WorldWideScience

Sample records for rdna primer specifity

  1. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  2. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  3. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  4. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  5. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  6. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  7. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  8. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  9. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  10. PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

    Science.gov (United States)

    Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

    2007-01-01

    Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

  11. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  12. Multiplex PCR for specific and robust detection of Xanthomonas campestris pv. musacearum in pure culture and infected plant material

    DEFF Research Database (Denmark)

    Adriko, John; Aritua, V.; Mortensen, Carmen Nieves

    2012-01-01

    The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...

  13. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  14. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    Science.gov (United States)

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.

  15. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  16. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  17. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  18. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  19. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  20. PCR-based molecular discrimination of Pandora neoaphidis isolates from related entomopathogenic fungi and development of species-specific diagnostic primers.

    Science.gov (United States)

    Tymon, Anna M; Shah, Paresh A; Pell, Judith K

    2004-04-01

    Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.

  1. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  2. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  3. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  4. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  5. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  6. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  7. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  9. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  10. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  11. Polymerase chain reaction assay for the detection of Bacillus cereus group cells

    DEFF Research Database (Denmark)

    Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse

    2001-01-01

    of the B. cereus group in food and in the environment. Using 16S rDNA as target, a PCR assay for the detection of B. cereus group cells has been developed. Primers specific for the 16S rDNA of the B. cereus group bacteria were selected and used in combination with consensus primers for 165 rDNA as internal...... PCR procedure control. The PCR procedure was optimized with respect to annealing temperature. When DNA from the B. cereus group bacteria was present, the PCR assay yielded a B. cereus specific fragment, while when non-B. cereus prokaryotic DNA was present, the consensus 165 rDNA primers directed...

  12. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    Science.gov (United States)

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  13. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  14. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  15. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  16. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  17. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  20. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    Science.gov (United States)

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

    2008-01-01

    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  1. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  3. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  4. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  5. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  6. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  7. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  8. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  9. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  10. The internal transcribed spacer rDNA specific markers for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... amplified efficiently when paired with universal primer ITS4 in Z. piperitum, but not in Z. schinifolium. ..... generation of protein database search programs. ... Dillon SL, Lawrence PK, Henry RJ, Ross L, Price HJ, Johnston JS.

  11. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    Science.gov (United States)

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  12. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  13. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

    Directory of Open Access Journals (Sweden)

    Denilce Meneses Lopes

    2010-01-01

    Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  14. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  15. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  16. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  17. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  18. Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-07-01

    Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

  19. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  20. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  1. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    Science.gov (United States)

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  2. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  3. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  4. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  5. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  6. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  7. New view on the age-specificity of pig Cryptosporidium by species-specific primers for distinguishing Cryptosporidium suis and Cryptosporidium pig genotype II

    Czech Academy of Sciences Publication Activity Database

    Jeníková, M.; Němejc, K.; Sak, Bohumil; Květoňová, Dana; Kváč, Martin

    2011-01-01

    Roč. 176, 2/3 (2011), 120-125 ISSN 0304-4017 R&D Projects: GA ČR GP523/07/P117 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium suis * Cryptosporidium pig genotype II * Mixed infection * Age-specificity * Species-specific primers Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.579, year: 2011

  8. Assessment of Equine Fecal Contamination: The Search for Alternative Bacterial Source-tracking Targets

    Science.gov (United States)

    16S rDNA clone libraries were evaluated for detection of fecal source-identifying bacteria from a collapsed equine manure pile. Libraries were constructed using universal eubacterial primers and Bacteroides-Prevotella group-specific primers. Eubacterial sequences indicat...

  9. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  10. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  11. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  12. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  13. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    homeologous rRNA gene copies occurred in both synthetic and natural populations of Tragopogon allopolyploids. The extent of these rDNA changes was generally higher in natural populations than in the synthetic lines. We hypothesize that locus-specific and chromosomal changes in early generations of allopolyploids may influence patterns of rDNA evolution in later generations.

  14. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  15. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  16. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  17. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  18. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  19. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  20. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    Science.gov (United States)

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  1. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  2. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  3. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  4. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  5. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  6. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Science.gov (United States)

    Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca

    2018-01-01

    Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829

  7. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Directory of Open Access Journals (Sweden)

    Sofia Mazzoleni

    2018-01-01

    Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.

  8. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  9. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  10. MOLECULAR DIAGNOSTICS OF YERSINIA RUCKERI

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2014-06-01

    Full Text Available Purpose. The analysis of nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri and to develop the method of molecular diagnostic of enteric redmouth disease. Methodology. By the method of CLUSTALW algorithm in MEGA software version 6.0 the nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri were analysed. For development of molecular diagnostic of Y. ruckeri the method of polymerase chain reaction (PCR was used. Primer selection was carried out in software VectorNTI11 and on-line-service BLAST. The PCR products were investigated by the methods of sequencing and nucleotide analysis. Findings. Based on PCR assay the method of molecular diagnostic of enteric redmouth disease agent, bacterium Y. ruckeri was developed. It was shown that specific oligonucleotide primers generated PCR products in size of 600 base pairs. PCR products were investigated by the sequencing that showed right targeting of primers in reaction. Originality. Among high-conservative gene of 16S rDNA of Y. ruckeri the fragment of DNA was determined to which the specific primers for rapid diagnostic of virulent strains were selected. Practical Value. Rapid diagnostic of yersiniosis will allow to identify an agent of this infectious disease, bacterium Y. ruckeri, and to provide the prophylactic or medical measures in the fish farming of Ukraine.

  11. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    Science.gov (United States)

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  12. The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

    Science.gov (United States)

    Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

    2016-12-01

    Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  13. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  14. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  16. Absence of Mycoplasma-specific DNA sequence in brain, blood and CSF of patients with multiple sclerosis (MS): a study by PCR and real-time PCR.

    Science.gov (United States)

    Casserly, Georgina; Barry, Thomas; Tourtellotte, Wallace W; Hogan, Edward L

    2007-02-15

    Mycoplasmas are the smallest of the known self-replicating organisms. They lack cell walls and are associated with numerous diseases in humans and animals. We are exploring the possibility that infection by Mycoplasma may induce the inflammatory demyelinating disease of the central nervous system (CNS) that is MS. The presence of specific Mycoplasma species DNA was sought in brain, serum and cerebrospinal fluid (CSF) of patients diagnosed with multiple sclerosis (MS) and other neurological diseases (OND) including inflammatory disorders. The MS samples from patients with active and progressive MS, as well as in remission, a variety of other neurological disease controls, including inflammatory CNS diseases such as meningitis, cryptococcal meningitis and encephalitis and other neurological disorders such as migraine were also examined. Clinical samples were provided by the National Neurological Research Specimen Bank and the Human Brain and Spinal Fluid Resource Centre, Los Angeles. Analysis was carried out by conventional PCR using Mycoplasma-specific primers (McAuliffe et al., 2005) that target the 16S rDNA gene in Mycoplasma species. The Mycoplasma-specific primers could detect 102 Mycoplasma species. In this study, 30 samples of human brain and 57 pairs of serum and CSF and were examined. No Mycoplasma-specific nucleic acid sequence was detected, and the consistent observation of an endogenous gene, human serum albumin (HSA), as a positive control documented the adequacy of the method. Real-time PCR analysis of serum and CSF was done also targeting utilizing the Mycoplasma 16S rDNA gene, and this also demonstrated the lack of Mycoplasma in these samples. The presence of Mycoplasma at extraneural sites in MS patients is now being explored.

  17. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  18. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  1. Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

    Directory of Open Access Journals (Sweden)

    Mostafa Bakhshi

    2017-07-01

    Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

  2. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  3. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel).

    Science.gov (United States)

    Hoy, Marshal S; Kelly, Kevin; Rodriguez, Rusty J

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations. Published 2009. This article is a US Government work and is the public domain in the USA.

  4. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  5. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  6. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  7. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

    Science.gov (United States)

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

    2016-11-01

    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  8. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  10. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  11. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  12. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  13. rKnowledge: The Spatial Diffusion of rDNA Methods

    OpenAIRE

    Maryann Feldman; Dieter Kogler; David Rigby

    2013-01-01

    The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...

  14. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  15. Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S rDNA sequence fragments.

