership and regulatory status, service providers, transport medium, network protocols, and end-user services. (JOW)

  5. Thermal stability of quadruplex primers for highly versatile isothermal DNA amplification.

    Science.gov (United States)

    Mathias, Jordan; Okyere, Robert; Lomidze, Levan; Gvarjaladze, David; Musier-Forsyth, Karin; Kankia, Besik

    2014-01-01

    Quadruplex priming amplification (QPA) allows isothermal amplification of nucleic acids with improved yield and simplified detection. This assay is based on a DNA quadruplex, GGGTGGGTGGGTGGG (G3T), which in the presence of specific cations possesses unusually high thermal stability. QPA employs truncated G3T sequences as primers, which upon polymerase elongation, self-dissociate from the binding site and allow the next round of priming without thermal unfolding of amplicons. The rate of amplification strongly depends on the thermal stability of the primer/primer binding site (PBS) complex and to date QPA has been demonstrated to work over a narrow temperature range. To expand the capabilities of QPA, in the present study, we studied the fold and thermodynamic properties of the wild-type G3T and variants containing sequence modifications or extensions at the 5'-end. Circular dichroism studies demonstrate that the substitution of thymidines by other nucleotides or GC addition at the 5'-end does not change the parallel fold of G3T. Thermal unfolding experiments revealed that purine bases incorporated at loop positions and 5'-end dinucleotide extension significantly destabilize the quadruplex, while loop pyrimidines have almost no effect. Overall, the results of these studies suggest that linear isothermal QPA can be performed over a wide temperature range to accommodate both thermophilic and mesophilic DNA polymerases. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Identifying krill eggs in the central California current using novel multiplex PCR primers: Applications and limitations

    Science.gov (United States)

    Carrion, C. N.; Slesinger, E.; Marinovic, B.

    2016-02-01

    Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.

  7. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  8. Update on Acanthamoeba jacobsi genotype T15, including full-length 18S rDNA molecular phylogeny.

    Science.gov (United States)

    Corsaro, Daniele; Köhsler, Martina; Montalbano Di Filippo, Margherita; Venditti, Danielle; Monno, Rosa; Di Cave, David; Berrilli, Federica; Walochnik, Julia

    2017-04-01

    Free-living amoebae of the genus Acanthamoeba are worldwide present in natural and artificial environments, and are also clinically important, as causative agents of diseases in humans and other animals. Acanthamoeba comprises several species, historically assigned to one of the three groups based on their cyst morphology, but presently recognized as at least 20 genotypes (T1-T20) on the basis of their nuclear 18S ribosomal RNA (rRNA) gene (18S rDNA) sequences. While strain identification may usually be achieved targeting short (2200 bp) is necessary for correct genotype description and reliable molecular phylogenetic inference. The genotype T15, corresponding to Acanthamoeba jacobsi, is the only genotype described on the basis of partial sequences (~1500 bp). While this feature does not prevent the correct identification of the strains, having only partial sequences renders the genotype T15 not completely defined and may furthermore affect its position in the Acanthamoeba molecular tree. Here, we complete this gap, by obtaining full-length 18S rDNA sequences from eight A. jacobsi strains, genotype T15. Morphologies and physiological features of isolated strains are reported. Molecular phylogeny based on full 18S rDNA confirms some previous suggestions for a genetic link between T15 and T13, T16, and T19, with T19 as sister-group to T15.

  9. Karyotype characterization and evolution in South American species of Lathyrus (Notolathyrus, Leguminosae) evidenced by heterochromatin and rDNA mapping.

    Science.gov (United States)

    Chalup, Laura; Samoluk, Sergio Sebastián; Neffa, Viviana Solís; Seijo, Guillermo

    2015-11-01

    Notolathyrus is a section of South American endemic species of the genus Lathyrus. The origin, phylogenetic relationship and delimitation of some species are still controversial. The present study provides an exhaustive analysis of the karyotypes of approximately half (10) of the species recognized for section Notolathyrus and four outgroups (sections Lathyrus and Orobus) by cytogenetic mapping of heterochromatic bands and 45S and 5S rDNA loci. The bulk of the parameters analyzed here generated markers to identify most of the chromosomes in the complements of the analyzed species. Chromosome banding showed interspecific variation in the amount and distribution of heterochromatin, and together with the distribution of rDNA loci, allowed the characterization of all the species studied here. Additionally, some of the chromosome parameters described (st chromosomes and the 45S rDNA loci) constitute the first diagnostic characters for the Notolathyrus section. Evolutionary, chromosome data revealed that the South American species are a homogeneous group supporting the monophyly of the section. Variation in the amount of heterochromatin was not directly related to the variation in DNA content of the Notolathyrus species. However, the correlation observed between the amount of heterochromatin and some geographical and bioclimatic variables suggest that the variation in the heterochromatic fraction should have an adaptive value.

