Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J
2011-03-01
Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Preoperational test report, raw water system
Energy Technology Data Exchange (ETDEWEB)
Clifton, F.T.
1997-10-29
This represents the preoperational test report for the Raw Water System, Project W-030. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The system supplies makeup water to the W-030 recirculation evaporative cooling towers for tanks AY1O1, AY102, AZ1O1, AZ102. The Raw Water pipe riser and associated strainer and valving is located in the W-030 diesel generator building. The tests verify correct system operation and correct indications displayed by the central Monitor and Control System.
Preoperational test report, raw water system
International Nuclear Information System (INIS)
Clifton, F.T.
1997-01-01
This represents the preoperational test report for the Raw Water System, Project W-030. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The system supplies makeup water to the W-030 recirculation evaporative cooling towers for tanks AY1O1, AY102, AZ1O1, AZ102. The Raw Water pipe riser and associated strainer and valving is located in the W-030 diesel generator building. The tests verify correct system operation and correct indications displayed by the central Monitor and Control System
Directory of Open Access Journals (Sweden)
S. N. Depamede
2011-08-01
Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.
Sampling analytical tests and destructive tests for quality assurance
International Nuclear Information System (INIS)
Saas, A.; Pasquini, S.; Jouan, A.; Angelis, de; Hreen Taywood, H.; Odoj, R.
1990-01-01
In the context of the third programme of the European Communities on the monitoring of radioactive waste, various methods have been developed for the performance of sampling and measuring tests on encapsulated waste of low and medium level activity, on the one hand, and of high level activity, on the other hand. The purpose was to provide better quality assurance for products to be stored on an interim or long-term basis. Various testing sampling means are proposed such as: - sampling of raw waste before conditioning and determination of the representative aliquot, - sampling of encapsulated waste on process output, - sampling of core specimens subjected to measurement before and after cutting. Equipment suitable for these sampling procedures have been developed and, in the case of core samples, a comparison of techniques has been made. The results are described for the various analytical tests carried out on the samples such as: - mechanical tests, - radiation resistance, - fire resistance, - lixiviation, - determination of free water, - biodegradation, - water resistance, - chemical and radiochemical analysis. Every time it was possible, these tests were compared with non-destructive tests on full-scale packages and some correlations are given. This word has made if possible to improve and clarify sample optimization, with fine sampling techniques and methodologies and draw up characterization procedures. It also provided an occasion for a first collaboration between the laboratories responsible for these studies and which will be furthered in the scope of the 1990-1994 programme
Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC
Directory of Open Access Journals (Sweden)
afshin Nazari
2007-10-01
Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC
Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk
Directory of Open Access Journals (Sweden)
Milan Vasiľ
2016-12-01
Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics. Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.
Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.
Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E
2016-05-01
We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.
40 CFR 90.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... probe may not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe must be... the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to the HC... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 89.412 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... the exhaust pipe shall be as small as practical in order to minimize heat loss from the probe. (2) The... sample transport system from the engine exhaust pipe to the HC analyzer and the NOX analyzer must be... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 91.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... shall not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe shall be as... internally to the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
19 CFR 151.22 - Estimated duties on raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...
Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland
DEFF Research Database (Denmark)
Scullion, R.; Harrington, C.S.; Madden, R.H.
2006-01-01
A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....
Scoping Future Policy Dynamics in Raw Materials Through Scenarios Testing
Correia, Vitor; Keane, Christopher; Sturm, Flavius; Schimpf, Sven; Bodo, Balazs
2017-04-01
The International Raw Materials Observatory (INTRAW) project is working towards a sustainable future for the European Union in access to raw materials, from an availability, economical, and environmental framework. One of the major exercises for the INTRAW project is the evaluation of potential future scenarios for 2050 to frame economic, research, and environmental policy towards a sustainable raw materials supply. The INTRAW consortium developed three possible future scenarios that encompass defined regimes of political, economic, and technological norms. The first scenario, "Unlimited Trade," reflects a world in which free trade continues to dominate the global political and economic environment, with expectations of a growing demand for raw materials from widely distributed global growth. The "National Walls" scenario reflects a world where nationalism and economic protectionism begins to dominate, leading to stagnating economic growth and uneven dynamics in raw materials supply and demand. The final scenario, "Sustainability Alliance," examines the dynamics of a global political and economic climate that is focused on environmental and economic sustainability, leading towards increasingly towards a circular raw materials economy. These scenarios were reviewed, tested, and provided simulations of impacts with members of the Consortium and a panel of global experts on international raw materials issues which led to expected end conditions for 2050. Given the current uncertainty in global politics, these scenarios are informative to identifying likely opportunities and crises. The details of these simulations and expected responses to the research demand, technology investments, and economic components of raw materials system will be discussed.
Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit
2017-03-01
Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.
Directory of Open Access Journals (Sweden)
Angelovski Ljupco
2008-11-01
Full Text Available Somatic cells count and total viable count are criteria used to estimate the compliance of raw cow milk with the Book of rules for demands for safety and hygiene and procedures for official controls of milk and milk products, Official Gazette of RM 157/2007. According to the given demands, raw milk operators are obliged to conduct all procedures and to guarantee that milk is in compliance with the criteria laid down in Book of rules. At the same time, Republic of Macedonia have to fulfill EU criteria laid down in Directive 92/46 (Council directive 92/46/EEC laying down the health rules for the production and placing on the market of raw milk, heat-treated milk and milkbased products for quality of raw milk as part of implementation of community legislation and milk production. The independent laboratory for milk quality control at FVM-Skopje, in frame of its activities in the period February- August 2008 has conducted a study for obtaining preliminary results for the situation with raw milk quality produced in R. of Macedonia for somatic cells counts and total viable count. In the study we analyzed 2065 samples for TVC and 1625 samples for SCC of raw milk samples produced in different parts of the country. From the tested samples only 41,8% fulfill criteria for SCC and 41,45% criteria for TVC lay down in Book of rules for 2008. Assessment of the results in light of Council Directive it is obvious that only 42,7% of the samples for SCC and 10,7% for TVC fulfill the criteria of Council Directive having in mind different requirements vs. Book of rules.
Singh, Manju; Singh, Shoor Vir; Gupta, Saurabh; Chaubey, Kundan Kumar; Stephan, Bjorn John; Sohal, Jagdip Singh; Dutta, Manali
2018-04-26
Early rapid detection of Mycobacterium avium subspecies paratuberculosis (MAP) bacilli in milk samples is the major challenge since traditional culture method is time consuming and laboratory dependent. We report a simple, sensitive and specific nano-technology based 'Nano-immuno test' capable of detecting viable MAP bacilli in the milk samples within 10 h. Viable MAP bacilli were captured by MAP specific antibody-conjugated magnetic nano-particles using resazurin dye as chromogen. Test was optimized using true culture positive (10-bovine and 12-goats) and true culture negative (16-bovine and 25-goats) raw milk samples. Domestic livestock species in India are endemically infected with MAP. After successful optimization, sensitivity and specificity of the 'nano-immuno test' in goats with respect to milk culture was 91.7% and 96.0%, respectively. Whereas, it was 90.0% (sensitivity) and 92.6% (specificity) with respect to IS900 PCR. In bovine milk samples, sensitivity and specificity of 'nano-immuno test' with respect to milk culture was 90.0% and 93.7%, respectively. However, with respect to IS900 PCR, the sensitivity and specificity was 88.9% and 94.1%, respectively. Test was validated with field raw milk samples (goats-258 and bovine-138) collected from domestic livestock species to detect live/viable MAP bacilli. Of 138 bovine raw milk samples screened by six diagnostic tests, 81 (58.7%) milk samples were positive for MAP infection in one or more than one diagnostic tests. Of 81 (58.7%) positive bovine raw milk samples, only 24 (17.4%) samples were detected positive for the presence of viable MAP bacilli. Of 258 goats raw milk samples screened by six diagnostic tests, 141 (54.6%) were positive for MAP infection in one or more than one test. Of 141 (54.6%) positive raw milk samples from goats, only 48 (34.0%) were detected positive for live MAP bacilli. Simplicity and efficiency of this novel 'nano-immuno test' makes it suitable for wide-scale screening of milk
Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D
2008-10-01
The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.
Directory of Open Access Journals (Sweden)
A.A. Moawad
2011-10-01
Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.
Directory of Open Access Journals (Sweden)
Rodrigo Vera
2016-06-01
Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.
Directory of Open Access Journals (Sweden)
S.P. Tsygankov
2013-07-01
Full Text Available Results of development and testing the tentative technology of sweet sorghum and finger millet processing into bioethanol are described. The carbohydrates content and range of the studied vegetable biomass as the raw material is defined. Bioethanol potential output from sugar sorghum and finger millet carbohydrates and key technological parameters of preparation of both types of vegetable raw material for alcohol fermentation are defined. The concept of the tentative technology of bioethanol production from carbohydrate raw material of the first and second generations is offered. Testing of complex transformation of carbohydrates from vegetable raw materials into bioethanol is performed.
Effects of home-made boiling of bovine raw milk on its microbiological quality
Directory of Open Access Journals (Sweden)
Giampaolo Colavita
2012-10-01
Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.
Effects of storage on the major constituents of raw milk
Directory of Open Access Journals (Sweden)
Peter Zajác
2015-10-01
Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an
Monitoring of foodborne pathogens in raw cow milk in Tuscany
Directory of Open Access Journals (Sweden)
Laura Gasperetti
2014-03-01
Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.
Prevalence of the pathogen microorganisms in raw cow milk
Directory of Open Access Journals (Sweden)
Angelovski Ljupco
2009-11-01
Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.
On-chip sample preparation for complete blood count from raw blood.
Nguyen, John; Wei, Yuan; Zheng, Yi; Wang, Chen; Sun, Yu
2015-03-21
This paper describes a monolithic microfluidic device capable of on-chip sample preparation for both RBC and WBC measurements from whole blood. For the first time, on-chip sample processing (e.g. dilution, lysis, and filtration) and downstream single cell measurement were fully integrated to enable sample preparation and single cell analysis from whole blood on a single device. The device consists of two parallel sub-systems that perform sample processing and electrical measurements for measuring RBC and WBC parameters. The system provides a modular environment capable of handling solutions of various viscosities by adjusting the length of channels and precisely controlling mixing ratios, and features a new 'offset' filter configuration for increased duration of device operation. RBC concentration, mean corpuscular volume (MCV), cell distribution width, WBC concentration and differential are determined by electrical impedance measurement. Experimental characterization of over 100,000 cells from 10 patient blood samples validated the system's capability for performing on-chip raw blood processing and measurement.
19 CFR 151.23 - Allowance for moisture in raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for moisture in raw sugar. 151.23...; DEPARTMENT OF THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.23 Allowance for moisture in raw sugar. Inasmuch as the absorption of sea water or moisture...
Caffeine Extraction from Raw and Roasted Coffee Beans.
Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh
2018-04-01
Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.
MICROBIOLOGY OF RAW MATERIALS USED FOR CONFECTIONARY PRODUCTION
Directory of Open Access Journals (Sweden)
Jana Petrová
2015-02-01
Full Text Available The aim of our study was to evaluate the microbiological quality of raw materials used for preparation of confectionery products. For microbiological evaluation total count of bacteria, mesophilic aerobic bacteria, coliform bacteria, yeast and microscopic filamentous fungi in samples of raw materials used in the manufacture and creams of confectionery products were detected. In addition to these groups of microorganisms the presence of pathogenic microorganisms Salmonella spp. and Staphylococcus aureus in creams was monitored. Products are assessed according to the limit values of the number of microorganisms defined in the Codex Alimentary of the Slovak Republic. For microbiological analysis of confectionery products, sampling of components of confectionary products and cream was carried out according to current health regulations and altogether 65 samples of components and creams were collected: 10 samples of raw materials sugar, 10 samples of flour, 10 samples of butter and 10 samples of eggs, 5 samples of butter yolk from cream-filled disposable bag without rum addition, 5 samples of butter yolk from cream-filled disposable bag with rum addition, 5 samples of cream-filled multiple use paid bag, 5 samples of cream-filled newly purchased paid bag, 5 samples of Venček corpus and 5 samples of the French cubes corpus. From raw material the highest TBC (2.65log CFU was in flour, but the lowest in sugar (1.35 log CFU, the highest years counts was found on flour (2.42, but lowest in butter (1.18, while wasn’t in egg. In samples of creams and corpus were increased occurrence of yeast, coliform bacteria. Salmonella spp. and Staphylococcus aureus weren’t isolated from any tested sample.
Traceability of Plant Diet Contents in Raw Cow Milk Samples
Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego
2009-01-01
The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982
DEFF Research Database (Denmark)
Pineiro, C.; Barros-Velazquez, J.; Perez-Martin, R.I.
1999-01-01
A collaborative study was carried out in seven European labs with the aim of achieving a sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) standard operation procedure to identify fish species in raw and cooked samples. Urea and SDS-containing solutions were evaluated...... silver stained, yielded good results and afforded higher reproducibility, thus allowing a better matching of results among the laboratories participating in this collaborative study. Under the optimized technical conditions described above, all the fish species tested, either raw and cooked, yielded...... seemed not to be influenced so much by the state of the sample (raw, cooked at 60 degrees C, cooked at 85 degrees C). Desalting, ultrafiltration or treatment with RNase/DNase did not improve the discriminatory power of the protein patterns. Commercial homogeneous 15% ExcelGels, especially when they were...
Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin
2016-12-01
This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the
Colonna, A; Durham, C; Meunier-Goddik, L
2011-10-01
Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.
Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S
2018-06-01
Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.
Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran
Directory of Open Access Journals (Sweden)
Mohammad Hossein Sarrafzadeh Zargar
2014-07-01
Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.
Study on optimum length of raw material in stainless steel high-lock nuts forging
Cheng, Meiwen; Liu, Fenglei; Zhao, Qingyun; Wang, Lidong
2018-04-01
Taking 302 stainless steel (1Cr18Ni9) high-lock nuts for research objects, adjusting the length of raw material, then using DEFORM software to simulate the isothermal forging process of each station and conducting the corresponding field tests to study the effects of raw material size on the stainless steel high-lock nuts forming performance. The tests show that the samples of each raw material length is basically the same as the results of the DEFORM software. When the length of the raw material is 10mm, the appearance size of the parts can meet the design requirements.
Directory of Open Access Journals (Sweden)
Hamid Iqbal
2016-11-01
Full Text Available Objective: To evaluate the hygienic quality by determining the presence of predominant pathogenic microbial contaminants (contagious or environmental and indiscriminate heavy metals contained in unpasteurized milk samples collected from cattle specie of cow. Methods: Raw milk samples were collected in October, 2014 from different regions of District Kohat, Khyber Pakhtunkhwa, Pakistan and cultured on the selective media plates according to the manufacturer instructions to observe pathogenic microbial flora and confirm it with relevant biochemical tests to specify bacterial specie. Results: Milk samples analyzed on MacConkey and nutrient agar media were found contaminated mostly with coliform, Staphylococcus aureus, Enterobacter aerogenes and Proteus vulgaris. Similarly, result of the heavy metals analysis performed using atomic absorption spectrophotometer flame photometry showed that raw milk contains heavy metals residues of lead and cadmium contents at higher levels while copper, zinc and chromium were observed lower than permissible limits whereas manganese within specified recommended values. Conclusions: Microbial contamination of milk and toxic metals is mainly accredited to the scrupulous unhygienic measures during processing of milk exhibiting a wide array of hazardous impacts on human health.
International Nuclear Information System (INIS)
Martinez, G.L.; Navarrete, J.M.
2007-01-01
Erosion caused by external factors such as wind, rain, sunlight and temperature changes is considerable in raw materials used to build pre-hispanic monuments. However, there does exist an internal destruction factor even stronger: the humidity coming from the soil, which goes up by capillarity, depositing soluble salts on the walls surface. Therefore, one way to find some figure related to the specific capillarity or porosity shown by each raw material, is to obtain small prism-shaped pieces cut out from the large debris fallen down spontaneously from ancient walls due to internal humidity. Once these small samples are placed in contact with a 22 Na labeled solution during a given time, at the same geometrical conditions, dried overnight, conditioned either in test tubes or wrapped into polyethylene and detected in a well type 3' x 3' scintillation detector, the counts accumulated per time and weight units are a measure of the relative porosity shown by each material. In order to pull down this porosity, the samples are impregnated with a gelatin solution (50 g/l) at 60-80 deg C plus food preservatives such as potassium sorbate (2.5%) and sodium benzoate (2.5%). When gelatin begins to be formed 3 hours later and the samples look humid and brilliant, they are impregnated with formaldehyde solution (38%), and their absorption rate is dramatically reduced overnight (75-100%), which can be proven when samples are tested by making use of the 22 Na labeled solution. This technique has been applied at real scale in some pre-hispanic monuments. Ancient raw materials seems to be much more compact and well preserved during one limited period of time (10 to 13 months). Treatment is unnoticeable and reversible, and it may be applied periodically. (author)
Red mud addition in the raw meal for the production of Portland cement clinker.
Tsakiridis, P E; Agatzini-Leonardou, S; Oustadakis, P
2004-12-10
The aim of the present research work was to investigate the possibility of adding red mud, an alkaline leaching waste, which is obtained from bauxite during the Bayer process for alumina production, in the raw meal for the production of Portland cement clinker. For that reason, two samples of raw meals were prepared: one with ordinary raw materials, as a reference sample ((PC)Ref), and another with 3.5% red mud ((PC)R/M). The effect on the reactivity of the raw mix was evaluated on the basis of the unreacted lime content in samples sintered at 1350, 1400 and 1450 degrees C. Subsequently, the clinkers were produced by sintering the two raw meals at 1450 degrees C. The results of chemical and mineralogical analyses as well as the microscopic examination showed that the use of the red mud did not affect the mineralogical characteristics of the so produced Portland cement clinker. Furthermore, both clinkers were tested by determining the grindability, setting time, compressive strength and expansibility. The hydration products were examined by XRD analysis at 2, 7, 28 and 90 days. The results of the physico-mechanical tests showed that the addition of the red mud did not negatively affect the quality of the produced cement.
Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A
2010-11-01
The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.
Advances in paper-based sample pretreatment for point-of-care testing.
Tang, Rui Hua; Yang, Hui; Choi, Jane Ru; Gong, Yan; Feng, Shang Sheng; Pingguan-Murphy, Belinda; Huang, Qing Sheng; Shi, Jun Ling; Mei, Qi Bing; Xu, Feng
2017-06-01
In recent years, paper-based point-of-care testing (POCT) has been widely used in medical diagnostics, food safety and environmental monitoring. However, a high-cost, time-consuming and equipment-dependent sample pretreatment technique is generally required for raw sample processing, which are impractical for low-resource and disease-endemic areas. Therefore, there is an escalating demand for a cost-effective, simple and portable pretreatment technique, to be coupled with the commonly used paper-based assay (e.g. lateral flow assay) in POCT. In this review, we focus on the importance of using paper as a platform for sample pretreatment. We firstly discuss the beneficial use of paper for sample pretreatment, including sample collection and storage, separation, extraction, and concentration. We highlight the working principle and fabrication of each sample pretreatment device, the existing challenges and the future perspectives for developing paper-based sample pretreatment technique.
2013-08-28
... evaluated the FSIS Salmonella detection method (FSIS Microbiology Laboratory Guidebook Chapter 4.06) using... prevalence estimates, FSIS defines prevalence as the proportion of applicable product that would test... that is intended for use as raw, non-intact product tests positive for STEC, the product is adulterated...
Survey to determine why people drink raw milk.
Mullin, Gerard E; Belkoff, Stephen M
2014-11-01
Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.
Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan
2009-08-01
In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.
DEFF Research Database (Denmark)
Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud
2006-01-01
Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....
Detection of hepatitis A virus and bacterial contamination in raw oysters in Thailand.
Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa; Diraphat, Pornphan
2010-01-01
This study was conducted to determine the presence of hepatitis A virus (HAV) in raw oysters (Crassostrea belcheri) using a virus concentration method and reverse transcription-nested polymerase chain reaction (RT-nested PCR). A total of 220 oyster samples were collected from oyster farms and local markets in Thailand. HAV was found in three oyster samples. Nested PCR products of HAV detected in oysters were characterized further by DNA sequencing of the VP1/2A region and subjected to phylogenetic analysis. All HAV sequences (168 basepairs) were associated with human HAV subgenotype IB (GIB). Fecal coliforms and Escherichia coli were determined using the multiple tube fermentation method, to assess the microbiological quality of collected oysters. Among oyster samples tested, 65% had fecal coliforms higher than the standard level for raw shellfish [oyster samples (85%) were contaminated with E. coli in the range of 3.0-4.6 x 10(4) MPN/g. One oyster sample with an acceptable level of fecal coliforms contained HAV GIB. E. coli was found in all HAV-positive oyster samples. The results suggest a significant presence of HAV and bacterial indicators of fecal contamination in raw oysters, which are a health risk for consumers and a source of gastrointestinal illness. Enteric viruses should also be tested to assess the microbiological quality of oysters.
Lipid analyses of fumigated vs irradiated raw and roasted almonds
International Nuclear Information System (INIS)
Uthman, R.S.; Toma, R.B.; Garcia, R.; Medora, N.P.; Cunningham, S.
1998-01-01
The purpose of this study was to compare the effects of propylene oxide (PO) and irradiation treatments on the lipid analyses of raw and roasted almonds. Eight kilograms each of raw and roasted almonds were divided into four batches (2 kg each). Three of the batches were subjected to PO treatment or irradiation treatment with a dose of 6, 10·5 kGy. The untreated batch served as control samples, they were taken from all the batches at three consecutive times during storage (day 0, 8 weeks and 16 weeks) and analysed for iodine number, peroxide value and 2-thiobarbituric acid number. Overall, irradiated almonds incurred a higher variation in lipid stability than PO tested almonds while roasted almonds incurred a higher variation than raw almonds
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
International Nuclear Information System (INIS)
Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor
2012-01-01
We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)
Wojciechowski, Karen L; Melilli, Caterina; Barbano, David M
2014-09-01
Our objectives were to determine if mixing and sampling of a raw milk sample at 4°C for determination of total bacteria count (TBC) and if incubation at 14°C for 18h and sampling for a preliminary incubation (PI) count influenced the accuracy of subsequent fat, protein, or lactose measurement by mid-infrared (IR) analysis of milk from the same sample container due to either nonrepresentative sampling or the presence of microbial metabolites produced by microbial growth in the milk from the incubation. Milks of 4 fat levels (2.2, 3, 4, and 5%) reflected the range of fat levels encountered in producer milks. If the portion of milk removed from a cold sample was not representative, then the effect on a milk component test would likely be larger as fat content increases. Within the milks at each fat level, 3 treatments were used: (1) 20 vials of the same milk sampled for testing TBC using a BactoScan FC and then used for a milk component test; (2) 20 vials for testing TBC plus PI count followed by component test; and (3) 20 vials to run for IR component test without a prior micro sampling and testing. This was repeated in 3 different weeks using a different batch of milk each week. No large effect on the accuracy of component milk testing [IR fat B (carbon hydrogen stretch) and fat A (carbonyl stretch)] due to the cold milk sample handling and mixing procedures used for TBC was detected, confirming the fact that the physical removal of milk from the vial by the BactoScan FC (Foss Electric, Hillerød, Denmark) was a representative portion of the milk. However, the representativeness of any other sampling procedure (manual or automated) of a cold milk sample before running milk component testing on the same container of milk should be demonstrated and verified periodically as a matter of routine laboratory quality assurance. Running TBC with a BactoScan FC first and then IR milk analysis after had a minimal effect on milk component tests by IR when milk bacteria counts
40 CFR 1065.150 - Continuous sampling.
2010-07-01
... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Continuous sampling. 1065.150 Section... ENGINE-TESTING PROCEDURES Equipment Specifications § 1065.150 Continuous sampling. You may use continuous sampling techniques for measurements that involve raw or dilute sampling. Make sure continuous sampling...
Energy Technology Data Exchange (ETDEWEB)
Park, Ji Young; Lim, Chung Sup [Radiation Biotechnology and Applied Radioiostope Science, University of Science and Technology, Daejeon (Korea, Republic of); Lim, Jong Myoung; Ji, Young Yong; Chung, Kun Ho; Lee, Wan No; Kang, Mun Ja [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jang, Byung Uck [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2016-12-15
As new legislation has come into force implementing radiation safety management for the use of naturally occurring radioactive materials (NORM), it is necessary to establish a rapid and accurate measurement technique. Measurement of {sup 238}U and {sup 232}Th using conventional methods encounter the most significant difficulties for pretreatment (e.g., purification, speciation, and dilution/enrichment) or require time-consuming processes. Therefore, in this study, the applicability of ED-XRF as a non-destructive and rapid screening method was validated for raw materials and by-product samples. A series of experiments was conducted to test the applicability for rapid screening of XRF measurement to determine activity of {sup 238}U and {sup 23{sup 2}}Th based on certified reference materials (e.g., soil, rock, phosphorus rock, bauxite, zircon, and coal ash) and NORM samples commercially used in Korea. Statistical methods were used to compare the analytical results of ED-XRF to those of certified values of certified reference materials (CRM) and inductively coupled plasma mass spectrometry (ICP-MS). Results of the XRF measurement for {sup 238}U and {sup 232}Th showed under 20% relative error and standard deviation. The results of the U-test were statistically significant except for the case of U in coal fly ash samples. In addition, analytical results of {sup 238}U and {sup 232}Th in the raw material and by-product samples using XRF and the analytical results of those using ICP-MS (R{sup 2}≥0.95) were consistent with each other. Thus, the analytical results rapidly derived using ED-XRF were fairly reliable. Based on the validation results, it can be concluded that the ED-XRF analysis may be applied to rapid screening of radioactivities ({sup 238}U and {sup 232}Th) in NORM samples.
Vahedi, M; Nasrolahei, M; Sharif, M; Mirabi, A M
2013-06-01
The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes by culture methods and biochemical tests. Data analysis was performed by SPSS software using Chi2 test and described in percentage. In the raw milk, contamination with E. coli, coliforms and Staphylococcus aureus was observed in 42 (42%), 36 (36%) and 22 (22%) of samples respectively, and the same for the pasteurized milk samples was 9 (9%), 2 (2%) and 2 (2%), respectively. Listeria monocytogenes was not detected in any sample. Presence of E. coli in the milk could be due to contamination with waste water and fecal materials. Considering the contamination of raw and pasteurized milk with E. coli and coliforms, sanitary practice during collecting and transporting, particularly in the summer season is recommended.
Comparison of Biochars Characteristics from Different Raw Materials
SUN Tao; ZHU Xin-ping; LI Dian-peng; GU Zhu-yu; ZHANG Jia-xi; JIA Hong-tao
2017-01-01
Biochar is the carbon-rich product from biomass under limited supply of oxygen. Biochar has been well recognized in enhancing terrestrial carbon sequestration and greenhouse gas mitigation as well as in improving soil fertility and plant productivity. To explore the differences of biochars produced from different raw materials, six biochar samples made from alfalfa straw, wheat straw, cotton straw, grape vines, sludge and lignite were selected as test material. Qualitative and quantitative an...
Biernacka, Beata; Dziki, Dariusz; Różyło, Renata; Wójcik, Monika; Miś, Antoni; Romankiewicz, Daria; Krzysiak, Zbigniew
2018-04-01
The quality of pasta can be evaluated by measuring the characteristics which encompass the most important quality parameters, such as colour, cooking properties and texture. The aim of the study was to suggest new indices which can be used to evaluate the quality of pasta. For the tests, 15 samples of spaghetti (produced from either semolina or common wheat flour) were used. The bending test was performed for the determination of the strength properties of raw pasta, while the pasta colour parameters were evaluated via the Commission Internationale de l'Eclairage system. The pasta cooking test included the evaluation of optimum cooking time, weight increase index and cooking loss. The samples of cooked spaghetti were cut, and the parameters describing pasta texture were determined. Statistical analysis showed significant correlations (α = 0.05) between colour parameters (lightness and redness) and pasta ash content (R = -0.90 and 0.84, respectively). The mechanical properties of raw pasta correlated positively with pasta density. The strongest correlation was found between pasta density and flexural strength. The destruction force for raw spaghetti during the bending test correlated significantly and positively with the cutting force of the cooked pasta. The obtained correlations can be helpful in pasta quality evaluation.
