Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales
2010-08-16
In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy
Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana
2012-10-07
The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two
Directory of Open Access Journals (Sweden)
Merlo Manuel A
2012-10-01
Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not
Mahelka, Václav; Kopecky, David; Baum, Bernard R
2013-09-01
We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.
DEFF Research Database (Denmark)
Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik
2006-01-01
Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...
Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre
2016-01-01
Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
2011-01-01
Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815
Campo, Daniel; García-Vázquez, Eva
2012-01-01
The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
Directory of Open Access Journals (Sweden)
Garcia Sònia
2012-06-01
Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.
Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells
Directory of Open Access Journals (Sweden)
Youjin Hu
2013-01-01
Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.
Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia
2016-12-01
Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.
Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex
Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa
2016-01-01
Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051
The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).
Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M
2011-08-01
The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.
Directory of Open Access Journals (Sweden)
Kaitlynn LeRiche
Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.
Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.
2008-01-01
Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159
Regulation of rDNA stability by sumoylation
DEFF Research Database (Denmark)
Eckert-Boulet, Nadine; Lisby, Michael
2009-01-01
Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...
Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca
2018-01-01
Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829
Directory of Open Access Journals (Sweden)
Sofia Mazzoleni
2018-01-01
Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.
Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš
2017-05-18
Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
Directory of Open Access Journals (Sweden)
Hong Long
Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be
Directory of Open Access Journals (Sweden)
Soltis Pamela S
2010-09-01
Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of
[18S-25S rDNA variation in tissue culture of some Gentiana L. species].
Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A
2007-01-01
18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.
Directory of Open Access Journals (Sweden)
Gamal Mohamedin Hassan
2016-01-01
Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.
Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.
Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua
2004-01-01
In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.
Directory of Open Access Journals (Sweden)
Shafipour1, M.
2014-11-01
Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.
Directory of Open Access Journals (Sweden)
Elizabeth X. Kwan
2016-09-01
Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.
Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K
2016-09-08
The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.
Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families
Directory of Open Access Journals (Sweden)
Floreta Fiska Yuliarni
2014-06-01
Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.
Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.
Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří
2016-11-01
Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting
Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti
2016-08-01
The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.
da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana
2016-01-01
Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?
Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo
2017-04-15
Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.
Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.
Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A
2017-11-14
The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread
Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata
2015-08-01
Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.
Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.
2017-01-01
Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016
Noemi M. Fernandes; Inácio D. da Silva Neto
2013-01-01
Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequen...
A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).
Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao
2017-01-01
In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.
Clinorotation influences rDNA and NopA100 localization in nucleoli
Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.
The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.
CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA
Directory of Open Access Journals (Sweden)
L. Pouyaud
2016-10-01
Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from mitochondrial gene, a new episode of speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between Schilbeidae and Pangasiidae occurred in the Early Miocene.
Directory of Open Access Journals (Sweden)
Riccardo Castiglia
2011-06-01
Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.
International Nuclear Information System (INIS)
Highett, M.I.; Rawlins, D.J.; Shaw, P.J.
1993-01-01
We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš
2010-01-01
Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010
Directory of Open Access Journals (Sweden)
María Poggio
2011-05-01
Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.
Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast
International Nuclear Information System (INIS)
Lin, Y.H.; Keil, R.L.
1991-01-01
HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination
Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R
2018-01-01
The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.
Directory of Open Access Journals (Sweden)
Jinzhong FU
2009-04-01
Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.
Cruz, V P; Oliveira, C; Foresti, F
2015-01-01
5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.
Directory of Open Access Journals (Sweden)
Anne Kathrin Hett
Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.
Seligmann, Hervé
2016-07-01
Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.
Moran, Yehu; Weinberger, Hagar; Sullivan, James C; Reitzel, Adam M; Finnerty, John R; Gurevitz, Michael
2008-04-01
Gene families, which encode toxins, are found in many poisonous animals, yet there is limited understanding of their evolution at the nucleotide level. The release of the genome draft sequence for the sea anemone Nematostella vectensis enabled a comprehensive study of a gene family whose neurotoxin products affect voltage-gated sodium channels. All gene family members are clustered in a highly repetitive approximately 30-kb genomic region and encode a single toxin, Nv1. These genes exhibit extreme conservation at the nucleotide level which cannot be explained by purifying selection. This conservation greatly differs from the toxin gene families of other animals (e.g., snakes, scorpions, and cone snails), whose evolution was driven by diversifying selection, thereby generating a high degree of genetic diversity. The low nucleotide diversity at the Nv1 genes is reminiscent of that reported for DNA encoding ribosomal RNA (rDNA) and 2 hsp70 genes from Drosophila, which have evolved via concerted evolution. This evolutionary pattern was experimentally demonstrated in yeast rDNA and was shown to involve unequal crossing-over. Through sequence analysis of toxin genes from multiple N. vectensis populations and 2 other anemone species, Anemonia viridis and Actinia equina, we observed that the toxin genes for each sea anemone species are more similar to one another than to those of other species, suggesting they evolved by manner of concerted evolution. Furthermore, in 2 of the species (A. viridis and A. equina) we found genes that evolved under diversifying selection, suggesting that concerted evolution and accelerated evolution may occur simultaneously.
Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R
2000-06-01
We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N
Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni
2012-03-20
For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Tamura, Naoki; Ochi, Morio; Miyakawa, Hiroshi; Nakazawa, Futoshi
2013-01-01
To analyze and characterize the predominant bacterial flora associated with peri-implantitis by using culture techniques under obligate anaerobic conditions and 16S rDNA gene sequences. Subgingival bacterial specimens were taken from 30 patients: control (n = 15), consisting of patients with only healthy implants; and test (n = 15), consisting of patients with peri-implantitis. In both groups, subgingival bacterial specimens were taken from the deepest sites. An anaerobic glove box system was used to cultivate bacterial strains. The bacterial strains were identified by 16S rDNA genebased polymerase chain reaction and comparison of the gene sequences. Peri-implantitis sites had approximately 10-fold higher mean colony forming units (per milliliter) than healthy implant sites. A total of 69 different bacterial species were identified in the peri-implantitis sites and 53 in the healthy implant sites. The predominant bacterial species in the peri-implantitis sites were Eubacterium nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, Parascardovia denticolens, Prevotella intermedia, Fusobacterium nucleatum, Porphyromonas gingivalis, Centipeda periodontii, and Parvimonas micra. The predominant bacteria in healthy implant sites apart from Streptococcus were Pseudoramibacter alactolyticus, Veillonella species, Actinomyces israelii, Actinomyces species, Propionibacterium acnes, and Parvimonas micra. These results suggest that the environment in the depths of the sulcus showing peri-implantitis is well suited for growth of obligate anaerobic bacteria. The present study demonstrated that the sulcus around oral implants with peri-implantitis harbors high levels of asaccharolytic anaerobic gram-positive rods (AAGPRs) such as E. nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, and gram-negative anaerobic rods, suggesting that conventional periodontopathic bacteria are not the only periodontal pathogens active in peri-implantitis, and that AAGPRs
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Piscor, Diovani; Parise-Maltempi, Patricia Pasquali
2016-03-01
The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.
Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia
2017-10-01
Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Directory of Open Access Journals (Sweden)
Xiao P Peng
2018-01-01
Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.
Replication and meiotic transmission of yeast ribosomal RNA genes.
Brewer, B J; Zakian, V A; Fangman, W L
1980-11-01
The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.
Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F
2014-01-01
Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane
2018-04-15
Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.
Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M
1996-07-01
Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Directory of Open Access Journals (Sweden)
Mingsheng Yang
2015-03-01
Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.
Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki
2014-07-01
In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Li, Chun-Xiang; Yang, Qun
2003-03-01
DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.
Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan
2014-01-01
Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.
Directory of Open Access Journals (Sweden)
Vanessa Bueno
2014-01-01
Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.
Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.
Roa, Fernando; Guerra, Marcelo
2015-01-01
5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.
Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés
2011-10-17
The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.
Directory of Open Access Journals (Sweden)
Anne Kathrin Hett
2011-03-01
Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.Se presenta la primera descripción del cariotipo de Mugil incilis de Venezuela. El complemento cromosómico está compuesto por 48 cromosomas acrocéntricos uniformemente decrecientes en tamaño. Por lo tanto, los homólogos no pueden ser claramente identificados, con excepción de uno de los pares de mayor tamaño, clasificado como número 1, cuyos homólogos poseen una constricción secundaria subcentromérica, y el par de cromosomas número 24, considerablemente más pequeño que los otros. El bandeo-C reveló bloques heterocromáticos en las regiones centroméricas/pericentroméricas de todos los cromosomas, más conspicuas en el cromosoma 1 en el que las señales C
Directory of Open Access Journals (Sweden)
Anderson Alves
2012-09-01
Full Text Available The family Loricariidae with about 690 species divided into six subfamilies, is one of the world’s largest fish families. Cytogenetic studies conducted in the family showed that among 90 species analyzed the diploid number ranges from 2n=38 in Ancistrus sp. to 2n=96 in Hemipsilichthys gobio Luetken, 1874. In the present study, fluorescence in situ hybridization (FISH was employed to determine the chromosomal localization of the 18S rDNA gene in four suckermouth armoured catfishes: Kronichthys lacerta (Nichols, 1919, Pareiorhaphis splendens (Bizerril, 1995, Liposarcus multiradiatus (Hancock, 1828 and Hypostomus prope plecostomus (Linnaeus, 1758. All species analyzed showed one chromosome pair with 18S rDNA sequences, as observed in the previous Ag-NORs analyses. The presence of size and numerical polymorphism was observed and discussed, with proposing a hypothesis of the Ag-NOR evolution in Loricariidae.
Directory of Open Access Journals (Sweden)
Noemi M. Fernandes
2013-02-01
Full Text Available Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequences of Spirostomum teres Claparède & Lachmann, 1858 and Spirostomum minus Roux, 1901, isolated from a sewage treatment plant and a freshwater lake in the city of Rio de Janeiro, Brazil, respectively. For the morphological descriptions of S. teres and S. minus, living cells were observed using bright-field and differential interference contrast (DIC microscopy, the total infraciliature and nuclear apparatus were revealed by staining with protargol, and ciliary patterns were observed also with scanning electron microscopy (SEM. The complete sequences of the 18S rDNA of S. teres and S. minus were obtained using eukaryotic universal primers, and then compared with sequences of other species and populations of Spirostomum deposited in the GenBank database. Living S. minus measured 400-800 µm in length and 55-115 µm in width, with the following characteristics: adoral zone of membranelles approximately 112 µm long; inconspicuous paroral kinety; 30-40 kineties in somatic ciliature; moniliform macronucleus with 9-25 nodes, approximately 12 micronuclei; single and posterior contractile vacuole; and yellow-brown cytoplasm. Living and fully extended S. teres measured approximately 250 µm in length and 65 ìm in width, with the following characteristics: adoral zone of membranelles approximately 92 µm long; approximately 30 somatic kineties; compact macronucleus, approximately five micronuclei; macronuclear groove present; single and posterior contractile vacuole
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
Galián, José A; Rosato, Marcela; Rosselló, Josep A
2014-03-01
Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Directory of Open Access Journals (Sweden)
Daniël O. Warmerdam
2016-03-01
Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.
Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H
2016-03-22
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability
International Nuclear Information System (INIS)
Tao Weitao; Budd, Martin; Campbell, Judith L.
2003-01-01
We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones
Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability
Energy Technology Data Exchange (ETDEWEB)
Tao Weitao; Budd, Martin; Campbell, Judith L
2003-11-27
We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
Directory of Open Access Journals (Sweden)
Luiz Carlos Correa
2003-04-01
Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Directory of Open Access Journals (Sweden)
R. K. Chahota
2011-11-01
Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Directory of Open Access Journals (Sweden)
Carla C. Lange
2011-01-01
Full Text Available O objetivo deste trabalho foi identificar espécies de Staphylococcus (n=100 isoladas de mastite em rebanhos bovinos do Estado de Minas Gerais. Para esta finalidade foram utilizadas reações de PCR empregando oligonucleotídeos iniciadores descritos anteriormente para amplificar genes específicos de S. aureus (femA, S. intermedius (rDNA 16S e S. hyicus (rDNA 16S-23S e o sequenciamento do rDNA 16S. De acordo com as reações de PCR, 83 isolados foram identificados como S. aureus, 13 isolados como S. intermedius, dois como S. hyicus e dois isolados não foram identificados. Foram submetidos ao sequenciamento do rDNA 16S seis isolados identificados como S. aureus e os 17 restantes. Os seis isolados identificados como S. aureus confirmaram essa identificação. Dos outros 17 isolados, 13 foram identificados como S. chromogenes e quatro como S. hyicus, com similaridade igual ou superior a 99%. Baseando-se nos resultados da reação de PCR do gene femA e do sequenciamento do rDNA 16S, foram identificados 83 S. aureus, 13 S. chromogenes e quatro S. hyicus. Neste estudo os oligonucleotídeos iniciadores empregados na reação de PCR para S. intermedius não foram específicos, pois amplificaram também S. chromogenes; e os empregados na reação de PCR para S. hyicus não foram sensíveis, pois falharam na identificação de dois isolados de S. hyicus. A identificação definitiva das duas últimas espécies somente foi possível pelo sequenciamento do rDNA 16S.
Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.
Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly
2016-11-01
Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.
2016-01-01
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.
Bisht, M S; Mukai, Y
2000-12-01
Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.
rKnowledge: The Spatial Diffusion of rDNA Methods
Maryann Feldman; Dieter Kogler; David Rigby
2013-01-01
The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Czech Academy of Sciences Publication Activity Database
Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.
2008-01-01
Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Czech Academy of Sciences Publication Activity Database
Vitales, D.; D'Ambrosio, U.; Galvez, F.; Kovařík, Aleš; Garcia, S.
2017-01-01
Roč. 303, č. 8 (2017), s. 1115-1121 ISSN 0378-2697 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * ribosomal-rna genes * 5s rdna Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.239, year: 2016
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
Directory of Open Access Journals (Sweden)
Thomas Spaller
Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Haishan Wang
Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.
Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti
2018-03-10
One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
Altered gravity influences rDNA and NopA100 localization in nucleoli
Sobol, M. A.; Kordyum, E. L.
Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
Morphology and rDNA phylogeny of a Mediterranean Coolia monotis (Dinophyceae strain from Greece
Directory of Open Access Journals (Sweden)
Nicolas P. Dolapsakis
2006-03-01
Full Text Available Sequences of LSU and SSU ribosomal RNA genes and phylogeny have not been widely investigated for the dinoflagellate Coolia monotis Meunier, and no information is available on the small and large rDNA subunits of Mediterranean strains. A strain isolated from the Thermaikos Gulf in northern Greece was identified as C. monotis—a new record for the Greek algal flora—using thecal morphology by light, epifluorescence and scanning electron microscopy. The small subunit and partial (D1/D2 large subunit sequences were analyzed and compared to other strains of C. monotis and dinoflagellates from various regions. Thecal architecture showed that the Greek strain of C. monotis was phenotypically similar, but not identical, to other strains reported in literature. The partial LSU sequence (700 bp was found to vary by 113 bp positions (16% from the C. monotis strain from New Zealand, whereas the SSU (1757 bp had 15 bp differences (0.85% from the strain from Norway. Phylogenetic tree construction showed that the Greek strain fell within the Coolia clade and had a close relationship with the families Ostreopsidaceae and Goniodomaceae of the order Gonyaulacales. Preliminary findings suggest the existence of different genotype strains of C. monotis with large intraspecific genetic variability and minimal morphological differentiation (similar phenotypes. Certain ecological and evolutionary implications of these findings are discussed.
Kim, C G; Zhou, H Z; Imura, Y; Tominaga, O; Su, Z H; Osawa, S
2000-01-01
Most of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and a part of nuclear 28S ribosomal RNA gene were sequenced for 14 species of ground beetles belonging to the genus Leptocarabus. In both the ND5 and the 28S rDNA phylogenetic trees of Leptocarabus, three major lineages were recognized: (1) L. marcilhaci/L. yokoael/Leptocarabus sp. from China, (2) L. koreanus/L. truncaticollis/L. seishinensis/L. semiopacus/L. canaliculatus/L. kurilensis from the northern Eurasian continent including Korea and Hokkaido, Japan, and (3) all of the Japanese species except L. kurilensis. Clustering of the species in the trees is largely linked to their geographic distribution and does not correlate with morphological characters. The species belonging to different species groups are clustered in the same lineages, and those in the same species group are scattered among the different lineages. One of the possible interpretations of the present results would be that morphological transformations independently took place in the different lineages, sometimes with accompanying parallel morphological evolution, resulting in the occurrence of the morphological species belonging to the same species group (= type) in the different lineages.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
International Nuclear Information System (INIS)
Duan, Y.S.; Zhu, B.; Li, Z.Y.
2015-01-01
Atractylodes lancea (Thunb.) DC. in the Asteraceae family produces the atractylodes rhizome which is widely used as a traditional medicine in China. The subspecies A. lancea (Thunb.) DC subsp. Luotianensis distributed in mountainous Luotian and Yingshan regions in Hubei Province presented distinct morphology and superior medicinal quality. This study firstly reported the chromosome karyotype of this subspecies and the detection of 5S and 45S rDNA loci by fluorescent in situ hybridization. The karyotype was 2n=24=12m+12sm (2SAT). A single locus of 5S rDNA and two loci of 45S rDNA loci were identified and separated on different chromosomes. Its one pair of the satellited chromosomes rather than two pairs in other Atractylodes species yet still with 2n=24 occurred likely after its occupation of this geographic location. The evidence of karyotype differentiation of this subspecies native to the area is useful for elucidating the genome structure and identifying chromosomes. (author)
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions
International Nuclear Information System (INIS)
Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia
2013-01-01
16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun
2015-03-13
The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.
Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact
Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.
2014-01-01
The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300
Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.
Guo, Xiang; Han, Fangpu
2014-11-01
rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.
Directory of Open Access Journals (Sweden)
Vidal-Russell Romina
2004-10-01
Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Arabidopsis ATRX Modulates H3.3 Occupancy and Fine-Tunes Gene Expression
Duc, Cé line; Benoit, Matthias; Dé tourné , Gwé naë lle; Simon, Lauriane; Poulet, Axel; Jung, Matthieu; Veluchamy, Alaguraj; Latrasse, David; Le Goff, Samuel; Cotterell, Sylviane; Tatout, Christophe; Benhamed, Moussa; Probst, Aline V.
2017-01-01
, including the 45S ribosomal DNA (45S rDNA) loci, where loss of ATRX results in altered expression of specific 45S rDNA sequence variants. At the genome-wide scale, our data indicate that ATRX modifies gene expression concomitantly to H3.3 deposition at a set
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats
Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.
2016-01-01
rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.
Cooper, D N; Errington, L H; Clayton, R M
1983-01-01
Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).
Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar
2016-12-01
In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.
Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V
2017-01-01
Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Fu, Rao; Gong, Jun
2017-11-01
Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R
2013-07-01
Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Raupach Michael J
2010-09-01
Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang
2010-09-13
The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA
International Nuclear Information System (INIS)
Yakura, Kimitaka; Tanifuji, Shigeyuki.