  10. Two different and functional nuclear rDNA genes in the abalone Haliotis tuberculata: tissue differential expression.

    Science.gov (United States)

    Van Wormhoudt, Alain; Gaume, Béatrice; Le Bras, Yvan; Roussel, Valérie; Huchette, Sylvain

    2011-10-01

    Analysis of the 18S rDNA sequences of Haliotis tuberculata tuberculata and H. t. coccinea subtaxa identified two different types of 18S rDNA genes and ITS1 regions. These two different genes were also detected in H. marmorata, H. rugosa and H. diversicolor that are separated from H. tuberculata by 5-65 mya. The mean divergence value between type I and type II sequences ranged from 7.25% for 18S to 80% for ITS1. ITS1 type II is homologous with the ITS1 consensus sequences published for many abalone species, whereas ITS1 type I presented only minor homology with a unique database entry for H. iris ITS1. A phylogenetic analysis makes a clear separation between type I and type II ITS1 sequences and supports grouping H. t. tuberculata, H. t. coccinea and H. marmorata together. The two subtaxa do not show any significant differences between the homologous 18S rDNA sequences. A general structure of the ITS1 transcript was proposed, with four major helices for the two types. The two genes were expressed and, for the first time, a putative differential expression of ITS1 type I was detected in the gills, digestive gland and gonads whereas ITS1 type II was expressed in all tissues.

  11. Chromosomal location of heterochromatin and 45S rDNA sites in four South American triatomines (Heteroptera: Reduviidae

    Directory of Open Access Journals (Sweden)

    Vanessa Bardella

    2010-12-01

    Full Text Available The Triatominae are distributed in Brazilian regions and are the vector of Chagas disease. This group is also characterized by lower karyotype variability, occurrence of holokinetic chromosomes and inverted meiosis of the sex chromosomes. In this study, we determined the karyotype of four species of the genus Triatoma Laporte, 1832 using chromosome measurement, chromosome banding and FISH with a 45S rDNA probe. All samples showed 2n = 20A+XY with chromosomes sorted by size in decreasing order. Heterochromatin of Triatoma infestans melanosoma Lent, Jurberg, Galvão, Carcavallo, 1994 is distributed among eight autosomes and the sex chromosomes. In Triatoma brasiliensis Neiva, 1911, T. matogrossensis Leite, Barbosa, 1953 and T. rubrovaria Blanchard, 1834, heterochromatin was restricted to the Y chromosome, which was characterized as DAPI+ (weak signal. FISH using a 45S rDNA probe of Drosophila melanogaster Meigen, 1830 showed differences in the number and location of hybridization sites. T. brasiliensis and T. rubrovaria showed the signal on one autosome pair. T. matogrossensis showed signals on both sex chromosomes, and T. infestans melanosoma only on the X chromosome. Conventional banding analysis suggests a closer relationship between T. brasiliensis, T. matogrossensis and T. rubrovaria, except with regard to 45S rDNA location in T. matogrossensis, and a more differentiated karyotype in T. infestans melanosoma.

  12. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  13. Establishment of Methylation-Specific PCR for the Mouse p53 Gene

    Directory of Open Access Journals (Sweden)

    Ryuji Okazaki

    2011-01-01

    Full Text Available Methylation-specific PCR (MSP of the mouse p53 gene has not yet been reported. We searched the CpG islands, sequenced the bisulfited DNA, and designed PCR primers for methylation and unmethylation sites. DNA from a young mouse produced a strong PCR product with the unmethylated primer and a weaker band with the methylated primer. DNA from an old mouse produced bands of similar intensities with both primers. In radiation-induced tumors, DNA from an old mouse yielded similar bands with both types of primers. We suggest that MSP is a valuable technique for the epigenetic study of the mouse p53 gene.

  14. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  15. Species-specific detection of Dickeya sp. (Pectobacterium ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... +, 171bp product amplified by primers LF/LR; -, no amplified products; CGMCC, China general microbiological culture collection; ATCC,. American type culture collection. Table 2. GeneBank accession numbers and sequences compared to develop species-specific primers LF/LR for Dickeya sp.