Directory of Open Access Journals (Sweden)
Lucia Zeleňáková
2016-01-01
Full Text Available The aim of this study was to test the reliability of commercial ELISA tests (RC-bovino within raw and heat treated cow milk detection in sheep milk and cheese in order to obtain a high-quality, reliable and economically beneficial method suitable for routine application in practice. These tests were subsequently used for quantification of cow milk in commercial "Bryndza". Raw sheep milk, cow milk and heat-treated cow milk (pasteurisation at 72 °C for 15 sec or at 85 °C for 3 sec were mixed in precisely defined proportions (0 - 100% cow milk in sheep milk. The milk mixtures were sampled to detect adulteration and subsequently cheese was made. By ELISA tests was possible to determine these amounts of raw cow milk in sheep milk: 0.5% (0.2%, 5 % (4.81%, 50% (42.08% and 75% (56.52%. The pasteurized samples in different combinations gave lower optical density responses than those prepared from raw milk (by approximately 60%. In context with the above mentioned, the relationship between the real and detected amount of cow milk (% in different production stages (milk, cheese using a regression analysis was examined. However, a lower reliability of the detection was indicated by R2 values, which ranged from 0.4058 (cheese to 0.5175 (milk. In practice this means that although individual percentage (% of cow milk in the sample can be detected, but in the unknown sample it can not be clearly confirm whether the cow milk was raw or heat-treated. In this context, the results can be inaccurate and may not correspond to the real situation. Within monitoring phase of this research, 9 samples of bryndza were analysed with the results of detected cow milk ranged from 11.56% to 14.3%. The obtained results confirm that the appropriate selection of ELISA tests can become an important factor in the setting of analytical capabilities for the detection of milk and cheese adulteration.
Eftekhari, Mohsen; Mosavari, Nader
2016-12-01
Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.
Tran, Ngoc Han; Hu, Jiangyong; Li, Jinhua; Ong, Say Leong
2014-01-01
There is no quantitative data on the occurrence of artificial sweeteners in the aquatic environment in Southeast Asian countries, particularly no information on their suitability as indicators of raw wastewater contamination on surface water and groundwater. This study provided the first quantitative information on the occurrence of artificial sweeteners in raw wastewater, surface water and groundwater in the urban catchment area in Singapore. Acesulfame, cyclamate, saccharin, and sucralose were ubiquitous in raw wastewater samples at concentrations in the range of ng/L-μg/L, while other sweeteners were not found or found only in a few of the raw wastewater samples. Residential and commercial effluents were demonstrated to be the two main sources of artificial sweeteners entering the municipal sewer systems. Relatively higher concentrations of the detected sweeteners were frequently found in surface waters at the sampling sites located in the residential/commercial areas. No significant difference in the concentrations of the detected sweeteners in surface water or groundwater was noted between wet and dry weather conditions (unpaired T-test, p> 0.05). Relatively higher concentrations and detection frequencies of acesulfame, cyclamate and saccharin in surface water samples were observed at the potentially impacted sampling sites, while these sweeteners were absent in most of the background surface water samples. Similarly, acesulfame, cyclamate, and saccharin were found in most groundwater samples at the monitoring well (GW6), which is located close to known leaking sewer segment; whereas these were absent in the background monitoring well, which is located in the catchment with no known wastewater sources. Taken together, the results suggest that acesulfame, cyclamate, and saccharin can be used as potential indicators of raw wastewater contamination in surface water and groundwater. Copyright © 2013 Elsevier Ltd. All rights reserved.
Evaluation of sampling methods for toxicological testing of indoor air particulate matter.
Tirkkonen, Jenni; Täubel, Martin; Hirvonen, Maija-Riitta; Leppänen, Hanna; Lindsley, William G; Chen, Bean T; Hyvärinen, Anne; Huttunen, Kati
2016-09-01
There is a need for toxicity tests capable of recognizing indoor environments with compromised air quality, especially in the context of moisture damage. One of the key issues is sampling, which should both provide meaningful material for analyses and fulfill requirements imposed by practitioners using toxicity tests for health risk assessment. We aimed to evaluate different existing methods of sampling indoor particulate matter (PM) to develop a suitable sampling strategy for a toxicological assay. During three sampling campaigns in moisture-damaged and non-damaged school buildings, we evaluated one passive and three active sampling methods: the Settled Dust Box (SDB), the Button Aerosol Sampler, the Harvard Impactor and the National Institute for Occupational Safety and Health (NIOSH) Bioaerosol Cyclone Sampler. Mouse RAW264.7 macrophages were exposed to particle suspensions and cell metabolic activity (CMA), production of nitric oxide (NO) and tumor necrosis factor (TNFα) were determined after 24 h of exposure. The repeatability of the toxicological analyses was very good for all tested sampler types. Variability within the schools was found to be high especially between different classrooms in the moisture-damaged school. Passively collected settled dust and PM collected actively with the NIOSH Sampler (Stage 1) caused a clear response in exposed cells. The results suggested the higher relative immunotoxicological activity of dust from the moisture-damaged school. The NIOSH Sampler is a promising candidate for the collection of size-fractionated PM to be used in toxicity testing. The applicability of such sampling strategy in grading moisture damage severity in buildings needs to be developed further in a larger cohort of buildings.
Directory of Open Access Journals (Sweden)
Sudhanthirakodi Sudhanthiramani
2015-04-01
Full Text Available Aim: The study was carried out with the aim to identify the suitability of the milk for consumer use with special reference to Staphylococcus aureus from milk samples collected from various local vendors and determine the antibiotic susceptibility pattern of those positive isolates. Materials and Methods: A total of 110 milk samples were collected from the local milk vendors in and around Tirupathi region of India. All the samples were enriched with buffered peptone water in 9:1 ratio and the then inoculated on baird parker agar medium with added 2% egg yolk tellurite emulsion as selective medium for S.aureus and confirmed with mannitol salt agar, Gram’s staining and biochemical tests. The typical cultural characters with coagulase-positive samples were taken as positive samples the positive samples were tested for antibiotic susceptibility with 10 different antibiotics by employing disc diffusion method. Results: Prevalence of coagulase-positive S. aureus was 39.09% (43/110 from the milk samples. The antibiotic susceptibility test of positive isolates showed high resistant toward penicillin G 37/43 (86.04% and ampicillin 32/43 (74.42%, and also showed resistant to methicillin 6/43 (13.95%, cephalothin 6/43 (13.95%, tetracycline 6/43 (13.95%, ciprofloxacin 4/43 (9.30%, enrofloxacin 3/43 (6.97%, cefoxitin 2/43 (4.65%, gentamicin 2/43 (4.65%, and co-trimoxazole 2/43 (4.65%. Many individual isolates showed resistant against two or more antibiotics in our study. Conclusion: The above study results show that the milk samples collected from local vendor having S. aureus, which can induce disease condition as well as antibiotic resistant to the humans particularly young children and old age peoples by means of consumption of raw milk and its products. This is the public health issue, which needs to be solved by educating the local vendors regarding health problems related to unhygienic milk supply and make the awareness among the consumers about this
Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China
Directory of Open Access Journals (Sweden)
Li Aijun
2016-01-01
Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.
Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran
Directory of Open Access Journals (Sweden)
Ehsan Shamloo
2015-01-01
Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.
Iaconelli, M; Muscillo, M; Della Libera, S; Fratini, M; Meucci, L; De Ceglia, M; Giacosa, D; La Rosa, G
2017-03-01
Human enteric viruses are a major cause of waterborne diseases, and can be transmitted by contaminated water of all kinds, including drinking and recreational water. The objectives of the present study were to assess the occurrence of enteric viruses (enterovirus, norovirus, adenovirus, hepatitis A and E virus) in raw and treated wastewaters, in rivers receiving wastewater discharges, and in drinking waters. Wastewater treatment plants' (WWTP) pathogen removal efficiencies by adenovirus quantitative real-time PCR and the presence of infectious enterovirus, by cell culture assays, in treated wastewaters and in surface waters were also evaluated. A total of 90 water samples were collected: raw and treated wastewaters (treated effluents and ultrafiltered water reused for industrial purposes), water from two rivers receiving treated discharges, and drinking water. Nested PCR assays were used for the identification of viral DNA/RNA, followed by direct amplicon sequencing. All raw sewage samples (21/21), 61.9 % of treated wastewater samples (13/21), and 25 % of ultrafiltered water samples (3/12) were contaminated with at least one viral family. Multiple virus families and genera were frequently detected. Mean positive PCRs per sample decreased significantly from raw to treated sewage and to ultrafiltered waters. Moreover, quantitative adenovirus data showed a reduction in excess of 99 % in viral genome copies following wastewater treatment. In surface waters, 78.6 % (22/28) of samples tested positive for one or more viruses by molecular methods, but enterovirus-specific infectivity assays did not reveal infectious particles in these samples. All drinking water samples tested negative for all viruses, demonstrating the effectiveness of treatment in removing viral pathogens from drinking water. Integrated strategies to manage water from all sources are crucial to ensure water quality.
Determination Of Work Indexes Of Basic Ceramic Raw Materials
İPEK, Halil; UÇBAŞ, Yaşar
2017-01-01
In this study, the grindability of basic ceramic raw materials have been investigated by using Bond grindability test and the results have been compared. Bond grindability test results show that work indexes of raw materials are dependent on their hardnesses.
COMPOSITIONAL EVALUATION OF RAW AND PROCESSED HARMS (Brachystegia eurycoma SEED FLOUR
Directory of Open Access Journals (Sweden)
M.O Aremu
2014-12-01
Full Text Available Brachystegia eurycoma is predominantly grown in the eastern region of Nigeria. Its seed is used in food majorly as a soup condiment, flavouring agent and soup thickener. The proximate, mineral and amino acid compositions were determined on raw and processed seeds (boiled, fermented and roasted using standard analytical techniques. The processing methods showed deviations in nutrients from the raw seeds. The crude protein was reduced by the processing methods with exception of roasting method. Crude fat was reduced in all the processing methods in this order: Raw > fermented > roasted > boiled samples. All the processing methods enhanced calcium content in this order: Raw < boiled < fermented < roasted samples. Boiling and fermenting reduced the content of magnesium by 72.6 and 30.2%, respectively while boiling, fermenting and roasting increased potassium content by 124.5, 12.2 and 120.4%, respectively. Generally, all the samples were found to be a good source of essential minerals and harmful heavy metals such as lead, chromium, arsenic and cadmium were not at detectable range of atomic absorption spectrophotometer. The amino acid profile revealed that amino acids in fermented sample were better concentrated than that of raw and other processed samples. The total essential amino acids (TEAA ranged from 28.63 g/100g crude protein in roasted sample to 34.79 g/100g crude protein in fermented sample. The limiting amino acid (LAA for all the samples was Met + Cys (TSAA.
40 CFR 92.123 - Test procedure; general requirements.
2010-07-01
... the test. Auxiliary fan(s) may be used to maintain engine cooling during operation on the dynamometer... smoke. (1) In the raw exhaust sampling procedure, sample is collected directly from the exhaust stream... of another raw exhaust sample. The fuel flow rate for each throttle setting is measured. (2) For...
Determination of Bacterial Pathogen in Foods for Export and their Raw Material
International Nuclear Information System (INIS)
Marambio, E.; Cordano, A.M.; Insunza, M.; Fernández, M.; Astorga, J.
2005-01-01
Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)
Determination of Bacterial Pathogen in Foods for Export and their Raw Material
Energy Technology Data Exchange (ETDEWEB)
Marambio, E.; Cordano, A. M.; Insunza, M.; Fernández, M.; Astorga, J. [Sección Microbiología de Alimentos, Instituto de Salud Pública de Chile (Chile)
2005-01-15
Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)
Radiation hygienization of raw sewage sludge
International Nuclear Information System (INIS)
Shah, M.R.; Lavale, D.S.; Rawat, P.; Benny, P.G.; Sharma, A.K.; Dey, G.R.; Bhave, V.
2001-01-01
'Radiation treatment of municipal sewage sludge can achieve resource conservation and recovery objectives. The liquid sludge irradiator of Sludge Hygienization Research Irradiator at Baroda (India) was operated for generating data on treatment of raw sludge containing 3-4 % solids. The plant system was modified for irradiating raw sludge without affecting basic irradiator initially designed to treat digested sludge. Hourly samples were analysed for estimation of disinfection dose requirement. Sand separated from the sludge was used as in-situ dosimeter by making use of its thermoluminescence property. Investigations are being carried out for regrowth of Total Coliforms in the sludge samples from this irradiator. Possibility of inadequate treatment due to geometric configuration of irradiator is being checked. (author)
Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A
2014-01-01
In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.
Strontium-90 and cesium-137 in raw milk
International Nuclear Information System (INIS)
1979-01-01
Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)
Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O
2016-09-24
The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.
Directory of Open Access Journals (Sweden)
Pınar Şanlıbaba
2018-02-01
Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.
International Nuclear Information System (INIS)
Mello, Roberta Monteiro de
2006-01-01
In order to decrease environmental impact, caused by mud discarding and clay extraction in the ceramic industry, it was used residual mud from marble and granite companies for structural ceramic. Samples were collected in twelve different marble companies located at the metropolitan region of Sao Paulo. However, only four samples were selected, based on its different characteristics. Clay stone was the raw material chosen to prepare the structural ceramic, considering its high use in this segment. Samples and clay stone were both analysed by the following procedures: granulometric analysis, x-rays fluorescent chemical analysis and x-rays diffraction mineralogical analysis, besides, tests in the samples were conducted following NBR 10004 standards. Once raw materials were characterized, the plasticity test was conducted. Test specimen were molded with different levels of mud, then burned and submitted to technological tests, such as: mechanical resistance, water absorption, porosity, specific gravity and retraction, material dilation before burning process and scanning electron microscopy. The final results have shown the viability of using this kind of mud, and pointed some advantages on its usage, but taking in consideration some previous conditions to be adopted. (author)
Identification of Particles in Parenteral Drug Raw Materials.
Lee, Kathryn; Lankers, Markus; Valet, Oliver
2018-04-18
Particles in drug products are not good and are therefore regulated. These particles can come from the very beginning of the manufacturing process, from the raw materials. To prevent particles, it is important to understand what they are and where they come from so the raw material quality, processing, and shipping can be improved. Thus, it is important to correctly identify particles seen in raw materials. Raw materials need to be of a certain quality with respect to physical and chemical composition, and need to have no contaminants in the form of particles which could contaminate the product or indicate the raw materials are not pure enough to make a good quality product. Particles are often seen when handling raw materials due to color, size, or shape characteristics different from those in the raw materials. Particles may appear to the eye to be very different things than they actually are, so microscope, chemical, and elemental analyses are required for accuracy in proper identification. This paper shows how using three different spectroscopy tools correctly and together can be used to identify particles from extrinsic, intrinsic, and inherent particles. Sources of materials can be humans and the environment (extrinsic), from within the process (intrinsic), and part of the formulation (inherent). Microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and IR spectroscopy are excellent tools for identifying particles because they are fast and accurate techniques needing minimal sample preparation that can provide chemical composition as well as images that can be used for identification. The micro analysis capabilities allow for easy analysis of different portions of samples so multiple components can be identified and sample preparation can be reduced. Using just one of these techniques may not be sufficient to give adequate identification results so that the source of contamination can be adequately identified. The
Douglas, David; Banaszewski, Katie; Juskelis, Rima; Al-Taher, Fadwa; Chen, Yang; Cappozzo, Jack; McRobbie, Lindsay; Salter, Robert S
2012-07-01
β-Lactam antibiotics are the most commonly used drugs on dairy farms. β-Lactam residues in milk are kept out of the human milk supply with good agricultural practices and mandatory truck screening performed by the dairy industry under Appendix N of the Pasteurized Milk Ordinance. Flunixin, a nonsteroidal and anti-inflammatory drug, appears in dairy cattle tissue residues with a frequency similar to the occurrence of penicillin G. This creates concern that flunixin residues could be in milk and would go undetected under current milk screening programs. A single test that combines mandatory β-lactam screening with voluntary flunixin screening is an economical approach for monitoring and controlling for potential flunixin or 5-hydroxyflunixin, the primary flunixin metabolite marker in milk. The objective of this study was to validate a β-lactam and flunixin rapid lateral flow test (LFT) and compare the results obtained with a liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS) method for the simultaneous determination of flunixin and 5-hydroxyflunixin in raw milk with a limit of detection of , 1 ppb, equivalent to 1 ng/ml. Using the LFT, three combined manufactured lots of test strips detected penicillin G at 2.0 ppb, ampicillin at 6.8 ppb, amoxicillin at 5.9 ppb, cephapirin at 13.4 ppb, ceftiofur (total metabolites) at 63 ppb, and 5-hydroxyflunixin at 1.9 ppb at least 90% of the time with 95% confidence. The LFT also detected incurred flunixin milk samples that were analyzed with the LC-MS/MS and diluted to tolerance in raw milk. The detection levels for the LFT are lower than the U.S. safe levels or tolerances and qualify the test to be used in compliance with U.S. milk screening programs.
Thorium and Uranium in the Rock Raw Materials Used For the Production of Building Materials
Pękala, Agnieszka
2017-10-01
Thorium and uranium are constant components of all soils and most minerals thereby rock raw materials. They belong to the particularly dangerous elements because of their natural radioactivity. Evaluation of the content of the radioactive elements in the rock raw materials seems to be necessary in the early stage of the raw material evaluation. The rock formations operated from deposits often are accumulated in landfills and slag heaps where the concentration of the radioactive elements can be many times higher than under natural conditions. In addition, this phenomenon may refer to buildings where rock raw materials are often the main components of the construction materials. The global control system of construction products draws particular attention to the elimination of used construction products containing excessive quantities of the natural radioactive elements. In the presented study were determined the content of thorium and uranium in rock raw materials coming from the Bełachatów lignite deposit. The Bełchatów lignite deposit extracts mainly lignite and secondary numerous accompanying minerals with the raw material importance. In the course of the field works within the framework of the carried out work has been tested 92 samples of rocks of varied petrographic composition. There were carried out analyses of the content of the radioactive elements for 50 samples of limestone of the Jurassic age, 18 samples of kaolinite clays, and 24 samples of siliceous raw materials, represented by opoka-rocks, diatomites, gaizes and clastic rocks. The measurement of content of the natural radioactive elements thorium and uranium based on measuring the frequency counts of gamma quantum, recorded separately in measuring channels. At the same time performed measurements on volume patterns radioactive: thorium and uranium. The studies were carried out in Mazar spectrometer on the powdered material. Standardly performed ten measuring cycles, after which were calculated
Occurrence of perfluorinated compounds in raw water from New Jersey public drinking water systems.
Post, Gloria B; Louis, Judith B; Lippincott, R Lee; Procopio, Nicholas A
2013-01-01
Perfluorooctanoic acid (PFOA) and perfluorooctane sulfonic acid (PFOS) were previously detected (≥ 4 ng/L) in 65% and 30%, respectively, of 23 New Jersey (NJ) public drinking water systems (PWS) sampled in 2006. We now report on a 2009 study of the occurrence of PFOA, PFOS, and eight other perfluorinated compounds (PFCs) in raw water samples from 30 intakes (18 groundwater and 12 surface water) from 29 additional NJ PWS. Between 1 and 8 PFCs were detected (≥ 5 ng/L) in 21 (70%) of 30 PWS samples at total PFC concentrations of 5-174 ng/L. Although PFOA was the most commonly detected PFC (57% of samples) and was found at the highest maximum concentration (100 ng/L), some of the higher levels of other PFCs were at sites with little or no PFOA. Perfluorononanoic acid was detected more frequently (30%) and at higher concentrations (up to 96 ng/L) than in raw or finished drinking water elsewhere, and it was found at several sites as the sole or predominant PFC, a pattern not reported in other drinking water studies. PFOS, perfluoropentanoic acid, and perfluorohexanoic acid were each detected in more than 20% of samples, while perfluoroheptanoic acid, perfluorobutane sulfonic acid, and perfluorohexane sulfonic acid were detected less frequently. Perfluorobutanoic acid was found only once (6 ng/L), and perfluorodecanoic acid was not detected. Total PFCs were highest in two reservoirs near an airfield; these were also the only sites with total perfluorosulfonic acids higher than total perfluorocarboxylic acids (PFCAs). PFC levels in raw and finished water from the same source were similar at those sites where both were tested. Five wells of two additional NJ PWS known to be contaminated with PFOA were also each sampled 4-9 times in 2010-13 for nine of the same PFCs. Total PFCs (almost completely PFCAs) at one of these PWS located near an industrial source of PFCs were higher than in any other PWS tested (up to 330 ng/L). These results show that multiple PFCs are
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Xiao, Sanhua; Lv, Xuemin; Zeng, Yifan; Jin, Tao; Luo, Lan; Zhang, Binbin; Zhang, Gang; Wang, Yanhui; Feng, Lin; Zhu, Yuan; Tang, Fei
2017-10-01
Public concern was aroused by frequently reported water pollution incidents in Taihu Lake and the Yangtze River. The pollution also caught and sustained the attention of the scientific community. From 2010 to 2016, raw water and drinking water samples were continually collected at Waterworks A and B (Taihu Lake) and Waterworks C (Yangtze River). The non-volatile organic pollutants in the water samples were extracted by solid phase extraction. Ames tests and yeast estrogen screen (YES) assays were conducted to evaluate the respective mutagenic and estrogenic effects. Water samples from the Yangtze River-based Waterworks C possessed higher mutagenicity than those from Taihu Lake-based Waterworks A (P<0.001) and Waterworks B (P = 0.026). Water treatment enhanced the direct mutagenicity (P = 0.022), and weakened the estrogenicity of the raw water (P<0.001) with a median removal rate of 100%. In fact, very few of the finished samples showed estrogenic activity. Raw water samples from Waterworks A showed weaker estrogenicity than those from Waterworks B (P = 0.034) and Waterworks C (P = 0.006). In summary, mutagenic effects in drinking water and estrogenic effects in raw water merited sustained attention. The Yangtze River was more seriously polluted by mutagenic and estrogenic chemicals than Taihu Lake was. Copyright © 2017 Elsevier Ltd. All rights reserved.
McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M
2015-12-01
This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively
Directory of Open Access Journals (Sweden)
Manzoor Khan
2014-01-01
Full Text Available This paper presents new classes of estimators in estimating the finite population mean under double sampling in the presence of nonresponse when using information on fractional raw moments. The expressions for mean square error of the proposed classes of estimators are derived up to the first degree of approximation. It is shown that a proposed class of estimators performs better than the usual mean estimator, ratio type estimators, and Singh and Kumar (2009 estimator. An empirical study is carried out to demonstrate the performance of a proposed class of estimators.
Survey of Veterinary Drug Residues in Raw Milk in Hebei Province, China.
Han, Rong-Wei; Yu, Zhong-Na; Zhen, Tian-Yuan; Wang, Jun
2017-10-17
The objective of this study was to investigate the occurrence of veterinary drug residues in raw milk from Hebei, the second-largest dairy production province in the People's Republic of China. A total of 192 raw milk samples were collected from 64 milk stations in seven districts. Twenty-eight veterinary drug residues were analyzed by ultraperformance liquid chromatography with tandem mass spectrometry based on a China National Standard. Raw milk samples with multiple residues of veterinary drugs were not found in the present study. Residues of four veterinary drugs, penicillin G, sulfacetamide, trimethoprim, and lincomycin, were detected in 12 (6.25%) raw milk samples, with detection ratios of 1.04, 0.52, 3.13, and 1.56%, respectively. All veterinary drug residues detected were under the maximum residue levels as regulated by China, the European Union, the United States, and the Codex Alimentarius Commission. In general, raw milk from Hebei province was considered relatively safe for human consumption because of the low prevalence of veterinary drug residues. However, stringent control measurements for veterinary drug residues in raw milk are required because some veterinary drugs were detected in milk from some areas of Hebei province.
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Directory of Open Access Journals (Sweden)
Tatiane Vendramin
2014-09-01
Full Text Available Milkborne transmission of Shiga toxin- producing Escherichia coli (STEC has raised considerable concern due to recent outbreaks worldwide and poses a threat to public health. The aim of this study was to develop a sensitive and specific multiplex PCR assay to detect the presence of STEC in bovine raw milk. To identify E. coli (ATCC 25922 contamination, the gene uspA was used, and PCR sensitivity and specificity were accessed by testing diluted samples ranging from 2 to 2.0 × 10(6 CFU/mL. To detect STEC, the stx1 and stx2 genes were selected as targets. After reaction standardization, the multiplex assay was tested in raw milk collected from 101 cows on dairy farms. PCR assay for E. coli detection had a specificity of 100% and sensitivity of 79% (P<0.0001, with a lower detection limit of 2 CFU/mL. Multiplex PCR assay had 100% sensitivity for E. coli positive raw milk samples, and 31.1% were contaminated with STEC, 28.3% of stx2, and 1.9% of stx1. The multiplex PCR assay described in the present study can be employed to identify and screen E. coli harboring stx1 and stx2 genes in raw milk on dairy farms and in industries.
Ahmed, Imtiaz; Hughes, Denise; Jenson, Ian; Karalis, Tass
2009-03-01
Testing of beef destined for use in ground beef products for the presence of Escherichia coli O157:H7 has become an important cornerstone of control and verification activities within many meat supply chains. Validation of the ability of methods to detect low levels of E. coli O157:H7 is critical to confidence in test systems. Many rapid methods have been validated against standard cultural methods for 25-g samples. In this study, a number of previously validated enrichment broths and commercially available test kits were validated for the detection of low numbers of E. coli O157:H7 in 375-g samples of raw ground beef component matrices using 1 liter of enrichment broth (large-sample:low-volume enrichment protocol). Standard AOAC International methods for 25-g samples in 225 ml of enrichment broth, using the same media, incubation conditions, and test kits, were used as reference methods. No significant differences were detected in the ability of any of the tests to detect low levels of E. coli O157:H7 in samples of raw ground beef components when enriched according to standard or large-sample:low-volume enrichment protocols. The use of large-sample:low-volume enrichment protocols provides cost savings for media and logistical benefits when handling and incubating large numbers of samples.
Directory of Open Access Journals (Sweden)
Ali Dabiri
2016-03-01
Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.
40 CFR 1065.230 - Raw exhaust flow meter.
2010-07-01
... the following cases, you may use a raw exhaust flow meter signal that does not give the actual value... dew and pressure, p total at the flow meter inlet. Use these values in emission calculations according... CONTROLS ENGINE-TESTING PROCEDURES Measurement Instruments Flow-Related Measurements § 1065.230 Raw exhaust...
Raw milk consumption and health
Directory of Open Access Journals (Sweden)
Popović-Vranješ Anka
2015-01-01
Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095
Matali, Sharmeela; Rahman, Norazah Abdul; Idris, Siti Shawaliah; Yaacob, Nurhafizah
2017-12-01
Torrefaction, also known as mild pyrolysis, is proven to convert raw biomass into a value-added energy commodity particularly for application in combustion and co-firing systems with improved storage and handling properties. This paper aims to compare the characteristics of Malaysian bituminous coal i.e. Silantek coal with raw and torrefied biomass pellet originated from oil palm frond and fast growing tree species, Leucaena Leucocephala. Biomass samples were initially torrefied at 300 °C for 60 minutes. Resulting torrefied biomass pellets were analysed using a number of standard fuel characterisation analyses i.e. elemental analysis, proximate analysis and calorific content (high heating values) experiments. Investigations on combustion characteristics via dynamic thermogravimetric analysis (TGA), grindability and moisture uptake tests were also performed on the torrefied biomass pellets. Better quality bio-chars were produced as compared to its raw forms and with optimal process conditions, torrefaction may potentially produces a solid fuel with combustion reactivity and porosity equivalent to raw biomass while having compatible energy density and grindability to coal.
Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V
2011-07-01
Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Paula Cristina Galati
2013-01-01
Full Text Available OBJECTIVE: This study aimed to analyze and compare the microbiological profile and vitamin C content of raw and cooked foods destined for neutropenic inpatients. METHODS: Three vegetables and nine fruits, raw and boiled, washed and sanitized were examined. Heat-tolerant coliforms and coagulase-positive staphylococci were counted and the presence of Salmonella spp was investigated. The vitamin C content was analyzed by a colorimetric reaction. The Statistical Package for Social Sciences (SPSS software was used for statistical analysis and the nonparametric Wilcoxon test was used to compare the mean vitamin C values of the cooked and raw foods. The Spearman correlation test was applied to determine the associations between the parameters evaluated RESULTS: Salmonella spp was absent in all samples and the populations of coagulase-positive staphylococci and heat-tolerant coliforms were below the minimum detectable limits of the methods employed (< 100 colony forming units (CFU/g and < 3 most probable number (MPN/g, respectively. There was a significant loss of vitamin C in the cooked foods, 38.9% on average, compared to the raw foods, a loss that was positively correlated with cooking time. CONCLUSION: The fresh fruits and vegetables properly sanitized in this study had a microbiological profile consistent with that required by Brazilian law. Furthermore, the nutritional value of the neutropenic diet is diminished, at least in terms of the vitamin C content.