1983-01-01
EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
Trichostrongylus colubriformis rDNA polymorphism associated with arrested development
Czech Academy of Sciences Publication Activity Database
Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej
2008-01-01
Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008
Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V
2018-04-06
Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom
2017-07-01
Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin
Directory of Open Access Journals (Sweden)
Chelsea Herdman
2017-07-01
Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state
Dingman, Douglas W
2012-07-01
Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.
Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna
2018-02-01
Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi
2015-09-21
Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China.
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai
2014-05-01
, Sphingomonas might not be detected by routine bacteria culture. Among seven species which were identified by both methods, pyrophosphate sequencing yielded higher positive rate than that of ordinary bacteria culture [Streptococcus: 88.9% (24/27) vs. 18.5% (5/27), Klebsiella: 55.6% (15/27) vs. 18.5% (5/27), Acinetobacter: 70.4% (19/27) vs. 37.0% (10/27), Corynebacterium: 55.6% (15/27) vs. 7.4% (2/27), P0.05]. 16S rDNA sequencing analysis confirmed that pathogenic bacteria in sputum of VAP were complicated with multiple drug resistant strains. Compared with routine bacterial culture, pyrophosphate sequencing had higher positive rate in detecting pathogens. 16S rDNA gene sequencing technology may become a new method for etiological diagnosis of VAP.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores
2009-12-03
Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix
Directory of Open Access Journals (Sweden)
Olga Y. Yurkevich
2017-08-01
Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology.
Soltis, P S; Soltis, D E; Chase, M W
1999-11-25
Comparative biology requires a firm phylogenetic foundation to uncover and understand patterns of diversification and evaluate hypotheses of the processes responsible for these patterns. In the angiosperms, studies of diversification in floral form, stamen organization, reproductive biology, photosynthetic pathway, nitrogen-fixing symbioses and life histories have relied on either explicit or implied phylogenetic trees. Furthermore, to understand the evolution of specific genes and gene families, evaluate the extent of conservation of plant genomes and make proper sense of the huge volume of molecular genetic data available for model organisms such as Arabidopsis, Antirrhinum, maize, rice and wheat, a phylogenetic perspective is necessary. Here we report the results of parsimony analyses of DNA sequences of the plastid genes rbcL and atpB and the nuclear 18S rDNA for 560 species of angiosperms and seven non-flowering seed plants and show a well-resolved and well-supported phylogenetic tree for the angiosperms for use in comparative biology.
Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley
DEFF Research Database (Denmark)
Pedersen, C.; Linde-Laursen, I.
1994-01-01
is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Mahelka, Václav; Kopecký, David
2010-06-01
Four accessions of hexaploid Elymus repens from its native Central European distribution area were analyzed using sequencing of multicopy (internal transcribed spacer, ITS) and single-copy (granule-bound starch synthase I, GBSSI) DNA in concert with genomic and fluorescent in situ hybridization (GISH and FISH) to disentangle its allopolyploid origin. Despite extensive ITS homogenization, nrDNA in E. repens allowed us to identify at least four distinct lineages. Apart from Pseudoroegneria and Hordeum, representing the major genome constituents, the presence of further unexpected alien genetic material, originating from species outside the Triticeae and close to Panicum (Paniceae) and Bromus (Bromeae), was revealed. GBSSI sequences provided information complementary to the ITS. Apart from Pseudoroegneria and Hordeum, two additional gene variants from within the Triticeae were discovered: One was Taeniatherum-like, but the other did not have a close relationship with any of the diploids sampled. GISH results were largely congruent with the sequence-based markers. GISH clearly confirmed Pseudoroegneria and Hordeum as major genome constituents and further showed the presence of a small chromosome segment corresponding to Panicum. It resided in the Hordeum subgenome and probably represents an old acquisition of a Hordeum progenitor. Spotty hybridization signals across all chromosomes after GISH with Taeniatherum and Bromus probes suggested that gene acquisition from these species is more likely due to common ancestry of the grasses or early introgression than to recent hybridization or allopolyploid origin of E. repens. Physical mapping of rDNA loci using FISH revealed that all rDNA loci except one minor were located on Pseudoroegneria-derived chromosomes, which suggests the loss of all Hordeum-derived loci but one. Because homogenization mechanisms seem to operate effectively among Pseudoroegneria-like copies in this species, incomplete ITS homogenization in our samples
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.
Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun
2015-12-03
The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.
Directory of Open Access Journals (Sweden)
Osmar Vaz de Carvalho-Netto
2008-01-01
Full Text Available Cachaça is a typical Brazilian liquor produced from the distillation of fermented sugarcane juice mainly by Saccharomyces cerevisiae. Most of the domestic production is artisanal, and producers usually are not concerned regarding microbiological control of the fermentation. This study aimed to characterize the contaminant bacterial community of the yeast used in the production of cachaça in an artisanal still. Four samples were collected, of which one (NA was used for comparison purposes and was collected one year earlier. The remaining samples were collected at three different periods: at the end of the first day of fermentation (NP, after fifteen days (NS, and thirty days after the same yeast was used (NT. Five hundred and eighty-seven sequences were analyzed from the partial sequencing of the 16S rDNA gene. Sequence analyses revealed the presence of 170 operational taxonomic units (OTUs. Of these, only one was shared among three samples and seventeen were shared between two samples. The remaining 152 OTUs were identified only once in distinct samples indicating that the contaminant bacterial population is highly dynamic along the fermentation process. Statistical analyses revealed differences in bacterial composition among samples. Undescribed species in the literature on yeasts of cachaça were found, such as Weissella cibaria, Leuconostoc citreum, and some species of Lactobacillus, in addition to some unknown bacteria. The community of bacteria in the fermentation process is much more complex than it was previously considered. No previous report is known regarding the use of this technique to determine bacterial contaminants in yeast for the production of cachaça.A cachaça é uma bebida típica brasileira produzida a partir da destilação do caldo de cana-de-açúcar fermentado principalmente por Saccharomyces cerevisiae. Grande parte da produção nacional é artesanal, e não há uma preocupação por parte dos produtores quanto ao
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.
Directory of Open Access Journals (Sweden)
Mona Hoppenrath
2010-10-01
Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.
Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K
2016-07-29
A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
Directory of Open Access Journals (Sweden)
Philipp Dalkmann
Full Text Available Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin, 4.3 µg/kg (sulfamethoxazole, and 5.4 µg/kg (carbamazepine in soils irrigated for 19-28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15 × 10(-3 ± 0.22 × 10(-3 copies/16S rDNA than in non-irrigated soils (4.35 × 10(-5± 1.00 × 10(-5 copies/16S rDNA, while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61 × 10(-4 ± 0.59 × 10(-4 versus 2.99 × 10(-5 ± 0.26 × 10(-5 copies/16S rDNA. Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang
2016-01-01
To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Comparison of two approaches for the classification of 16S rRNA gene sequences.
Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan
2014-10-01
The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Iwanowicz, Luke R; Iwanowicz, Deborah D; Pote, Linda M; Blazer, Vicki S; Schill, William B
2008-02-01
Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 +/- 0.3 microm (range 15.7-20.3) in length, and 5.4 +/- 0.1 microm (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 +/- 1.1 microm (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 +/- 0.1 microm (range 5.48-7.06), while the shorter is 5.7 +/- 0.1 microm (range 4.8-6.4) in length. Polar capsule width is 1.2 +/- 0.03 microm (range 1.0-1.54). The total length of the spore is 60.9 +/- 1.2 microm (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus.
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Atibalentja, N; Noel, G R; Domier, L L
2000-03-01
A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Improving the Analysis of Dinoflagellate Phylogeny based on rDNA
DEFF Research Database (Denmark)
Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.
2005-01-01
Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
Czech Academy of Sciences Publication Activity Database
Matyášek, Roman; Tate, J. A.; Lim, Y.K.; Šrubařová, Hana; Koh, J.; Leitch, A.R.; Soltis, D.E.; Soltis, P.S.; Kovařík, Aleš
2007-01-01
Roč. 176, č. 4 (2007), s. 2509-2519 ISSN 0016-6731 R&D Projects: GA ČR(CZ) GA204/05/0687; GA ČR(CZ) GA521/07/0116; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA silencing * nucleolar dominance * allopolyploidy Subject RIV: BO - Biophysics Impact factor: 4.001, year: 2007
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.
Directory of Open Access Journals (Sweden)
Anna Maria Fiore-Donno
Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.
2006-01-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid
2016-12-01
Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Siebe, Christina; Willaschek, Elisha; Sakinc, Tuerkan; Huebner, Johannes; Amelung, Wulf; Grohmann, Elisabeth; Siemens, Jan
2012-01-01
Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin), 4.3 µg/kg (sulfamethoxazole), and 5.4 µg/kg (carbamazepine) in soils irrigated for 19–28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate) were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15×10−3±0.22×10−3 copies/16S rDNA) than in non-irrigated soils (4.35×10−5±1.00×10−5 copies/16S rDNA), while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61×10–4±0.59×10−4 versus 2.99×10−5±0.26×10−5 copies/16S rDNA). Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a long-term increase in
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Czech Academy of Sciences Publication Activity Database
Crhák Khaitová, Lucie; Werlemark, G.; Nybom, H.; Kovařík, Aleš
2010-01-01
Roč. 104, č. 1 (2010), s. 113-120 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA521/07/0116; GA MŠk(CZ) LC06004; GA ČR(CZ) GD204/09/H002 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polyploidy * rDNA genes * Rosaceae Subject RIV: BO - Biophysics Impact factor: 4.569, year: 2010
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Directory of Open Access Journals (Sweden)
Juliano S. Cabral
2006-01-01
Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Plant rDNA database: ribosomal DNA loci information goes online
Czech Academy of Sciences Publication Activity Database
Garcia, S.; Garnatje, T.; Kovařík, Aleš
2012-01-01
Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012
Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A
2017-01-01
The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary
Guerra, Marcelo; García, Miguel A
2004-02-01
Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Physical localization and DNA methylation of 45S rRNA gene loci in Jatropha curcas L.
Directory of Open Access Journals (Sweden)
Zhiyun Gong
Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n=2x=22=12m+10 sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation.
Physical Localization and DNA Methylation of 45S rRNA Gene Loci in Jatropha curcas L.
Gong, Zhiyun; Xue, Chao; Zhang, Mingliang; Guo, Rui; Zhou, Yong; Shi, Guoxin
2013-01-01
In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n = 2x = 22 = 12m+10sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation. PMID:24386362
He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun
2012-01-01
Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
The actin family protein ARP6 contributes to the structure and the function of the nucleolus
Energy Technology Data Exchange (ETDEWEB)
Kitamura, Hiroshi [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoka-ku, Sendai 981-8555 (Japan); Matsumori, Haruka [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Kalendova, Alzbeta; Hozak, Pavel [Department of Biology of the Cell Nucleus, Institute of Molecular Genetics of the Academy of Sciences of the Czech Republic, v.v.i., Vídeňská 1083, 142 20 Prague (Czech Republic); Goldberg, Ilya G. [Image Informatics and Computational Biology Unit, Laboratory of Genetics, National Institute on Aging, National Institutes of Health, 251 Bayview Boulevard, Suite 100, Baltimore, MD 21224 (United States); Nakao, Mitsuyoshi [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, Tokyo 102-0076 (Japan); Saitoh, Noriko [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811 (Japan); Harata, Masahiko, E-mail: mharata@biochem.tohoku.ac.jp [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoka-ku, Sendai 981-8555 (Japan)
2015-08-21
The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. - Highlights: • ARP6, an actin related protein, is important for nucleolar function and structure. • A population of ARP6 is localized in the center of nucleolus. • Depletion of ARP6 resulted in aberrant shape of the nucleolus. • ARP6 maintains the active rDNA transcription under high glucose. • ARP6 is required for the repression of rDNA transcription under starvation.