    Science.gov (United States)

    Cook, Courtney A; Lawton, Scott P; Davies, Angela J; Smit, Nico J

    2014-06-13

    SUMMARY Research was undertaken to clarify the true taxonomic position of the terrestrial tortoise apicomplexan, Haemogregarina fitzsimonsi (Dias, 1953). Thin blood films were screened from 275 wild and captive South African tortoises of 6 genera and 10 species between 2009-2011. Apicomplexan parasites within films were identified, with a focus on H. fitzsimonsi. Ticks from wild tortoises, especially Amblyomma sylvaticum and Amblyomma marmoreum were also screened, and sporogonic stages were identified on dissection of adult ticks of both species taken from H. fitzsimonsi infected and apparently non-infected tortoises. Parasite DNA was extracted from fixed, Giemsa-stained tortoise blood films and from both fresh and fixed ticks, and PCR was undertaken with two primer sets, HEMO1/HEMO2, and HepF300/HepR900, to amplify parasite 18S rDNA. Results indicated that apicomplexan DNA extracted from tortoise blood films and both species of tick had been amplified by one or both primer sets. Haemogregarina  fitzsimonsi 18S rDNA sequences from tortoise blood aligned with those of species of Hepatozoon, rather than those of species of Haemogregarina or Hemolivia. It is recommended therefore that this haemogregarine be re-assigned to the genus Hepatozoon, making Hepatozoon fitzsimonsi (Dias, 1953) the only Hepatozoon known currently from any terrestrial chelonian. Ticks are its likely vectors.

  16. Genetic diversity of archaea in deep-sea hydrothermal vent environments.

    OpenAIRE

    Takai, K; Horikoshi, K

    1999-01-01

    Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the...

  17. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    Directory of Open Access Journals (Sweden)

    Elizabeth X. Kwan

    2016-09-01

    Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.

  18. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

    Science.gov (United States)

    Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

    2016-09-08

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

  19. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  20. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  1. Evolution of rDNA in Nicotiana allopolyploids: A potential link between rDNa homogenization and epigenetics

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.

    2008-01-01

    Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008

  2. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  3. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  4. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.

    2003-01-01

    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  5. High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

    Science.gov (United States)

    Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

    2017-01-01

    The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary

  6. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  7. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  8. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  10. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  12. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  13. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  15. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  16. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  17. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  18. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  19. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  20. Development of PCR-based detection methods for the quarantine phytopathogen Synchytrium endobioticum, causal agent of wart disease

    NARCIS (Netherlands)

    Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.

    2005-01-01

    Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and

  1. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  2. Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

    Science.gov (United States)

    Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

    2005-08-01

    In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

  3. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  4. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  5. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  6. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  7. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  8. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    Directory of Open Access Journals (Sweden)

    Dong Chen

    Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.

  9. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  10. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  11. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  12. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  13. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Paula Rogério Fernandes

    2008-09-01

    Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the

  14. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  15. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  16. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  17. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    Science.gov (United States)

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  18. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  19. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  2. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  3. Trichostrongylus colubriformis rDNA polymorphism associated with arrested development

    Czech Academy of Sciences Publication Activity Database

    Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej

    2008-01-01

    Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008

  4. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Use of DNA sequencing to detect pathogenic, saprotrophic, and stain fungi in sapwood of declining red pine (Pinus resinosa) in the Upper Midwest

    Science.gov (United States)

    M.T. Banik; D.L. Lindner; J. Juzwik; J.A. Glaeser

    2013-01-01

    An inexpensive kit was developed to collect wood samples for molecular detection of pathogenic, saprotrophic and stain fungi in declining Pinus resinosa in the Upper Midwest. The kit contained materials for "clean" collection of sapwood drill shavings, which were then subjected to PCR of the rDNA ITS region with fungal-specific primers,...

  6. Identification of geobacter populations in the uranium mill tailings Shiprock

    International Nuclear Information System (INIS)

    Radeva, G.; Selenska-Pobell, S.

    2006-01-01

    Geobacter - specific primers were used for construction of a 16S rDNA library for a water sample collected from uranium mill tailings near Shiprock (Sh853) in the USA . Most of the retrieved sequences were affiliated with different Geobacter species, however sequences related to other δ -Proteobacteria were identified as well. (authors)

  7. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  8. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  9. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  10. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    Science.gov (United States)

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  12. Citrus huanglongbing in São Paulo State, Brazil: PCR detection of the 'Candidatus' Liberibacter species associated with the disease.

    Science.gov (United States)

    do Carmo Teixeira, Diva; Luc Danet, Jean; Eveillard, Sandrine; Cristina Martins, Elaine; de Jesus Junior, Waldir Cintra; Takao Yamamoto, Pedro; Aparecido Lopes, Silvio; Beozzo Bassanezi, Renato; Juliano Ayres, Antonio; Saillard, Colette; Bové, Joseph Marie

    2005-06-01

    Symptoms of huanglongbing (HLB), one of the most serious diseases of citrus in Asia and Africa, have been noticed in March 2004 in the Araraquara region of São Paulo State, Brazil. HLB has not been reported previously from America. The causal HLB bacteria, Candidatus Liberibacter africanus in Africa and Candidatus Liberibacter asiaticus in Asia, can be detected in symptomatic citrus leaves by PCR amplification of their 16S rDNA with previously described primers. When this technique was applied to 43 symptomatic leaf samples from the Araraquara region, all PCR reactions were negative. This suggested that a new pathogen, not detected by the above primers, could be involved in HLB in the State of São Paulo. Indeed, by using universal primers for amplification of bacterial 16S rDNA, a new liberibacter species, Candidatus Liberibacter americanus, has recently been identified. Specific primers for PCR amplification of the 16S rDNA of Ca. L. americanus have been selected. Using these primers, the new liberibacter could be detected in 214 symptomatic leaf samples tested. The leaves of two additional samples were infected with Candidatus Liberibacter asiaticus, and two further samples contained both Ca. L. americanus and Ca. L. asiaticus. The samples came from 47 farms in 35 municipalities. The psyllid vector of Ca. L. asiaticus, Diaphorina citri, is established in South, Central, and North America (Florida and Texas). Ca. L. americanus could be detected by PCR in several batches of D. citri psyllids collected on symptomatic sweet orange trees infected with Ca. L. americanus, strongly suggesting that D. citri is the vector of Ca. L. americanus. The results reported here confirm the presence of HLB in the State of São Paulo. Ca. L. americanus is the most widely distributed pathogen.

  13. Morphology and 18S rDNA gene sequence of Spirostomum minus and Spirostomum teres (Ciliophora: Heterotrichea from Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Noemi M. Fernandes

    2013-02-01

    Full Text Available Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequences of Spirostomum teres Claparède & Lachmann, 1858 and Spirostomum minus Roux, 1901, isolated from a sewage treatment plant and a freshwater lake in the city of Rio de Janeiro, Brazil, respectively. For the morphological descriptions of S. teres and S. minus, living cells were observed using bright-field and differential interference contrast (DIC microscopy, the total infraciliature and nuclear apparatus were revealed by staining with protargol, and ciliary patterns were observed also with scanning electron microscopy (SEM. The complete sequences of the 18S rDNA of S. teres and S. minus were obtained using eukaryotic universal primers, and then compared with sequences of other species and populations of Spirostomum deposited in the GenBank database. Living S. minus measured 400-800 µm in length and 55-115 µm in width, with the following characteristics: adoral zone of membranelles approximately 112 µm long; inconspicuous paroral kinety; 30-40 kineties in somatic ciliature; moniliform macronucleus with 9-25 nodes, approximately 12 micronuclei; single and posterior contractile vacuole; and yellow-brown cytoplasm. Living and fully extended S. teres measured approximately 250 µm in length and 65 ìm in width, with the following characteristics: adoral zone of membranelles approximately 92 µm long; approximately 30 somatic kineties; compact macronucleus, approximately five micronuclei; macronuclear groove present; single and posterior contractile vacuole

  14. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  15. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    Science.gov (United States)

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  16. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  17. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  18. Problematic barcoding in flatworms: A case-study on monogeneans and rhabdocoels (Platyhelminthes

    Directory of Open Access Journals (Sweden)

    Maarten Vanhove

    2013-12-01

    Full Text Available Some taxonomic groups are less amenable to mitochondrial DNA barcoding than others. Due to the paucity of molecular information of understudied groups and the huge molecular diversity within flatworms, primer design has been hampered. Indeed, all attempts to develop universal flatworm-specific COI markers have failed so far. We demonstrate how high molecular variability and contamination problems limit the possibilities for barcoding using standard COI-based protocols in flatworms. As a consequence, molecular identification methods often rely on other widely applicable markers. In the case of Monogenea, a very diverse group of platyhelminth parasites, and Rhabdocoela, representing one-fourth of all free-living flatworm taxa, this has led to a relatively high availability of nuclear ITS and 18S/28S rDNA sequences on GenBank. In a comparison of the effectiveness in species assignment we conclude that mitochondrial and nuclear ribosomal markers perform equally well. In case intraspecific information is needed, rDNA sequences can guide the selection of the appropriate (i.e. taxon-specific COI primers if available.

  19. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  20. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  1. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  2. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  3. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  4. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  5. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.