Photoshop CS3 RAW Transforming your RAW data into works of art
Aaland, Mikkel
2008-01-01
Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n
Jamali, Hossein; Paydar, Mohammadjavad; Radmehr, Behrad; Ismail, Salmah
2015-02-01
The aims of this study were to investigate the prevalence and to characterize and determine the antibiotic resistance of Yersinia spp. isolates from raw milk. From September 2008 to August 2010, 446 raw milk samples were obtained from farm bulk milk tanks in Varamin, Iran. Yersinia spp. were detected in 29 (6.5%) samples, out of which 23 (79.3%), 5 (17.2%), and 1 (3.4%) were isolated from cow, sheep, and goat raw milk, respectively. The most common species isolated was Yersinia enterocolitica (65.5%), followed by Yersinia frederiksenii (31%), and Yersinia kristensenii (3.4%). Of the 19 Y. enterocolitica isolates, 14 (73.7%) were grouped into bioserotype 1A/O:9, 4 (21.1%) belonged to bioserotype 1B:O8, 1 (5.3%) belonged to bioserotype 4/O:3, and 1 isolate (biotype 1A) was not typable. All the isolates of biotypes 1B and 4harbored both the ystA and ail genes. However, all the isolates of biotype 1A were only positive for the ystB gene. The tested Yersinia spp. showed the highest percentages of resistance to tetracycline (48.3%), followed by ciprofloxacin and cephalothin (each 17.2%), ampicillin (13.8%), streptomycin (6.9%), and amoxicillin and nalidixic acid (each 3.4%). All of the tested isolates demonstrated significant sensitivity to gentamicin and chloramphenicol. Recovery of potentially pathogenic Y. enterocolitica from raw milk indicates high risks of yersiniosis associated with consumption of raw milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar
Directory of Open Access Journals (Sweden)
A.R Barami
2012-02-01
Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p
QUALITY AND SAFETY OF RAW COW’S MILK IN SLOVAKIA IN 2011
Directory of Open Access Journals (Sweden)
Jozef Čurlej
2012-04-01
Full Text Available The quality and safety of raw cow’s milk is very important for dairy companies and consumers of milk products. Due to the methods of production, it is impossible to completely eliminate contamination of milk with microorganisms, therefore the microbial content of milk is a major feature in determining its quality. Other important factors to consider include somatic cells count, veterinary drug residues, milk composition and freezing point. Somatic cells represent the udder health and can be used for monitoring of subclinical mastitis. A high level of somatic cells can increase proteolysis in milk which affects technological processes. Veterinary drugs administered to cows may lead to residues in the milk which are harmful to humans. The content of fat, protein and solids-non-fat are the main indicators used by dairies for technological purposes. In this article we discuss the quality and safety of raw cow’s milk in Slovakia during 2011. We found that 73.53% of samples tested for somatic cell count, and 84.54% of samples tested for total bacterial count, met the European Union legislation limits. We found the largest decrease in fat and protein content was during the summer period and the largest increase was in the winter period. We found that 92.14 %, 98.7% and 91.38% of samples met the limit presented in STN 570529:1999 for fat content, protein content and freezing point respectively. The percentage of drug positive samples was 0.087%.doi:10.5219/189
ISMRM Raw data format: A proposed standard for MRI raw datasets
DEFF Research Database (Denmark)
Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas
2016-01-01
programming languages (C++, MATLAB, Python). Results Images were obtained by reconstructing the raw data from all vendors. The source code, raw data, and images comprising this work are shared online, serving as an example of an image reconstruction project following a paradigm of reproducible research......Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB......, and Python. Converters for Bruker, General Electric, Philips, and Siemens proprietary file formats were implemented in C++. Raw data were collected using magnetic resonance imaging scanners from four vendors, converted to ISMRM Raw Data format, and reconstructed using software implemented in three...
Andrews, Philip
2007-01-01
One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl
Stability of vitamin C in frozen raw fruit and vegetable homogenates
Retention of vitamin C in homogenized raw fruits and vegetables stored under laboratory conditions prior to analysis was investigated. Raw collard greens, clementines, and potatoes were chosen, to be representative of food matrices to be sampled in USDA’s National Food and Nutrient Analysis Program...
Heavy metal and pesticide content in commonly prescribed individual raw Chinese Herbal Medicines
Energy Technology Data Exchange (ETDEWEB)
Harris, Eric S.J., E-mail: eric.sj.harris@gmail.com [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Cao, Shugeng [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Littlefield, Bruce A. [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Craycroft, Jane A.; Scholten, Robert [Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Kaptchuk, Ted [Osher Research Center, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 (United States); Department of Medicine, Division of General Internal Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215 (United States); Fu, Yanling [International Cooperation Center, Beijing University of Chinese Medicine, 11 Bai San Huan Dong Lu, Chao Yang District, Beijing 100029 (China); Wang, Wenquan; Liu, Yong [School of Chinese Pharmacy, Beijing University of Chinese Medicine, No. 6 Wangjing Zhong Huan Nan Lu, Chaoyang District, Beijing 100102 (China); Chen, Hubiao; Zhao, Zhongzhen [School of Chinese Medicine, Hong Kong Baptist University, 7 Baptist University Road, Kowloon Tong, Hong Kong Special Administrative Region (China); Clardy, Jon [Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115 (United States); Woolf, Alan D. [Children' s Hospital Boston, 300 Longwood Avenue and Department of Pediatrics, Harvard Medical School, Boston, MA 02118 (United States); and others
2011-09-15
Heavy metal and pesticide contamination has previously been reported in Chinese Herbal Medicines (CHMs), in some cases at potentially toxic levels. This study was conducted to determine general patterns and toxicological significance of heavy metal and pesticide contamination in a broad sample of raw CHMs. Three-hundred-thirty-four samples representing 126 species of CHMs were collected throughout China and examined for arsenic, cadmium, chromium, lead, and mercury. Of the total, 294 samples representing 112 species were also tested for 162 pesticides. At least 1 metal was detected in all 334 samples (100%) and 115 samples (34%) had detectable levels of all metals. Forty-two different pesticides were detected in 108 samples (36.7%), with 1 to 9 pesticides per sample. Contaminant levels were compared to toxicological reference values in the context of different exposure scenarios. According to a likely scenario of CHM consumption, only 3 samples (1%) with heavy metals and 14 samples (5%) with pesticides were found with concentrations that could contribute to elevated background levels of contaminant exposure. According to the most conservative scenario of CHM consumption, 231 samples (69%) with heavy metals and 81 samples (28%) with pesticides had contaminants that could contribute to elevated levels of exposure. Wild collected plants had higher contaminant levels than cultivated samples. Cadmium, chromium, lead, and chlorpyrifos contamination showed weak correlations with geographic location. Based on our assumptions of the likely mode of consumption of raw CHMs, the vast majority (95%) of the 334 samples in this study contained levels of heavy metals or pesticides that would be of negligible concern. However, given the number of samples with detectable contaminants and the range between the more likely and more conservative scenarios of contaminant exposure, more research and monitoring of heavy metals (especially cadmium and chromium) and pesticide residues
Heavy metal and pesticide content in commonly prescribed individual raw Chinese Herbal Medicines
International Nuclear Information System (INIS)
Harris, Eric S.J.; Cao, Shugeng; Littlefield, Bruce A.; Craycroft, Jane A.; Scholten, Robert; Kaptchuk, Ted; Fu, Yanling; Wang, Wenquan; Liu, Yong; Chen, Hubiao; Zhao, Zhongzhen; Clardy, Jon; Woolf, Alan D.
2011-01-01
Heavy metal and pesticide contamination has previously been reported in Chinese Herbal Medicines (CHMs), in some cases at potentially toxic levels. This study was conducted to determine general patterns and toxicological significance of heavy metal and pesticide contamination in a broad sample of raw CHMs. Three-hundred-thirty-four samples representing 126 species of CHMs were collected throughout China and examined for arsenic, cadmium, chromium, lead, and mercury. Of the total, 294 samples representing 112 species were also tested for 162 pesticides. At least 1 metal was detected in all 334 samples (100%) and 115 samples (34%) had detectable levels of all metals. Forty-two different pesticides were detected in 108 samples (36.7%), with 1 to 9 pesticides per sample. Contaminant levels were compared to toxicological reference values in the context of different exposure scenarios. According to a likely scenario of CHM consumption, only 3 samples (1%) with heavy metals and 14 samples (5%) with pesticides were found with concentrations that could contribute to elevated background levels of contaminant exposure. According to the most conservative scenario of CHM consumption, 231 samples (69%) with heavy metals and 81 samples (28%) with pesticides had contaminants that could contribute to elevated levels of exposure. Wild collected plants had higher contaminant levels than cultivated samples. Cadmium, chromium, lead, and chlorpyrifos contamination showed weak correlations with geographic location. Based on our assumptions of the likely mode of consumption of raw CHMs, the vast majority (95%) of the 334 samples in this study contained levels of heavy metals or pesticides that would be of negligible concern. However, given the number of samples with detectable contaminants and the range between the more likely and more conservative scenarios of contaminant exposure, more research and monitoring of heavy metals (especially cadmium and chromium) and pesticide residues
RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION
Directory of Open Access Journals (Sweden)
S. Gallina
2010-06-01
Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.
Artificial neural network as the tool in prediction rheological features of raw minced meat.
Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta
2012-01-01
The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.
Directory of Open Access Journals (Sweden)
Liliana Tudoreanu
2013-11-01
Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio
Katsioti, M; Tsakiridis, P E; Leonardou-Agatzini, S; Oustadakis, P
2006-04-17
The aim of the present research work was to investigate the possibility of adding a jarosite-alunite chemical precipitate, a waste product of a new hydrometallurgical process developed to treat economically low-grade nickel oxides ores, in the raw meal for the production of sulfoaluminate cement clinker. For that reason, two samples of raw meals were prepared, one contained 20% gypsum, as a reference sample ((SAC)Ref) and another with 11.31% jarosite-alunite precipitate ((SAC)J/A). Both raw meals were sintered at 1300 degrees C. The results of chemical and mineralogical analyses as well as the microscopic examination showed that the use of the jarosite-alunite precipitate did not affect the mineralogical characteristics of the so produced sulfoaluminate cement clinker and there was confirmed the formation of the sulfoaluminate phase (C4A3S), the most typical phase of this cement type. Furthermore, both clinkers were tested by determining the grindability, setting time, compressive strength and expansibility. The hydration products were examined by XRD analysis at 2, 7, 28 and 90 days. The results of the physico-mechanical tests showed that the addition of jarosite-alunite precipitate did not negatively affect the quality of the produced cement.
Directory of Open Access Journals (Sweden)
Danuser Jürg
2003-12-01
Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other
Rheological behavior of raw natural rubber coagulated by microorganisms
Directory of Open Access Journals (Sweden)
Zhifen Wang
2014-01-01
Full Text Available Tests of the strain sweep, frequency sweep and stress relaxation for raw natural rubber coagulated by microorganisms (NR-m and raw natural rubber coagulated by acid (NR-a were carried out with the use of a rubber process analyzer (RPA. The results showed that the storage torque, complex viscosity of NR-m were higher than those of NR-a while the loss factor was lower. The effect of temperature on viscosity of raw NR was studied following the Arrhenious-Frenkel-Eyring model. The viscous flow behavior of NR-m was poorer than those of NR-a. Furthermore, stress relaxation measurements of raw NR showed a longer period of relaxation for NR-m.
Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.
Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe
2013-11-01
Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.
A nationwide survey of NDMA in raw and drinking water in Japan.
Asami, Mari; Oya, Masami; Kosaka, Koji
2009-05-15
A nationwide survey of N-nitrosodimethylamine (NDMA) in both raw and finished water samples from drinking water treatment plants (DWTPs) in Japan was conducted. NDMA was analyzed by solid-phase extraction (SPE) followed by ultra performance liquid chromatography (UPLC) coupled with tandem mass spectrometry (MS/MS). NDMA was detected in 15 of 31 raw water samples collected in the summer at concentrations up to 2.6 ng/L, and in 9 of 28 raw water samples collected in winter at concentrations up to 4.3 ng/L. The NDMA concentrations were higher in raw water samples collected from treatment plants with catchment areas that have high population densities. The NDMA concentrations were higher in river water samples collected from the east and west of Japan than in those collected from other areas. NDMA was detected in 10 of 31 finished samples collected in summer at reduced concentrations of up to 2.2 ng/L, while 5 of 28 finished samples collected in winter showed NDMA concentrations up to 10 ng/L. The highest NDMA levels were detected in finished water samples collected from the Yodo River basin DWTP, which uses ozonation. Furthermore, evaluation of the process water produced at six advanced water treatment plants was conducted. Influent from the Yodo River indicated that the NDMA concentration increased during ozonation to as high as 20 ng/L, and then decreased with subsequent biological activated carbon treatment. To our knowledge, this is the first nationwide evaluation of NDMA concentrations in water conducted in Japan to date.
Determination of essential nutrients in raw milk
Directory of Open Access Journals (Sweden)
Penphimon Phongphanphanee
2006-03-01
Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.
Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source
Directory of Open Access Journals (Sweden)
T Moshtaghi Maleki
2015-11-01
Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.
Radiation sterilization of some cosmetic raw materials and preparations
International Nuclear Information System (INIS)
Achmatowicz-Szmajke, T.; Bryl-Sandelewska, T.; Galazka, M.
1979-01-01
The problem of microbiological purity of cosmetic preparations is discussed. Some results obtained on the influence of ionizing radiation on organoleptic and physicochemical properties of some cosmetic raw materials and final products are reported. The samples of raw materials and the final products were irradiated with a 10 MeV electron beam from an LAE 13/9 linear accelerator located in INR. The doses delivered to the materials were 0.5 - 2.3 Mrad (5-23 kGy). Immediately after irradiation, organoleptic estimations were made and over the next few days physicochemical investigations were performed. Non-irradiated samples were investigated together with irradiated ones. (T.I.)
Short communication: Microbial quality of raw milk following commercial long-distance hauling.
Darchuk, Emily M; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy
2015-12-01
Hauling is a critical part of the commercial milk supply chain, yet very few studies have aimed to understand its effect on raw milk quality. This study focused on the effect of extended-duration tanker use during hauling on raw milk quality at a commercial facility. Standard tanker use [cleaned-in-place (CIP) once per 24h] served as a control and an incremental between-load water rinse with sanitizer treatment (RS) was evaluated to mitigate any effect from extended duration hauling. During this study, 1 commercial truck with 2 trailers was monitored for 10d. The truck collected milk at a large dairy farm, transported the milk to a manufacturing facility, and then returned to the same farm for a second load. Each round-trip journey took between 10 and 12h, allowing for 2 loads per 24-h use period. Following the second delivery, the truck was cleaned by CIP treatment starting a new treatment day. Producer samples were collected from the raw milk bulk tank on the farm before loading milk into the tanker. The same milk was sampled directly out of the tanker truck before unloading at the manufacturer. Effect on individual bacteria count, thermophilic spore count, and preliminary incubation count was quantified through common industry tests. Surface sponge swabs were also used to monitor tanker sanitation and the efficacy of cleaning treatments. Results did not identify a negative effect on raw milk quality due to extended duration hauling. Whereas the addition of RS did not provide any measurable quality benefits for the microbial milk quality, swab results demonstrated that the RS treatment was able to reduce surface bacteria in the tanker, although not to the same level as the full CIP treatment. Based on this study, current CIP practices for long distance milk hauling appear to be effective in mitigating any measurable effect on raw milk quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Mineralogy And Raw Material Characterization Of Esie Stone ...
African Journals Online (AJOL)
Electronprobe mineral data of samples of Esie statues is presented as a possible tool for provenance studies. Most of the samples contain talc, chlorite, cummingtonite and rarely tremolite. Other talc-bearing schists are prevalent in the Esie area. However talc-cummingtonite rocks, similar to the raw materials used for the ...
40 CFR 89.404 - Test procedure overview.
2010-07-01
... engine operating conditions to be conducted on an engine dynamometer. The exhaust gases, generated raw or... matter. For more information on particulate matter sampling see § 89.112(c). The test cycles consist of... (raw analysis), and the power output during each mode. The measured values are weighted and used to...
Monitoring of psychrotrophic microorganisms in raw milk
Directory of Open Access Journals (Sweden)
Radka Burdychová
2008-01-01
Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.
Directory of Open Access Journals (Sweden)
F. Tonucci
2009-09-01
Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.
Test sample handling apparatus
International Nuclear Information System (INIS)
1981-01-01
A test sample handling apparatus using automatic scintillation counting for gamma detection, for use in such fields as radioimmunoassay, is described. The apparatus automatically and continuously counts large numbers of samples rapidly and efficiently by the simultaneous counting of two samples. By means of sequential ordering of non-sequential counting data, it is possible to obtain precisely ordered data while utilizing sample carrier holders having a minimum length. (U.K.)
O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat
2004-09-01
Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.
Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines
Directory of Open Access Journals (Sweden)
Gheorghe Şteţca
2014-11-01
Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain.
Addo, K K; Mensah, G I; Aning, K G; Nartey, N; Nipah, G K; Bonsu, C; Akyeh, M L; Smits, H L
2011-02-01
To investigate the microbiological quality and the presence of antibiotic residues in raw cow milk and in some indigenous milk products produced and marketed by the informal sector in the coastal savannah zone of Ghana. Milk samples were aseptically collected from 224 kraals and samples of 26 indigenous milk products were purchased from processors and retailers. Total plate counts, total coliform counts and the presence of Escherichia coli and E. coli O157:H7 were determined in all 250 samples. Milk samples were also tested for antibiotic residues. Total plate counts exceeded 10⁵ CFU/ml in 45.2% of the samples while coliforms exceeded 10³ CFU/ml in 66.0% and E. coli was detected in 11.2%. E. coli was present in raw cow milk but not in the indigenous products and all E. coli isolates were negative for E. coli O157:H7. Antibiotic residues were detected in 3.1% of the raw cow milk samples. Bulk milk contains unacceptable levels of hygiene indicators and antibiotic residues and is a potential source of milk-borne infections. The detection of E. coli and antibiotic residues raises public health concerns about the safety of fresh unpasteurized cow milk in the coastal savannah zone of Ghana and calls for improved farm hygiene, the need for milk pasteurization and the sensible use of antibiotics in the milk industry. © 2010 Blackwell Publishing Ltd.
Benefits of balancing method for component RAW importance measure
International Nuclear Information System (INIS)
Kim, Kil Yoo; Yang, Joon Eon
2005-01-01
In the Risk Informed Regulation and Applications (RIR and A), the determination of risk significant Structure, System and Components (SSCs) plays an important role, and importance measures such as Fussell-Vesely (FV) and RAW (Risk Achievement Worth) are widely used in the determination of risk significant SSCs. For example, in the Maintenance Rule, Graded Quality Assurance(GQA) and Option 2, FV and RAW are used in the categorization of SSCs. Especially, in the GQA and Option 2, the number of SSCs to be categorized is too many to handle, so the FVs and RAWs of the components are practically derived in a convenient way with those of the basic events which have already been acquired as PSA (Probabilistic Safety Assessment) results instead of by reevaluating the fault tree/event tree of the PSA model. That is, the group FVs and RAWs for the components are derived from the FVs and RAWs of the basic events which consist of the group. Here, the basic events include random failure, Common Cause Failure (CCF), test and maintenance, etc. which make the system unavailable. A method called 'Balancing Method' which can practically and correctly derive the component RAW with the basic event FVs and RAWs even if CCFs exists as basic events was introduced in Ref.. However, 'Balancing Method' has other advantage, i.e., it can also fairly correctly derive component RAW using fault tree without using basic events FVs and RAWs
Microbial Contamination of Raw Vegetables in Ahvaz, Iran during 2014-2015
Directory of Open Access Journals (Sweden)
Abdol Kazem Neisi
2016-07-01
Full Text Available Background & Aims of the Study: Vegetables are useful for humans as they contain minerals, vitamins, fiber and other nutrients. Eating raw vegetables are a nutritional habit in Iranian families. Raw eating vegetables is the main source of parasitic infections. The aim of this study was to determine microbial contamination of raw vegetables in Ahvaz, Iran during 2014-2015. Materials and Methods: In this study, 20 samples collected from markets of Ahvaz. Average weight of collecting raw vegetables was 1 to 2 kilograms. Then, raw vegetables were washed by 4 to 5 liter tap water. For parasitic ova washed water leaved for 24 hours for sedimentation and then the supernatant poured and about 50 to 100 milliliter of settled water transferred to 15 ml centrifugal tubes. After centrifugation, pellet floated and finally parasitic ova were observed microscopically (corrected Bailenger method. The multiple tube method used for Coliform bacteria (Total & Faecal examination. Results: Maximum Coliform bacteria was in Kootabdullah samples (total Coliform was 25893319.52 MPN/100ml and Fecal Coliform was 15054572.83 MPN/100ml. Maximum Ascaris ova in Hamidieh was 43.3 per liter and Sheiban 36.66 per litter. Conclusion: Microbial contamination of raw vegetables, especially in Kootabdullah, possibly was due to Karoon river water pollution by sewage discharge of Ahvaz city, and also in Hamidieh possibly due to Karkheh river water pollution by sewage discharge of Hamidieh city. Thus, sewage treatment of these cities before discharging in rivers is necessary.
Methodology for Evaluating Raw Material Changes to RSRM Elastomeric Insulation Materials
Mildenhall, Scott D.; McCool, Alex (Technical Monitor)
2001-01-01
The Reusable Solid Rocket Motor (RSRM) uses asbestos and silicon dioxide filled acrylonitrile butadiene rubber (AS-NBR) as the primary internal insulation to protect the case from heat. During the course of the RSRM Program, several changes have been made to the raw materials and processing of the AS-NBR elastomeric insulation material. These changes have been primarily caused by raw materials becoming obsolete. In addition, some process changes have been implemented that were deemed necessary to improve the quality and consistency of the AS-NBR insulation material. Each change has been evaluated using unique test efforts customized to determine the potential impacts of the specific raw material or process change. Following the evaluations, the various raw material and process changes were successfully implemented with no detectable effect on the performance of the AS-NBR insulation. This paper will discuss some of the raw material and process changes evaluated, the methodology used in designing the unique test plans, and the general evaluation results. A summary of the change history of RSRM AS-NBR internal insulation is also presented.
The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy
Directory of Open Access Journals (Sweden)
Ehsan Sadeghi
2013-03-01
Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.
Strategic raw materials. Risk management
International Nuclear Information System (INIS)
Bertau, Martin; Matschullat, Joerg; Kausch, Peter
2014-01-01
This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de
Utilization of immunomagnetic separation for detection of Salmonella in raw broiler parts
Directory of Open Access Journals (Sweden)
Ribeiro Aldemir Reginato
2002-01-01
Full Text Available This study was conducted aiming to compare the conventional microbiological method to detect Salmonella in broiler parts with the Immunomagnetic Separation method (IMS followed by plate isolation and also the IMS associated with Rappaport-Vassiliadis broth (RV. The IMS was performed following a pre- enrichment step in buffered peptone water. Sixty-one samples (raw broiler parts were tested and the results showed that the use of the IMS method alone allowed the isolation of Salmonella in 9 of the tested samples, while the association IMS/RV detected the agent in 30 samples. The conventional microbiological method was able to isolate the agent in 25 opportunities. These results allowed to conclude that the IMS/RV association presented an increased sensitivity and permitted a better isolation of Salmonella. The conclusion was that other means of isolation, in particular those which do not interfere with the growth of bead bounded Salmonella, should be searched.
Calcium flouride (CaF2) from oyster shell as a raw material for thermoluminescence dosimeter
International Nuclear Information System (INIS)
Coloma, Lyra C.; Fanuga, Lyn N.; Ocreto, Cherries Ann; Rodriguez, Richita
2006-03-01
This study aims to develop a thermoluminescence dosimeter raw material made of calcium fluoride from locally available seashells that is suitable for personal radiation monitoring. Oyster shells were collected and grounded as powder samples and analyzed for calcium fluoride (CaF 2 ) content using XRF and XRD testing. Samples include pure CaF 2 , pure oyster shell, and oyster shells treated with acid. Based from the XRF results, natural oyster shell (w/ and w/o HNO 3 ) had high percentage of calcium about 49.64% and 47.45%, next to the pure calcium fluoride of 51.08%. X-ray diffractrogram shows that oyster sample had the nearest desired structure of CaF 2 compared with two seashells relative to the pure CaF 2 as standard materials. Results show that all of the natural oyster samples displayed TL emission glow curves at the temperature range 200-300 o C. It was also found that pure oyster sample has better TL response as compared to the treated ones. The researchers concluded that the calcium fluoride from oyster shells (without acid and heated) is a potentially good low-cost TLD raw material and may be used as an alternative for the much more expensive LiF dosimeters. (Authors)
... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...
Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province
Directory of Open Access Journals (Sweden)
B. A. Abbas
2012-01-01
Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.
Study of chemisrty and hydrolysates drying parameters of feather-downy raw material
LISITSYN A.B.; KRIGER O.V.; MITROKHIN P.V.
2016-01-01
The article describes chemical and amino acid composition of feather-downy raw material. It determines the mass fraction of crude protein, crude fiber, ash, calcium, phosphorus, sodium in the samples of feather-downy raw material. It is stated that the waste from poultry processing obtained from hens of all the studied species are characterized by a high content of crude protein and low in crude fiber and ash. The most valuable feather-downy raw material regarding protein is waste containing ...
Gleeble Testing of Tungsten Samples
2013-02-01
temperature on an Instron load frame with a 222.41 kN (50 kip) load cell . The samples were compressed at the same strain rate as on the Gleeble...ID % RE Initial Density (cm 3 ) Density after Compression (cm 3 ) % Change in Density Test Temperature NT1 0 18.08 18.27 1.06 1000 NT3 0...4.1 Nano-Tungsten The results for the compression of the nano-tungsten samples are shown in tables 2 and 3 and figure 5. During testing, sample NT1
Directory of Open Access Journals (Sweden)
K. Konell
2014-12-01
Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.
Effect of the raw materials processing on their dustiness
International Nuclear Information System (INIS)
López Lilaoa, A.; Juárezb, M.; Sanfelix Fornera, V.; Mallol Gascha, G.; Monfort Gimeno, E.
2017-01-01
During the handling and/or processing of powdered materials in the CERAMICS INDUSTRY, one of the most important risks regarding the environmental and occupational health is the potential generation of dust. In this regard, a parameter of great interest is the dustiness of the processed materials; this parameter quantifies the tendency of the powdered materials to generate dust when handled. In this study, to determine the dustiness of a ceramic raw material composition (mixture of the body raw materials), the continuous drop method has been used. This test apparatus was selected because it is considered to better simulate how ceramic materials are handled in the CERAMICS INDUSTRY. The obtained results show that the dustiness of the same ceramic composition exhibits significant changes during the manufacturing process, depending on the presentation form. In this regard, the dry milling sample presents the highest dustiness, which can be significantly reduced (>75%) applying the the moisturization and agglomeration. The obtained results also shown that the best presentation form, regarding the minimization of the dust generation, is achieved in the spray-drying process, where the dustiness is reduced by 95%. [es
Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A
2011-07-01
Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d
Directory of Open Access Journals (Sweden)
S. Gallina
2009-12-01
Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.
Compression module for the BCM1F microTCA raw data readout
Dostanic, Milica
2017-01-01
BCM1F is a diamond based detector and one of the luminometers and background monitors operated by the BRIL group, part of the CMS experiment. BCM1F's front-end produces analog signals which are digitized in a new microTCA back-end. An FPGA in the back-end part takes care of signal processing and stores raw data. The raw data readout has been improved by implementing a data compression module in the firmware. This module has allowed storing larger amount of data in short time intervals. The module has been implemented in VHDL, using a zero suppression algorithm: only data above a defined threshold is stored into memory, while the samples around the base line are discarded. Thanks to metadata, describing the suppressed data, the shape of input signals and time information are preserved. Tests with simulations and a pulse generator showed good results and proved that the module can achieve large compression factor.
Raw material versus processing
International Nuclear Information System (INIS)
Berg, E.A.T.
1989-01-01
Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt
XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK
Directory of Open Access Journals (Sweden)
Agnieszka Greń
2012-12-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1. Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246
Effects of inulin, carrot and cellulose fibres on the properties of raw ...
African Journals Online (AJOL)
The effects of inulin, carrot, and cellulose fibres (3%, 6%, and 9%) on raw and fried chicken meatballs were studied. Meatball pH, thiobarbituric acid reactive substances (TBARS), and colour values were determined for raw samples in refrigerated storage on the 1st, 5th and 10th days. The effects of fibres and their various ...