The actin family protein ARP6 contributes to the structure and the function of the nucleolus
International Nuclear Information System (INIS)
Kitamura, Hiroshi; Matsumori, Haruka; Kalendova, Alzbeta; Hozak, Pavel; Goldberg, Ilya G.; Nakao, Mitsuyoshi; Saitoh, Noriko; Harata, Masahiko
2015-01-01
The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. - Highlights: • ARP6, an actin related protein, is important for nucleolar function and structure. • A population of ARP6 is localized in the center of nucleolus. • Depletion of ARP6 resulted in aberrant shape of the nucleolus. • ARP6 maintains the active rDNA transcription under high glucose. • ARP6 is required for the repression of rDNA transcription under starvation
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Zhao, Yan; Yi, Zhenzhen; Gentekaki, Eleni; Zhan, Aibin; Al-Farraj, Saleh A; Song, Weibo
2016-01-01
Ciliates comprise a highly diverse protozoan lineage inhabiting all biotopes and playing crucial roles in regulating microbial food webs. Nevertheless, subtle morphological differences and tiny sizes hinder proper species identification for many ciliates. Here, we use the species-rich taxon Frontonia and employ both nuclear and mitochondrial loci. We attempt to assess the level of genetic diversity and evaluate the potential of each marker in delineating species of Frontonia. Morphological features and ecological characteristics are also integrated into genetic results, in an attempt to resolve conflicts of species identification based on morphological and molecular methods. Our studies reveal: (1) the mitochondrial cox1 gene, nuclear ITS1 and ITS2 as well as the hypervariable D2 region of LSU rDNA are promising candidates for species delineation; (2) the cox1 gene provides the best resolution for analyses below the species level; (3) the V2 and V4 hypervariable regions of SSU rDNA, and D1 of LSU rDNA as well as the 5.8S rDNA gene do not show distinct barcoding gap due to overlap between intra- and inter-specific genetic divergences; (4) morphological character-based analysis shows promise for delimitation of Frontonia species; and (5) all gene markers and character-based analyses demonstrate that the genus Frontonia consists of three groups and monophyly of the genus Frontonia is questionable. Copyright © 2015 Elsevier Inc. All rights reserved.
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na
2017-07-15
Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.
Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.
1993-01-01
The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.
Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A
2016-12-01
Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Directory of Open Access Journals (Sweden)
Ogunjumo Oluwasanmi
2004-06-01
Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
Cavalier-Smith, Thomas
2015-04-01
Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require
Directory of Open Access Journals (Sweden)
Abhishek Walia
2015-12-01
Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.
Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi
2007-03-01
To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
The Role of the S40 Gene Family in Leaf Senescence
Directory of Open Access Journals (Sweden)
Muhammad Jehanzeb
2017-10-01
Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.
Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup
2018-03-01
Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands
Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.
2006-01-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
Directory of Open Access Journals (Sweden)
Sebastian Pita
2013-05-01
Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Leiomodins: larger members of the tropomodulin (Tmod) gene family
Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.
2001-01-01
The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Myo-Jing Kim
2014-12-01
Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.
Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo
2013-01-01
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.
Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria
Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.
2003-01-01
The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Directory of Open Access Journals (Sweden)
Sandra Gutiérrez
2012-01-01
Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.
Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B
2006-09-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.
Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio
2008-11-01
The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.
Gene-expression patterns in peripheral blood classify familial breast cancer susceptibility.
Piccolo, Stephen R; Andrulis, Irene L; Cohen, Adam L; Conner, Thomas; Moos, Philip J; Spira, Avrum E; Buys, Saundra S; Johnson, W Evan; Bild, Andrea H
2015-11-04
Women with a family history of breast cancer face considerable uncertainty about whether to pursue standard screening, intensive screening, or prophylactic surgery. Accurate and individualized risk-estimation approaches may help these women make more informed decisions. Although highly penetrant genetic variants have been associated with familial breast cancer (FBC) risk, many individuals do not carry these variants, and many carriers never develop breast cancer. Common risk variants have a relatively modest effect on risk and show limited potential for predicting FBC development. As an alternative, we hypothesized that additional genomic data types, such as gene-expression levels, which can reflect genetic and epigenetic variation, could contribute to classifying a person's risk status. Specifically, we aimed to identify common patterns in gene-expression levels across individuals who develop FBC. We profiled peripheral blood mononuclear cells from women with a family history of breast cancer (with or without a germline BRCA1/2 variant) and from controls. We used the support vector machines algorithm to differentiate between patients who developed FBC and those who did not. Our study used two independent datasets, a training set of 124 women from Utah (USA) and an external validation (test) set from Ontario (Canada) of 73 women (197 total). We controlled for expression variation associated with clinical, demographic, and treatment variables as well as lymphocyte markers. Our multigene biomarker provided accurate, individual-level estimates of FBC occurrence for the Utah cohort (AUC = 0.76 [0.67-84]) . Even at their lower confidence bounds, these accuracy estimates meet or exceed estimates from alternative approaches. Our Ontario cohort resulted in similarly high levels of accuracy (AUC = 0.73 [0.59-0.86]), thus providing external validation of our findings. Individuals deemed to have "high" risk by our model would have an estimated 2.4 times greater odds of
Directory of Open Access Journals (Sweden)
Andrew Macrae
2000-06-01
Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.
Dong, Chun-Juan; Shang, Qing-Mao
2013-07-01
Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.
Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi
2008-07-01
Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.
Directory of Open Access Journals (Sweden)
Zhi Zou
Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.
International Nuclear Information System (INIS)
Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming
2012-01-01
Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.
Sexy gene conversions: locating gene conversions on the X-chromosome.
Lawson, Mark J; Zhang, Liqing
2009-08-01
Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.
Directory of Open Access Journals (Sweden)
Dandan eLi
2015-12-01
Full Text Available The heavy metal ATPase (HMA family plays an important role in transition metal transport in plants. However, this gene family has not been extensively studied in Populus trichocarpa. We identified 17 HMA genes in P. trichocarpa (PtHMAs, of which PtHMA1–PtHMA4 belonged to the zinc (Zn/cobalt (Co/cadmium (Cd/lead (Pb subgroup, and PtHMA5–PtHMA8 were members of the copper (Cu/silver (Ag subgroup. Most of the genes were localized to chromosomes I and III. Gene structure, gene chromosomal location, and synteny analyses of PtHMAs indicated that tandem and segmental duplications likely contributed to the expansion and evolution of the PtHMAs. Most of the HMA genes contained abiotic stress-related cis-elements. Tissue-specific expression of PtHMA genes showed that PtHMA1 and PtHMA4 had relatively high expression levels in the leaves, whereas Cu/Ag subgroup (PtHMA5.1- PtHMA8 genes were upregulated in the roots. High concentrations of Cu, Ag, Zn, Cd, Co, Pb and Mn differentially regulated the expression of PtHMAs in various tissues. The preliminary results of the present study generated basic information on the HMA family of Populus that may serve as foundation for future functional studies.
5-Methyldeoxycytidine in the Physarum minichromosome containing the ribosomal RNA genes.