    2017-01-01

    Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016

  6. Metabarcoding Analysis of Phytophthora Diversity Using Genus-Specific Primers and 454 Pyrosequencing.

    Science.gov (United States)

    Prigigallo, Maria I; Abdelfattah, Ahmed; Cacciola, Santa O; Faedda, Roberto; Sanzani, Simona M; Cooke, David E L; Schena, L

    2016-03-01

    A metabarcoding method based on genus-specific primers and 454 pyrosequencing was utilized to investigate the genetic diversity of Phytophthora spp. in soil and root samples of potted plants, from eight nurseries. Pyrosequencing enabled the detection of 25 Phytophthora phylotypes distributed in seven different clades and provided a much higher resolution than a corresponding cloning/Sanger sequencing approach. Eleven of these phylotypes, including P. cactorum, P. citricola s.str., P. palmivora, P. palmivora-like, P. megasperma or P. gonapodyides, P. ramorum, and five putative new Phytophthora species phylogenetically related to clades 1, 2, 4, 6, and 7 were detected only with the 454 pyrosequencing approach. We also found an additional 18 novel records of a phylotype in a particular nursery that were not detected with cloning/Sanger sequencing. Several aspects confirmed the reliability of the method: (i) many identical sequence types were identified independently in different nurseries, (ii) most sequence types identified with 454 pyrosequencing were identical to those from the cloning/Sanger sequencing approach and/or perfectly matched GenBank deposited sequences, and (iii) the divergence noted between sequence types of putative new Phytophthora species and all other detected sequences was sufficient to rule out sequencing errors. The proposed method represents a powerful tool to study Phytophthora diversity providing that particular attention is paid to the analysis of 454 pyrosequencing raw read sequences and to the identification of sequence types.

  7. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  8. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  9. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  10. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  11. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  12. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  13. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  14. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  15. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  16. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  18. Different patterns of rDNA distribution in Pisum sativum nucleoli correlate with different levels of nucleolar activity

    International Nuclear Information System (INIS)

    Highett, M.I.; Rawlins, D.J.; Shaw, P.J.

    1993-01-01

    We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)

  19. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  20. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  1. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  2. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  3. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  4. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  5. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  6. PCR Primer Specific CaMV 35S Promoter to Detect Transgenic Soybean in Indonesia Commercial Soy Bean and Tempeh

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-11-01

    Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.

  7. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    DEFF Research Database (Denmark)

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.

    2005-01-01

    Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...

  8. Phylogenetic analysis of TCE-dechlorinating consortia enriched on a variety of electron donors.

    Science.gov (United States)

    Freeborn, Ryan A; West, Kimberlee A; Bhupathiraju, Vishvesh K; Chauhan, Sadhana; Rahm, Brian G; Richardson, Ruth E; Alvarez-Cohen, Lisa

    2005-11-01

    Two rapidly fermented electron donors, lactate and methanol, and two slowly fermented electron donors, propionate and butyrate, were selected for enrichment studies to evaluate the characteristics of anaerobic microbial consortia that reductively dechlorinate TCE to ethene. Each electron donor enrichment subculture demonstrated the ability to dechlorinate TCE to ethene through several serial transfers. Microbial community analyses based upon 16S rDNA, including terminal restriction fragment length polymorphism (T-RFLP) and clone library/sequencing, were performed to assess major changes in microbial community structure associated with electron donors capable of stimulating reductive dechlorination. Results demonstrated that five phylogenic subgroups or genera of bacteria were present in all consortia, including Dehalococcoides sp., low G+C Gram-positives (mostly Clostridium and Eubacterium sp.), Bacteroides sp., Citrobacter sp., and delta Proteobacteria (mostly Desulfovibrio sp.). Phylogenetic association indicates that only minor shifts in the microbial community structure occurred between the four alternate electron donor enrichments and the parent consortium. Inconsistent detection of Dehalococcoides spp. in clone libraries and T-RFLP of enrichment subcultures was resolved using quantitative polymerase chain reaction (Q-PCR). Q-PCR with primers specific to Dehalococcoides 16S rDNA resulted in positive detection of this species in all enrichments. Our results suggest that TCE-dechlorinating consortia can be stably maintained on a variety of electron donors and that quantities of Dehalococcoides cells detected with Dehalococcoides specific 16S rDNA primer/probe sets do not necessarily correlate well with solvent degradation rates.

  9. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  10. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    Science.gov (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  11. The β-1,3-glucanosyltransferase Gas1 regulates Sir2-mediated rDNA stability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki

    2014-07-01

    In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  13. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  14. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  15. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  16. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  17. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  18. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  19. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Juliano S. Cabral

    2006-01-01

    Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.

  20. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  1. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš

    2012-01-01

    Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  2. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  3. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

    Science.gov (United States)

    Guerra, Marcelo; García, Miguel A

    2004-02-01

    Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

  5. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  6. Multi-functional roles of a soldier-specific volatile as a worker arrestant, primer pheromone and an antimicrobial agent in a termite.

    Science.gov (United States)

    Mitaka, Yuki; Mori, Naoki; Matsuura, Kenji

    2017-07-26

    Division of labour in eusocial insects is characterized by efficient communication systems based on pheromones. Among such insects, termites have evolved specialized sterile defenders, called soldiers. Because they are incapable of feeding themselves, it has been suggested that soldiers are sustained by workers and emit the pheromone arresting workers. However, such a soldier pheromone has not been identified in any termite species, and the details of the soldier-worker interaction remain to be explored. Here, we identified a soldier-specific volatile sesquiterpene as a worker arrestant, which also acts as a primer pheromone regulating soldier differentiation and fungistatic agent in a termite Reticulitermes speratus Chemical analyses revealed that (-)- β -elemene is the major component of soldier extract, and its authentic standard exhibited arrestant activity to workers and inhibited the differentiation from workers to soldiers. This compound also showed fungistatic activity against entomopathogenic fungi. These suggest that (-)- β -elemene secreted by soldiers acts not only as a worker arrestant but also as one component of inhibitory primer pheromone and an anti-pathogenic agent. Our study provides novel evidence supporting the multi-functionality of termite soldier pheromone and provides new insights into the role of soldiers and the evolutionary mechanisms of pheromone compounds. © 2017 The Author(s).

  7. Molecular technique reveals high variability of 18S rDNA distribution in harvestmen (Opiliones, Phalangiidae) from South Africa.

    Science.gov (United States)

    Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R

    2018-01-01

    The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.

  8. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  11. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  12. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    Science.gov (United States)

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida).

    Science.gov (United States)

    Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M

    1996-07-01

    Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.

  14. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  16. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  18. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  19. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  20. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  1. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  2. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  3. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  4. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  5. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  6. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  7. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  8. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  9. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  10. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  11. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  12. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  13. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

    NARCIS (Netherlands)

    Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

    1994-01-01

    Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

  14. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  15. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  16. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  17. Multiplex PCR identification of Taenia spp. in rodents and carnivores.

    Science.gov (United States)

    Al-Sabi, Mohammad N S; Kapel, Christian M O

    2011-11-01

    The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

  18. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  19. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  20. Detecting in situ copepod diet diversity using molecular technique: development of a copepod/symbiotic ciliate-excluding eukaryote-inclusive PCR protocol.

    Science.gov (United States)

    Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie

    2014-01-01

    Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey

  1. Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.

    Science.gov (United States)

    Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy

    2012-01-01

    We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.

  2. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  3. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  4. The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

    Directory of Open Access Journals (Sweden)

    Andrew Macrae

    2000-06-01

    Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

  5. Variabilidade genética na região its do rDNA de isolados de trichoderma spp. (Biocontrolador e Fusarium oxysporum f. sp. Chrysanthemi Genetic variability in rDNA ITS region of Trichoderma spp. (biocontrole agent and Fusarium oxysporum f. sp. chrysanthemi isolates

    Directory of Open Access Journals (Sweden)

    Josiane Pacheco Menezes

    2010-02-01

    Full Text Available A análise de características morfológicas e culturais podem não ser suficientes para uma caracterização precisa das espécies de Trichoderma e Fusarium. Objetivou-se, neste trabalho, caracterizar a região do Espaço Interno Transcrito (ITS do rDNA dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma spp. utilizados no biocontrole de Fusarium oxysporum f. sp. chrysanthemi (isolado UFSMF6. A extração de DNA de cada isolado foi realizada a partir de micélio produzido em meio líquido Batata-Dextrose. As amostras de DNA genômico foram submetidas à Reação em Cadeia da Polimerase (PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4 e o produto gerado foi sequenciado. Os fragmentos gerados pela amplificação da PCR foram tratados com as enzimas de restrição HaeIII, HinfI e MboI. As regiões ITS1, ITS2 e 5.8S do rDNA desses isolados fúngicos foram amplificadas com sucesso. A região ITS dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma e o isolado UFSMF6 de Fusarium apresentaram uma banda simples com um fragmento de aproximadamente 600 pares de base (pb. As enzimas de restrição HaeIII, HinfI e MboI geraram polimorfismo de bandas entre os isolados. Com base nas análises da sequência de DNA, os isolados UFSMT15.1, UFSMT16, UFSMT17 e UFSMF6 apresentaram maior similaridade com as espécies Trichoderma koningiopsis, Hypocrea virens, Hypocrea lixii e Fusarium oxysporum, respectivamente.The analysis of morphological and cultural characteristics may not enough for the characterization of the species of Trichoderma and Fusarium. The aim of this work was to characterize the Internal Transcribed Spacer (ITS region of the rDNA of UFSMT15.1, UFSMT16 and UFSMT17 isolates of Trichoderma spp. used in the biocontrol of Fusarium oxysporum f. sp. chrysanthemi UFSMF6. DNA extraction of each isolate was accomplished starting from hyphae produced in liquid medium Potato-Dextrose-Agar. The samples of genomic DNA were submitted to

  6. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  7. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  8. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Detection of early and single infections of Schistosoma japonicum in the intermediate host snail, Oncomelania hupensis, by PCR and loop-mediated isothermal amplification (LAMP) assay.