Natural Dyeing and UV Protection of Raw and Bleached/Mercerised Cotton
Directory of Open Access Journals (Sweden)
Čuk Nina
2017-05-01
Full Text Available Dyeing with natural dyes extracted from curcuma, green tea, avocado seed, pomegranate peel and horse chestnut bark was studied to evaluate the dyeability and ultraviolet (UV blocking properties of raw and bleached/mercerised cotton fabrics. 20 g/l of powdered plant material was extracted in distilled water and used as a dyeing bath. No mordants were used to obtain ecologically friendly finishing. The colour of samples was measured on a refl ectance spectrophotometer, while UV-blocking properties were analysed with UV-Vis spectrophotometer. The results showed that dyeing increased UV protection factor (UPF to all samples, however much higher UPF values were measured for the dyed raw cotton samples. The highest UPF values were obtained on both cotton fabrics dyed with pomegranate peel and green tea extracts, giving them excellent protective properties (UPF 50+. The lowest UPF values were obtained by dyeing cotton with avocado seed extract and curcumin. Dyeing with selected dyes is not stable to washing, so the UV-blocking properties worsen after repetitive washing. However, raw cotton samples retain their very good Uvblocking properties, while bleached/mercerised cotton fabrics do not provide even satisfactory UV-blocking properties. No correlation between CIE L*a*b*, K/S and UPF values were found.
International Nuclear Information System (INIS)
Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.
2013-01-01
Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed. - Author-Highlights: • We measured elemental and chemical composition of raw and activated halloysite mineral samples. • We showed that X-ray techniques allow precise study of changes in the sample composition. • We describe procedure of activation of the samples by etching them in sulfuric acid. • We tested ability of halloysite mineral to absorb lead from contaminated water
Isolating E.Coli Bacteriophage from Raw Sewage and Determining its Selectivity to the Host Cell
Directory of Open Access Journals (Sweden)
SM Imeni
2016-05-01
Full Text Available Introduction: Bacteriophages are viruses that infect and destroy prokaryote cells, specifically the bacteria. They act too selective, so as each bacteriophage affects only on specific type of bacteria. Due to their specific features, bacteriophages can be used as an appropriate substitute for antibiotics in infectious diseases treatment. Therefore, this study aimed to isolate E. coli-specific bacteriophage from raw sewage. Methods: Eight samples of raw sewage, each containing approximately 50 ml of raw sewage with 10 minute gap, were prepared from Zargandeh wastewater treatment plant, Tehran, Iran. The sewages were mixed with Brain-heart infusion medium (BHI as a liquid culture medium in order to let the microorganisms grow. Incubation, purification and determination of bacteria were followed repeatedly to isolate the bacteriophage. Then it was tested on E.coli (ATCC 25922, Enterococcus faecalis (ATCC 19433, Staphylococcus aureus (ATCC 2392, and Yersinia enterocolitica (ATCC 9610 in order to determine the bacteriophage selectivity. Results: The E.coli bacteriophages were successfully isolated from all the eight samples, that were completely able to lyse and destroy E.coli bacterial cells, though no effect was observed on other types of bacteria. Conclusion: The study findings revealed that bacteriophages act selectively. Considering the raise of antibiotic resistance in the world, bacteriophages can serve as a good substitute for antibiotics in treating infectious diseases.
Acceptance test procedure for core sample trucks
International Nuclear Information System (INIS)
Smalley, J.L.
1995-01-01
The purpose of this Acceptance Test Procedure is to provide instruction and documentation for acceptance testing of the rotary mode core sample trucks, HO-68K-4600 and HO-68K-4647. The rotary mode core sample trucks were based upon the design of the second core sample truck (HO-68K-4345) which was constructed to implement rotary mode sampling of the waste tanks at Hanford. Acceptance testing of the rotary mode core sample trucks will verify that the design requirements have been met. All testing will be non-radioactive and stand-in materials shall be used to simulate waste tank conditions. Compressed air will be substituted for nitrogen during the majority of testing, with nitrogen being used only for flow characterization
Coppens, Leonora C; Verkoeijen, Peter P J L; Bouwmeester, Samantha; Rikers, Remy M J P
2016-05-31
The testing effect is the finding that information that is retrieved during learning is more often correctly retrieved on a final test than information that is restudied. According to the semantic mediator hypothesis the testing effect arises because retrieval practice of cue-target pairs (mother-child) activates semantically related mediators (father) more than restudying. Hence, the mediator-target (father-child) association should be stronger for retrieved than restudied pairs. Indeed, Carpenter (2011) found a larger testing effect when participants received mediators (father) than when they received target-related words (birth) as final test cues. The present study started as an attempt to test an alternative account of Carpenter's results. However, it turned into a series of conceptual (Experiment 1) and direct (Experiment 2 and 3) replications conducted with online samples. The results of these online replications were compared with those of similar existing laboratory experiments through small-scale meta-analyses. The results showed that (1) the magnitude of the raw mediator testing effect advantage is comparable for online and laboratory experiments, (2) in both online and laboratory experiments the magnitude of the raw mediator testing effect advantage is smaller than in Carpenter's original experiment, and (3) the testing effect for related cues varies considerably between online experiments. The variability in the testing effect for related cues in online experiments could point toward moderators of the related cue short-term testing effect. The raw mediator testing effect advantage is smaller than in Carpenter's original experiment.
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Changchai, Nuttawee; Saunjit, Sudarat
2014-05-01
Occurrence, population density and virulence of Vibrio parahaemolyticus and V. vulnificus in 240 retail raw oysters collected monthly between March 2010 and February 2011 from Ang Sila coast, Chon Buri Province, Thailand were determined using most probable number (MPN) multiplex PCR. Multiplex PCR detected V. parahaemolyticus in 219 raw oyster samples, of which 29 samples contained the virulence tdh. MPN values for V. parahaemolyticus and pathogenic strains in most samples ranged from 10 to 10(2) and from 3 to 10 MPN/g, respectively. The presence of V. vulnificus was found in 53 oyster samples in amounts between 10 and 10(2) MPN/g. Of 1,087 V. parahaemolyticus isolates, 14 and 2 isolates carried tdh and virulence trh, respectively but none with both genes. However, none of the presumptive isolates was shown to be V. vulnificus. The detection of pathogenic V. parahaemolyticus and V. vulnificus in raw oysters has rendered high awareness of risk in consumption of raw or undercooked oysters.
Tolman, G.H.
1995-01-01
The effect of hot aqueous ethanol treatment on several nutritionally relevant mainly protein-related parameters in raw peas (var. Solara) and ultra-filtrated pea protein isolate was examined. Of all test samples, water absorptive capacity (WAC), weight loss and protein loss owing to the processing
Zohri, Maryam; Alavidjeh, Mohammad Shafiee; Haririan, Ismaeil; Ardestani, Mehdi Shafiee; Ebrahimi, Seyed Esmaeil Sadat; Sani, Hadi Tarighati; Sadjadi, Seyed Kazem
2010-12-01
The aim of this study was to evaluate the antibacterial effect of nisin-loaded chitosan/alginate nanoparticles as a novel antibacterial delivery vehicle. The nisin-loaded nanoparticles were prepared using colloidal dispersion of the chitosan/alginate polymers in the presence of nisin. After the preparation of the nisin-loaded nanoparticles, their physicochemical properties such as size, shape, and zeta potential of the formulations were studied using scanning electron microscope and nanosizer instruments, consecutively. FTIR and differential scanning calorimetery studies were performed to investigate polymer-polymer or polymer-protein interactions. Next, the release kinetics and entrapment efficiency of the nisin-loaded nanoparticles were examined to assess the application potential of these formulations as a candidate vector. For measuring the antibacterial activity of the nisin-loaded nanoparticles, agar diffusion and MIC methods were employed. The samples under investigation for total microbial counts were pasteurized and raw milks each of which contained the nisin-loaded nanoparticles and inoculated Staphylococcus aureus (ATCC 19117 at 10(6) CFU/mL), pasteurized and raw milks each included free nisin and S. aureus (10(6) CFU/mL), and pasteurized and raw milks each had S. aureus (10(6) CFU/mL) in as control. Total counts of S. aureus were measured after 24 and 48 h for the pasteurized milk samples and after the time intervals of 0, 6, 10, 14, 18, and 24 h for the raw milk samples, respectively. According to the results, entrapment efficiency of nisin inside of the nanoparticles was about 90-95%. The average size of the nanoparticles was 205 nm, and the average zeta potential of them was -47 mV. In agar diffusion assay, an antibacterial activity (inhibition zone diameter, at 450 IU/mL) about 2 times higher than that of free nisin was observed for the nisin-loaded nanoparticles. MIC of the nisin-loaded nanoparticles (0.5 mg/mL) was about four times less than
Directory of Open Access Journals (Sweden)
Supreena Srisaikham
2017-02-01
Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.
Arsenic species in raw and cooked rice: Implications for human health in rural Bengal
Energy Technology Data Exchange (ETDEWEB)
Halder, Dipti, E-mail: dipti@kth.se [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden); Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Biswas, Ashis [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden); Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Šlejkovec, Zdenka [Environmental Sciences Department, Jožef Stefan Institute, Jamova 39, 1000, Ljubljana (Slovenia); Chatterjee, Debashis [Department of Chemistry, University of Kalyani, Kalyani, 741 235, West Bengal (India); Nriagu, Jerome [Department of Environmental Health Sciences, School of Public Health, University of Michigan, 109 Observatory Street, Ann Arbor, MI 48109-2029 (United States); Jacks, Gunnar; Bhattacharya, Prosun [KTH-International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, KTH Royal Institute of Technology, Teknikringen 76, SE-100 44 Stockholm (Sweden)
2014-11-01
This study compares the concentrations of total and different species of arsenic (As) in 29 pairs of raw and cooked rice samples collected from households in an area of West Bengal affected by endemic arsenicism. The aim is to investigate the effects of indigenous cooking practice of the rural villagers on As accumulation and speciation in cooked rice. It is found that inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). Cooking of rice with water low in As (< 10 μg L{sup −1}) significantly decreases the total and inorganic As content in cooked rice compared to raw rice. Arsenic concentration is mainly decreased during boiling of rice grains with excess water. Washing of rice grains with low As water has negligible effect on grain As concentration. The study suggests that rice cooking with low As water by the villagers is a beneficial risk reduction strategy. Despite reductions in As content in cooked rice because of cooking with low As water, the consumption of cooked rice represents a significant health threat (in terms of chronic As toxicity) to the study population. - Highlights: • Pairs of raw and cooked rice samples are collected from households. • Total and different species of As in raw and cooked rice samples are compared. • Cooking with As safe water reduces total and inorganic As contents in cooked rice. • Inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). • Risks of As exposure from cooked rice consumption exceed the safety standards.
Arsenic species in raw and cooked rice: Implications for human health in rural Bengal
International Nuclear Information System (INIS)
Halder, Dipti; Biswas, Ashis; Šlejkovec, Zdenka; Chatterjee, Debashis; Nriagu, Jerome; Jacks, Gunnar; Bhattacharya, Prosun
2014-01-01
This study compares the concentrations of total and different species of arsenic (As) in 29 pairs of raw and cooked rice samples collected from households in an area of West Bengal affected by endemic arsenicism. The aim is to investigate the effects of indigenous cooking practice of the rural villagers on As accumulation and speciation in cooked rice. It is found that inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). Cooking of rice with water low in As (< 10 μg L −1 ) significantly decreases the total and inorganic As content in cooked rice compared to raw rice. Arsenic concentration is mainly decreased during boiling of rice grains with excess water. Washing of rice grains with low As water has negligible effect on grain As concentration. The study suggests that rice cooking with low As water by the villagers is a beneficial risk reduction strategy. Despite reductions in As content in cooked rice because of cooking with low As water, the consumption of cooked rice represents a significant health threat (in terms of chronic As toxicity) to the study population. - Highlights: • Pairs of raw and cooked rice samples are collected from households. • Total and different species of As in raw and cooked rice samples are compared. • Cooking with As safe water reduces total and inorganic As contents in cooked rice. • Inorganic As is the predominant species in both raw (93.8%) and cooked rice (88.1%). • Risks of As exposure from cooked rice consumption exceed the safety standards
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q
2017-06-01
Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Tests on standard concrete samples
CERN PhotoLab
1973-01-01
Compression and tensile tests on standard concrete samples. The use of centrifugal force in tensile testing has been developed by the SB Division and the instruments were built in the Central workshops.
40 CFR 89.413 - Raw sampling procedures.
2010-07-01
... of the exhaust pipe—whichever is the larger—upstream of the exit of the exhaust gas system. (b) In..., such as in a “Vee” engine configuration, it is permissible to: (1) Sample after all exhaust pipes have been connected together into a single exhaust pipe. (2) For each mode, sample from each exhaust pipe...
Investigations of torrefied biomass grindability using a modified Hardgrove test
Directory of Open Access Journals (Sweden)
Tymoszuk Mateusz
2017-01-01
Full Text Available This paper presents results of investigations of torrefied biomass grindability using a modified Hardgrove test. The following types of torrefied biomass were used during the testing: alder chips, palm kernel shells and willow chips. Tests were conducted in a standard Hardgrove test mill for 50 cm3 volumetric samples (the same volume as applied in [1]. Volumetric samples of raw biomass were also tested for comparison purposes. Two ranges of the sample particle size were applied during the investigations: 0.6-1.18 mm (as in [2] and 0.2-1.18 mm. As opposed to the standard Hardgrove test, the cumulative passing mass of the product was determined for a wider range of passing of standard sieves. The obtained results point to an increase in the grindability of torrefied fuels compared to raw biomass. They can be used to categorize torrefied biomass fuels due to their grindability, and as basic information in semi-technical scale studies on torrefied biomass comminution features.
Database-driven primary analysis of raw sequencing data
DEFF Research Database (Denmark)
2014-01-01
The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...
Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.
Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran
2007-11-15
During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.
Experimental and Sampling Design for the INL-2 Sample Collection Operational Test
Energy Technology Data Exchange (ETDEWEB)
Piepel, Gregory F.; Amidan, Brett G.; Matzke, Brett D.
2009-02-16
This report describes the experimental and sampling design developed to assess sampling approaches and methods for detecting contamination in a building and clearing the building for use after decontamination. An Idaho National Laboratory (INL) building will be contaminated with BG (Bacillus globigii, renamed Bacillus atrophaeus), a simulant for Bacillus anthracis (BA). The contamination, sampling, decontamination, and re-sampling will occur per the experimental and sampling design. This INL-2 Sample Collection Operational Test is being planned by the Validated Sampling Plan Working Group (VSPWG). The primary objectives are: 1) Evaluate judgmental and probabilistic sampling for characterization as well as probabilistic and combined (judgment and probabilistic) sampling approaches for clearance, 2) Conduct these evaluations for gradient contamination (from low or moderate down to absent or undetectable) for different initial concentrations of the contaminant, 3) Explore judgment composite sampling approaches to reduce sample numbers, 4) Collect baseline data to serve as an indication of the actual levels of contamination in the tests. A combined judgmental and random (CJR) approach uses Bayesian methodology to combine judgmental and probabilistic samples to make clearance statements of the form "X% confidence that at least Y% of an area does not contain detectable contamination” (X%/Y% clearance statements). The INL-2 experimental design has five test events, which 1) vary the floor of the INL building on which the contaminant will be released, 2) provide for varying the amount of contaminant released to obtain desired concentration gradients, and 3) investigate overt as well as covert release of contaminants. Desirable contaminant gradients would have moderate to low concentrations of contaminant in rooms near the release point, with concentrations down to zero in other rooms. Such gradients would provide a range of contamination levels to challenge the sampling
de Oliveira, Tatiane Milão; Augusto Peres, Jayme; Lurdes Felsner, Maria; Cristiane Justi, Karin
2017-08-15
Milk is an important food in the human diet due to its physico-chemical composition; therefore, it is necessary to monitor contamination by toxic metals such as Pb. Milk sample slurries were prepared using Triton X-100 and nitric acid for direct analysis of Pb using graphite furnace atomic absorption spectrometry - GF AAS. After dilution of the slurries, 10.00µl were directly introduced into the pyrolytic graphite tube without use of a chemical modifier, which acts as an advantage considering this type of matrix. The limits of detection and quantification were 0.64 and 2.14µgl -1 , respectively. The figures of merit studied showed that the proposed methodology without pretreatment of the raw milk sample and using external standard calibration is suitable. The methodology was applied in milk samples from the Guarapuava region, in Paraná State (Brazil) and Pb concentrations ranged from 2.12 to 37.36µgl -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.
Enteric Viruses in Raw Vegetables and Groundwater Used for Irrigation in South Korea▿
Cheong, Sooryun; Lee, Cheonghoon; Song, Sung Won; Choi, Weon Cheon; Lee, Chan Hee; Kim, Sang-Jong
2009-01-01
Raw vegetables irrigated with groundwater that may contain enteric viruses can be associated with food-borne viral disease outbreaks. In this study, we performed reverse transcription-PCR (RT-PCR) and cell culture-PCR to monitor the occurrence of enteric viruses in groundwater samples and in raw vegetables that were cultivated using that groundwater in South Korea. Samples were collected 10 times from three farms located in Gyeonggi Province, South Korea. RT-PCR and cell culture-PCR were performed to detect adenoviruses (AdVs), enteroviruses (EVs), noroviruses (NoVs), and rotaviruses, followed by sequence analyses of the detected strains. Of the 29 groundwater samples and the 30 vegetable samples, five (17%) and three (10%) were positive for enteric viruses, respectively. AdVs were the most frequently detected viruses in four groundwater and three vegetable samples. EVs and NoVs were detected in only one groundwater sample and one spinach sample, respectively. The occurrence of enteric viruses in groundwater and vegetable samples was not correlated with the water temperature and the levels of indicator bacteria, respectively. Phylogenetic analysis indicated that most of the detected AdVs were temporally distributed, irrespective of sample type. Our results indicate that raw vegetables may be contaminated with a broad range of enteric viruses, which may originate from virus-infected farmers and virus-contaminated irrigation water, and these vegetables may act as a potential vector of food-borne viral transmission. PMID:19854919
Review of scientific Research results in identification of plant raw materials in food products
GOLUBTSOVA YU. V.
2016-01-01
Currently, the science-based capabilities have been generated to develop and test various identification methods of food products and reveal adulteration using advanced technique and processes. This article reviews researches and developments to identify the plant raw materials in food products based on morphological, anatomic, physical and chemical test methods and the latest DNA-technologies. Review of physical, chemical, anatomic and morphological test methods to identify raw materials bot...
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
International Nuclear Information System (INIS)
Campos, N.Q.; Tapajos, N.S.
2012-01-01
In the state of Para, the red ceramic industry has several segments highly generators of jobs and a strong social appeal. With so many companies focused on this productive sector emerge, but many without any administration quality. Therefore, this study focused the technological and mineralogical characterization of the raw material used in the manufacture of ceramic blocks, by Ceramica Vermelha Company, located in the district of Inhangapi-PA. The raw material was obtained by the techniques of X-ray diffraction (XRD) to determine the present crystalline phases through an accurate and efficient procedure, where it was possible to identify the peaks relating to montmorillonite, illite and kaolinite clay in the sample, and kaolinite and quartz in the sample laterite. Another important result was the absorption of water, with average satisfactory according to the standards. According to a sieve analysis, the laterite the sand fraction showed a greater extent compared to the other, while the clay silt exceeding 80% was found to be too plastic material. The resistance to compression, the results were below the required by the standard, suggesting more accurate test methods. (author)
Sample Size Determination for One- and Two-Sample Trimmed Mean Tests
Luh, Wei-Ming; Olejnik, Stephen; Guo, Jiin-Huarng
2008-01-01
Formulas to determine the necessary sample sizes for parametric tests of group comparisons are available from several sources and appropriate when population distributions are normal. However, in the context of nonnormal population distributions, researchers recommend Yuen's trimmed mean test, but formulas to determine sample sizes have not been…
Investigations of torrefied biomass grindability using a modified Hardgrove test
Tymoszuk Mateusz
2017-01-01
This paper presents results of investigations of torrefied biomass grindability using a modified Hardgrove test. The following types of torrefied biomass were used during the testing: alder chips, palm kernel shells and willow chips. Tests were conducted in a standard Hardgrove test mill for 50 cm3 volumetric samples (the same volume as applied in [1]). Volumetric samples of raw biomass were also tested for comparison purposes. Two ranges of the sample particle size were applied during the in...
Estimating Sample Size for Usability Testing
Directory of Open Access Journals (Sweden)
Alex Cazañas
2017-02-01
Full Text Available One strategy used to assure that an interface meets user requirements is to conduct usability testing. When conducting such testing one of the unknowns is sample size. Since extensive testing is costly, minimizing the number of participants can contribute greatly to successful resource management of a project. Even though a significant number of models have been proposed to estimate sample size in usability testing, there is still not consensus on the optimal size. Several studies claim that 3 to 5 users suffice to uncover 80% of problems in a software interface. However, many other studies challenge this assertion. This study analyzed data collected from the user testing of a web application to verify the rule of thumb, commonly known as the “magic number 5”. The outcomes of the analysis showed that the 5-user rule significantly underestimates the required sample size to achieve reasonable levels of problem detection.
Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena
2014-01-01
In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Validation and application of FTIR spectroscopy in raw milk analysis
Directory of Open Access Journals (Sweden)
Kučević Denis S.
2017-01-01
Full Text Available The aim of this study was to investigate whether FTIR spectroscopy is an accurate and valid technique for the assessment of quality parameters in raw cow's milk: fat, protein, lactose, and total solids. The assessment was based on calibration series and comparison with reference material. Furthermore, it takes into account the results obtained in the inter-laboratory comparisons (proficiency testing. The calibration samples were purchased from the accredited regional reference laboratories. The validation parameters included linearity, accuracy, repeatability, reproducibility, and robustness. The linearity ratio was 0.95%. The biases calculated for the fat, protein, lactose and dry matter were -0.33, 0.31, -0.25, and 0.06 respectively. The F value from the F-test was used to determine the significant differences between two independent sets of the results. The obtained results were as follows: 1.469 for fat, 1.634 for protein, 1.192 for lactose, and 0.528 for dry matter. The intra-laboratory reproducibility calculated as the Horwitz Ratios for all parameters were within the criterion limits (0.5 to 0.8. The data obtained for carry-over were 0.27% for fat, 0.52% for protein, 0.47% for lactose, and 0.47% for dry matter. Based on the obtained results it can be concluded that the FTIR spectroscopy is a reliable instrumental technique for the determination of fat, protein, lactose and total solids in raw cow's milk.
Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema
2012-11-01
Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.
40 CFR 1065.245 - Sample flow meter for batch sampling.
2010-07-01
... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Sample flow meter for batch sampling... Sample flow meter for batch sampling. (a) Application. Use a sample flow meter to determine sample flow... difference between a diluted exhaust sample flow meter and a dilution air meter to calculate raw exhaust flow...
CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK
Directory of Open Access Journals (Sweden)
Lukáčová Anetta
2012-10-01
Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.
Grazziotin, Maria Celestina Bonzanini; Grazziotin, Ana Laura; Vidal, Newton Medeiros; Freire, Marcia Helena de Souza; da Silva, Regina Paula Guimarães Vieira Cavalcante
2016-08-01
Milk safety is an important concern in neonatal units and human milk banks. Therefore, evidence-based recommendations regarding raw milk handling and storage are needed to safely promote supplying hospitalized infants with their mother's own milk. To evaluate raw human milk storage methods according to Brazilian milk management regulations by investigating the effects of refrigeration (5°C) for 12 hours and freezing (-20°C) for 15 days on the acidity and energy content in a large number of raw milk samples. Expressed milk samples from 100 distinct donors were collected in glass bottles. Each sample was separated into 3 equal portions that were analyzed at room temperature and after either 12 hours of refrigeration or 15 days of freezing. Milk acidity and energy content were determined by Dornic titration and creamatocrit technique, respectively. All samples showed Dornic acidity values within the established acceptable limit (≤ 8°D), as required by Brazilian regulations. In addition, energy content did not significantly differ among fresh, refrigerated and frozen milk samples (median of ~50 kcal/100 mL for each). Most samples tested (> 80%) were considered top quality milk (milk energy content was preserved after storage. We conclude that the storage methods required by Brazilian regulations are suitable to ensure milk safety and energy content of stored milk when supplied to neonates. © The Author(s) 2016.
Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert
2006-11-01
The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.
Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.
Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J
2008-04-01
Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.
Sampling and analysis methods for geothermal fluids and gases
Energy Technology Data Exchange (ETDEWEB)
Shannon, D. W.
1978-01-01
The data obtained for the first round robin sample collected at Mesa 6-2 wellhead, East Mesa Test Site, Imperial Valley are summarized. Test results are listed by method used for cross reference to the analytic methods section. Results obtained for radioactive isotopes present in the brine sample are tabulated. The data obtained for the second round robin sample collected from the Woolsey No. 1 first stage flash unit, San Diego Gas and Electric Niland Test Facility are presented in the same manner. Lists of the participants of the two round robins are given. Data from miscellaneous analyses are included. Summaries of values derived from the round robin raw data are presented. (MHR)
Seasonal variation in the Dutch bovine raw milk composition
Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.
2009-01-01
In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main
Testing a groundwater sampling tool: Are the samples representative?
International Nuclear Information System (INIS)
Kaback, D.S.; Bergren, C.L.; Carlson, C.A.; Carlson, C.L.
1989-01-01
A ground water sampling tool, the HydroPunch trademark, was tested at the Department of Energy's Savannah River Site in South Carolina to determine if representative ground water samples could be obtained without installing monitoring wells. Chemical analyses of ground water samples collected with the HydroPunch trademark from various depths within a borehole were compared with chemical analyses of ground water from nearby monitoring wells. The site selected for the test was in the vicinity of a large coal storage pile and a coal pile runoff basin that was constructed to collect the runoff from the coal storage pile. Existing monitoring wells in the area indicate the presence of a ground water contaminant plume that: (1) contains elevated concentrations of trace metals; (2) has an extremely low pH; and (3) contains elevated concentrations of major cations and anions. Ground water samples collected with the HydroPunch trademark provide in excellent estimate of ground water quality at discrete depths. Groundwater chemical data collected from various depths using the HydroPunch trademark can be averaged to simulate what a screen zone in a monitoring well would sample. The averaged depth-discrete data compared favorably with the data obtained from the nearby monitoring wells
Analysis of zirconia and alumina products and raw materials by X-ray fluorescence spectrometry
International Nuclear Information System (INIS)
Boix, A.; Draignaud, M.; Debras-Guedon, J.
1975-01-01
An X-ray fluorescence spectrometric method of analysis for various raw materials and materials based on zirconia, alumina and silica was developed. The measurements were made on beads made from the sample and a borax based flux, in the proportions 1:10. A repeatability test allowed the relative standard deviation to be estimated for the three main constituents: SiO 2 , Al 2 O 3 , ZrO 2 : it is at the level of 1%. The element analyzed are: Si, Al, Fe, Ti, Ca, Hf and Zr [fr
Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu
2016-05-26
The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.
Public health investigations of Salmonella Enteritidis in catering raw shell eggs, 2002-2004.
Little, C L; Surman-Lee, S; Greenwood, M; Bolton, F J; Elson, R; Mitchell, R T; Nichols, G N; Sagoo, S K; Threlfall, E J; Ward, L R; Gillespie, I A; O'Brien, S
2007-06-01
In response to a dramatic change in the epidemiology of Salmonella Enteritidis in England and Wales thought to be associated with raw shell eggs, the Health Protection Agency initiated public health investigations to establish the incidence of Salmonella contamination and origin of eggs used by catering premises implicated in outbreaks of Salm. Enteritidis. Between October 2002 and November 2004, 16 971 eggs were sampled and Salmonella were recovered from 3.4%. Salmonella was isolated from 5.5% and 6.3% of Spanish and eggs of unknown origin, respectively, used in catering premises linked to outbreaks, a level significantly higher than that (1.1%) found in nonLion Quality UK eggs sampled. The small sample of UK Lion Quality eggs tested (reflecting their lack of use in premises visited) did not contain Salmonella. Several phage types of Salm. Enteritidis other than phage type 4 (PT 4) were identified with nonUK eggs. Eggs from Spain were implicated as a major source of infection. Eggs were contaminated more frequently with Salmonella when shells were dirty and/or cracked, and stored at above 8 degrees C. The use of Spanish eggs by the catering sector has been identified as a consistent significant factor in many of the outbreaks caused by Salm. Enteritidis nonPT4 in England and Wales during 2002-2004. Advice to caterers and hospitals that raw shell eggs should not be used in food that will either not be cooked or only lightly cooked should be reinforced.