  16. 45S rDNA external transcribed spacer organization reveals new phylogenetic relationships in Avena genus

    Science.gov (United States)

    Rodrigues, Joana; Viegas, Wanda

    2017-01-01

    The genus Avena comprises four distinct genomes organized in diploid (AA or CC), tetraploid (AABB or AACC) and hexaploid species (AACCDD), constituting an interesting model for phylogenetic analysis. The aim of this work was to characterize 45S rDNA intergenic spacer (IGS) variability in distinct species representative of Avena genome diversity–A. strigosa (AA), A. ventricosa (CvCv), A. eriantha (CpCp), A. barbata (AABB), A. murphyi (AACC), A. sativa (AACCDD) and A. sterilis (AACCDD) through the assessment of the 5’ external transcribed spacer (5’-ETS), a promising IGS region for phylogenetic studies poorly studied in Avena genus. In this work, IGS length polymorphisms were detected mainly due to distinct 5’-ETS sequence types resulting from major differences in the number and organization of repeated motifs. Although species with A genome revealed a 5’-ETS organization (A-organization) similar to the one previously described in A. sativa, a distinct organization was unraveled in C genome diploid species (C-organization). Interestingly, such new organization presents a higher similarity with other Poaceae species than A-genome sequences, supporting the hypothesis of C-genome being the ancestral Avena genome. Additionally, polyploid species with both genomes mainly retain the A-genome 5’-ETS organization, confirming the preferential elimination of C-genome sequences in Avena polyploid species. Moreover, 5’-ETS sequences phylogenetic analysis consistently clustered the species studied according to ploidy and genomic constitution supporting the use of ribosomal genes to highlight Avena species evolutive pathways. PMID:28448637

  17. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  18. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  19. Preliminary study on applicability of microsatellite DNA primers from parasite protozoa Trypanosoma cruzi in free-living protozoa

    Science.gov (United States)

    Zhang, Wenjing; Yu, Yuhe; Shen, Yunfen; Miao, Wei; Feng, Weisong

    2004-04-01

    In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10, MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE11, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T. thermophila BF1. Further, eight 300 500 bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.

  20. Identification by 16S rDNA fragment amplification and determination of genetic diversity by random amplified polymorphic DNA analysis of Pasteurella pneumotropica isolated from laboratory rodents.

    Science.gov (United States)

    Kodjo, A; Villard, L; Veillet, F; Escande, F; Borges, E; Maurin, F; Bonnod, J; Richard, Y

    1999-02-01

    Pasteurella pneumotropica is an opportunistic bacterium frequently isolated from colonies of various laboratory rodents. Identification of this species, including its differentiation into two distinct biotypes (Jawetz and Heyl), is usually based on the use of conventional bacteriologic methods. In this study, a 16S rDNA fragment amplification procedure was developed for use as an alternative method for identification and differentiation of P. pneumotropica. Polymerase chain reaction (PCR) products were two distinctive fragments of 937 and 564 bp specific for biotypes Jawetz and Heyl, respectively. Specificity of PCR products could be achieved by EcoRI cleavage, leading to 596 plus 341-bp and 346 plus 218-bp fragments for each of the amplification products. Use of this procedure confirmed identification of 34 field isolates and allowed definitive identification of some strains that could not have been done by use of bacteriologic examinations. Field isolates subjected to random amplified polymorphic DNA (RAPD) analysis had high genetic diversity among biotype Jawetz strains in contrast to biotype Heyl strains. In conclusion, RAPD could represent an additional means for identification of ambiguous strains of biotype Heyl and a valuable epidemiologic tool for identification of biotype Jawetz strains of P. pneumotropica.

  1. Elastic stability and HEP detectors: a primer

    CERN Document Server

    Wertelaers, P

    2018-01-01

    Destabilizing -- or "buckling" -- phenomena can compromise the quality of a physics detector long before the point of collapse has been reached. We rehearse on the two types of buckling : snap-through versus bifurcation. Then, we discuss bifurcation problems in a detector example. This introductory text specifically targets a non-engineer audience.

  2. 45S rDNA regions are chromosome fragile sites expressed as gaps in vitro on metaphase chromosomes of root-tip meristematic cells in Lolium spp.

    Directory of Open Access Journals (Sweden)

    Jing Huang

    Full Text Available BACKGROUND: In humans, chromosome fragile sites are regions that are especially prone to forming non-staining gaps, constrictions or breaks in one or both of the chromatids on metaphase chromosomes either spontaneously or following partial inhibition of DNA synthesis and have been well identified. So far, no plant chromosome fragile sites similar to those in human chromosomes have been reported. METHODS AND RESULTS: During the course of cytological mapping of rDNA on ryegrass chromosomes, we found that the number of chromosomes plus chromosome fragments was often more than the expected 14 in most cells for Lolium perenne L. cv. Player by close cytological examination using a routine chromosome preparation procedure. Further fluorescent in situ hybridization (FISH using 45S rDNA as a probe indicated that the root-tip cells having more than a 14-chromosome plus chromosome fragment count were a result of chromosome breakage or gap formation in vitro (referred to as chromosome lesions at 45S rDNA sites, and 86% of the cells exhibited chromosome breaks or gaps and all occurred at the sites of 45S rDNA in Lolium perenne L. cv. Player, as well as in L. multiflorum Lam. cv. Top One. Chromatin depletion or decondensation occurred at various locations within the 45S rDNA regions, suggesting heterogeneity of lesions of 45S rDNA sites with respect to their position within the rDNA region. CONCLUSIONS: The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes, and thus we conclude that the high frequency of chromosome lesions in vitro in Lolium species is the result of the expression of 45S rDNA fragile sites. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are discussed.