    Science.gov (United States)

    Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo

    2010-09-01

    Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places.

  10. Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

    Science.gov (United States)

    Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

    1999-03-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

  11. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  12. Molecular variations in Vibrio alginolyticus and V. harveyi in shrimp-farming systems upon stress

    OpenAIRE

    Santhyia,Anix Vivek; Mulloorpeedikayil,Rosalind George; Kollanoor,Riji John; Jeyaseelan,Prince M.J.

    2015-01-01

    A study was performed to investigate the genomic variations in the shrimp farm isolates of Vibrio alginolyticus and V. harveyi when the isolates were subjected to environmental stress. Samples of shrimps, water and sediment were collected from Southern Indian coastal shrimp farms. Vibrio isolates were biochemically identified and confirmed using 16S rDNA and gyrB gene specific PCR. The bacterial strains were genotyped by PCR fingerprinting using GTG(5) and IS (Insertion Sequence) primers. Sev...

  13. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  14. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  15. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  16. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  17. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    Science.gov (United States)

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  18. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  19. Specific detection of Angiostrongylus cantonensis in the snail Achatina fulica using a loop-mediated isothermal amplification (LAMP) assay.

    Science.gov (United States)

    Liu, Chun-Yan; Song, Hui-Qun; Zhang, Ren-Li; Chen, Mu-Xin; Xu, Min-Jun; Ai, Lin; Chen, Xiao-Guang; Zhan, Xi-Mei; Liang, Shao-Hui; Yuan, Zi-Guo; Lin, Rui-Qing; Zhu, Xing-Quan

    2011-08-01

    Angiostrongylus cantonensis, a rat lungworm, can cause eosinophilic meningitis and angiostrongyliasis in humans following ingestion of contaminated foods or intermediate/paratenic hosts with infective larvae. The snail Achatina fulica is one of the important intermediate hosts of A. cantonensis and is commonly eaten by humans in some countries. In the present study, we developed a loop-mediated isothermal amplification (LAMP) method for the specific detection of A. cantonensis in Ac. fulica. Primers for LAMP were designed based on the first internal transcribed spacer (ITS-1) of nuclear ribosomal DNA (rDNA) of A. cantonensis. Specificity tests showed that only the products of A. cantonensis were detected when DNA samples of A. cantonensis and the heterologous control samples Anisakis simplex s.s, Trichuris trichiura, Toxocara canis, Trichinella spiralis and Ascaris lumbricoides were amplified by LAMP. Sensitivity evaluation indicated that the LAMP assay is 10 times more sensitive than the conventional polymerase chain reaction (PCR) assay. The established LAMP assay is rapid, inexpensive and easy to be performed. It can be used in clinical applications for rapid and sensitive detection of A. cantonensis in snails, which has implications for the effective control of angiostrongyliasis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  1. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  2. Detection and identification of phytoplasma DNA in symptomatic mushrooms of the genus Ramaria (O. Gomphales

    Directory of Open Access Journals (Sweden)

    Martín, María P.

    2002-06-01

    Full Text Available Using polymerase chain reaction assays with specific primers for amplifying phytoplasma 16S rDNA, the presence of phytoplasmas in Ramaria basidiomes with abnormal development has been detected for the first time in fungi. Phytoplasmas have not been detected in asymptomatic basidiomes. Sequence analyses based on parsimony and maximum likelihood place the phytoplasma in the Stolbur group.Mediante la reacci6n en cadena de la polimerasa y el uso de iniciadores específicos para la regidn 16S rDNA de fitoplasmas, se ha detectado por primera vez en hongos la presencia de estos organismos en basidiomas de Ramaria que presentaban un desarrollo anormal. El analisis filogen&ico de las secuencias por los criterios de parsimonia y de maxima verosimilitud confirman a este fitoplasma como del grupo "Stolbur".

  3. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  4. Molecular diagnosis of rhino-orbito-cerebral mucormycosis from fresh tissue samples.

    Science.gov (United States)

    Zaman, Kamran; Rudramurthy, Shivaprakash Mandya; Das, Ashim; Panda, Naresh; Honnavar, Prasanna; Kaur, Harsimran; Chakrabarti, Arunaloke

    2017-08-01

    We aimed to evaluate a PCR-based technique for the diagnosis of mucormycosis and the identification of fungi from fresh tissue specimens in patients with rhino-orbito-cerebral-mucormycosis (ROCM). Fifty cases of ROCM were included in the study. Conventional identification was performed using microscopy and culture. Molecular diagnosis was performed by amplifying the ribosomal DNA using pan-fungal ITS primers and semi-nested Mucorales-specific primers of the 18S region. The amplified products were sequenced to identify the agents. The utility of PCR-RFLP of the 18S region of rDNA was evaluated to identify the Mucorales. The ROCM cases were diagnosed by the demonstration of aseptate ribbon-like hyphae in biopsy specimens collected from the patients. Isolation was possible in 24 (48 %) samples. The ITS2 PCR confirmed mucormycosis in 27 cases (54 %; CI 59.4-68.2). By comparison, Mucorales-specific PCR was able to amplify DNA and the sequence enabled the identification of Mucorales speciesin all the patients. PCR-RFLP of the 18S region of rDNA could only identify the agent to genus level. The molecular technique was able to identify Mucorales species in 26 (42 %) cases that were negative by culture. Mucorales-specific semi-nested PCR targeting the 18S region is a better technique than ITS2 PCR for diagnosis. PCR-RFLP of the 18S region helps in identification to genus level.

  5. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  6. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  7. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  8. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  9. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  10. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  11. Residual DNA analysis in biologics development: review of measurement and quantitation technologies and future directions.

    Science.gov (United States)

    Wang, Xing; Morgan, Donna M; Wang, Gan; Mozier, Ned M

    2012-02-01

    Residual DNA (rDNA) is comprised of deoxyribonucleic acid (DNA) fragments and longer length molecules originating from the host organism that may be present in samples from recombinant biological processes. Although similar in basic structural base pair units, rDNA may exist in different sizes and physical forms. Interest in measuring rDNA in recombinant products is based primarily on demonstration of effective purification during manufacturing, but also on some hypothetical concerns that, in rare cases, depending on the host expression system, some DNA sequences may be potentially infectious or oncogenic (e.g., HIV virus and the Ras oncogene, respectively). Recent studies suggest that a sequence known as long interspersed nucleotide element-1 (LINE-1), widely distributed in the mammalian genome, is active as a retrotransposon that can be transcribed to RNA, reverse-transcribed into DNA and inserts into a new site in genome. This integration process could potentially disrupt critical gene functions or induce tumorigenesis in mammals. Genomic DNA from microbial sources, on the other hand, could add to risk of immunogenicity to the target recombinant protein being expressed, due to the high CpG content and unmethylated DNA sequence. For these and other reasons, it is necessary for manufacturers to show clearance of DNA throughout production processes and to confirm low levels in the final drug substance using an appropriately specific and quantitative analytical method. The heterogeneity of potential rDNA sequences that might be makes the testing of all potential analytes challenging. The most common methodology for rDNA quantitation used currently is real-time polymerase chain reaction (RT-PCR), a robust and proven technology. Like most rDNA quantitation methods, the specificity of RT-PCR is limited by the sequences to which the primers are directed. To address this, primase-based whole genome amplification is introduced herein. This paper will review the recent

  12. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  13. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  14. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  15. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  16. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  17. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  18. Genetic diversity of archaea in deep-sea hydrothermal vent environments.

    Science.gov (United States)

    Takai, K; Horikoshi, K

    1999-08-01

    Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the phylogenetic analysis, a number of rDNA sequences obtained from deep-sea hydrothermal vents were placed in deep lineages of the crenarchaeotic phylum prior to the divergence of cultivated thermophilic members of the crenarchaeota or between thermophilic members of the euryarchaeota and members of the methanogen-halophile clade. Whole cell in situ hybridization analysis suggested that some microorganisms of novel phylotypes predicted by molecular phylogenetic analysis were likely present in deep-sea hydrothermal vent environments. These findings expand our view of the genetic diversity of archaea in deep-sea hydrothermal vent environments and of the phylogenetic organization of archaea.

  19. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata

    Directory of Open Access Journals (Sweden)

    Yang Haishui

    2012-04-01

    Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. Results We defined 305 ITS virtual taxa (ITS-VTs among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. Conclusion The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity

  20. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata.