Disassa, Nigatu; Sibhat, Berhanu; Mengistu, Shimelis; Muktar, Yimer; Belina, Dinaol
2017-01-01
A cross-sectional study was conducted from October 2014 to July 2015 to determine the prevalence and populations of E. coli as well as the prevalence and antimicrobial susceptibility of E. coli O157:H7 isolated from raw milk. Biochemical and serological tests methods were used to confirm E. coli and E. coli O157:H7 and isolates were subjected to antimicrobial susceptibility test using the agar disc diffusion method. Out of 380 raw milk samples examined, 129 (33.9%) and 11 (2.9%) were contaminated with E. coli and E. coli O157:H7, respectively. The highest prevalence was recorded in samples obtained from vendors (39.1%, 4.978 ± 0.180 log 10 /ml) compared with samples from farmers (28.1%, 3.93 ± 0.01 log 10 /ml) with significant differences ( P = 0.02). The frequency of contamination was higher in the samples collected from milk that was stored and transported in plastic containers (39.4%) than in the containers made of stainless steel (23.0%) ( P = 0.002). The antimicrobial susceptibility profile showed that E. coli O157:H7 were resistant to tetracycline (81.8%), streptomycin (81.8%), and kanamycin (63.6%). Milk samples were produced and handled under poor hygienic conditions, stored, and transported in inappropriate containers and under temperature abuse conditions leading to high health risk to the consumers. Additional studies would be needed to establish association between the occurrences of E. coli O157:H7 in raw milk and all the risk factors involved in and around Asosa town.
Directory of Open Access Journals (Sweden)
F Tajbakhsh
2014-05-01
Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.
Microbiologically influenced corrosion of sa106 gr.b carbon steel in raw water
International Nuclear Information System (INIS)
Tunaru, M.; Velciu, L.; Stancu, M.; Popa, L.
2015-01-01
This paper presents the evaluation of microbiological corrosion susceptibility of carbon steel SA106gr.B in raw water. The experiment consisted of a series of electrochemical accelerated tests which evaluated the pitting corrosion susceptibility and determined corrosion rates before and after the immersion. The microbiological analysis of the water determined the types of bacteria and bacterial concentration present in water and in biofilms. Microbiological analysis of the water sample emphasized the existence, in small numbers (10-101 ml-1), of heterotrophic aerobic bacteria, sulphate-reducing bacteria and iron-oxidizing microorganisms. Along with sulphate-reducing bacteria, the heterotrophic aerobic bacteria and the iron-oxidizing microorganisms are categorized as having an important role in the corrosion of metals, including steel. The surfaces of the tested samples were analysed using the optical and electronic microscope, and emphasized the role of bacteria in the development of biofilms under which appeared characteristics of corrosion attack. (authors)
Nutritional quality of raw and processed unripe Carica papaya fruit ...
African Journals Online (AJOL)
the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...
The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product
Directory of Open Access Journals (Sweden)
Rini Mastuti
2012-02-01
Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value 7.89, WHC 48.345, and moisture content 75.20%. Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.
Codo, Carla Regina Bianchi; Caldas, Jamil Pedro de Siqueira; Peixoto, Rafaella Regina Alves; Sanches, Vitor Lacerda; Guiraldelo, Tamara Cristina; Cadore, Solange; Marba, Sérgio Tadeu Martins
2018-02-22
To determine and compare the concentrations of electrolytes and minerals in three different types of maternal milk samples: term donor milk before pasteurization, term donor milk after pasteurization and raw milk of mothers of preterm newborns at bedside. Descriptive cross-sectional study. Concentrations of calcium (Ca), phosphorous (P), magnesium (Mg), sodium (Na) and potassium (K) were measured in random samples of three human breast milk groups. Samples were analyzed using acid mineralization assisted by microwave radiation and further analysis by inductively coupled plasma optical emission spectrometry. Concentrations were expressed in mg/L, described as mean and standard deviation. The one-way ANOVA and Tukey's post-test were applied to determine the variability between the means of each group. Significance level was set at 5%. There was a significant reduction in the content of Ca (259.4±96.8 vs. 217.0±54.9; p=0.003), P (139.1±51.7 vs. 116.8±33.3; p=0.004) and K (580.8±177.1 vs. 470.9±109.4; ppasteurization. Samples of raw milk presented higher contents of Na than the donated milk (twice). The elements P and Ca would only reach the daily intake levels recommended by the European Society of Pediatric Gastroenterology, Hepatology and Nutrition if at least 60 mL of milk could be offered every 3 hours. Mg levels were not different between the three groups. There was a significant reduction in Ca, P and K levels in samples after pasteurization. The Na value in raw milk, collected at bedside, was higher than in the samples of donor's milk before pasteurization.
International Nuclear Information System (INIS)
Vucina, L.J.
1977-01-01
Trace elements in aluminium, raw materials and in the samples from different stages of aluminium production were determined by nondestructive neutron radioactivation analysis. The samples were taken from the Bayer's process of alumina production (bauxite, red sludge and alumina), from the components of the reduction cell (anode, criolyte and AlF 3 ) and of the final product - aluminium (purity 99.5-99.7%). Under given set of conditions ten trace elements (V,La,Ga,Mn,Co,Cr,Sc,Sb,Zn and Fe) were determined in aluminium and followed through the production process. It was found that the main impurities in aluminium are iron (0.15%) and zinc (0.O6%). It has been concluded that the purity of produced aluminium depends mainly on the purity of used alumina. The second important source of contamination of aluminium is anode. The results obtained by radioactivation analysis for V, Mn, Cr and Fe fall within the ranges of concentrations of these elements determined by use of other methods (volumetry, spectrophotometry, atomic absorption). Higher values for zinc were obtained by radioactivation analysis, probably due to unsatisfactory irradiation and measuring conditions for this element. The possibilities of application of radioactivation analysis to these kinds of samples are also disscused
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.
1998-01-01
The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat
Qin, Kunming; Wang, Bin; Li, Weidong; Cai, Hao; Chen, Danni; Liu, Xiao; Yin, Fangzhou; Cai, Baochang
2015-05-01
In traditional Chinese medicine, raw and processed herbs are used to treat different diseases. Suitable quality assessment methods are crucial for the discrimination between raw and processed herbs. The dried fruit of Arctium lappa L. and their processed products are widely used in traditional Chinese medicine, yet their therapeutic effects are different. In this study, a novel strategy using high-performance liquid chromatography and diode array detection coupled with multivariate statistical analysis to rapidly explore raw and processed Arctium lappa L. was proposed and validated. Four main components in a total of 30 batches of raw and processed Fructus Arctii samples were analyzed, and ten characteristic peaks were identified in the fingerprint common pattern. Furthermore, similarity evaluation, principal component analysis, and hierachical cluster analysis were applied to demonstrate the distinction. The results suggested that the relative amounts of the chemical components of raw and processed Fructus Arctii samples are different. This new method has been successfully applied to detect the raw and processed Fructus Arctii in marketed herbal medicinal products. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Parasitic Contamination of Raw Vegetables in Zanjan Markets, Iran
Directory of Open Access Journals (Sweden)
Negin Torabi
2016-09-01
Full Text Available Background: Complex surface of vegetables facilitate attachment and transmission of several pathogens. No previous study has been conducted in survey of parasitic contamination of vegetables in Zanjan. This study aimed to detect the parasitic contamination in common raw vegetables in Zanjan markets. Methods: A total of 352 raw vegetable samples, including leek, parsley, basil, mint, radish, cress and dill were collected from grocery stores using cluster sampling in different regions of the city during 2014. The edible parts of vegetables were separated and immersed in normal saline solution. Floating vegetables were removed and the solution was allowed to sediment at room temperature for 24 hours. The pellet was examined following sedimentation and floatation methods. Results:Various Organisms were detected in 54% (190 of the 352 samples, but only 2.8% of samples had pathogenic parasites including; Trichostrongylus eggs (3, Hookworm eggs (2, Eimeria oocysts (2, Sarcocystis oocyst (1, Strongyloides larvae (1, and Fasciola eggs (1. The contamination rate of vegetables was highest (90.4% in the fall (p˂0.05. Conclusion: Vegetable contamination with parasitic organisms in this area was low, maybe due to irrigation of vegetables with sources other than sewage water, but it is still necessary to improve sanitary conditions of vegetables.
Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D
2017-07-01
Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.
Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein
2012-12-01
Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.
Directory of Open Access Journals (Sweden)
Dmitry Alexandrovich Izotov
2013-12-01
Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore
Jogsten, Ingrid Ericson; Perelló, Gemma; Llebaria, Xavier; Bigas, Esther; Martí-Cid, Roser; Kärrman, Anna; Domingo, José L
2009-07-01
In this study, the role that some food processing and packaging might play as a source of perfluorinated compounds (PFCs) through the diet was assessed. The levels of PFCs were determined in composite samples of veal steak (raw, grilled, and fried), pork loin (raw, grilled, and fried), chicken breast (raw, grilled, and fried), black pudding (uncooked), liver lamb (raw), marinated salmon (home-made and packaged), lettuce (fresh and packaged), pate of pork liver, foie gras of duck, frankfurt, sausages, chicken nuggets (fried), and common salt. Among the 11 PFCs analyzed, only PFHxS, PFOS, PFHxA, and PFOA were detected in at least one composite sample, while the levels of the remaining PFCs (PFBuS, PFHpA, PFNA, PFDA, PFUnDA, and PFDoDA) were under their respective detection limits. PFOS was the compound most frequently detected, being found in 8 of the 20 food items analyzed, while PFHxA was detected in samples of raw veal, chicken nuggets, frankfurt, sausages, and packaged lettuce. According to the results of the present study, it is not sufficiently clear if cooking with non-stick cookware, or packaging some foods, could contribute to a higher human exposure to PFCs.
Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A
2014-08-01
Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Comparison of breast percent density estimation from raw versus processed digital mammograms
Li, Diane; Gavenonis, Sara; Conant, Emily; Kontos, Despina
2011-03-01
We compared breast percent density (PD%) measures obtained from raw and post-processed digital mammographic (DM) images. Bilateral raw and post-processed medio-lateral oblique (MLO) images from 81 screening studies were retrospectively analyzed. Image acquisition was performed with a GE Healthcare DS full-field DM system. Image post-processing was performed using the PremiumViewTM algorithm (GE Healthcare). Area-based breast PD% was estimated by a radiologist using a semi-automated image thresholding technique (Cumulus, Univ. Toronto). Comparison of breast PD% between raw and post-processed DM images was performed using the Pearson correlation (r), linear regression, and Student's t-test. Intra-reader variability was assessed with a repeat read on the same data-set. Our results show that breast PD% measurements from raw and post-processed DM images have a high correlation (r=0.98, R2=0.95, p<0.001). Paired t-test comparison of breast PD% between the raw and the post-processed images showed a statistically significant difference equal to 1.2% (p = 0.006). Our results suggest that the relatively small magnitude of the absolute difference in PD% between raw and post-processed DM images is unlikely to be clinically significant in breast cancer risk stratification. Therefore, it may be feasible to use post-processed DM images for breast PD% estimation in clinical settings. Since most breast imaging clinics routinely use and store only the post-processed DM images, breast PD% estimation from post-processed data may accelerate the integration of breast density in breast cancer risk assessment models used in clinical practice.
Cardiotoxic Effects of Raw Opium.
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
Cardiotoxic Effects of Raw Opium
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
Ali, Nazish Mazhar; Sarwar, Khadija; Mazhar, Syed Abdullah; Liaqat, Iram; Andleeb, Saiqa; Mazhar, Bushra; Kalim, Bushra
2017-11-01
Present study has been undertaken to isolate and identify the bacterial flora in raw, boiled and pasteurized milk. Agar disc diffusion method was used to determine their sensitivity using medicinal plants, antibiotics and heavy metals. Methylene blue reduction test was used to test the quality of milk samples. Total 10 pathogenic strains were isolated, five strains were isolated from raw milk, three from boiled milk and 2 two from pasteurized milk. To determine optimum conditions for growth, these pathogenic microorganisms were incubated at various temperatures and pH. Gram's staining and biochemical tests revealed that these pathogenic bacteria include Lactobacillus sp., E. coli, Salmonella sp., Pseudomonas sp., Streptococcus sp. and Staphylococcus. Ribotyping revealed S2 as Pseudomonas fluorescens, S5 as Lactococcus lactis and S9 as Lactobacillus acidophilus. Prevalence of pathogenic organisms provided the evidence that contamination of milk arises during milking, transportation and storage of milk. Raw milk is more contaminated than other two types of milk because it contains highest percentage of pathogenic organisms and pasteurized milk was found to be of best quality among three types. So it is recommended to drink milk after proper boiling or pasteurization. Proper pasteurization and hygienic packing of milk is essential to minimize contamination in milk which can save human beings from many milk borne diseases. Our study suggests that antimicrobial use in animal husbandry should be minimized to reduce the hazard of antibiotic resistance. Plant extracts are better alternative against pathogenic bacteria in milk.
Lahou, Evy; Jacxsens, Liesbeth; Van Landeghem, Filip; Uyttendaele, Mieke
2014-08-01
Food service operations are confronted with a diverse range of raw materials and served meals. The implementation of a microbial sampling plan in the framework of verification of suppliers and their own production process (functionality of their prerequisite and HACCP program), demands selection of food products and sampling frequencies. However, these are often selected without a well described scientifically underpinned sampling plan. Therefore, an approach on how to set-up a focused sampling plan, enabled by a microbial risk categorization of food products, for both incoming raw materials and meals served to the consumers is presented. The sampling plan was implemented as a case study during a one-year period in an institutional food service operation to test the feasibility of the chosen approach. This resulted in 123 samples of raw materials and 87 samples of meal servings (focused on high risk categorized food products) which were analyzed for spoilage bacteria, hygiene indicators and food borne pathogens. Although sampling plans are intrinsically limited in assessing the quality and safety of sampled foods, it was shown to be useful to reveal major non-compliances and opportunities to improve the food safety management system in place. Points of attention deduced in the case study were control of Listeria monocytogenes in raw meat spread and raw fish as well as overall microbial quality of served sandwiches and salads. Copyright © 2014 Elsevier Ltd. All rights reserved.
Assessment of Raw Cow Milk Quality in Smallholder Dairy Farms in Pemba Island Zanzibar, Tanzania
Directory of Open Access Journals (Sweden)
S. H. Gwandu
2018-01-01
Full Text Available Milk quality depends on the physicochemical characteristics, hygienic standards, and nutritional quality; however, animal husbandry practices, unhygienic harvesting and processing, may affect its quality. A cross-sectional study was conducted between August 2010 and July 2011 to assess the hygiene of cow milk production environment, raw cow milk physicochemical characteristics, and microbial quality and estimate the prevalence of antimicrobial residues using standard methods in Pemba Island. A total of 98 raw cow milk samples from selected smallholder dairy farms were analyzed, and the judgement on the quality used the East African Standards. Generally, the milk production chain was done under the unhygienic condition, and dirty plastic containers were used for collection and storage of milk under room temperature. Some milk samples had abnormal colour (2.1%, abnormal smell (7.1%, and pH below normal (35.7%, clotted on alcohol test (9.2%, and had the specific gravity below normal (13.3%. All the milk samples had mineral contents within the recommended range. Milk samples with butterfat below normal were 29.6%, while 14.3% had total solids below recommended values. The mean total viable count (TVC of milk container surfaces was 9.7±10.5 log CFU/100 cm2, while total coliform count (TCC was 7.8±8.5 log CFU/100 cm2. Up to 55.1% of milk had TVC beyond the recommended levels. The milk mean TVC was 11.02±11.6 log CFU/ml and TCC was 6.7±7.3 log CFU/ml. Up to 26.5% of milk samples had the TCC beyond levels. Results on physicochemical characteristics and nutritional analysis show that the raw cow milk in Pemba Island is of inferior quality. Microbiological results of this study imply heavy contaminations of milk. Antimicrobial residues were detected in 83% of the samples and most of them were from Wete District. Unhygienic milk production chain accelerates microbial contaminations, and antimicrobial residues in milk are a big
Alp, I; Deveci, H; Yazici, E Y; Türk, T; Süngün, Y H
2009-07-15
Pyrite cinders, which are the waste products of sulphuric acid manufacturing plants, contain hazardous heavy metals with potential environmental risks for disposal. In this study, the potential use of pyrite cinders (PyCs) as iron source in the production of Portland cement clinker was demonstrated at the industrial scale. The chemical and mineralogical analyses of the PyC sample used in this study have revealed that it is essentially a suitable raw material for use as iron source since it contains >87% Fe(2)O(3) mainly in the form of hematite (Fe(2)O(3)) and magnetite (Fe(3)O(4)). The samples of the clinkers produced from PyC in the industrial scale trial operation of 6 months were tested for the conformity of their chemical composition and the physico-mechanical performance of the resultant cement products. The data were compared with the clinker products of the iron ore, which is used as the raw material for the production Portland cement clinker in the plant. The chemical compositions of all the clinker products of PyC appeared to conform to those of the iron ore clinker, and hence, a Portland cement clinker. The mechanical performance of the mortars prepared from the PyC clinker was found to be consistent with those of the industrial cements e.g. CEM I type cements. It can be inferred from the leachability tests (TCLP and SPLP) that PyC could be a potential source of heavy metal pollution while the mortar samples obtained from the PyC clinkers present no environmental problems. These findings suggest that the waste pyrite cinders can be readily used as iron source for the production of Portland cement. The availability of PyC in large quantities at low cost provides further significant benefits for the management/environmental practices of these wastes and for the reduction of mining and processing costs of cement raw materials.
International Nuclear Information System (INIS)
Arnold, O.
1975-01-01
In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de
The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...
Contamination Level of Staphylococcus spp. in Raw Goat Milk and Associated Risk Factors
Directory of Open Access Journals (Sweden)
E. Taufik
2008-12-01
Full Text Available This study was aimed to investigate the presence of pathogenic bacteria in raw goat milk by using Staphylococcus spp. as indicator bacteria, and also to evaluate the potential risk factors associated with them. Information regarding potential risk factors was collected by questionnaire. The conventional bacteriological method for bacterial isolation and the indirect test (California Mastitis Test (CMT for determining udder inflammation status were employed. A sample size of 300 udder halves milk samples from three commercial dairy goat farms in the Bogor District, West Java Province, Indonesia were investigated for counts and prevalence of indicator bacteria. Ten potential risk factors were also evaluated in relation to counts and prevalence of indicator bacteria. The results showed that the median value of indicator bacterial count from overall udder-half milk samples was 3.00 log cfu/ml. The indicator bacterial count from udder-half milk samples was significantly different (P<0.05 among farms. Overall prevalence of Staphylococcus spp. was 78.7%. As one of potential risk factors, udder inflammation status was found to be risk factor for Staphylococcus spp. contamination in milk. Udders with inflammation had significant association and a higher chance of having contaminated samples by Staphylococcus spp. as compared to udders without inflammation. Additionally, according to these study results, CMT can be used as an effective, reliable, cheap and “farm and farmer friendly test” for screening test of intramammary infection (IMI or sub clinical mastitis in dairy goats.
7 CFR 28.952 - Testing of samples.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Testing of samples. 28.952 Section 28.952 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... processing tests of the properties of cotton samples and report the results thereof to the persons from whom...
Characteristics of Escherichia coli from raw vegetables at a retail market in the Czech Republic.
Skočková, Alena; Karpíšková, Renáta; Koláčková, Ivana; Cupáková, Šárka
2013-10-15
A large epidemic caused by shigatoxigenic Escherichia coli (E. coli) in spring 2011 in Germany resulted in reduction of trust in the health safety of raw vegetables and sprouted seeds. This study focused on the detection and characterization of E. coli in raw vegetables and sprouted seeds sold in the Czech Republic. Out of 91 samples, 24 (26.4%) were positive for the presence of E. coli. Resistance to antimicrobial agents was determined by the disk diffusion method and E-test. Polymerase chain reaction was used for the detection of selected genes encoding virulence--eaeA, hly, stx1, and stx2 and genes encoding resistance to tetracycline--tet(A), tet(B), tet(C), and tet(G) and to β-lactams--blaTEM, blaSHV, and blaCTX. The blaTEM gene was detected in two isolates, the tet(B) gene in three and tet(A) in one isolate. No hly, stx1, or stx2 genes were present, but the eaeA gene was found in three (11.1%) isolates from imported vegetables. These isolates can be considered as potentially enteropathogenic. Results of this study show that raw vegetables and sprouted seeds sold in the retail market can represent a potential risk for consumers. © 2013.
Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung
2017-11-01
The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.
Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia
2014-08-28
Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.
The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).
Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş
2007-03-01
This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.
Use of alternative raw materials for yoghurt production | Farinde ...
African Journals Online (AJOL)
Soymilk and maize steep water were used as alternative raw materials to cow milk and commercial starter, respectively, for production of yoghurt. The cow milk used was both Fresh milk and dried powdered milk (DANO). The cost of production of the yoghurt samples as well as their chemical, microbial and organoleptic ...
Tryland, Ingun; Eregno, Fasil Ejigu; Braathen, Henrik; Khalaf, Goran; Sjølander, Ingrid; Fossum, Marie
2015-02-04
The fully automated Colifast ALARM™ has been used for two years for daily monitoring of the presence/absence of Escherichia coli in 100 mL raw water at Oset drinking water treatment plant in Oslo, Norway. The raw water is extracted from 35 m depth from the Lake Maridalsvannet. E. coli was detected in 18% of the daily samples. In general, most samples positive for E. coli were observed during the autumn turnover periods, but even in some samples taken during warm and dry days in July, with stable temperature stratification in the lake, E. coli was detected. The daily samples gave useful additional information compared with the weekly routine samples about the hygienic raw water quality and the hygienic barrier efficiency of the lake under different weather conditions and seasons. The winter 2013/2014 was much warmer than the winter 2012/2013. The monitoring supported the hypothesis that warmer winters with shorter periods with ice cover on lakes, which may be a consequence of climate changes, may reduce the hygienic barrier efficiency in deep lakes used as drinking water sources.
Fratini, Filippo; Turchi, Barbara; Ferrone, Martina; Galiero, Alessia; Nuvoloni, Roberta; Torracca, Beatrice; Cerri, Domenico
2016-09-01
The consumption of raw milk is currently increasing due to several beneficial aspects, such as nutritional qualities, taste, and health benefits. However, some authors highlight the potential risk associated with raw milk consumption. In Italy, while the absence of some pathogen microorganisms is set by the regional regulation DGR 381/2007, for other microorganisms, such as Leptospira, no recommendations are provided. Leptospira is not ascribed among classical milk pathogens; however, it can potentially be present in raw milk. The aim of this study was to evaluate the survival in raw milk of six serovars of Leptospira after storage at different temperatures (4 °C ± 2 °C, 20 °C ± 2 °C, and 30 °C ± 2 °C) for different incubation times (20 min, 45 min, 1 h, and 1 h and 30 min), in order to determine the potential risk for consumers. Moreover, the immediate effect of bovine, goat, and donkey raw milk on tested Leptospira serovars was visually evaluated. After incubation, all samples were subcultured in EMJH and incubated aerobically at 30 °C for 3 months. All inoculated media were weekly examined by dark-field microscope in order to assess Leptospira survival. Extemporary observation of strains' behavior in milk allowed to detect an almost immediate motility loss, and no leptospires were detected by microscopic observations carried out weekly during the trial period. According to our results, it could be possible to exclude raw milk as a source of Leptospira infection for consumers.
Airflow Test of Acoustic Board Samples
DEFF Research Database (Denmark)
Jensen, Rasmus Lund; Jensen, Lise Mellergaard
In the laboratory of Indoor Environmental Engineering, Department of Civil Engineering, Aalborg University an airflow test on 2x10 samples of acoustic board were carried out the 2nd of June 2012. The tests were carried out for Rambøll and STO AG. The test includes connected values of volume flow...
GET electronics samples data analysis
International Nuclear Information System (INIS)
Giovinazzo, J.; Goigoux, T.; Anvar, S.; Baron, P.; Blank, B.; Delagnes, E.; Grinyer, G.F.; Pancin, J.; Pedroza, J.L.; Pibernat, J.; Pollacco, E.; Rebii, A.
2016-01-01
The General Electronics for TPCs (GET) has been developed to equip a generation of time projection chamber detectors for nuclear physics, and may also be used for a wider range of detector types. The goal of this paper is to propose first analysis procedures to be applied on raw data samples from the GET system, in order to correct for systematic effects observed on test measurements. We also present a method to estimate the response function of the GET system channels. The response function is required in analysis where the input signal needs to be reconstructed, in terms of time distribution, from the registered output samples.
Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran
Directory of Open Access Journals (Sweden)
Mafakheri, Sh.
2010-07-01
Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.
Consumer use and response to online third-party raw DNA interpretation services.
Wang, Catharine; Cahill, Tiernan J; Parlato, Andrew; Wertz, Blake; Zhong, Qiankun; Cunningham, Tricia Norkunas; Cummings, James J
2018-01-01
With the availability of raw DNA generated from direct-to-consumer (DTC) testing companies, there has been a proliferation of third-party online services that are available to interpret the raw data for both genealogy and/or health purposes. This study examines the current landscape and downstream clinical implications of consumer use of third-party services. Study participants were recruited online from social media platforms. A total of 321 survey respondents reported using third-party services for raw DNA interpretation. Participants were highly motivated to explore raw DNA for ancestral information (67%), individual health implications (62%), or both (40%). Participants primarily used one of seven companies to interpret raw DNA; 73% used more than one. Company choice was driven by the type of results offered (51%), price (45%), and online reviews (31%). Approximately 30% of participants shared results with a medical provider and 21% shared with more than one. Outcomes of sharing ranged from disinterest/discounting of the information to diagnosis of genetic conditions. Participants were highly satisfied with their decision to analyze raw DNA (M = 4.54/5), yet challenges in understanding interpretation results were reported irrespective of satisfaction ratings. Consumers face challenges in understanding the results and may seek out clinical assistance in interpreting their raw DNA results. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
46 CFR 160.050-5 - Sampling, tests, and inspection.
2010-10-01
... one from which any sample ring life buoy failed the buoyancy or strength test, the sample shall... ring life buoys with this subpart. The manufacturer shall provide means to secure any test that is not... procedures. Table 160.050-5(e)—Sampling for Buoyancy Tests Lot size Number of life buoys in sample 100 and...
International Nuclear Information System (INIS)
Liu Shunmin; Yang Dawei; Li Rongwu; Li Guoxia; Cheng Huansheng; Zheng Jongxin; Chen Lifang
2010-01-01
In order to find out sources of raw, ingredients and classification relationship for Blue-and-White porcelain from Jingdezhen and Dehua area in different time, 34 Blue-and-White porcelain samples were selected. The chemical ingredients of every sample were determined by proton induced X-ray emission. The chemical ingredients data of all samples were further analyzed using fuzzy cluster analysis. The results indicate that the sources of raw and classification relationship of majority bodies from Blue-and-White porcelain of Dehua and Jingdezhen area are commendably differentiated. The sources of raw and batch formulas of eight transparent enamel samples from Jingdezhen area in Ming Dynasty and majority transparent enamel samples from Dehua area are commendably differentiated. Except one or two samples, majority Blue-and-White glaze samples from two areas are obviously different, and it might be an important path for non-destructive discrimination among Blue-and-White porcelains from two areas. (authors)
40 CFR 90.404 - Test procedure overview.
2010-07-01
... mode and five power modes at one speed (rated or intermediate). The test cycle for Class I-A, III, IV... measurement device. The exhaust gases generated during engine operation are sampled either raw or dilute and... fuel consumption. For Phase 2 Class I-B, Class I, and Class II natural gas fueled engines the test is...
DEFF Research Database (Denmark)
Walford, Antonia
2017-01-01
. Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....
Tracing and control of raw materials sourcing for vaccine manufacturers.
Faretra Peysson, Laurence
2010-05-01
The control of the raw materials used to manufacture vaccines is mandatory; therefore, a very clear process must be in place to guarantee that raw materials are traced. Those who make products or supplies used in vaccine manufacture (suppliers of culture media, diagnostic tests, etc.) must apply quality systems proving that they adhere to certain standards. ISO certification, Good Manufacturing Practices for production sites and the registration of culture media with a 'Certificate of Suitability' from the European Directorate for the Quality of Medicines and Healthcare are reliable quality systems pertaining to vaccine production. Suppliers must assure that each lot of raw materials used in a product that will be used in vaccine manufacture adheres to the level of safety and traceability required. Incoming materials must be controlled in a single 'Enterprise Resource Planning' system which is used to document important information, such as the assignment of lot number, expiration date, etc. Ingredients for culture media in particular must conform to certain specifications. The specifications that need to be checked vary according to the ingredient, based on the level of risk. The way a raw material is produced is also important, and any aspect relative to cross-contamination, such as the sanitary measures used in producing and storing the raw material must be checked as well. In addition, suppliers can reduce the risk of viral contamination of raw materials by avoiding purchases in countries where a relevant outbreak is currently declared. 2010 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.
Utilization of flotation wastes of copper slag as raw material in cement production
International Nuclear Information System (INIS)
Alp, I.; Deveci, H.; Suenguen, H.