Cooney, C A; Matthews, H R; Bradbury, E M
1984-01-01
5-Methyldeoxycytidine (5MC) was analyzed by high pressure liquid chromatography (HPLC) and by restriction enzyme digestion in rDNA isolated from Physarum polycephalum. rDNA from Physarum M3C strain microplasmodia has a significant 5MC content (about half that of the whole genomic DNA). This rDNA contains many C5MCGG sites because it is clearly digested further by Msp I than by Hpa II. However, most 5MC is in other sites. In particular, alternating CG sequences appear to be highly methylated. HPLC of deoxyribonucleosides shows tha most of the transcribed regions contain little or no 5MC. Restriction digestion indicates that there is little or no 5MC in any of the transcribed regions including the transcription origin and adjacent sequences. Over 90% of the total 5MC is in or near the central nontranscribed spacer and most methylated restriction sites are in inverted repeats of this spacer. rDNA is very heterogeneous with respect to 5MC. The 5MC pattern doesn't appear to change with inactivation of the rRNA genes during reversible differentiation from microplasmodia (growing) to microsclerotia (dormant), showing that inactivation is due to changes in other chromatin variables. The 5MC pattern is different between Physarum strains. The possible involvement of this 5MC in rDNA chromatin structure and in cruciform and Z-DNA formation is discussed. Images PMID:6322108
Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L
2014-04-08
In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.
NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.
Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran
2017-09-01
To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Genomic sequence and organization of two members of a human lectin gene family
International Nuclear Information System (INIS)
Gitt, M.A.; Barondes, S.H.
1991-01-01
The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family
International Nuclear Information System (INIS)
Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert
2008-01-01
BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility
Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.
Directory of Open Access Journals (Sweden)
Yoshikazu Furuta
Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.
Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).
Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W
2015-12-29
GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.
Directory of Open Access Journals (Sweden)
Fang Hu
2014-10-01
Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
DEFF Research Database (Denmark)
Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.
2001-01-01
supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...
Modulation of immune response to rDNA hepatitis B vaccination by psychological stress
L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)
1996-01-01
textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels
International Nuclear Information System (INIS)
Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.
1990-01-01
The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus
Genome-wide analysis of WRKY gene family in Cucumis sativus.
Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan
2011-09-28
WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.
Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza
2017-09-27
Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.
Differential roles of TGIF family genes in mammalian reproduction
Directory of Open Access Journals (Sweden)
Renfree Marilyn B
2011-09-01
Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.
LENUS (Irish Health Repository)
Fernandez, Desiree M
2012-02-03
OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.
Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing
Directory of Open Access Journals (Sweden)
Planý Matej
2016-06-01
Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.
Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P
2017-06-01
Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou
2016-02-23
The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Directory of Open Access Journals (Sweden)
Ling Wei
2016-02-01
Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Repair of DNA damage in the human metallothionein gene family
International Nuclear Information System (INIS)
Leadon, S.A.; Snowden, M.M.
1987-01-01
In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab
International Nuclear Information System (INIS)
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
The nuclear IκB family of proteins controls gene regulation and immune homeostasis.
MaruYama, Takashi
2015-10-01
The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Derek L Lindstrom
2011-03-01
Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.
Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong
2015-04-01
Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Chepyshko Hanna
2012-07-01
Full Text Available Abstract Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were
Patil, Gunvant; Valliyodan, Babu; Deshmukh, Rupesh; Prince, Silvas; Nicander, Bjorn; Zhao, Mingzhe; Sonah, Humira; Song, Li; Lin, Li; Chaudhary, Juhi; Liu, Yang; Joshi, Trupti; Xu, Dong; Nguyen, Henry T
2015-07-11
SWEET (MtN3_saliva) domain proteins, a recently identified group of efflux transporters, play an indispensable role in sugar efflux, phloem loading, plant-pathogen interaction and reproductive tissue development. The SWEET gene family is predominantly studied in Arabidopsis and members of the family are being investigated in rice. To date, no transcriptome or genomics analysis of soybean SWEET genes has been reported. In the present investigation, we explored the evolutionary aspect of the SWEET gene family in diverse plant species including primitive single cell algae to angiosperms with a major emphasis on Glycine max. Evolutionary features showed expansion and duplication of the SWEET gene family in land plants. Homology searches with BLAST tools and Hidden Markov Model-directed sequence alignments identified 52 SWEET genes that were mapped to 15 chromosomes in the soybean genome as tandem duplication events. Soybean SWEET (GmSWEET) genes showed a wide range of expression profiles in different tissues and developmental stages. Analysis of public transcriptome data and expression profiling using quantitative real time PCR (qRT-PCR) showed that a majority of the GmSWEET genes were confined to reproductive tissue development. Several natural genetic variants (non-synonymous SNPs, premature stop codons and haplotype) were identified in the GmSWEET genes using whole genome re-sequencing data analysis of 106 soybean genotypes. A significant association was observed between SNP-haplogroup and seed sucrose content in three gene clusters on chromosome 6. Present investigation utilized comparative genomics, transcriptome profiling and whole genome re-sequencing approaches and provided a systematic description of soybean SWEET genes and identified putative candidates with probable roles in the reproductive tissue development. Gene expression profiling at different developmental stages and genomic variation data will aid as an important resource for the soybean research
The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.
Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María
2016-09-01
The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.
Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia
2016-01-01
Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
Understanding familial and non-familial renal cell cancer.
Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J M; Eleveld, Marc J; Martens, Gerard J M; Weterman, Marian A J; van Kessel, Ad Geurts
2002-10-01
Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is still pending. Additionally, a novel role for constitutional chromosome 3 translocations as risk factors for conventional RCC development is rapidly emerging. Also, several candidate loci have been mapped to other chromosomes in both familial and non-familial RCCs of distinct histologic subtypes. The MET gene on chromosome 7, for example, was found to be involved in both forms of papillary RCC. A PRCC-TFE3 fusion gene is typically encountered in t(X;1)-positive non-familial papillary RCCs and results in abrogation of the cell cycle mitotic spindle checkpoint in a dominant-negative fashion, thus leading to RCC. Together, these data turn human RCC into a model system in which different aspects of both familial and non-familial syndromes may act as novel paradigms for cancer development.
Directory of Open Access Journals (Sweden)
Hong-Yang Wang
2015-01-01
Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.
Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M
2017-06-01
The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi
2015-02-15
WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.
Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.
Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang
2015-06-30
Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.
Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.
Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L
2015-10-30
MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.
Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua
2014-01-01
Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088
Directory of Open Access Journals (Sweden)
Hong Yu
Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.