    Science.gov (United States)

    Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin

    2012-04-12

    Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic

  1. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  2. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  3. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  4. Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains

    Directory of Open Access Journals (Sweden)

    Espinola Emilio E

    2006-05-01

    Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.

  5. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  6. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  7. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  8. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  9. Group-specific multiplex PCR detection systems for the identification of flying insect prey.

    Directory of Open Access Journals (Sweden)

    Daniela Sint

    Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

  10. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  11. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    results showed that the detection limit of the assay was 0.2 pg μL −1 of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg μL −1 to 400 pg μL −1 . What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  12. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  13. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  14. Diversity, Dynamics, and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis†

    OpenAIRE

    Randazzo, Cinzia L.; Torriani, Sandra; Akkermans, Antoon D. L.; de Vos, Willem M.; Vaughan, Elaine E.

    2002-01-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  15. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  16. Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy

    Science.gov (United States)

    Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha

    2012-01-01

    Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780

  17. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  18. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  19. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  20. Application of hierarchical oligonucleotide primer extension (HOPE) to assess relative abundances of ammonia- and nitrite-oxidizing bacteria

    KAUST Repository

    Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying

    2017-01-01

    for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study

  1. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  2. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  3. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  4. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

    Science.gov (United States)

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

    2016-09-01

    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  5. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  6. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  7. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  8. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide effective tool for their molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Fiala, Ivan; Hypša, Václav

    2009-01-01

    Roč. 53, č. 1 (2009), s. 81-93 ISSN 1055-7903 R&D Projects: GA AV ČR KJB600960701; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : myxosporea * phylogeny * LBA * LSU rDNA * 28S * SSU rDNA * 18S * D domains Subject RIV: EG - Zoology Impact factor: 3.556, year: 2009

  9. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  10. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  11. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  12. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  13. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  14. Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions

    International Nuclear Information System (INIS)

    Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia

    2013-01-01

    16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.

  15. Eukaryotic Plankton Species Diversity in the Western Channel of the Korea Strait using 18S rDNA Sequences and its Implications for Water Masses

    Science.gov (United States)

    Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup

    2018-03-01

    Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.

  16. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    Science.gov (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  17. Bacterial diversity in a soil sample from Uranium mining waste pile as estimated via a culture-independent 16S rDNA approach

    International Nuclear Information System (INIS)

    Satchanska, G.; Golovinsky, E.; Selenska-Pobell, S.

    2004-01-01

    Bacterial diversity was studied in a soil sample collected from a uranium mining waste pile situated near the town of Johanngeorgenstadt, Germany. As estimated by ICP-MS analysis the studied sample was highly contaminated with Fe, Al, Mn, Zn, As, Pb and U. The 16S rDNA retrieval, applied in this study, demonstrated that more than the half of the clones of the constructed 16S rDNA library were represented by individual RFLP profiles. This indicates that the composition of the bacterial community in the sample was very complex. However, several 16S rDNA RFLP groups were found to be predominant and they were subjected to a sequence analysis. The most predominant group, which represented about 13% of the clones of the 16S rDNA library, was affiliated with the Holophaga/Acidobacterium phylum. Significant was also the number of the proteobacterial sequences which were distributed in one predominant α-proteobacterial cluster representing 11% of the total number of clones and in two equal-sized β- and γ-proteobacterial clusters representing each 6% of the clones. Two smaller groups representing both 2% of the clones were affiliated with Nitrospira and with the novel division WS3. Three of the analysed sequences were evaluated as a novel, not yet described lineage and one as a putative chimera. (authors)

  18. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    . In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg {mu}L{sup -1} of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg {mu}L{sup -1} to 400 pg {mu}L{sup -1}. What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  19. Real-time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan.

    Science.gov (United States)

    Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi

    2009-01-14

    We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .

  20. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  1. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  2. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  3. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  4. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    Science.gov (United States)

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  5. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  6. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  7. Determination Of Uncultured Endo phytic Bacterial Community From Rice Root

    International Nuclear Information System (INIS)

    Ying, P.L.W.; Jong, B.C.

    2013-01-01

    Culture-independent approaches were developed for rapid analysis of microbial community diversity in various environments. Direct analysis based on 16S rDNA as the phylogenetic markers is the most ordinary, conventional and suitable methods for bacterial diversity analysis. The objective of this study is to investigate the microbial diversity from the rice root tissues using culture-independent approach by 16S rDNA library construction. The 16S rDNAs were directly extracted from a total genomic DNA by polymerase chain reaction (PCR) amplification using with the bacteria-specific primer set. The 16S rDNAs were subsequently analysed by cloning and restriction digestion. The amplified ribosomal DNA restriction analysis (ARDRA) clustered the 16S rDNAs into eight majority patterns. These predominant patterns were analysed by DNA sequencing. A better understanding at microbial diversity level is critical to potentiate the endophyte as plant growth promoters. (author)

  8. DNA barcoding amphibians and reptiles.

    Science.gov (United States)

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  9. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    OpenAIRE

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...

  10. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  11. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida from the Atlantic Ocean: comparative analysis using 28S rDNA.

    Directory of Open Access Journals (Sweden)

    Georgina D Cepeda

    Full Text Available Species of Oithona (Copepoda, Cyclopoida are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them.

  12. Determining the specific microbial populations and their spatial distribution within the stromatolite ecosystem of Shark Bay.

    Science.gov (United States)

    Goh, Falicia; Allen, Michelle A; Leuko, Stefan; Kawaguchi, Tomohiro; Decho, Alan W; Burns, Brendan P; Neilan, Brett A

    2009-04-01

    The stromatolites at Shark Bay, Western Australia, are analogues of some of the oldest evidence of life on Earth. The aim of this study was to identify and spatially characterize the specific microbial communities associated with Shark Bay intertidal columnar stromatolites. Conventional culturing methods and construction of 16S rDNA clone libraries from community genomic DNA with both universal and specific PCR primers were employed. The estimated coverage, richness and diversity of stromatolite microbial populations were compared with earlier studies on these ecosystems. The estimated coverage for all clone libraries indicated that population coverage was comprehensive. Phylogenetic analyses of stromatolite and surrounding seawater sequences were performed in ARB with the Greengenes database of full-length non-chimaeric 16S rRNA genes. The communities identified exhibited extensive diversity. The most abundant sequences from the stromatolites were alpha- and gamma-proteobacteria (58%), whereas the cyanobacterial community was characterized by sequences related to the genera Euhalothece, Gloeocapsa, Gloeothece, Chroococcidiopsis, Dermocarpella, Acaryochloris, Geitlerinema and Schizothrix. All clones from the archaeal-specific clone libraries were related to the halophilic archaea; however, no archaeal sequence was identified from the surrounding seawater. Fluorescence in situ hybridization also revealed stromatolite surfaces to be dominated by unicellular cyanobacteria, in contrast to the sub-surface archaea and sulphate-reducing bacteria. This study is the first to compare the microbial composition of morphologically similar stromatolites over time and examine the spatial distribution of specific microorganismic groups in these intertidal structures and the surrounding seawater at Shark Bay. The results provide a platform for identifying the key microbial physiology groups and their potential roles in modern stromatolite morphogenesis and ecology.

  13. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  14. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    Czech Academy of Sciences Publication Activity Database

    Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří

    2015-01-01

    Roč. 81, č. 2 (2015), s. 198-209 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  15. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

    Science.gov (United States)

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

    2004-06-15

    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

  16. Evaluation of Faecalibacterium 16S rDNA genetic markers for accurate identification of swine faecal waste by quantitative PCR.

    Science.gov (United States)

    Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang

    2016-10-01

    A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. A phytoplasma closely related to the pigeon pea witches'-broom phytoplasma (16Sr IX) is associated with citrus huanglongbing symptoms in the state of São Paulo, Brazil.

    Science.gov (United States)

    Teixeira, D C; Wulff, N A; Martins, E C; Kitajima, E W; Bassanezi, R; Ayres, A J; Eveillard, S; Saillard, C; Bové, J M

    2008-09-01

    In February 2007, sweet orange trees with characteristic symptoms of huanglongbing (HLB) were encountered in a region of São Paulo state (SPs) hitherto free of HLB. These trees tested negative for the three liberibacter species associated with HLB. A polymerase chain reaction (PCR) product from symptomatic fruit columella DNA amplifications with universal primers fD1/rP1 was cloned and sequenced. The corresponding agent was found to have highest 16S rDNA sequence identity (99%) with the pigeon pea witches'-broom phytoplasma of group 16Sr IX. Sequences of PCR products obtained with phytoplasma 16S rDNA primer pairs fU5/rU3, fU5/P7 confirm these results. With two primers D7f2/D7r2 designed based on the 16S rDNA sequence of the cloned DNA fragment, positive amplifications were obtained from more than one hundred samples including symptomatic fruits and blotchy mottle leaves. Samples positive for phytoplasmas were negative for liberibacters, except for four samples, which were positive for both the phytoplasma and 'Candidatus Liberibacter asiaticus'. The phytoplasma was detected by electron microscopy in the sieve tubes of midribs from symptomatic leaves. These results show that a phytoplasma of group IX is associated with citrus HLB symptoms in northern, central, and southern SPs. This phytoplasma has very probably been transmitted to citrus from an external source of inoculum, but the putative insect vector is not yet known.