2008-01-01
Copper slag wastes, even if treated via processes such as flotation for metal recovery, still contain heavy metals with hazardous properties posing environmental risks for disposal. This study reports the potential use of flotation waste of a copper slag (FWCS) as iron source in the production of Portland cement clinker. The FWCS appears a suitable raw material as iron source containing >59% Fe 2 O 3 mainly in the form of fayalite (Fe 2 SiO 4 ) and magnetite (Fe 3 O 4 ). The clinker products obtained using the FWCS from the industrial scale trial operations over a 4-month period were characterised for the conformity of its chemical composition and the physico-mechanical performance of the resultant cement products was evaluated. The data collected for the clinker products produced using an iron ore, which is currently used as the cement raw material were also included for comparison. The results have shown that the chemical compositions of all the clinker products including those of FWCS are typical of a Portland cement clinker. The mechanical performance of the standard mortars prepared from the FWCS clinkers were found to be similar to those from the iron ore clinkers with the desired specifications for the industrial cements e.g. CEM I type cements. Furthermore, the leachability tests (TCLP and SPLP) have revealed that the mortar samples obtained from the FWCS clinkers present no environmental problems while the FWCS could act as the potential source of heavy metal contamination. These findings suggest that flotation wastes of copper slag (FWCS) can be readily utilised as cement raw material due to its availability in large quantities at low cost with the further significant benefits for waste management/environmental practices of the FWCS and the reduced production and processing costs for cement raw materials
Utilization of flotation wastes of copper slag as raw material in cement production.
Alp, I; Deveci, H; Süngün, H
2008-11-30
Copper slag wastes, even if treated via processes such as flotation for metal recovery, still contain heavy metals with hazardous properties posing environmental risks for disposal. This study reports the potential use of flotation waste of a copper slag (FWCS) as iron source in the production of Portland cement clinker. The FWCS appears a suitable raw material as iron source containing >59% Fe(2)O(3) mainly in the form of fayalite (Fe(2)SiO(4)) and magnetite (Fe(3)O(4)). The clinker products obtained using the FWCS from the industrial scale trial operations over a 4-month period were characterised for the conformity of its chemical composition and the physico-mechanical performance of the resultant cement products was evaluated. The data collected for the clinker products produced using an iron ore, which is currently used as the cement raw material were also included for comparison. The results have shown that the chemical compositions of all the clinker products including those of FWCS are typical of a Portland cement clinker. The mechanical performance of the standard mortars prepared from the FWCS clinkers were found to be similar to those from the iron ore clinkers with the desired specifications for the industrial cements e.g. CEM I type cements. Furthermore, the leachability tests (TCLP and SPLP) have revealed that the mortar samples obtained from the FWCS clinkers present no environmental problems while the FWCS could act as the potential source of heavy metal contamination. These findings suggest that flotation wastes of copper slag (FWCS) can be readily utilised as cement raw material due to its availability in large quantities at low cost with the further significant benefits for waste management/environmental practices of the FWCS and the reduced production and processing costs for cement raw materials.
Aflatoxin M1 levels in raw milk, pasteurised milk and infant formula
Directory of Open Access Journals (Sweden)
Sharaf S. Omar
2016-06-01
Full Text Available The incidence of contamination of aflatoxin M1 (AFM1 in milk samples collected from the Jordanian market was investigated by using the competitive enzyme linked immunosorbent assay (ELISA technique. A total of 175 samples were collected during 2014-2015. All tested samples were contaminated with various levels of AFM1 ranging from 9.71 to 288.68 ng/kg. The concentration of AFM1 in 66% of fresh milk samples was higher than the maximum tolerance limit accepted by the European Union (50 ng/kg and 23% higher than the maximum tolerance limit accepted by the US (500 ng/kg. Percentages of contaminated raw cow, sheep, goat and camel milk exceeding the European tolerance limit were 60, 85, 75 and 0%, respectively. Of AFM1 contaminated pasteurised cow milk samples, 12% exceeded the European tolerance limit with a range of contamination between 14.60 and 216.78 ng/kg. For infant formula samples, the average concentration of AFM1 was 120.26 ng/kg (range from 16.55 to 288.68 ng/kg, the concentration of AFM1 in 85% of infant formula samples was higher than the maximum tolerance limit accepted by the European Union and the US (25 ng/kg.
Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.
Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy
2017-02-01
Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.
Zhang, Gong; Huang, Guangwei; Xiao, Lu; Mitchell, Alyson E
2011-11-23
A sensitive and reliable LC-(ESI)MS/MS method was developed and validated for the simultaneous analysis of five common advanced glycation endproducts (AGEs) after enzymatic digestion in raw and roasted almonds. AGEs included carboxymethyl-lysine (CML), carboxyethyl-lysine (CEL), pyralline (Pyr), argpyrimidine (Arg-p), and pentosidine (Pento-s). This method allows accurate quantitation of free and AGE-protein adducts of target AGEs. Results indicate that CML and CEL are found in both raw and roasted almonds. Pyr was identified for the first time in roasted almonds and accounted for 64.4% of free plus bound measured AGEs. Arg-p and Pento-s were below the limit of detection in all almond samples tested. Free AGEs accounted for 1.3-26.8% of free plus bound measured AGEs, indicating that protein-bound forms predominate. The roasting process significantly increased CML, CEL, and Pyr formation, but no significant correlation was observed between these AGEs and roasting temperature.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Coagulation effectiveness of graphene oxide for the removal of turbidity from raw surface water.
Aboubaraka, Abdelmeguid E; Aboelfetoh, Eman F; Ebeid, El-Zeiny M
2017-08-01
This study presents the performance of graphene oxide (GO) as a coagulant in turbidity removal from naturally and artificially turbid raw surface water. GO is considered an excellent alternative to alum, the more common coagulant used in water treatment processes, to reduce the environmental release of aluminum. Effects of GO dosage, pH, and temperature on its coagulation ability were studied to determine the ideal turbidity removal conditions. The turbidity removal was ≥95% for all levels of turbid raw surface water (20, 100, and 200 NTU) at optimum conditions. The role of alkalinity in inducing turbidity removal by GO coagulation was much more pronounced upon using raw surface water samples compared with that using artificially turbid deionized water samples. Moreover, GO demonstrated high-performance removal of biological contaminants such as algae, heterotrophic bacteria, and fecal coliform bacteria by 99.0%, 98.8% and 96.0%, respectively, at a dosage of 40 mg/L. Concerning the possible environmental release of GO into the treated water following filtration process, there was no residual GO in a wide range of pH values. The outcomes of the study highlight the excellent coagulation performance of GO for the removal of turbidity and biological contaminants from raw surface water. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lead, cadmium and chromium in raw and boiled portions of Norway lobster.
Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele
2014-01-01
Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.
The hygienic quality of raw reindeer milk
Directory of Open Access Journals (Sweden)
Joanna Kurki
2004-04-01
Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten
Ngasala, J Uma Bukuku; Nonga, Hezron Emmanuel; Mtambo, Mkumbukwa Madundo Angelo
2015-06-01
A cross-sectional study was conducted to assess the quality of raw milk and stakeholders' awareness on milk-borne health risks and factors for poor milk hygiene in Arusha City and Meru District, Tanzania between October and December 2012. A total of 105 smallholder dairy farmers, milk vendors and milk retailers were interviewed, and milk samples were collected for physical, microbial and antibiotic residue analysis using standard procedures. Questionnaire results indicated high level of awareness (94 %) that drinking raw milk can predispose consumers to milk-borne diseases; nevertheless, 65 % of respondents consumed raw milk. Physicochemical analyses showed some of the milk had sediments (20 %), bad smell (21 %) and had clotted on alcohol test (27 %). About 36 % of milk samples had pH below 6.6, and 25 % had specific gravity below 1.028 g/ml. The mean total viable count (TVC) of milk from vendors is significantly (P milk samples assessed had a higher TVC than the level recommended (2.0 × 10(5) cfu/ml) by the East African Community (EAC) standards. Up to 91 % of the milk samples had bacterial growth that included Eschericia coli (66 %), Staphylococcus aureus (33 %), Corynebacterium (11 %) and Pseudomonas (10 %). All smallholder dairy farmers were aware of drug residues, but majority (57 %) were unaware of human health effects caused by veterinary drug residues in milk. Up to 97 % of respondents reported to comply with drug withdrawal periods. This possibly led to all milk samples analysed to be negative from detectable levels of antibiotic residues. It is concluded that the level of awareness on milk quality is high, although practices associated with milking and post-harvest handling predispose milk to bacterial contamination which is a public health risk to milk consumers.
Remediation of raw sewage water by ionizing radiation
International Nuclear Information System (INIS)
El-Motaium, R.A.; Laroussi, B.F.
2007-01-01
Raw sewage water has been used for irrigation in many countries in the world including Egypt. Although the reuse of sewage water for irrigation has become essential, this practice could represent a hazard to the environment and human health. Radiation treatment was applied to test its effect on the remediation of raw sewage water collected from the inlet of El-Gabal El-Asfar Waste Water Treatment Plant, north east of Cairo city. Different doses of gamma radiation and electron beam ( 0.5, 1.0, 1.5, 2.0, 2.5 KGy) were tested for their effects on raw sewage water properties. The parameters tested were total Coliform, BOD, COD, TSS, ph, EC, heavy metals, NH 4 and NO 3 . The data showed an inverse relationship between radiation dose and total Coliform, BOD, COD and TSS. This result proved true for both kinds of radiations. However, the effect of gamma radiation was more pronounced than the electron beam at the same dose. The lethal doses for total Coliform were 1.5 KGy and 3.0 KGy for gamma radiation and electron beam, respectively. Regarding ammonium and nitrate ions, there was a reduction in their content as the radiation dose increased. The reduction was 20% for NH 4 and 21% for NO 3 at 2.5 KGy dose using gamma or electron beam, respectively. The total heavy metals levels were 40.0, 5.8, 55.9, 0.55, 32.2 and 16.4 ppb for Ni, Co, Cu, Cd, Pb and Zn. The soluble fraction were 19.5, 3.3, 8.3, 0.02, 0.50, 3.1 ppb representing 49%, 58%, 15%, 3%, 1.6% and 19% of the total Ni, Co, Cu, Cd, Pb and Zn, respectively. In general, there was a tendency for reduction of the soluble fractions of heavy metals as the radiation dose increased
Norlia, Mahror; Nor-Khaizura, M A R; Selamat, Jinap; Abu Bakar, Fatimah; Radu, Son; Chin, Cheow Keat
2018-06-18
The peanut supply chain in Malaysia is dominated by three main stakeholders (importers, manufacturers, retailers). The present study, aimed to determine the levels and critical points of aflatoxins and fungal contamination in peanuts along the supply chain. Specifically, two types of raw peanuts and six types of peanut-based products were collected (N = 178). Samples were analysed for aflatoxins by using High Performance Liquid Chromatography. Results revealed that the aflatoxins contamination was significantly higher (P≤0.05) in raw peanuts and peanut-based products from the retailers. However, there was no significant different (P≥0.05) in fungal contamination for both types of peanuts except for the total fungal count in raw peanuts from the retailers. Furthermore, raw peanut kernels from the retailers were the most contaminated ones ranged from contamination (0.3 - 3.6 log CFU/g) was relatively higher in raw peanuts compared to that of peanut-based products (0.6 - 2.7 log CFU/g). In conclusion, the manufacturers and retailers were the critical points for aflatoxins contamination in peanuts. However, fungal contamination was more critical in the raw peanuts compared to peanut-based products. The study was limited by a minimal number of samples from the importer. Therefore, further investigations on a larger sample size should be conducted to confirm the findings in this present study.
Directory of Open Access Journals (Sweden)
Naim Deniz Ayaz
2016-08-01
Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.
Directory of Open Access Journals (Sweden)
Ingun Tryland
2015-02-01
Full Text Available The fully automated Colifast ALARMTM has been used for two years for daily monitoring of the presence/absence of Escherichia coli in 100 mL raw water at Oset drinking water treatment plant in Oslo, Norway. The raw water is extracted from 35 m depth from the Lake Maridalsvannet. E. coli was detected in 18% of the daily samples. In general, most samples positive for E. coli were observed during the autumn turnover periods, but even in some samples taken during warm and dry days in July, with stable temperature stratification in the lake, E. coli was detected. The daily samples gave useful additional information compared with the weekly routine samples about the hygienic raw water quality and the hygienic barrier efficiency of the lake under different weather conditions and seasons. The winter 2013/2014 was much warmer than the winter 2012/2013. The monitoring supported the hypothesis that warmer winters with shorter periods with ice cover on lakes, which may be a consequence of climate changes, may reduce the hygienic barrier efficiency in deep lakes used as drinking water sources.
CO2 Capture by Cement Raw Meal
DEFF Research Database (Denmark)
Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll
2013-01-01
The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....
Operability test procedure for PFP wastewater sampling facility
International Nuclear Information System (INIS)
Hirzel, D.R.
1995-01-01
Document provides instructions for performing the Operability Test of the 225-WC Wastewater Sampling Station which monitors the discharge to the Treated Effluent Disposal Facility from the Plutonium Finishing Plant. This Operability Test Procedure (OTP) has been prepared to verify correct configuration and performance of the PFP Wastewater sampling system installed in Building 225-WC located outside the perimeter fence southeast of the Plutonium Finishing Plant (PFP). The objective of this test is to ensure the equipment in the sampling facility operates in a safe and reliable manner. The sampler consists of two Manning Model S-5000 units which are rate controlled by the Milltronics Ultrasonic flowmeter at manhole No.C4 and from a pH measuring system with the sensor in the stream adjacent to the sample point. The intent of the dual sampling system is to utilize one unit to sample continuously at a rate proportional to the wastewater flow rate so that the aggregate tests are related to the overall flow and thereby eliminate isolated analyses. The second unit will only operate during a high or low pH excursion of the stream (hence the need for a pH control). The major items in this OTP include testing of the Manning Sampler System and associated equipment including the pH measuring and control system, the conductivity monitor, and the flow meter
Allergic reactions to raw, pasteurized, and homogenized/pasteurized cow milk
DEFF Research Database (Denmark)
Høst, A; Samuelsson, E G
1988-01-01
Five children aged 12-40 months with IgE-mediated adverse reactions to cow milk (immediate onset clinical pattern of cow milk allergy) were orally challenged double-blind in random order with three different milk preparations processed from the same batch of milk 1) raw untreated cow milk, 2......) pasteurized cow milk, 3) homogenized and pasteurized cow milk, and 4) Nutramigen (a commercial hypoallergenic infant formula based on hydrolysed casein) as placebo. Skin prick tests with the same preparations were also performed. On oral challenge the three different processed milk types provoked significant...... and similar allergic reactions in each child, and no adverse reactions followed the challenge with placebo (Nutramigen). Skin prick test with the same milk products were positive in all children and comparable to the results with an extract of purified raw cow milk protein (Soluprick), whereas Nutramigen did...
Mixing and sampling tests for Radiochemical Plant
International Nuclear Information System (INIS)
Ehinger, M.N.; Marfin, H.R.; Hunt, B.
1999-01-01
The paper describes results and test procedures used to evaluate uncertainly and basis effects introduced by the sampler systems of a radiochemical plant, and similar parameters associated with mixing. This report will concentrate on experiences at the Barnwell Nuclear Fuels Plant. Mixing and sampling tests can be conducted to establish the statistical parameters for those activities related to overall measurement uncertainties. Density measurements by state-of-the art, commercially availability equipment is the key to conducting those tests. Experience in the U.S. suggests the statistical contribution of mixing and sampling can be controlled to less than 0.01 % and with new equipment and new tests in operating facilities might be controlled to better accuracy [ru
Energy Technology Data Exchange (ETDEWEB)
Mello, Roberta Monteiro de
2006-07-01
In order to decrease environmental impact, caused by mud discarding and clay extraction in the ceramic industry, it was used residual mud from marble and granite companies for structural ceramic. Samples were collected in twelve different marble companies located at the metropolitan region of Sao Paulo. However, only four samples were selected, based on its different characteristics. Clay stone was the raw material chosen to prepare the structural ceramic, considering its high use in this segment. Samples and clay stone were both analysed by the following procedures: granulometric analysis, x-rays fluorescent chemical analysis and x-rays diffraction mineralogical analysis, besides, tests in the samples were conducted following NBR 10004 standards. Once raw materials were characterized, the plasticity test was conducted. Test specimen were molded with different levels of mud, then burned and submitted to technological tests, such as: mechanical resistance, water absorption, porosity, specific gravity and retraction, material dilation before burning process and scanning electron microscopy. The final results have shown the viability of using this kind of mud, and pointed some advantages on its usage, but taking in consideration some previous conditions to be adopted. (author)
Directory of Open Access Journals (Sweden)
Bhoomika
2016-09-01
Full Text Available Aim: To assess the prevalence of antimicrobial resistance producing extended-spectrum β-lactamases (ESBL (blaTEM, blaSHV, and blaCTX-M genes in Escherichia coli isolated from chicken meat, chevon meat, raw milk, and human urine and stool samples collected from tribal districts of Chhattisgarh, viz., Jagdalpur, Dantewada, Kondagaon, and Kanker. Materials and Methods: A total of 330 samples, comprising 98 chicken meat, 82 chevon meat, 90 raw milk, and 60 human urine and stool samples, were processed for isolation of E. coli. Isolates were confirmed biochemically and further tested against commonly used antibiotics to know their resistant pattern. The resistant isolates were tested for ESBL production by phenotypic method followed by characterization with molecular method using multiplex-polymerase chain reaction technique. Results: Overall 57.87% (191/330 samples were found positive for E. coli, which include 66.32% (65/98 chicken meat, 46.34% (38/82 chevon meat, 81.11% (73/90 raw milk, and 25% (15/60 human urine and stool samples. Isolates showed the highest resistance against cefotaxime (41.36% followed by oxytetracycline (34.03%, ampicillin (29.31%, cephalexin (24.60%, cefixime (16.75%, and ceftazidime (13.08%. Phenotypic method detected 10.99% (21/191 isolates as presumptive ESBL producers, however, molecular method detected 3.66% (7/191, 2.09% (4/191, and 0.00% (0/191 prevalence of blaTEM, blaCTX-M, and blaSHV, respectively. Conclusion: The present study indicates a high prevalence of E. coli in raw chicken meat, chevon meat, and milk due to poor hygienic practices. The antibiotic susceptibility test detected the presence of the resistance pattern against ESBL in E. coli isolated from raw chicken meat, chevon meat, milk, and also in human clinical samples is of great concern. The appearance of E. coli in the human food chain is alarming and requires adaptation of hygienic practices and stipulate use of antibiotics.
Reliability study: raw and make-up water system, Portsmouth Gaseous Diffusion Plant
International Nuclear Information System (INIS)
Peterman, S.M.; Wiehle, W.E.; Walder, A.; Houk, T.C.; West, R.M.
1981-09-01
A reliability study for determining the ability of the raw and make-up water system to provide reliable and adequate service through the year 2000 has been completed. This study includes an evaluation of the well fields, X-608 Raw Water Pump House, X-605 Booster Station Complex, X-611 Water Treatment Complex, and the associated piping. The raw and make-up water system is in good overall condition, but to maintain this condition, the reliability study team made the following recommendations: (1) increase well field capacity; (2) replace certain speed reducers at X-611; (3) repair deteriorated poles, crossarms, and accessories on F-2 and W-1 feeders; (4) stabilize the landslide in vicinity of the 48 in. raw water main; and (5) initiate further investigation, testing, or engineering studies to correct deficiencies in the supervisory control system between well fields, pump house, and X-611, and determine if the 2400 volt underground cables to X-608A wells should be replaced
Method for critical current testing
International Nuclear Information System (INIS)
Siddall, M.B.; Smathers, D.B.
1989-01-01
Superconducting critical current testing software was developed with four important features not feasible with analog test equipment. First, quasi-steady-state sample current conditions are achieved by incrementing sample current, followed by holding some milliseconds until the transient voltage decays before voltage sampling. Then the self-field correction from a helically wound sample is computed and subtracted from each sampled field reading. A copper wire inductively wound shunt which is used for quench protection has a constant measured resistance from which the shunt leakage current is computed and subtracted from the sample current by measuring the shunt voltage after each sample current reading. Finally, the critical current is recomputed from a least squares curve fit to the power law: E=A*In when the correlation coefficient for the fit is high enough to ensure a better result than the raw datum. Comparison with NBS Standard Reference Material (NbTi) and current round robin Nb/sub 3/Sn testing is examined
An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.
Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar
2016-11-01
Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.
40 CFR 205.171-3 - Test motorcycle sample selection.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test motorcycle sample selection. 205... ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycle Exhaust Systems § 205.171-3 Test motorcycle sample selection. A test motorcycle to be used for selective enforcement audit testing...
Effect of Raw Crushed Garlic (Allium sativum L.) on Components of Metabolic Syndrome.
Choudhary, Prema Ram; Jani, Rameshchandra D; Sharma, Megh Shyam
2017-09-28
Metabolic syndrome consists of a group of risk factors characterized by abdominal obesity, hypertension, atherogenic dyslipidemia, hyperglycemia, and prothrombotic and proinflammatory conditions. Raw garlic homogenate has been reported to reduce serum lipid levels in animal model; however, no precise studies have been performed to evaluate the effect of raw crushed garlic (Allium sativum L.) on components of metabolic syndrome. Therefore, the present study was designed to investigate the effect of raw crushed garlic on components of metabolic syndrome. A total of 40 metabolic syndrome patients were randomly selected from the diabetic center of SP Medical College, Bikaner, Rajasthan, India. They underwent treatment with 100 mg/kg body weight raw crushed garlic 2 times a day with standard diet for 4 weeks; their anthropometric and serum biochemical variables were measured at both the beginning and the end of the study. Statistical analysis was performed using IBM SPSS version 20, and Student's paired "t" test was used to compare variables before and after treatment with garlic preparation. Raw crushed garlic significantly reduced components of metabolic syndrome including waist circumference (p .05) of patients with metabolic syndrome after consumption of raw crushed garlic for 4 weeks. Raw crushed garlic has beneficial effects on components of metabolic syndrome; therefore, it can be used as an accompanying remedy for prevention and treatment of patients with metabolic syndrome.
Artificial neural network as the tool in prediction rheological features of raw minced meat
Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko
2012-01-01
Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...
Food safety hazards associated with consumption of raw milk.
Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E
2009-09-01
An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.
Pamela G. Sikkink; Roy Renkin; Geneva Chong; Art Sikkink
2013-01-01
The five field sampling methods tested for this study differed in richness and Simpson's Index values calculated from the raw data. How much the methods differed, and which ones were most similar to each other, depended on which diversity measure and which type of data were used for comparisons. When the number of species (richness) was used as a measure of...
Determination of Antibiotic Residues in Milk by Microbial Inhibitory Tests
Directory of Open Access Journals (Sweden)
Juščáková D.
2017-09-01
Full Text Available Undesirable substances enter the organism of animals mostly via feed, water or veterinary medicines and their residues pass subsequently into the products of animal origin. In dairy cows, sheep and goats these residues are eliminated particularly in milk. Milk intended for human consumption must comply with safety criteria also with respect to residues of antibiotics. The aim of this study was to determine the presence or absence of antibiotic residues in the milk using the tests Milchtest and Premi®Test. While the Milchtest was developed for the determination of antibiotic residues in cow, sheep and goat milk, the Premi®Test is intended for the determination of antibiotic residues in meat juice, liver, kidneys, fish, eggs and in the urine of animals treated with antibiotics. As examined matrices, we used 45 samples of raw cow’s milk collected at 3 agricultural farms and 10 samples of milk offered to consumers at grocery stores. When using the Milchtest, 8 samples tested positive and 10 provided dubious results while testing with the Premi®Test showed that only 6 samples were positive for antibiotics. Comparison of the results confirmed a higher detection sensitivity of Milchtest reflected in higher numbers of positive samples and the detection of dubious results in samples of raw cow’s milk. However, it should be noted that even the Premi®Test, although not intended preferably for the determination of antibiotics in milk, can be used, if needed, for the preliminary screening of antibiotic residues in such a matrix.
Directory of Open Access Journals (Sweden)
Sim Kheng Yuen
2016-01-01
Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.
THE COMPRESSIVE AND FLEXURAL STRENGTHS OF SELF-COMPACTING CONCRETE USING RAW RICE HUSK ASH
Directory of Open Access Journals (Sweden)
MD NOR ATAN
2011-12-01
Full Text Available This study investigates the compressive and flexural strengths of self-compacting concrete incorporating raw rice husk ash, individually and in combination with other types of mineral additives, as partial cement replacement. The additives paired with raw rice husk ash were fine limestone powder, pulverized fuel ash and silica fumes. The mix design was based on the rational method where solid constituents were fixed while water and superplasticizer contents were adjusted to produce optimum viscosity and flowability. All mixes were designed to achieve SF1 class slump-flow with conformity criteria ≥ 520 mm and ≤ 700 mm. Test results show that 15% replacement of cement using raw rice husk ash produced grade 40 concrete. It was also revealed that 30% and 45% cement replacements using raw rice husk ash combined with limestone powder and raw rice husk ash combined with limestone powder and silica fume respectively, produced comparable compressive strength to normal concrete and improved flexural strengths.
Test plan for core sampling drill bit temperature monitor
International Nuclear Information System (INIS)
Francis, P.M.
1994-01-01
At WHC, one of the functions of the Tank Waste Remediation System division is sampling waste tanks to characterize their contents. The push-mode core sampling truck is currently used to take samples of liquid and sludge. Sampling of tanks containing hard salt cake is to be performed with the rotary-mode core sampling system, consisting of the core sample truck, mobile exhauster unit, and ancillary subsystems. When drilling through the salt cake material, friction and heat can be generated in the drill bit. Based upon tank safety reviews, it has been determined that the drill bit temperature must not exceed 180 C, due to the potential reactivity of tank contents at this temperature. Consequently, a drill bit temperature limit of 150 C was established for operation of the core sample truck to have an adequate margin of safety. Unpredictable factors, such as localized heating, cause this buffer to be so great. The most desirable safeguard against exceeding this threshold is bit temperature monitoring . This document describes the recommended plan for testing the prototype of a drill bit temperature monitor developed for core sampling by Sandia National Labs. The device will be tested at their facilities. This test plan documents the tests that Westinghouse Hanford Company considers necessary for effective testing of the system
Hemachandra, Chamini K; Pathiratne, Asoka
2017-01-01
Biological effect directed in vivo tests with model organisms are useful in assessing potential health risks associated with chemical contaminations in surface waters. This study examined the applicability of two in vivo test systems viz. plant, Allium cepa root based tests and fish, Oreochromis niloticus erythrocyte based tests for screening cytogenotoxic potential of raw source water, water treatment waste (effluents) and treated water of drinking water treatment plants (DWTPs) using two DWTPs associated with a major river in Sri Lanka. Measured physico-chemical parameters of the raw water, effluents and treated water samples complied with the respective Sri Lankan standards. In the in vivo tests, raw water induced statistically significant root growth retardation, mitodepression and chromosomal abnormalities in the root meristem of the plant and micronuclei/nuclear buds evolution and genetic damage (as reflected by comet scores) in the erythrocytes of the fish compared to the aged tap water controls signifying greater genotoxicity of the source water especially in the dry period. The effluents provoked relatively high cytogenotoxic effects on both test systems but the toxicity in most cases was considerably reduced to the raw water level with the effluent dilution (1:8). In vivo tests indicated reduction of cytogenotoxic potential in the tested drinking water samples. The results support the potential applications of practically feasible in vivo biological test systems such as A. cepa root based tests and the fish erythrocyte based tests as complementary tools for screening cytogenotoxicity potential of the source water and water treatment waste reaching downstream of aquatic ecosystems and for evaluating cytogenotoxicity eliminating efficacy of the DWTPs in different seasons in view of human and ecological safety. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mahmoodi, M; Islami, M R; Asadi Karam, G R; Khaksari, M; Sahebghadam Lotfi, A; Hajizadeh, M R; Mirzaee, M R
2006-10-01
Hyperlipidemia is one of the famous disorders that can lead to atherosclerosis. Garlic has been considered as one of the blood lipids lowering agents for ages, and various studies have been carried out, some of them confirmed this effect of garlic and some did not. The aim of this study was to evaluate the effect of raw garlic consumption on human blood biochemical factors in hyperlipidemic individuals. This clinical trial was conducted on 30 volunteer individuals with blood cholesterol higher than 245 mg/dl. Fasting blood samples were collected for biochemical tests. The volunteers consumed 5 g raw garlic twice a day for 42 days. Second fasting blood samples were collected and the individuals did not use any kind of garlic for next 42 days. After that, the third fasting blood samples were collected and the biochemical factors were measured. After 42 days of garlic consumption the mean of blood total cholesterol (pconsumption total cholesterol (pconsumption alone can decrease serum lipids, but it cannot be used as the main therapeutic agent for hyperlipidemia. Garlic can be used in mild hyperlipidemia or when the patients cannot tolerate the chemical drugs.