  3. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  4. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  5. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription.

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P; Ogden, Allison J; Hicks, Rodney J; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D; Hannan, Katherine M; Pearson, Richard B

    2016-08-02

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer.

  6. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  7. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Directory of Open Access Journals (Sweden)

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  8. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  9. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  10. A Primer on Alternative Transportation Fuels

    Science.gov (United States)

    2010-09-01

    The power plants associated with the two gas turbines ( LM6000 and AGT- 1500) represent a compromise to provide reasonably high specific power and...Energy (Wh/kg) Wartsila- Sulzer RTA96-C Diesel (ship) 109,000 1.2x107 735 2x106 107 .5 6.8 5,000 General Electric LM6000 gas turbine (ship...represented by the AGT 1500, the LM6000 , and RTA96-C power plants. It seems unlikely that any future battery and fuel cell arrangement will meet the

  11. Comparison of broad range 16S rDNA PCR and conventional blood culture for diagnosis of sepsis in the newborn: a case control study

    Directory of Open Access Journals (Sweden)

    Nakstad Britt

    2009-01-01

    Full Text Available Abstract Background Early onset bacterial sepsis is a feared complication of the newborn. A large proportion of infants admitted to the Neonatal Intensive Care Unit (NICU for suspected sepsis receive treatment with potent systemic antibiotics while a diagnostic workup is in progress. The gold standard for detecting bacterial sepsis is blood culture. However, as pathogens in blood cultures are only detected in approximately 25% of patients, the sensitivity of blood culture is suspected to be low. Therefore, the diagnosis of sepsis is often based on the development of clinical signs, in combination with laboratory tests such as a rise in C – reactive protein (CRP. Molecular assays for the detection of bacterial DNA in the blood represent possible new diagnostic tools for early identification of a bacterial cause. Methods A broad range 16S rDNA polymerase chain reaction (PCR without preincubation was compared to conventional diagnostic work up for clinical sepsis, including BACTEC blood culture, for early determination of bacterial sepsis in the newborn. In addition, the relationship between known risk factors, clinical signs, and laboratory parameters considered in clinical sepsis in the newborn were explored. Results Forty-eight infants with suspected sepsis were included in this study. Thirty-one patients were diagnosed with sepsis, only 6 of these had a positive blood culture. 16S rDNA PCR analysis of blinded blood samples from the 48 infants revealed 10 samples positive for the presence of bacterial DNA. PCR failed to be positive in 2 samples from blood culture positive infants, and was positive in 1 sample where a diagnosis of a non-septic condition was established. Compared to blood culture the diagnosis of bacterial proven sepsis by PCR revealed a 66.7% sensitivity, 87.5% specificity, 95.4% positive and 75% negative predictive value. PCR combined with blood culture revealed bacteria in 35.1% of the patients diagnosed with sepsis

  12. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    Science.gov (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  13. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  14. Depth profiles and free volume in aircraft primer films

    Science.gov (United States)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.

    2015-06-01

    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  15. Improved primer for bonding polyurethane adhesives to metals

    Science.gov (United States)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  16. Barcoded primers used in multiplex amplicon pyrosequencing bias amplification.

    Science.gov (United States)

    Berry, David; Ben Mahfoudh, Karim; Wagner, Michael; Loy, Alexander

    2011-11-01

    "Barcode-tagged" PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  17. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  18. Sights, Sounds, Senses in Step with Reading. Primer.

    Science.gov (United States)

    Norris, Mildred W.; Messerli, John H.

    This Title III bibliography presents books, films, filmstrips, and records that correlate with stories from primers. The list of books is prepared from the suggested lists of the Ginn, Houghton Mifflin, Lippincott, and Scott, Foresman reading series. The bibliography includes sections about animals, birthdays, cowboys, fantasy, helpers, holidays,…

  19. Children on Medication: A Primer for School Personnel.

    Science.gov (United States)

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  20. A Primer on Ways To Explore Item Bias.

    Science.gov (United States)

    Cromwell, Susan

    This paper provides an introductory primer on methods for exploring item bias. The purposes of item bias analysis are to investigate whether test scores are affected by different sources of variance in the various subpopulations, and if different sources of variance are found, to determine if an unfair advantage exists. The review discusses three…