Directory of Open Access Journals (Sweden)
Anna Bachmann
Full Text Available BACKGROUND: To avoid spleen-dependent killing mechanisms parasite-infected erythrocytes (IE of Plasmodium falciparum malaria patients have the capacity to bind to endothelial receptors. This binding also known as sequestration, is mediated by parasite proteins, which are targeted to the erythrocyte surface. Candidate proteins are those encoded by P. falciparum multicopy gene families, such as var, rif, stevor or PfMC-2TM. However, a direct in vivo proof of IE sequestration and expression of multicopy gene families is still lacking. Here, we report on the analysis of IE from a black African immigrant, who received the diagnosis of a malignant lymphoproliferative disorder and subsequently underwent splenectomy. Three weeks after surgery, the patient experienced clinical falciparum malaria with high parasitemia and circulating developmental parasite stages usually sequestered to the vascular endothelium such as late trophozoites, schizonts or immature gametocytes. METHODOLOGY/PRINCIPAL FINDINGS: Initially, when isolated from the patient, the infected erythrocytes were incapable to bind to various endothelial receptors in vitro. Moreover, the parasites failed to express the multicopy gene families var, A-type rif and stevor but expression of B-type rif and PfMC-2TM genes were detected. In the course of in vitro cultivation, the parasites started to express all investigated multicopy gene families and concomitantly developed the ability to adhere to endothelial receptors such as CD36 and ICAM-1, respectively. CONCLUSION/SIGNIFICANCE: This case strongly supports the hypothesis that parasite surface proteins such as PfEMP1, A-type RIFIN or STEVOR are involved in interactions of infected erythrocytes with endothelial receptors mediating sequestration of mature asexual and immature sexual stages of P. falciparum. In contrast, multicopy gene families coding for B-type RIFIN and PfMC-2TM proteins may not be involved in sequestration, as these genes were
Urbani, C; Russo, D; Raggi, F; Lombardi, M; Sardella, C; Scattina, I; Lupi, I; Manetti, L; Tomisti, L; Marcocci, C; Martino, E; Bogazzi, F
2014-10-01
Acromegaly usually occurs as a sporadic disease, but it may be a part of familial pituitary tumor syndromes in rare cases. Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been associated with a predisposition to familial isolated pituitary adenoma. The aim of the present study was to evaluate the AIP gene in a patient with gigantism and in her relatives. Direct sequencing of AIP gene was performed in fourteen members of the family, spanning among three generations. The index case was an 18-year-old woman with gigantism due to an invasive GH-secreting pituitary adenoma and a concomitant tall-cell variant of papillary thyroid carcinoma. A novel germline mutation in the AIP gene (c.685C>T, p.Q229X) was identified in the proband and in two members of her family, who did not present clinical features of acromegaly or other pituitary disorders. Eleven subjects had no mutation in the AIP gene. Two members of the family with clinical features of acromegaly refused either the genetic or the biochemical evaluation. The Q229X mutation was predicted to generate a truncated AIP protein, lacking the last two tetratricopeptide repeat domains and the final C-terminal α-7 helix. We identified a new AIP germline mutation predicted to produce a truncated AIP protein, lacking its biological properties due to the disruption of the C-terminus binding sites for both the chaperones and the client proteins of AIP.
Differential expression pattern of UBX family genes in Caenorhabditis elegans
International Nuclear Information System (INIS)
Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi
2007-01-01
UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated
Svanem, Britt Iren Glærum; Skjåk-Bræk, Gudmund; Ertesvåg, Helga; Valla, Svein
1999-01-01
The cloning and expression of a family of five modular-type mannuronan C-5-epimerase genes from Azotobacter vinelandii (algE1 to -5) has previously been reported. The corresponding proteins catalyze the Ca2+-dependent polymer-level epimerization of β-d-mannuronic acid to α-l-guluronic acid (G) in the commercially important polysaccharide alginate. Here we report the identification of three additional structurally similar genes, designated algE6, algE7, and algY. All three genes were sequenced...
Genome-wide identification and characterization of WRKY gene family in peanut
Directory of Open Access Journals (Sweden)
Hui eSong
2016-04-01
Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.
Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun
2016-01-01
WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.
2015-01-01
The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230
Immanen, Juha; Nieminen, Kaisa; Duchens Silva, Héctor; Rodríguez Rojas, Fernanda; Meisel, Lee A; Silva, Herman; Albert, Victor A; Hvidsten, Torgeir R; Helariutta, Ykä
2013-12-16
Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis.
Directory of Open Access Journals (Sweden)
Érico Leandro da Silveira
2006-10-01
Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Energy Technology Data Exchange (ETDEWEB)
Bonaventure, J.; Lasselin, C. [Hopital Necker, Paris (France); Toutain, A. [CHU Bretonneau, Tours (France)] [and others
1994-09-01
The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximal value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.
Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu
2018-04-01
MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Raherison Elie
2012-08-01
Full Text Available Abstract Background Conifers have very large genomes (13 to 30 Gigabases that are mostly uncharacterized although extensive cDNA resources have recently become available. This report presents a global overview of transcriptome variation in a conifer tree and documents conservation and diversity of gene expression patterns among major vegetative tissues. Results An oligonucleotide microarray was developed from Picea glauca and P. sitchensis cDNA datasets. It represents 23,853 unique genes and was shown to be suitable for transcriptome profiling in several species. A comparison of secondary xylem and phelloderm tissues showed that preferential expression in these vascular tissues was highly conserved among Picea spp. RNA-Sequencing strongly confirmed tissue preferential expression and provided a robust validation of the microarray design. A small database of transcription profiles called PiceaGenExpress was developed from over 150 hybridizations spanning eight major tissue types. In total, transcripts were detected for 92% of the genes on the microarray, in at least one tissue. Non-annotated genes were predominantly expressed at low levels in fewer tissues than genes of known or predicted function. Diversity of expression within gene families may be rapidly assessed from PiceaGenExpress. In conifer trees, dehydrins and late embryogenesis abundant (LEA osmotic regulation proteins occur in large gene families compared to angiosperms. Strong contrasts and low diversity was observed in the dehydrin family, while diverse patterns suggested a greater degree of diversification among LEAs. Conclusion Together, the oligonucleotide microarray and the PiceaGenExpress database represent the first resource of this kind for gymnosperm plants. The spruce transcriptome analysis reported here is expected to accelerate genetic studies in the large and important group comprised of conifer trees.
Directory of Open Access Journals (Sweden)
Nomar Espinosa Waminal
Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.
Directory of Open Access Journals (Sweden)
Zhongliang Zhao
2016-03-01
Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.