Composition of raw cow milk and artisanal yoghurt collected in ...
African Journals Online (AJOL)
The composition of milk is of most importance to the dairy industry and human health. This study was conducted to provide data on the composition of raw cow milk and artisanal yoghurt collected in Maroua (Cameroon). Milk and yoghurt samples were collected from 11 breeding sites and 12 producers in the city of Maroua, ...
Estimation of sample size and testing power (part 5).
Hu, Liang-ping; Bao, Xiao-lei; Guan, Xue; Zhou, Shi-guo
2012-02-01
Estimation of sample size and testing power is an important component of research design. This article introduced methods for sample size and testing power estimation of difference test for quantitative and qualitative data with the single-group design, the paired design or the crossover design. To be specific, this article introduced formulas for sample size and testing power estimation of difference test for quantitative and qualitative data with the above three designs, the realization based on the formulas and the POWER procedure of SAS software and elaborated it with examples, which will benefit researchers for implementing the repetition principle.
Quality aspects of raw goat milk in Lower Southern Thailand
Siriwat Wasiksiri; Usa Chethanond; Sahutaya Pongprayoon; Somjit Srimai; Bunjob Nasae
2010-01-01
This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05) on pH and total plate count among samples from eachfarm. However...
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
CONTRIBUTION TO THE DEBATE ON THE MICROBIOLOGICAL QUALITY OF RAW MILK FROM VENDING MACHINES
Directory of Open Access Journals (Sweden)
Ján Šnelcer
2011-07-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE MicrosoftInternetExplorer4 Microbiological quality or raw milk from vending maschine was analyzed in this work. Despite the pathogenic bacteria may be present in raw milk, the analyses and evaluations were focused to bacterial indicators only. Refer to total bacterial counts, the criterion ≤ 100,000 cfu/ml met 12 from 15 samples (80% and all samples complied with the supplementary criterion of 5×104 cfu/ml for psychrotrophs. Numbers of coagulase-positive staphylococci ranged closely around the average value 2.9×102 cfu/ml. Average numbers of coliforms and E. coli in raw milk were found 4.34 ± 0.42 and 3.25 ± 0.83 log CFU/ml, respectively. These values significantly exceeded even the limits applicable in the past. On the basis of unchanged numbers of these bacteria in milk after 24 h at 6 °C, we assume that the high numbers of coliforms and E. coli present in milk are the result of fecal contamination and not growth. As E. coli is an indicator of faecal contamination of raw milk comprising the possible presence of Salmonella sp. Campylobacter sp. and other pathogens, microbiological survey suggested appropriate preventive measures that should be applied in terms of risk management.doi:10.5219/98
Prevalence and quantification of Vibrio parahaemolyticus in raw salad vegetables at retail level.
Tunung, Robin; Margaret, Selina; Jeyaletchumi, Ponniah; Chai, Lay C; Tuan Zainazor, Tuan C; Ghazali, Farinazleen M; Nakaguchi, Yoshitsugu; Nishibuchi, Mitsuaki; Son, Radu
2010-02-01
The purpose of this study was to investigate the biosafety of Vibrio parahaemolyticus in raw salad vegetables at wet market and supermarket in Malaysia. A combination of Most Probable Number - Polymerase Chain Reaction (MPN-PCR) method was applied to detect the presence of V. parahaemolyticus and to enumerate their density in the food samples. The study analyzed 276 samples of common vegetables eaten raw in Malaysia (Wild cosmos = 8; Japanese parsley = 21; Cabbage = 30; Lettuce = 16; Indian pennywort = 17; Carrot = 31; Sweet potato = 29; Tomato = 38; Cucumber = 28; Four winged bean = 26; Long bean = 32). The samples were purchased from two supermarkets (A and B) and two wet markets (C and D). The occurrence of V. parahaemolyticus detected was 20.65%, with higher frequency of V. parahaemolyticus in vegetables obtained from wet markets (Wet market C = 27.27%Wet Market D = 32.05%) compared to supermarkets (Supermarket A = 1.64%; Supermarket B = 16.67%). V. parahaemolyticus was most prevalent in Indian pennywort (41.18%). The density of V. parahaemolyticus in all the samples ranged from 2400 MPN/g, mostly Malaysia.
Raw sewage as breeding site to Aedes (Stegomyia) aegypti (Diptera, culicidae).
Chitolina, R F; Anjos, F A; Lima, T S; Castro, E A; Costa-Ribeiro, M C V
2016-12-01
The selection of oviposition sites by females of Aedes (Stegomyia) aegypti is a key factor for the larval survival and egg dispersion and has a direct influence in vector control programs. In this study, we evaluated the aspects of reproductive physiology of Ae. aegypti mosquitoes tested in the presence of raw sewage. Ae. aegypti females were used in oviposition bioassays according to two methodologies: (i) choice assay, in which three oviposition substrates were offered in the same cage: treatment (raw sewage), positive control (distilled water) and negative control (1% sodium hypochlorite) and; (ii) no choice assay, in which only one substrate was available. The physicochemical and microbiological analysis of the raw sewage used in this study indicated virtually no levels of chlorine, low levels of dissolved oxygen and high levels of nitrogenous compounds as well as the presence of Escherichia coli and total fecal coliforms. After 72h of oviposition, the eggs were counted and there was no statistically significant difference (p>0.05) in the oviposition rate between raw sewage and positive control in both methodologies. In addition, females were dissected to evaluate egg-retention and also there were no appreciable differences in egg retention even when raw sewage was the only substrate offered. The data also showed that egg hatching and larvae development occurred normally in the raw sewage. Therefore, the present study suggests that Ae. aegypti can adapt to new sites and lay eggs in polluted water, such as the raw sewage. These findings are of particular importance for the control and surveillance programs against Ae. aegypti in countries where the conditions of poor infrastructure and lack of basic sanitation are still an issue. Copyright © 2016 Elsevier B.V. All rights reserved.
Testing of Small Graphite Samples for Nuclear Qualification
Energy Technology Data Exchange (ETDEWEB)
Julie Chapman
2010-11-01
Accurately determining the mechanical properties of small irradiated samples is crucial to predicting the behavior of the overal irradiated graphite components within a Very High Temperature Reactor. The sample size allowed in a material test reactor, however, is limited, and this poses some difficulties with respect to mechanical testing. In the case of graphite with a larger grain size, a small sample may exhibit characteristics not representative of the bulk material, leading to inaccuracies in the data. A study to determine a potential size effect on the tensile strength was pursued under the Next Generation Nuclear Plant program. It focuses first on optimizing the tensile testing procedure identified in the American Society for Testing and Materials (ASTM) Standard C 781-08. Once the testing procedure was verified, a size effect was assessed by gradually reducing the diameter of the specimens. By monitoring the material response, a size effect was successfully identified.
Nichols, R. A. B.; Connelly, L.; Sullivan, C. B.; Smith, H. V.
2010-01-01
We analyzed 1,042 Cryptosporidium oocyst-positive slides (456 from raw waters and 586 from drinking waters) of which 55.7% contained 1 or 2 oocysts, to determine species/genotypes present in Scottish waters. Two nested PCR-restriction fragment length polymorphism (RFLP) assays targeting different loci (1 and 2) of the hypervariable region of the 18S rRNA gene were used for species identification, and 62.4% of samples were amplified with at least one of the PCR assays. More samples (577 slides; 48.7% from raw water and 51.3% from drinking water) were amplified at locus 1 than at locus 2 (419 slides; 50.1% from raw water and 49.9% from drinking water). PCR at loci 1 and 2 amplified 45.4% and 31.7% of samples containing 1 or 2 oocysts, respectively. We detected both human-infectious and non-human-infectious species/genotype oocysts in Scottish raw and drinking waters. Cryptosporidium andersoni, Cryptosporidium parvum, and the Cryptosporidium cervine genotype (now Cryptosporidium ubiquitum) were most commonly detected in both raw and drinking waters, with C. ubiquitum being most common in drinking waters (12.5%) followed by C. parvum (4.2%) and C. andersoni (4.0%). Numerous samples (16.6% total; 18.9% from drinking water) contained mixtures of two or more species/genotypes, and we describe strategies for unraveling their identity. Repetitive analysis for discriminating mixtures proved useful, but both template concentration and PCR assay influenced outcomes. Five novel Cryptosporidium spp. (SW1 to SW5) were identified by RFLP/sequencing, and Cryptosporidium sp. SW1 was the fourth most common contaminant of Scottish drinking water (3%). PMID:20639357
Myrmel, M; Lange, H; Rimstad, E
2015-09-01
A study of enteric viruses in raw and treated sewage from two secondary treatment plants, which received sewage from Oslo city (plant A) and small municipalities in Hedmark county in Norway (plant B), showed high levels of noro-, adeno-, and bocavirus throughout the year. A seasonal variation was observed for adeno- and GII norovirus with higher levels during winter and bocavirus that had more positive samples during winter. The virus concentrations in raw sewage were comparable in the two plants, with medians (log10 genome copies per liter) of 6.1, 6.3, 6.0, and 4.5 for noro GI, noro GII, adeno-, and bocavirus, respectively. The level of hepatitis E virus was not determined as it was below the limit of quantification. The mean log10 virus reduction was 0.55 (plant A) and 1.44 (plant B) with the highest reduction found in the plant with longer hydraulic retention time. The adenoviruses were dominantly serotype 41, while serotype 12 appeared sporadically. Of the 102 raw and treated sewage samples that were tested, eight were positive for hepatitis E virus of which four were from treated sewage. Two of the four obtained gene sequences from hepatitis E virus originated from the rural sewage samples and showed high similarity with a genotype 3 strain of hepatitis E virus detected in local piglets. Two other hepatitis E virus sequences obtained from urban sewage samples showed high similarities with genotype 3 strains isolated from urban sewage in Spain and a human genotype 1 isolate from India. The study gives information on the levels of noroviruses in raw and treated sewage, which is valuable to risk assessment, information indicating that some infections with hepatitis E viruses in Norway have a regional origin and that human bocavirus 2 and 3 are prevalent in the Norwegian population.
Visual and colorimetric methods for rapid determination of total tannins in vegetable raw materials
Directory of Open Access Journals (Sweden)
S. P. Kalinkina
2016-01-01
Full Text Available The article is dedicated to the development of rapid colorimetric method for determining the amount of tannins in aqueous extracts of vegetable raw materials. The sorption-based colorimetric test is determining sorption tannins polyurethane foam, impregnated of FeCl3, receiving on its surface painted in black and green color of the reaction products and the determination of their in sorbent matrix. Selectivity is achieved by determining the tannins specific interaction of polyphenols with iron ions (III. The conditions of sorption-colorimetric method: the concentration of ferric chloride (III, impregnated in the polyurethane foam; sorbent mass in the analytical cartridge; degree of loading his agent; the contact time of the phases. color scales have been developed for the visual determination of the amount of tannins in terms of gallic acid. Spend a digitized image obtained scales using computer program “Sorbfil TLC”, excluding a subjective assessment of the intensity of the color scale of the test. The results obtained determine the amount of tannins in aqueous extracts of vegetable raw rapid method using tablets and analytical cartridges. The results of the test determination of tannins with visual and densitometric analytical signal registration are compared to known methods. Spend a metrological evaluation of the results of determining the amount of tannins sorption rapid colorimetric methods. Time visual and densitometric rapid determination of tannins, taking into account the sample preparation is 25–30 minutes, the relative error does not exceed 28 %. The developed test methods for quantifying the content of tannins allow to exclude the use of sophisticated analytical equipment, carry out the analysis in non-laboratory conditions do not require highly skilled personnel.
Directory of Open Access Journals (Sweden)
Wiwik Sudarwati
2017-07-01
Full Text Available The raw material inventory control system determines and guarantees the availability of raw material stock in the right quantity quality and timing. The problem in this research is the procurement of raw materials of tobacco. PR. Sukun still often experiences the excess. This is related to the frequency of raw material purchases and the quantity of raw material purchases which can lead to waste of working capital embedded in raw material inventory raw material ordering costs and raw material storage costs. The purpose of this research is to know how to make an efficiency level in procurement of raw material inventory between EOQ method compared with policy of PR. Sukun. The type of research used is analytic descriptive type. Data analysis begins by analyzing raw material quantity comparison total raw material inventory cost and raw material cost between PR Sukun policy with EOQ method. Based on the results of research known that by using EOQ method can be much more efficient compared to policy of PR. Sukun. The quantity and frequency of purchasing raw materials is less but still take into account the safety stock and reorder point so the production process is not disturbed. In addition the cost of purchasing ordering costs and raw materials storage costs less so as to create efficiencies on the cost of raw materials inventory. PR. Sukun in the procurement of raw material inventory should use EOQ method to be more efficient and take into account the safety stock and reorder point to avoid the inventory excess of raw materials.
Evaluation of raw milk quality in three subregions of the department of Sucre, Colombia
Directory of Open Access Journals (Sweden)
Alberto Romero P
2018-03-01
Full Text Available The objective was to evaluate the physicochemical, microbiological quality, somatic cell count and presence of inhibitors in raw milks in the department of Sucre. 150 samples of raw milk from six storage centers or processing plants from three subregions of the department of Sucre (Sabanas, San Jorge and Gulf of Morrosquillo were taken using a descriptive cross-sectional study. 25 samples in each collection center that correspond to 25 producers from the different subregions of the department were taken. Microbiological and physiochemical parameters and udder health were determined of a total of 50 samples for each subregion. The data obtained were analyzed according to accepted standards in Colombia. For the most part of the physicochemical parameters, were within the accepted values established in decree 616 of 2006 and decree 1880of 2011(protein ≥2.9%, fat ≥3.0%, density (15oC ≥1.030, TS ≥11.30, SNF ≥8.30. The count of colony forming units (CFU/mL in the different subregions was greater than 600,000 CFU/mL. The somatic cell count (SCC/mL was greater than 500,000 SCC/mL. In 8% of the sampled milks showed presence of inhibitors. Overall, the raw milk had good physicochemical quality but, the microbiological quality and health of the udder were poor, which requires immediate implementation of programs in order to obtain high quality hygienic milk.
SAR Raw Data Generation for Complex Airport Scenes
Directory of Open Access Journals (Sweden)
Jia Li
2014-10-01
Full Text Available The method of generating the SAR raw data of complex airport scenes is studied in this paper. A formulation of the SAR raw signal model of airport scenes is given. Via generating the echoes from the background, aircrafts and buildings, respectively, the SAR raw data of the unified SAR imaging geometry is obtained from their vector additions. The multipath scattering and the shadowing between the background and different ground covers of standing airplanes and buildings are analyzed. Based on the scattering characteristics, coupling scattering models and SAR raw data models of different targets are given, respectively. A procedure is given to generate the SAR raw data of airport scenes. The SAR images from the simulated raw data demonstrate the validity of the proposed method.
International Nuclear Information System (INIS)
Zarzycki, Pawel K.; Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J.
2011-01-01
The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.
Energy Technology Data Exchange (ETDEWEB)
Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)
2011-03-04
The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.
A One-Sample Test for Normality with Kernel Methods
Kellner , Jérémie; Celisse , Alain
2015-01-01
We propose a new one-sample test for normality in a Reproducing Kernel Hilbert Space (RKHS). Namely, we test the null-hypothesis of belonging to a given family of Gaussian distributions. Hence our procedure may be applied either to test data for normality or to test parameters (mean and covariance) if data are assumed Gaussian. Our test is based on the same principle as the MMD (Maximum Mean Discrepancy) which is usually used for two-sample tests such as homogeneity or independence testing. O...
40 CFR 205.160-2 - Test sample selection and preparation.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test sample selection and preparation... sample selection and preparation. (a) Vehicles comprising the sample which are required to be tested... maintained in any manner unless such preparation, tests, modifications, adjustments or maintenance are part...
Directory of Open Access Journals (Sweden)
O.Yu. Kuznetsova
2016-03-01
Full Text Available High-frequency capacitive discharge (RF plasma at low pressure was used as preliminary stage for the intensification of extraction from natural medicinal raw material. RF-plasma treatment was carried out in two modes differed by the nature of plasma-forming gas. Chaga (Inonotus obliquus (Pers. Pil. known as the birch mushroom was selected as a perspective source of raw material. Extraction was carried out in two ways – remaceration and maceration. The analy-sis of chaga extracts and melanins was performed using traditional techniques including determination of physical and chemical, antioxidant and spectral characteristics. The obtained extracts and melanins were compared to the control samples and literature data. RF-plasma treatment of medicinal raw material increased the yield of extractive substances, in particular of the main active component of chaga – melanin. The antioxidant activity of chaga extracts grew, while for melanins it remained at the level similar to that of control samples. The IR spectral characteristics of the studied chaga melanins are similar and agree well with the literature data. Insignificant deviations in the position and intensity of absorption strips were observed for the samples after RF treatment. IR spectra of the studied chaga melanins are similar to those for mushroom melanins, thereby confirming the similarity in their nature. RF-plasma treatment of chaga medicinal raw materials allows to modify them partially. The structural and mechanical properties of melanins modified by RF plasma remain the same.
International Nuclear Information System (INIS)
Cabral, R.G.
1981-02-01
The feasibility of the determination of uranium in oil shale, by the fission track registration technique is studied. The wet and dry methods were employed, using a Bayer policarbonate, Makrofol KG, as detector. It was created a new variant of the dry method. The fission track registration technique was used in samples of raw, retorted and spent shale from Irati, Parana in Brazil, 16 μg U/g, 20 μg U/g and 20μg U/g were found, respectively, with a total error ranging from 19% to 20%. Some experimental results were included for illustration and comparison. The feasibility of the determination of uranium in oil shale from Irati was verified. (Author) [pt
Method for online measurement of the CHON composition of raw gas from biomass gasifier
International Nuclear Information System (INIS)
Neves, Daniel; Thunman, Henrik; Tarelho, Luís; Larsson, Anton; Seemann, Martin; Matos, Arlindo
2014-01-01
Highlights: • Measuring the CHON composition of a raw gas by current methods is challenging. • An alternative method is to burn the raw gas before measuring the CHON composition. • The CHON contents of the raw gas can be accurately measured by the alternative method. • Measuring the CHON contents of the raw gas is now performed in a “one-step” analysis. • The new method is used to evaluate the operation of a dual fluidised bed gasifier. - Abstract: For unattended biomass gasification processes, rapid methods for monitoring the elemental composition (CHON) of the raw gas leaving the gasifier are needed. Conventional methods rely on time-consuming and costly laboratory procedures for analysing the condensable part of the raw gas. An alternative method, presented in this work, assesses the CHON composition of raw gas in a “one step” analysis without the need to previously characterise its chemical species composition. Our method is based on the quantitative conversion of a raw gas of complex chemical composition into CO 2 , H 2 O, and N 2 in a small combustor. The levels of these simple species can be measured with high accuracy and good time resolution, and the CHON composition of the raw gas can be determined from the mass balance across the combustor. To evaluate this method, an online combustion facility was built and used to analyse the raw gas from the Chalmers 2-MW th dual fluidised bed steam gasifier. Test runs of the developed facility demonstrated complete combustion of the raw gas and the measurements were both fast and reliable. The new method used in combination with zero-dimensional reactor modelling provides valuable data for the operational monitoring of gasification processes, such as the degree of fuel conversion, composition of the char exiting the gasifier, oxygen transport by catalytic bed material, and amount of condensables in raw gas
Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil
Directory of Open Access Journals (Sweden)
Helena Fagundes
2010-06-01
Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.
Prairie Canal Well No. 1, Calcasieu Parish, Louisiana. Volume II. Well test data. Final report
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
The following are included in appendices: field test data, field non-edited data, raw data, tentative method of testing for hydrogen sulfide in natural gas using length of stain tubes, combined sample log, report on reservoir fluids study, well test analysis, analysis of solids samples from primary zone, chemical analysis procedures, scale and corrosion evaluation, laboratory report on scale deposits, and sand detector strip charts. (MHR)
van Zyl, W. B.; Page, N. A.; Grabow, W. O. K.; Steele, A. D.; Taylor, M. B.
2006-01-01
Group A rotaviruses (RVs) are the most important cause of acute viral gastroenteritis in infants and young children. In this study raw and treated drinking water supplies at plants in two geographic areas, as well as selected irrigation water and corresponding raw vegetables in three regions of southern Africa, were screened for the presence of RVs using molecular techniques. Group A RVs were detected in 11.8% of partially treated and 1.7% of finally treated drinking water samples and in 14% of irrigation water samples and 1.7% of corresponding raw vegetable samples. Type-specific reverse transcriptase-PCR and sequence analysis revealed the presence of multiple types (G1, G2, G8, and G9) in irrigation water and single types (G1 or G3) in raw and treated drinking water. Group A RVs detected in all samples consisted of mixed P types (P[4], P[6], P[8], and P[9]), with P[6] predominating. The detection of types G8, G9, and P[6] reflects the emergence of these types in clinical infections. The similarity of environmental types to those in patients with clinical RV infections confirms the value of wastewater screening as a tool for assessing RVs circulating in communities, with the benefit of detecting types that cause both clinical and subclinical infections. The results provide new information on RV types in water and related environments and identify the potential risk of waterborne transmission. In addition, the presence of RVs in drinking water underlines shortcomings in quality specifications. These data provide valuable information regarding the prevalence of RVs in environmental sources, with important implications for vaccine development. PMID:16820443
2010-07-01
... MINING PRODUCTS REQUIREMENTS FOR THE APPROVAL OF FLAME-RESISTANT CONVEYOR BELTS General Provisions § 14.5 Test samples. Upon request by MSHA, the applicant must submit 3 precut, unrolled, flat conveyor belt...
Visciano, Pierina; Perugini, Monia; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Salese, Carmine; Amorena, Michele
2013-12-18
The distribution of total arsenic in different portions of Norway lobster (Nephrops norvegicus L., Crustacea) was studied both in fresh samples and after a boiling process. All individuals (n = 80) were selected of medium standard commercial size (13-15 cm). The highest mean concentrations (26.86 ± 1.57 mg/kg wet weight (ww)) were found in the raw brown meat of the crustacean, probably due to its detoxification role, whereas the lowest mean values (15.97 ± 0.85 mg/kg ww) were in the raw exoskeleton. The raw white meat reported mean values of 16.09 ± 0.61 mg/kg ww. The levels of arsenic contamination detected in the boiled portions showed a significant (p < 0.01) decrease compared to the raw portions, as a consequence of solubilization phenomena. In fact, a large amount of arsenic from raw lobsters was transferred to the corresponding boiling broth. In the most commonly consumed portion, the white meat, only slight losses (7.22%) in total arsenic content were observed compared to the raw portion.
Tylosin production by Streptomyces fradiae using raw cornmeal in airlift bioreactor.
Choi, Dubok; Choi, On You; Shin, Hyun-Jae; Chung, Dong-Ok; Shin, Dae-Yewn
2007-07-01
Using a 50-l airlift bioreactor, for the effective production of tylosin from Streptomyces fradiae TM-224 using raw cornmeal as the energy source, various environmental factors were studied in flask cultures. The maximum tylosin concentration was obtained at 32 degrees C and pH between 7.0 and 7.5. When seed was inoculated after 24 h of culture, the maximum tylosin concentration, 5.7 g/l, was obtained after 4 days of culture. Various concentrations of raw cornmeal were tested to investigate the optimum initial concentration for the tylosin production. An initial raw cornmeal concentration of 80 g/l gave the highest tylosin concentration, 5.8 g/l, after 5 days of culture. Of the various nitrogen sources, soybean meal and fish meal were found to be the most effective for the production of tylosin. In particular, with the optimal mixing ratio, 12 g/l of soybean meal to 14 g/l of fish meal, 7.2 g/l of tylosin was obtained after 5 days of culture. To compare raw cornmeal and glucose for the production oftylosin in the 50-1 airlift bioreactor for 10 days, fed-batch cultures were carried out under the optimum culture conditions. When raw corn meal was used as the energy source, the tylosin production increased with increasing culture time. The maximum tylosin concentration after 10 days of culture was 13.5 g/l, with a product yield from raw cornmeal of 0.123 g/g of consumed carbon source, which was about 7.2 times higher than that obtained when glucose was used as the carbon source.
Forward selection two sample binomial test
Wong, Kam-Fai; Wong, Weng-Kee; Lin, Miao-Shan
2016-01-01
Fisher’s exact test (FET) is a conditional method that is frequently used to analyze data in a 2 × 2 table for small samples. This test is conservative and attempts have been made to modify the test to make it less conservative. For example, Crans and Shuster (2008) proposed adding more points in the rejection region to make the test more powerful. We provide another way to modify the test to make it less conservative by using two independent binomial distributions as the reference distribution for the test statistic. We compare our new test with several methods and show that our test has advantages over existing methods in terms of control of the type 1 and type 2 errors. We reanalyze results from an oncology trial using our proposed method and our software which is freely available to the reader. PMID:27335577
Raw materials policy: implications for Germany
Energy Technology Data Exchange (ETDEWEB)
Gaertner, E
1978-04-01
The contribution characterizes the situation of the national mining industry in 1977, deals with international raw materials policies within the framework of the North-South dialogue and with the policies of the western industrial countries, points out the dangers of worldwide state-controlled raw materials policies and calls for a) the political risk of enterprise cooperation with developing countries to be covered and b) double taxation to be avoided. Finally, the problems of securing the Federal Republic of Germany's raw materials supplies on a long-term basis are portrayed.
Improving the safety and quality of raw tuna fillets by x-ray irradiation
In this study, raw tuna fillet (25 g) samples were inoculated by immersing in 0.1% peptone water that contained 108-9 CFU ml-1 of a three-strain mixture of Salmonella enterica for 1 min. The samples were then air dried at 22 oC for 30 min and were packaged separately in sterilized bags prior to X-ra...
Conchillo, A. (Ana); Ansorena, D. (Diana); Astiasarán, I. (Iciar)
2004-01-01
Raw and cooked chicken breasts were stored at −18 °C for 3 months under aerobic and vacuum conditions, and the intensity of lipid oxidation and the formation of COP (cholesterol oxidation products) were studied. Raw samples showed low COP levels (4.60–7.40 µg g−1 fat), TBARS (thiobarbituric acid reactive substances) levels (0.01–0.03 mg kg−1) and peroxide values (not detected) under both aerobic and vacuum conditions. Cooked samples (grilled and roasted) showed TBARS levels of 0.36–0.99 mg kg...
Quality and Sensorial Characteristics of Raw-Vegan Bars
Directory of Open Access Journals (Sweden)
Liana Claudia Salanţă
2015-11-01
Full Text Available Increased consumer interest in healthier food products is driven by a variety of factors including growing awareness of the link between diet and health, the desire to age ‘gracefully’ by maintaining good health, greater convenience in meeting nutritional needs and preventing chronic diseases. In raw food diet, food is consumed predominantly or exclusively as uncooked and unprocessed raw food; the main components of the diet are fruits, nuts, seeds, and sprouted grains and beans. The aim of this study was to obtain two raw-vegan bars using dry raw materials and to establish the physicochemical and sensory characteristics of the products. Raw-vegan bars were formulated using fruits and seeds (cranberries, figs, raisins, raspberries, cashew, chia seeds, etc. and binding agents (honey. Raw-vegan bars stands out among fast foods due to their balanced nutritional content and convenience.
Okorie-Kanu, O. Josephine; Ezenduka, E. Vivienne; Okorie-Kanu, C. Onwuchokwe; Ugwu, L. Chinweokwu; Nnamani, U. John
2016-01-01
Aim: This study was conducted to investigate the occurrence of pathogenic Escherichia coli and Salmonella species in retail raw table eggs sold for human consumption in Enugu State and to determine the resistance of these pathogens to antimicrobials commonly used in human and veterinary practices in Nigeria. Materials and Methods: A total of 340 raw table eggs comprising 68 composite samples (5 eggs per composite sample) were collected from five selected farms (13 composite samples from the farms) and 10 retail outlets (55 composite samples from the retail outlets) in the study area over a period of 4-month (March-June, 2014). The eggs were screened for pathogenic E. coli and Salmonella species following standard procedures within 24 h of sample collection. Isolates obtained were subjected to in-vitro antimicrobial susceptibility test with 15 commonly used antimicrobials using the disk diffusion method. Results: About 37 (54.4%) and 7 (10.3%) of the 68 composite samples were positive for pathogenic E. coli and Salmonella species, respectively. The shells showed significantly higher (p0.05). The organisms obtained showed a multiple drug resistance. They were completely resistant to nitrofurantoin, sulfamethoxazole/trimethoprim, penicillin G and oxacillin. In addition to these, Salmonella spp. also showed 100% resistance to tetracycline. The pathogenic E. coli isolates obtained were 100% susceptible to gentamicin, neomycin, ciprofloxacin, and amoxicillin-clavulanic acid while Salmonella spp. showed 100% susceptibility to erythromycin, neomycin, and rifampicin. Both organisms showed varying degrees of resistance to streptomycin, amoxicillin, vancomycin, and doxycycline. Conclusion: From the results of the study, it can be concluded that the raw table eggs marketed for human consumption in Enugu State, Nigeria is contaminated with pathogenic E. coli and Salmonella species that showed multiple drug resistance to antimicrobial agents commonly used in veterinary and human
Fauza, G.; Prasetyo, H.; Amanto, B. S.