  18. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  19. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  20. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  1. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    Directory of Open Access Journals (Sweden)

    Assawamakin Anunchai

    2007-08-01

    Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

  2. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...

  3. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  4. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  5. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  6. Uso de PCR e sequenciamento do rDNA 16S para identificação de bactérias do gênero Staphylococcus isoladas de mastite bovina

    Directory of Open Access Journals (Sweden)

    Carla C. Lange

    2011-01-01

    Full Text Available O objetivo deste trabalho foi identificar espécies de Staphylococcus (n=100 isoladas de mastite em rebanhos bovinos do Estado de Minas Gerais. Para esta finalidade foram utilizadas reações de PCR empregando oligonucleotídeos iniciadores descritos anteriormente para amplificar genes específicos de S. aureus (femA, S. intermedius (rDNA 16S e S. hyicus (rDNA 16S-23S e o sequenciamento do rDNA 16S. De acordo com as reações de PCR, 83 isolados foram identificados como S. aureus, 13 isolados como S. intermedius, dois como S. hyicus e dois isolados não foram identificados. Foram submetidos ao sequenciamento do rDNA 16S seis isolados identificados como S. aureus e os 17 restantes. Os seis isolados identificados como S. aureus confirmaram essa identificação. Dos outros 17 isolados, 13 foram identificados como S. chromogenes e quatro como S. hyicus, com similaridade igual ou superior a 99%. Baseando-se nos resultados da reação de PCR do gene femA e do sequenciamento do rDNA 16S, foram identificados 83 S. aureus, 13 S. chromogenes e quatro S. hyicus. Neste estudo os oligonucleotídeos iniciadores empregados na reação de PCR para S. intermedius não foram específicos, pois amplificaram também S. chromogenes; e os empregados na reação de PCR para S. hyicus não foram sensíveis, pois falharam na identificação de dois isolados de S. hyicus. A identificação definitiva das duas últimas espécies somente foi possível pelo sequenciamento do rDNA 16S.

  7. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  8. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  9. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  10. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  11. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  12. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  13. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  14. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  15. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  16. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  17. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  18. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    Science.gov (United States)

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.

  19. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  20. Behavior of variable V3 region from 16S rDNA of lactic acid bacteria in denaturing gradient gel electrophoresis.

    Science.gov (United States)

    Ercolini, D; Moschetti, G; Blaiotta, G; Coppola, S

    2001-03-01

    Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (DGGE) was tested as a tool for differentiation of lactic acid bacteria commonly isolated from food. Variable V3 regions of 21 reference strains and 34 wild strains referred to species belonging to the genera Pediococcus, Enterococcus, Lactococcus, Lactobacillus, Leuconostoc, Weissella, and Streptococcus were analyzed. DGGE profiles obtained were species-specific for most of the cultures tested. Moreover, it was possible to group the remaining LAB reference strains according to the migration of their 16S V3 region in the denaturing gel. The results are discussed with reference to their potential in the analysis of LAB communities in food, besides shedding light on taxonomic aspects.

  1. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  2. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  3. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  4. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  5. Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

    Science.gov (United States)

    Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

    2000-07-01

    A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

  6. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

    Science.gov (United States)

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

    2002-12-01

    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  7. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  8. A nested-polymerase chain reaction protocol for detection and population biology studies of Peronospora arborescens, the downy mildew pathogen of opium poppy, using herbarium specimens and asymptomatic, fresh plant tissues.

    Science.gov (United States)

    Montes-Borrego, Miguel; Muñoz Ledesma, Francisco J; Jiménez-Díaz, Rafael M; Landa, Blanca B

    2009-01-01

    A sensitive nested-polymerase chain reaction (PCR) protocol was developed using either of two primer pairs that improves the in planta detection of Peronospora arborescens DNA. The new protocol represented an increase in sensitivity of 100- to 1,000-fold of detection of the oomycete in opium poppy tissue compared with the detection limit of single PCR using the same primer pairs. The new protocol allowed amplification of 5 to 0.5 fg of Peronospora arborescens DNA mixed with Papaver somniferum DNA. The protocol proved useful for amplifying Peronospora arborescens DNA from 96-year-old herbarium specimens of Papaver spp. and to demonstrate that asymptomatic, systemic infections by Peronospora arborescens can occur in wild Papaver spp. as well as in cultivated opium poppy. Also, the increase in sensitivity of the protocol made possible the detection of seedborne Peronospora arborescens in commercial opium poppy seed stocks in Spain with a high frequency, which poses a threat for pathogen spread. Direct sequencing of purified amplicons allowed alignment of a Peronospora arborescens internal transcribed spacer (ITS) ribosomal DNA (rDNA) sequence up to 730-bp long when combining the sequences obtained with the two primer sets. Maximum parsimony analysis of amplified Peronospora arborescens ITS rDNA sequences from specimens of Papaver dubium, P. hybridum, P. rhoeas, and P. somniferum from different countries indicated for the first time that a degree of host specificity may exist within populations of Peronospora arborescens. The reported protocol will be useful for epidemiological and biogeographical studies of downy mildew diseases as well as to unravel misclassification of Peronospora arborescens and Peronospora cristata, the reported causal agents of the opium poppy downy mildew disease.

  9. Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

    Science.gov (United States)

    Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

    2013-02-01

    The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

  10. A global meta-analysis of Tuber ITS rDNA sequences: species diversity, host associations and long-distance dispersal

    Science.gov (United States)

    Gregory M. Bonito; Andrii P. Gryganskyi; James M. Trappe; Rytas. Vilgalys

    2010-01-01

    Truffles (Tuber) are ectomycorrhizal fungi characterized by hypogeous fruitbodies. Their biodiversity, host associations and geographical distributions are not well documented. ITS rDNA sequences of Tuber are commonly recovered from molecular surveys of fungal communities, but most remain insufficiently identified making it...

  11. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  12. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  13. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  14. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  15. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  16. Human Platelet Antigen Alleles in 998 Taiwanese Blood Donors Determined by Sequence-Specific Primer Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Shun-Chung Pai

    2013-01-01

    Full Text Available Polymorphism of human platelet antigens (HPAs leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT, posttransfusion purpura (PTP, and platelet transfusion refractoriness (PTR. HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR.

  17. Identification of hare meat by a species-specific marker of mitochondrial origin.

    Science.gov (United States)

    Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel

    2012-03-01

    Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  20. An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

    Science.gov (United States)

    Mendrek, M. J.

    1992-01-01

    A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

  1. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  2. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  3. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  4. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  5. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    Science.gov (United States)

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  6. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  7. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  8. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  9. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  10. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  11. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  12. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  13. A New Phylogenetic Approach to Investigate the Intestinal Bacterial Composition

    DEFF Research Database (Denmark)

    Hermann-Bank, Marie Louise; Mølbak, Lars

    literature, meaning their use had already been verified. DNA from reference bacteria and DNA from faecal samples were used to check specificity and sensitivity of the assay when analysing bacterial communities. The heat map showed nice dilution colour series consistent with the diluted sample concentrations...... reactions in a few hours. Subsequently the 16S rDNA amplicons can be harvested and used for next generation sequencing. The experimental setup was designed so that the primers represented a phylogenetic overview of the biggest groups of intestinal bacteria. Primers were mainly chosen from published...... ranging from 50 to 0.005 ng/μl and in agreement to the expected results. This implies that the AA48.48 is a useful tool when examining the bacterial composition of faeces and maybe superior to competitive methods, as it gives a quantitative measurement of the bacteria in the sample and afterwards...

  14. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  15. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  16. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  17. Comparison of Two Suspension Arrays for Simultaneous Detection of Five Biothreat Bacterial in Powder Samples

    Directory of Open Access Journals (Sweden)

    Yu Yang

    2012-01-01

    Full Text Available We have developed novel Bio-Plex assays for simultaneous detection of Bacillus anthracis, Yersinia pestis, Brucella spp., Francisella tularensis, and Burkholderia pseudomallei. Universal primers were used to amplify highly conserved region located within the 16S rRNA amplicon, followed by hybridized to pathogen-specific probes for identification of these five organisms. The other assay is based on multiplex PCR to simultaneously amplify five species-specific pathogen identification-targeted regions unique to individual pathogen. Both of the two arrays are validated to be flexible and sensitive for simultaneous detection of bioterrorism bacteria. However, universal primer PCR-based array could not identify Bacillus anthracis, Yersinia pestis, and Brucella spp. at the species level because of the high conservation of 16S rDNA of the same genus. The two suspension arrays can be utilized to detect Bacillus anthracis sterne spore and Yersinia pestis EV76 from mimic “write powder” samples, they also proved that the suspension array system will be valuable tools for diagnosis of bacterial biothreat agents in environmental samples.

  18. Pathogenicity and molecular detection of Uruguayan isolates of Greeneria uvicola and Cadophora luteo-olivacea associated with grapevine trunk diseases

    Directory of Open Access Journals (Sweden)

    Fernando NAVARRETE

    2011-12-01

    Full Text Available Normal 0 21 MicrosoftInternetExplorer4 Species from different fungal genera have been indicated as responsible for the development of trunk diseases of grapevines. Greeneria uvicola is responsible for the bitter rot of Vitis vinifera grape bunchesnear harvest, and can also attack other Vitis species. In Uruguay, G. uvicola was isolated from dead arm affected grapevines and as an endophyte from healthy canes. Cadophora luteo-olivacea is a phialophora-likeascomycete with a wide distribution that was isolated from asymptomatic wood tissues in Vitis and Petridisease-affected nursery plants in Uruguay. Pathogenicity of isolates of both species was evaluated on Vitis vinifera cv. Tannat and Cabernet Sauvignon, and rootstocks SO4 and 3309C. Specific primers were developed for the ITS rDNA region for both species. Number of plants showing discoloration, length of discoloration, number of re-isolations and amplifications confirmed the pathogenicity of G. uvicola isolates. Pathogenicityof the isolate of C. luteo-olivacea obtained from symptomatic tissues is discussed. Specific primers can be usedto detect the presence of these fungi in asymptomatic tissues.

  19. Detection of Yersinia enterocolitica in milk powders by cross-priming amplification combined with immunoblotting analysis.

    Science.gov (United States)

    Zhang, Hongwei; Feng, Shaolong; Zhao, Yulong; Wang, Shuo; Lu, Xiaonan

    2015-12-02

    Yersinia enterocolitica (Y. enterocolitica) is frequently isolated from a wide variety of foods and can cause human yersiniosis. Biochemical and culture-based assays are common detection methods, but require a long incubation time and easily misidentify Y. enterocolitica as other non-pathogenic Yersinia species. Alternatively, cross-priming amplification (CPA) under isothermal conditions combined with immunoblotting analysis enables a more sensitive detection in a relatively short time period. A set of specific displacement primers, cross primers and testing primers was designed on the basis of six specific sequences in Y. enterocolitica 16S-23S rDNA internal transcribed spacer. Under isothermal condition, amplification and hybridization were conducted simultaneously at 63°C for 60 min. The specificity of CPA was tested for 96 different bacterial strains and 165 commercial milk powder samples. Two red lines were developed on BioHelix Express strip for all of the Y. enterocolitica strains, and one red line was shown for non-Y. enterocolitica strains. The limit of detection of CPA was 10(0)fg for genomic DNA (1000 times more sensitive than PCR assay), 10(1) CFU/ml for pure bacterial culture, and 10(0) CFU per 100 g milk powder with pre-enrichment at 37°C for 24 h. CPA combined with immunoblotting analysis can achieve highly specific and sensitive detection of Y. enterocolitica in milk powder in 90 min after pre-enrichment. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Stimulation of indigenous lactobacilli by fermented milk prepared with probiotic bacterium, Lactobacillus delbrueckii subsp. bulgaricus strain 2038, in the pigs.

    Science.gov (United States)

    Ohashi, Yuji; Tokunaga, Makoto; Taketomo, Naoki; Ushida, Kazunari

    2007-02-01

    The aim of this study was to evaluate the effect of feeding yoghurt, prepared with Lactobacillus delbrueckii subsp. bulgaricus strain 2038, on indigenous lactobacilli in the pig cecum. Three female pigs fistulated at the cecum were fed 250 g of this yoghurt that contained over 10(11) colony-forming units of L. delbrueckii subsp. bulgaricus strain 2038 with their daily meal for 2 wk. The relative abundance and the composition of cecal lactobacilli was monitored by analysis of bacterial 16S rDNA with real time PCR and amplified bacterial rDNA restriction analysis using Lactobacillus-group specific primers, respectively, for 2 wk prior to, at the end of 2 wk of and 2 wk after the administration of this yoghurt. The relative abundance of lactobacilli was significantly increased by feeding yoghurt (pdelbrueckii subsp. bulgaricus strain 2038 was not detected by amplified bacterial rDNA restriction analysis during this study. The number of operational taxonomic units (OTUs) detected was increased with feeding of the yoghurt in all pigs. At the same time, the estimated cell number of each OTU was increased with feeding of the yoghurt. It is demonstrated that continuous consumption of the probiotic lactobacilli will stimulate the growth of some indigenous lactobacilli and alter the composition of the lactobacilli.

  1. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  2. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  3. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  4. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  5. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  6. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    Energy Technology Data Exchange (ETDEWEB)

    Geuskens, M.; Alexandre, H. (Universite Libre de Bruxelles (Belgium). Dep. de Biologie Moleculaire)

    1984-06-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with (/sup 3/H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min (/sup 3/H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with (/sup 3/H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed.

  7. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Geuskens, M.; Alexandre, H.

    1984-01-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with ( 3 H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min ( 3 H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with ( 3 H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed. (author)

  8. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  9. Analyzing Arthropods for the Presence of Bacteria

    OpenAIRE

    Andrews, Elizabeth S.

    2013-01-01

    Bacteria within arthropods can be identified using culture-independent methods. This unit describes protocols for surface sterilization of arthropods, DNA extraction of whole bodies and tissues, touchdown PCR amplification using 16S rDNA general bacteria primers and profiling the bacterial community using denaturing gradient gel electrophoresis.

  10. Diversity, dynamics, and activity of bacterial communities during production of an artisanal Sicilian cheese as evaluated by 16S rRNA analysis.

    Science.gov (United States)

    Randazzo, Cinzia L; Torriani, Sandra; Akkermans, Antoon D L; de Vos, Willem M; Vaughan, Elaine E

    2002-04-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene, respectively. DGGE profiles from samples taken during cheese production indicated dramatic shifts in the microbial community structure. Cloning and sequencing of rDNA amplicons revealed that mesophilic lactic acid bacteria (LAB), including species of Leuconostoc, Lactococcus lactis, and Macrococcus caseolyticus were dominant in the raw milk, while Streptococcus thermophilus prevailed during lactic fermentation. Other thermophilic LAB, especially Lactobacillus delbrueckii and Lactobacillus fermentum, also flourished during ripening. Comparison of the rRNA-derived patterns obtained by RT-PCR to the rDNA DGGE patterns indicated a substantially different degree of metabolic activity for the microbial groups detected. Identification of cultivated LAB isolates by phenotypic characterization and 16S rDNA analysis indicated a variety of species, reflecting to a large extent the results obtained from the 16S rDNA clone libraries, with the significant exception of the Lactobacillus delbrueckii species, which dominated in the ripening cheese but was not detected by cultivation. The present molecular approaches combined with culture can effectively describe the complex ecosystem of natural fermented dairy products, giving useful information for starter culture design and preservation of artisanal fermented food technology.

  11. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    Science.gov (United States)

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  12. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  13. Significant performance variation among PCR systems in diagnosing congenital toxoplasmosis in São Paulo, Brazil: analysis of 467 amniotic fluid samples

    Directory of Open Access Journals (Sweden)

    Thelma Suely Okay

    2009-03-01

    Full Text Available INTRODUCTION: Performance variation among PCR systems in detecting Toxoplasma gondii has been extensively reported and associated with target genes, primer composition, amplification parameters, treatment during pregnancy, host genetic susceptibility and genotypes of different parasites according to geographical characteristics. PATIENTS: A total of 467 amniotic fluid samples from T. gondii IgM- and IgG-positive Brazilian pregnant women being treated for 1 to 6 weeks at the time of amniocentesis (gestational ages of 14 to 25 weeks. METHODS: One nested-B1-PCR and three one-round amplification systems targeted to rDNA, AF146527 and the B1 gene were employed. RESULTS: Of the 467 samples, 189 (40.47% were positive for one-round amplifications: 120 (63.49% for the B1 gene, 24 (12.69% for AF146527, 45 (23.80% for both AF146527 and the B1 gene, and none for rDNA. Fifty previously negative one-round PCR samples were chosen by computer-assisted randomization analysis and re-tested (nested-B1-PCR, during which nine additional cases were detected (9/50 or 18%. DISCUSSION: The B1 gene PCR was far more sensitive than the AF146527 PCR, and the rDNA PCR was the least effective even though the rDNA had the most repetitive sequence. Considering that the four amplification systems were equally affected by treatment, that the amplification conditions were optimized for the target genes and that most of the primers have already been reported, it is plausible that the striking differences found among PCR performances could be associated with genetic diversity in patients and/or with different Toxoplasma gondii genotypes occurring in Brazil. CONCLUSION: The use of PCR for the diagnosis of fetal Toxoplasma infections in Brazil should be targeted to the B1 gene when only one gene can be amplified, preferably by nested amplification with primers B22/B23.

  14. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  15. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  16. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  17. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  18. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  19. Development of a Species-specific PCR Assay for Three Xanthomonas Species, Causing Bulb and Flower Diseases, Based on Their Genome Sequences

    Directory of Open Access Journals (Sweden)

    Chang-Gi Back

    2015-09-01

    Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.

  20. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  1. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  2. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  3. Phylogeny of not-yet-cultured spirochetes from termite guts

    DEFF Research Database (Denmark)

    Paster, B.J.; Dewhirst, F.E.; Cooke, S.M.

    1996-01-01

    Comparisons of 16S rDNA sequences were used to determine the phylogeny of not-yet-cultured spirochetes from hindguts of the African higher termite, Nasutitermes lujae (Wasmann). The 16S rRNA genes were amplified directly from spirochete-rich hindguts by using universal primers, and the amplified...

  4. Mechanical soil disturbance as a determinant of arbuscular mycorrhizal fungal communities in semi-natural grassland

    DEFF Research Database (Denmark)

    Schnoor, Tim Krone; Lekberg, Ylva; Rosendahl, Søren

    2011-01-01

    an ongoing grassland restoration experiment that contained replicated plowed and control plots. The AM fungal community in roots was determined using nested PCR and LSU rDNA primers. We identified 38 phylotypes within the Glomeromycota, of which 29 belonged to Glomus A, six to Glomus B, and three...

  5. Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria

    NARCIS (Netherlands)

    Salzman, NH; de Jong, H; Paterson, Y; Harmsen, HJM; Welling, GW; Bos, NA

    2002-01-01

    Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of

  6. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  7. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  8. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  9. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  10. Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Irma Suriyani

    2015-05-01

    Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

  11. Use of species-specific PCR for the identification of 10 sea cucumber species

    Science.gov (United States)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  13. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  14. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  15. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

    Directory of Open Access Journals (Sweden)

    María Poggio

    2011-05-01

    Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

  16. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    Science.gov (United States)

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  17. The detection of Mycoplasma (formerly Eperythrozoon) wenyonii by 16S rDNA PCR and denaturing gradient gel electrophoresis.

    Science.gov (United States)

    McAuliffe, Laura; Lawes, Joanna; Bell, Suzanna; Barlow, Alex; Ayling, Roger; Nicholas, Robin

    2006-10-31

    Although the role of Mycoplasma wenyonii in disease is still subject to some debate, infections have been reported to result in parasitaemia, anaemia, scrotal and hind limb oedema, tachycardia, pyrexia, infertility, swollen teats, prefemoral lymphadenopathy and decreased milk production. Previously, diagnosis of M. wenyonii has been based on blood smears but is not specific for M. wenyonii and can be difficult to interpret. We have previously described the use of PCR and denaturing gradient gel electrophoresis (DGGE) for the detection and differentiation of Mycoplasma species. DGGE enables the rapid and specific identification of Mycoplasma species and is ideally suited to detecting both mixed infections and new and unusual species. In this study, we have used DGGE with universal primers to detect M. wenyonii DNA from blood samples. DGGE can be used on blood samples as a rapid and specific test for M. wenyonii and can also be used as a screening test for other blood borne pathogens.

  18. Karyotypes and fish detection of 5s and 45s rdna loci in chinese medicinal plant atractylodes lancea subsp. luotianensis: cytological evidence for the new taxonomic unit

    International Nuclear Information System (INIS)

    Duan, Y.S.; Zhu, B.; Li, Z.Y.

    2015-01-01

    Atractylodes lancea (Thunb.) DC. in the Asteraceae family produces the atractylodes rhizome which is widely used as a traditional medicine in China. The subspecies A. lancea (Thunb.) DC subsp. Luotianensis distributed in mountainous Luotian and Yingshan regions in Hubei Province presented distinct morphology and superior medicinal quality. This study firstly reported the chromosome karyotype of this subspecies and the detection of 5S and 45S rDNA loci by fluorescent in situ hybridization. The karyotype was 2n=24=12m+12sm (2SAT). A single locus of 5S rDNA and two loci of 45S rDNA loci were identified and separated on different chromosomes. Its one pair of the satellited chromosomes rather than two pairs in other Atractylodes species yet still with 2n=24 occurred likely after its occupation of this geographic location. The evidence of karyotype differentiation of this subspecies native to the area is useful for elucidating the genome structure and identifying chromosomes. (author)

  19. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Directory of Open Access Journals (Sweden)

    Haishan Wang

    Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  20. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  1. Development and evaluation of a novel fast broad-range 16S ribosomal DNA PCR and sequencing assay for diagnosis of bacterial infective endocarditis: multi-year experience in a large Canadian healthcare zone and a literature review.

    Science.gov (United States)

    Miller, Robert J H; Chow, Barbara; Pillai, Dylan; Church, Deirdre

    2016-04-12

    The study aimed to explore the sensitivity and specificity of a novel fast 16S rDNA PCR and sequencing assay for the improved diagnosis of infective endocarditis (IE) in patients with suspected native or prosthetic heart valve (HV) infection over a multi-year period at our cardiovascular center. Sixty-eight patients were prospectively enrolled who underwent HV replacement for suspected or confirmed IE between February 1, 2009 and September 1, 2014. Patient demographics, medical co-morbidities, Duke's criteria, culture results, and antibiotic therapy were collected by detailed chart reviews. Dual-priming oligonucleotide primers targeted to 500 bps of the V1-V3 region of the 16S rRNA gene were used to perform fast broad-range 16S rDNA PCR and Sanger sequencing on ribosomal DNA extracted from HV tissues. The performance/diagnostic efficiency of the molecular test was evaluated against blood cultures and Gram stain and culture of HV tissue in patients' with definite IE according to Duke's criteria. Fifty patients (73.5%) had definite IE and another 8 (11.8%) had possible IE according to Duke's criteria. Cardiac surgery was delayed an average of 15.4 days from the time of the patient's last positive blood culture, and appropriate antibiotic therapy was given in the pre-operative period. While 44/50 (88%) patients had a positive blood culture, HV tissue culture was only positive in 23 (46%) of them. Molecular testing of all HV tissues had sensitivity, specificity, NPV and PPV of 92, 77.8, 77.8 and 92% compared to 44, 100, 39.1 and 100% respectively for culture for diagnosis of definite IE. For prosthetic HV tissue, 16S rDNA PCR had sensitivity of 93% and specificity of 83% compared to 35 and 100% respectively for culture. A literature review showed that the diagnostic accuracy of our novel fast broad-range 16S rDNA PCR assay was similar or better than that of previously published studies. This novel fast broad-range 16S rDNA PCR/sequencing test had superior sensitivity

  2. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  3. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  4. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  5. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  6. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  7. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  8. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  9. [Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].

    Science.gov (United States)

    Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

    2004-01-01

    18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

  10. SMM-system: A mining tool to identify specific markers in Salmonella enterica.

    Science.gov (United States)

    Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

    2011-03-01

    This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  12. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  13. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  14. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  15. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  16. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

    Directory of Open Access Journals (Sweden)

    R. K. Chahota

    2011-11-01

    Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

  17. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  18. Application of a novel Paenibacillus-specific PCR-DGGE method and sequence analysis to assess the diversity of Paenibacillus spp. in the maize rhizosphere

    NARCIS (Netherlands)

    Silva, da K.R.A.; Salles, J.F.; Seldin, L.; Elsas, van J.D.

    2003-01-01

    In this study, a Paenibacillus-specific PCR system, based on the specific primer PAEN515F in combination with bacterial primer R1401, was tested and used to amplify specific fragments of the 16S rRNA gene from rhizosphere DNA. The amplicons were used in a second (semi-nested) PCR for DGGE, in which

  19. Application of a novel Paenibacillus-specific PCR-DGGE method and sequence analysis to assess the diversity of Paenibacillus spp. in the maize rhizosphere.

    NARCIS (Netherlands)

    da Silva, Katia Regina Araujo; Falcao Salles, Joana; Seldin, Lucy; van Elsas, Jan

    In this study, a Paenibacillus-specific PCR system, based on the specific primer PAEN515F in combination with bacterial primer R1401, was tested and used to amplify specific fragments of the 16S rRNA gene from rhizosphere DNA. The amplicons were used in a second (semi-nested) PCR for DGGE, in which

  20. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  1. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  2. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  3. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

  4. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  6. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  7. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  8. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    International Nuclear Information System (INIS)

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

    2007-01-01

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

  9. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  10. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  12. Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

    Science.gov (United States)

    Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

    2011-05-01

    Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

  13. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  14. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  17. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  18. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  19. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  20. Development of Candida-Specific Real-Time PCR Assays for the Detection and Identification of Eight Medically Important Candida Species.

    Science.gov (United States)

    Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching

    2016-01-01

    Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.