2018-05-01
Studies on an integrated production-inventory model for deteriorating items have been done extensively. Most of the studies define deterioration as physical depletion of some inventories over time. This definition may not represent the deterioration characteristics of food products. The quality of food production decreases over time while the quantity remains the same. Further, in the existing models, the raw material is replenished several times (or at least once) within one production cycle. In food industries, however, a food company, for several reasons (e.g., the seasonal raw materials, discounted price, etc.) sometimes will get more benefit if it orders raw materials in a large quantity. Considering this fact, this research, therefore, is aimed at developing a more representative inventory model by (i) considering the quality losses in food and (ii) adopting a general raw material procurement policy. A mathematical model is established to represent the proposed policy in which the total profit of the system is the objective function. To evaluate the performance of the model, a numerical test was conducted. The numerical test indicates that the developed model has better performance, i.e., the total profit is 2.3% higher compared to the existing model.
Characterization of Limestone as Raw Material to Hydrated Lime
Salem Hwidi, Rajeb; Nuraiti Tengku Izhar, Tengku; Saad, Farah Naemah Mohd
2018-03-01
In Malaysia, limestone is essentially important for the economic growth as raw materials in the industry sector. Nevertheless, a little attention was paid to the physical, chemical, mineralogical, and morphological properties of the limestone using X-ray fluorescence (X-RF), X-ray diffraction (X-RD), Fourier transform infrared spectroscopy (FTIR), and Scanning electron microscopy / energy dispersive x-ray spectroscopy (SEM-EDS) respectively. Raw materials (limestone rocks) were collected from Bukit Keteri area, Chuping, Kangar, Perlis, Malaysia. Lab crusher and lab sieved were utilized to prepare five different size of ground limestone at (75 µm, 150 µm, 225 µm, 300, and 425 µm) respectively. It is found that the main chemical composition of bulk limestone was Calcium oxide (CaO) at 97.58 wt.% and trace amount of MnO, Al2O3, and Fe2O3 at 0.02%, 0.35%, and 0.396% respectively. XRD diffractograms showed characteristic peaks of calcite and quartz. Furthermore, main FTIR absorption bands at 1,419, 874.08 and 712.20 cm-1 indicated the presence of calcite. The micrographs showed clearly the difference of samples particle size. Furthermore, EDS peaks of Ca, O, and C elements confirmed the presence of CaCO3 in the samples.
International Nuclear Information System (INIS)
Bai, D.S.; Chun, Y.R.; Kim, J.G.
1995-01-01
This paper considers the design of life-test sampling plans based on failure-censored accelerated life tests. The lifetime distribution of products is assumed to be Weibull with a scale parameter that is a log linear function of a (possibly transformed) stress. Two levels of stress higher than the use condition stress, high and low, are used. Sampling plans with equal expected test times at high and low test stresses which satisfy the producer's and consumer's risk requirements and minimize the asymptotic variance of the test statistic used to decide lot acceptability are obtained. The properties of the proposed life-test sampling plans are investigated
Test of a sample container for shipment of small size plutonium samples with PAT-2
International Nuclear Information System (INIS)
Kuhn, E.; Aigner, H.; Deron, S.
1981-11-01
A light-weight container for the air transport of plutonium, to be designated PAT-2, has been developed in the USA and is presently undergoing licensing. The very limited effective space for bearing plutonium required the design of small size sample canisters to meet the needs of international safeguards for the shipment of plutonium samples. The applicability of a small canister for the sampling of small size powder and solution samples has been tested in an intralaboratory experiment. The results of the experiment, based on the concept of pre-weighed samples, show that the tested canister can successfully be used for the sampling of small size PuO 2 -powder samples of homogeneous source material, as well as for dried aliquands of plutonium nitrate solutions. (author)
International Nuclear Information System (INIS)
Polkowska-Motrenko, H.; Sypula, M.; Sadowska-Bratek, M.; Fuks, L.
2007-01-01
Proficiency testing (PT) on the determination of radioactivity concentration of 137 Cs and 0S r in samples of drinking and surface waters, wheat flour and sand was organized in 2006 by the Institute of Nuclear Chemistry and Technology (INCT). The PT was conducted on the request of the National Atomic Energy Agency, Poland (PAA) and financed by the NAEA President. Report presents statistical evaluation of results obtained by the participants. The PT was provided in accordance with ISO/IEC Guide 43-1:1997. Samples were prepared by spiking the appropriate raw materials separately with known amounts of the certified standard solutions of 137 Cs and 0S r. Ten laboratories from Poland and one from Hungary took part in the PT. The participants were asked to choose which samples they were willing to analyze. the results provided by the participants were statistically evaluated by means of z and zeta-scores in accordance with ISO 13528:2005 and IUPAC protocol. They were evaluated also using the evaluation criteria for trueness and precision usually applied by the International Atomic Energy Agency (IAEA). (authors) [pl
Directory of Open Access Journals (Sweden)
Mojtaba Bonyadian
2014-04-01
Full Text Available The aim of this study was to determine the occurrence of enterotoxigenic and enteroaggregative Escherichia coli strains and antibiotic resistance of the isolates in raw milk and unpasteurized cheese. Out of 200 samples of raw milk and 50 samples of unpasteurized cheeses, 96 and 24 strains of E. coli were isolated, respectively. Polymerase chain reaction (PCR was used to detect the genes encoding heat-stable enterotoxin a (STa, heat-stable enterotoxin b (STb, heat labile toxin (LT and enteroaggregative heat-stable toxin1 (EAST1. Twelve out of 120 (10.00% isolates harbored the gene for EAST1, 2(1.66% isolates were detected as producing STb and LT toxins and 12 (10.00% strains contained STb and EAST1 genes. None of the strains contain the STa gene. All of the strains were tested for antibiotic resistance by disk diffusion method. Disks included: ciprofloxacin (CFN, trimetoprim-sulfamethoxazole (TSX, oxytetracycline (OTC, gentamicin (GMN, cephalexin (CPN, nalidixic acid (NDA and nitrofurantoin (NFN, ampicillin (AMP, neomycin (NEO and streptomycin (STM. Among 120 isolated strains of E. coli, the resistance to each antibiotics were as follows: OTC100%, CPN 86.00%, NDA 56.00%, NFN 42.00%, GMN 30.00%, TSX 28.00%, CFN 20%, AM 23.40% and STM 4.25%. None of the isolates were resistant to NEO. The present data indicate that different resistant E. coli pathogens may be found in raw milk and unpasteurized cheese. It poses an infection risk for human and transferring the resistant factors to microflora of the consumers gut.
Chemical Contaminants in Raw and Pasteurized Human Milk.
Hartle, Jennifer C; Cohen, Ronald S; Sakamoto, Pauline; Barr, Dana Boyd; Carmichael, Suzan L
2018-05-01
Environmental contaminants ranging from legacy chemicals like p,p'-dichlorodiphenyltrichloroethane (DDT) to emerging chemicals like phthalates are ubiquitous. Research aims/questions: This research aims to examine the presence and co-occurrence of contaminants in human milk and effects of pasteurization on human milk chemical contaminants. We analyzed human milk donated by 21 women to a milk bank for 23 chemicals, including the persistent organic pollutants (POPs) polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDT), and dichlorodiphenyldichloroethylene (DDE) isomers that are known to sequester in adipose tissue, along with the current-use and nonpersistent pesticides chlorpyrifos and permethrin, phthalates, and bisphenol A (BPA). Human milk was analyzed raw and pasteurized for these chemicals using gas chromatography-tandem mass spectrometry for the POPs and high-performance liquid chromatography-tandem mass spectrometry for non-POPs. Within the different chemical classes, PBDE47, PCB153, ppDDE, and MEHHP (phthalate metabolite) had the highest median concentrations and were observed in all samples. We also observed chlorpyrifos and BPA in all samples and permethrin in 90% of the samples tested. Only two chemicals, chlorpyrifos and permethrin, were susceptible to substantial degradation from pasteurization, a standard method for processing donated human milk. We detected 19 of 23 chemicals in all of our prepasteurized milk and 18 of 23 chemicals in all of our pasteurized milk. Pasteurization did not affect the presence of most of the chemicals. Future research should continue to explore human milk for potential chemical contamination and as a means to surveil exposures among women and children.
BTEX and MTBE adsorption onto raw and thermally modified diatomite.
Aivalioti, Maria; Vamvasakis, Ioannis; Gidarakos, Evangelos
2010-06-15
The removal of BTEX (benzene, toluene, ethyl-benzene and xylenes) and MTBE (methyl tertiary butyl ether) from aqueous solution by raw (D(R)) and thermally modified diatomite at 550, 750 and 950 degrees C (D(550), D(750) and D(950) respectively) was studied. Physical characteristics of both raw and modified diatomite such as specific surface, pore volume distribution, porosity and pH(solution) were determined, indicating important structural changes in the modified diatomite, due to exposure to high temperatures. Both adsorption kinetic and isotherm experiments were carried out. The kinetics data proved a closer fit to the pseudo-second order model. Maximum values for the rate constant, k(2), were obtained for MTBE and benzene (48.9326 and 18.0996 g mg(-1)h(-1), respectively) in sample D(550). The isotherm data proved to fit the Freundlich model more closely, which produced values of the isotherm constant 1/n higher than one, indicating unfavorable adsorption. The highest adsorption capacity, calculated through the values of the isotherm constant k(F), was obtained for MTBE (48.42 mg kg(-1) (mg/L)(n)) in sample D(950). Copyright 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Austin Donner
2011-01-01
Full Text Available Food production, handling, and distribution practices pose a constant threat to the quality and safety of food products. The objective of this research is to evaluate an innovative in-package ozonation process to reduce Salmonella enteritidis on raw, shell eggs. Previous research has shown that in-package ozonation eliminates contaminants from outside sources, reduces pathogens, and extends shelf life. In this study, raw, shell eggs were inoculated with Salmonella enteritidis and exposed to ozonation treatment. Microbial recoveries were then tested to determine bacterial reductions. Measurements included: relative humidity (34 percent at 5oC, surface temperatures (oC, ozone concentrations, bacterial reductions of Salmonella enteritidis, and quality assessment of eggs (Haugh Unit [HU], color, pH, and weight. After a 24-hour storage period, all treated samples indicated 3 log10 reductions on average (previous research has achieved up to 6log10. These results show effective in-package ozonation treatment reducing Salmonella enteritidis on raw, shell eggs without significant effect on measured egg quality over time. Benefits of in-package ozonation include no heating, low power requirements (less or equal to 50 Watts, short treatment time (seconds to minutes, and adaptability into existing processes. Given its ability to ensure the safety and longevity of food products, this technology has great potential for utilization in the food processing industry.
Use of raw materials in the United States from 1900 through 2014
Matos, Grecia R.
2017-08-22
The economic growth of an industrialized nation such as the United States requires raw materials for construction (buildings, bridges, highways, and so forth), defense, and processing and manufacture of goods and services. Since the beginning of the 20th century, the types and quantities of raw materials used have increased and changed significantly. This fact sheet quantifies the amounts of raw materials (other than food and fuel) that have been used in the U.S. economy annually for a period of 115 years, from 1900 through 2014. It provides a broad overview of the quantity (weight) of nonfood and nonfuel materials used in the economy and illustrates the use and significance of raw nonfuel minerals in particular as building blocks of society.These data have been compiled to help the public and policymakers understand the changing annual flow of raw materials put into use in the United States. Such information can be helpful in assessing the potential effects of materials use on the environment, assessing materials’ intensity of use, and examining the role that these materials play in the economy. The data presented indicate the substitution and shift in materials usage from renewable to nonrenewable materials during the 20th century. The disaggregated quantities by commodity (not shown in this fact sheet) may be tested against supply adequacy and end of life issues.
Oat raw materials and bakery products - amino acid composition and celiac immunoreactivity.
Mickowska, Barbara; Litwinek, Dorota; Gambuś, Halina
2016-01-01
The aim of this study was to compare the biochemical and immunochemical properties of avenins in some special oat raw materials and additionally the possibility of using them as a raw material for the gluten-free bakery products. The compared oat raw materials were - oat flakes, commercial oat flours (including gluten-free oat flour) and residual oat flour, which is by-product of β-glucan preparation. Biochemical characteristic included amino acid compositions and SDS-PAGE profiles of extracted avenins. The immunochemical reactivity with polyclonal anti-gluten and monoclonal anti-gliadin antibodies was evaluated qualitatively and quantitatively by immunoblotting and ELISA methods. Additionally, experimental bakery products made of examined raw materials were assessed according to their suitability for the celiac patients' diet. The highest protein content was measured in the β-glucan preparation "Betaven" and gluten-free oat flour. Proteins of all materials are rich in glutamic and aspartic acid, leucine and arginine. Proportions of amino acids in avenins extracted from most of oat raw materials are similar, excluding gluten-free oat flour, which has a very low avenin content and proportions of individual amino acids are different. The SDS-PAGE protein pattern consisted of proteins with molecular weight of about 25-35 kDa. Polyclonal anti-gluten anti-body recognized all protein fractions of molecular weight higher than 20 kDa. Quantitative ELISA analysis shows that the majority of samples has a gliadin-like protein content within the range of 80-260 mg/kg, excluding gluten-free flours and corresponding bakery products. Altogether, β-glucan preparation has extremely high level of gliadin-like proteins. In the examined oat raw materials and foods the contents of immunoreactive amino acid sequences exceeded the limit of 20 mg/kg (considered as gluten-free) except for gluten-free flours (oat and the prepared mixture) and the bakery products based on gluten
International Nuclear Information System (INIS)
Wu Zhanjun; Zhao Weijuan; Lu Xiaoke; Li Guoxia; Guo Min; Xie Jianzhong; Qiu Xia; Feng Songlin
2007-01-01
Thirty-seven samples of ancient Chinese Ru porcelain bodies unearthed from Qingliangsi kiln (containing 32 Ru official porcelain bodies and 5 Ru folk porcelain bodies), thirty-two samples of ancient celadon bodies from Zhanggongxiang kiln, and fourteen samples of modern mineral, were selected and analyzed by neutron activation analysis (NAA) method. Twenty-three elements were measured. The data of these elemental contents were processed by scatter analysis and principle component analysis methods in order to determine the characteristics and sources of the raw materials of the celadon porcelain bodies from the foregoing two kilns. The results show that Fe, Ce, Ba, Ta, Th, La, Sm and Cr are the fingerprint elements to distinguish the ancient Ru official porcelain bodies from ancient celadon bodies of Zhanggongxiang kiln. The sources of the raw material of the ancient Ru official porcelain bodies from Qingliangsi kiln are more concentrated and stable than those from Zhanggongxiang kiln. The Ru folk porcelain bodies and the Ru official porcelain bodies from Qingliangsi kiln have the same provenance, both sources of which are local. The raw material origins of the ancient celadon bodies from Zhanggongxiang kiln is a little dispersed and the compositions of the raw material are different from the Ru porcelains, but the distance is not far away from each other. (authors)
Radioactivity in polluted cement and its raw materials
International Nuclear Information System (INIS)
Khan, K.; Aslam, M.; Orfi, S.D.
1999-01-01
Samples of portland cement manufactured in the North West frontier Province (NWFP) of Pakistan and its different raw materials have been investigated applying gamma-spectrometric techniques for natural gamma-emitting radionuclides. A high purity germanium detector (HPGE) was used for data acquisition. Average values of the total specific activity (in Bq.kg/sup -1/ ) due to all the three radionuclides (/sub 40/K, /sup 226/Ra and /sup 232/Th) were found to be 327.7+ - 168.2 for portland cement; 104.4 + - 21.1 for limestone; 193.2+ - 50.4 for gypsum; 890.4 + - 86.5 for state and 545.6+ - 56.6 for latrite. The average specific activities due to /sup 40/K in Portland cement and all the raw materials were found to be higher as compared to /sub 226/Ra and /sup 232/Th in the respective materials. It is concluded that such materials do not pose any health problem and are not a major source of radiation hazards. However, The data can be utilized in determining radioactivity associated with other building materials. (author)
Polyphenols in Raw and Cooked Cereals/Pseudocereals/Legume Pasta and Couscous.
Carcea, Marina; Narducci, Valentina; Turfani, Valeria; Giannini, Vittoria
2017-09-11
Pasta and couscous are popular foods manufactured (in their traditional form) from durum wheat semolina. In recent years, the consumers' quest for novel, functional, gluten-free, wholegrain foods has prompted the industry to manufacture new pasta and couscous products in which durum wheat has been partially or totally replaced by other vegetable flours. Besides dietary fibre, these raw materials might be an interesting source of phytochemicals. In this work, 16 commercial samples of pasta and four samples of couscous representative of the new products and made of refined and wholegrain flours of different species of cereals, pseudocereals and legumes were analysed for free, hydrolysable bound and total polyphenol content by means of the Folin-Ciocalteu procedure. Analyses were repeated on cooked samples to assess the quantity of polyphenols ingested by the consumers. The raw legume and pseudocereal products had a total polyphenol content higher than most cereal products (up to 1743.4 mg of Gallic Acid Equivalent (GAE) per 100 g dry weight). Wholegrain products had higher contents than refined products. The free fraction underwent up to 46% loss with cooking, probably because of solubility in water. The water absorption of pasta and couscous during cooking was in a ratio of 2:3, resulting in higher dilution of polyphenols in the cooked couscous.
Microbial production of raw starch digesting enzymes | Sun | African ...
African Journals Online (AJOL)
Raw starch digesting enzymes refer to enzymes that can act directly on raw starch granules below the gelatinization temperature of starch. With the view of energy-saving, a worldwide interest has been focused on raw starch digesting enzymes in recent years, especially since the oil crisis of 1973. Raw starch digesting ...
Outgassing tests on iras solar panel samples
Premat, G.; Zwaal, A.; Pennings, N. H.
1980-01-01
Several outgassing tests were carried out on representative solar panel samples in order to determine the extent of contamination that could be expected from this source. The materials for the construction of the solar panels were selected as a result of contamination obtained in micro volatile condensable materials tests.
CSIR Research Space (South Africa)
Joseph, S
2010-01-01
Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...
International Nuclear Information System (INIS)
Stojanovska, Z.; Nedelkovski, D.; Ristova, M.
2010-01-01
During the manufacturing process in the cement industry, raw materials of different levels of natural radioactivity are utilized. In this study we present the radiological impact of cements as a building material and the different raw materials used in their manufacture. A total of 218 samples of raw materials and their end product cements were collected from the cement industry of Macedonia (The Former Yugoslav Republic) during the period 2005-2007. The specific activities, evaluated by gamma spectrometry analysis, showed the highest mean specific activity in fly ash ( 226 Ra, 107 ± 45 Bq kg -1 ; 232 Th, 109 ± 30 Bq kg -1 ; 40 K, 685 ± 171 Bq kg -1 ), which is used as a raw material. However, the final cement product usually has relatively lower activity compared with the activity of the raw material and the mean specific activity of the final cement products were lower ( 226 Ra, 42 ± 10 Bq kg -1 ; 232 Th, 28 ± 6 Bq kg -1 ; 40 K, 264 ± 50 Bq kg -1 ). The radium equivalent activity and the hazard index were calculated for each sample to assess the radiation hazard. The mean annual effective dose originating from the cements was found to be 111 ± 22 μSv y -1 , which is below the recommended EC limit of 300 μSv y -1 .
Importance of Decision Support Systems About Food Safety in Raw Milk Production
Directory of Open Access Journals (Sweden)
Ecem Akan
2015-12-01
Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.
Energy Technology Data Exchange (ETDEWEB)
Maki, Y; Ishiguro, Y [Industrial Research Inst. of Kanagawa Prefecture, Yokohama (Japan)
1976-01-01
The sodium, manganese and copper contained in cocoons, raw silk and degummed silk thread were determined by the nondestructive activation analysis. After each sample was irradiated with the thermal neutron flux of 5 x 10/sup 11/n/cm/sup 2/.sec, its ..gamma..-ray spectrum was measured with a NaI(Tl) detector. With the photoelectric peaks at 511 keV (/sup 64/Cu), 1368 keV (/sup 24/Na) and 847 keV (/sup 56/Mn), each element was quantitatively determined and its content was obtained. The measurement of the ..gamma..-ray spectra of samples with a Ge (Li) detector proved the presence of An, Sb, Fe, Zn, Cr, Sc, Co, etc. Large amounts of Na and Cu were detected in the sericin portion of cocoons, and the adhesion of Cu from a reeling-off machine to raw silk was also observed during the process of degumming cocoons to make raw silk.
Testing Homogeneity in a Semiparametric Two-Sample Problem
Directory of Open Access Journals (Sweden)
Yukun Liu
2012-01-01
Full Text Available We study a two-sample homogeneity testing problem, in which one sample comes from a population with density f(x and the other is from a mixture population with mixture density (1−λf(x+λg(x. This problem arises naturally from many statistical applications such as test for partial differential gene expression in microarray study or genetic studies for gene mutation. Under the semiparametric assumption g(x=f(xeα+βx, a penalized empirical likelihood ratio test could be constructed, but its implementation is hindered by the fact that there is neither feasible algorithm for computing the test statistic nor available research results on its theoretical properties. To circumvent these difficulties, we propose an EM test based on the penalized empirical likelihood. We prove that the EM test has a simple chi-square limiting distribution, and we also demonstrate its competitive testing performances by simulations. A real-data example is used to illustrate the proposed methodology.
Energy Technology Data Exchange (ETDEWEB)
Lobo, A.O., E-mail: loboao@yahoo.com [Laboratorio Associado de Sensores e Materiais, INPE, Sao Jose dos Campos/SP (Brazil); Instituto Tecnologico de Aeronautica, ITA, Sao Jose dos Campos/SP (Brazil); Laboratorio de Nanotecnologia Biomedica, Universidade do Vale do Paraiba, Sao Jose dos Campos/SP (Brazil); Corat, M.A.F. [Centro Multidisciplinar para Investigacao Biologica na Area da Ciencia em Animais de Laboratorio, CEMIB, UNICAMP, Campinas/SP (Brazil); Antunes, E.F. [Laboratorio Associado de Sensores e Materiais, INPE, Sao Jose dos Campos/SP (Brazil); Instituto Tecnologico de Aeronautica, ITA, Sao Jose dos Campos/SP (Brazil); Ramos, S.C. [Instituto Tecnologico de Aeronautica, ITA, Sao Jose dos Campos/SP (Brazil); Pacheco-Soares, C. [Laboratorio de Dinamica de Compartimentos Celulares, UNIVAP, Sao Jose dos Campos/SP (Brazil); and others
2012-05-01
It was presented a strong difference on cell adhesion and proliferation of functionalized vertically-aligned multi-walled carbon nanotube (VACNT) scaffolds compared to raw-VACNT. Biocompatibility in vitro tests were performed on raw-VACNT after superficial modification by oxygen plasma, which changes its superhydrophobic character to superhydrophilic. Two cytocompatibility tests were applied: 1) total lactate dehydrogenase colorimetric assay for the study of proliferating cells; and 2) cellular adhesion by scanning electron microscopy. Results showed that superhydrophilic VACNT scaffolds stimulate cell growth with proliferation up to 70% higher than normal growth of cell culture.
A Fault Sample Simulation Approach for Virtual Testability Demonstration Test
Institute of Scientific and Technical Information of China (English)
ZHANG Yong; QIU Jing; LIU Guanjun; YANG Peng
2012-01-01
Virtual testability demonstration test has many advantages,such as low cost,high efficiency,low risk and few restrictions.It brings new requirements to the fault sample generation.A fault sample simulation approach for virtual testability demonstration test based on stochastic process theory is proposed.First,the similarities and differences of fault sample generation between physical testability demonstration test and virtual testability demonstration test are discussed.Second,it is pointed out that the fault occurrence process subject to perfect repair is renewal process.Third,the interarrival time distribution function of the next fault event is given.Steps and flowcharts of fault sample generation are introduced.The number of faults and their occurrence time are obtained by statistical simulation.Finally,experiments are carried out on a stable tracking platform.Because a variety of types of life distributions and maintenance modes are considered and some assumptions are removed,the sample size and structure of fault sample simulation results are more similar to the actual results and more reasonable.The proposed method can effectively guide the fault injection in virtual testability demonstration test.
International Nuclear Information System (INIS)
Wasilewska, M.; Ostachowicz, J.; Lankosz, M.; Molodynska, W.
1975-01-01
The characteristic iron and calcium-K series were excited using a Cd-109 isotope source. In order to determine the calcium and iron content in dry slurry, the Compton-effect scattered radiation of the Cd-109 source in the sample was used. A numerical process was worked out which allowed the elimination of the influence of changing contents of iron and water on the results of the calcium content determinations, and a device for continuous radiometric determination of calcium and iron in raw slurry was designed and constructed. The device was installed in the cement plant 'Przyjazn' under technical measuring conditions and its applicability was tested. (orig./LH) [de
Fibromyalgia syndrome improved using a mostly raw vegetarian diet: An observational study
Directory of Open Access Journals (Sweden)
Speight Neal
2001-09-01
Full Text Available Abstract Background Fibromyalgia engulfs patients in a downward, reinforcing cycle of unrestorative sleep, chronic pain, fatigue, inactivity, and depression. In this study we tested whether a mostly raw vegetarian diet would significantly improve fibromyalgia symptoms. Methods Thirty people participated in a dietary intervention using a mostly raw, pure vegetarian diet. The diet consisted of raw fruits, salads, carrot juice, tubers, grain products, nuts, seeds, and a dehydrated barley grass juice product. Outcomes measured were dietary intake, the fibromyalgia impact questionnaire (FIQ, SF-36 health survey, a quality of life survey (QOLS, and physical performance measurements. Results Twenty-six subjects returned dietary surveys at 2 months; 20 subjects returned surveys at the beginning, end, and at either 2 or 4 months of intervention; 3 subjects were lost to follow-up. The mean FIQ score (n = 20 was reduced 46% from 51 to 28. Seven of the 8 SF-36 subscales, bodily pain being the exception, showed significant improvement (n = 20, all P for trend Conclusion This dietary intervention shows that many fibromyalgia subjects can be helped by a mostly raw vegetarian diet.
Current problems of raw fish material processing while manufacturing dried products
Directory of Open Access Journals (Sweden)
Yashonkov A. A.
2017-09-01
Full Text Available The substantiation for using techniques of fish raw material canning has been presented, raw fish being caught or farmed in aquaculture. The main problems in raw fish canning have been reviewed, including significant reduction in thermolabile vitamins in the ultimate product as compared with the raw material due to the thermal processing. Promising canning technique – vacuum drying – has been proposed. This technique makes possible to reduce the temperature of thermal processing down to 50…55 °С and significantly enlarge preservation of thermolabile vitamins from the raw fish. Sampling of raw materials, semi-finished products, finished products, including preparation for analysis has been conducted by standard methods. Disadvantages of this way have been found, it is low energy efficiency of the process. The way to intensify the vacuum drying of aquatic organisms has been proposed based on the method of preliminary pore-forming due to augmenting the area of moisture evaporation. The design of the pilot plant has been proposed in order to research the process of pore forming and vacuum drying. Target species for processing have been suggested. They are as follows: Azov goby (fillet for food products and Black Sea sprat for feeds. The recipes of the feed mixture for granulated floating food for trout have been developed. The results of the first series of the pilot research have been provided. The experiments have proved that preliminary pore forming immediately before vacuum drying makes possible to enlarge the surface area of moisture evaporation by 15…25 %. By processing photomicrographs of sections by means of a special software the authors have got the results demonstrating that when manufacturing dried products by pore forming and drying under pressure 10 kPa the pore take 35...38 % of the inner volume of the product and with drying under pressure 10 kPa – only 18...21 %, and when drying under the atmospheric pressure – 11...13 %.
Haptoglobin and serum amyloid A in bulk tank milk in relation to raw milk quality.
Akerstedt, Maria; Waller, Karin Persson; Sternesjö, Ase
2009-11-01
The aim of the present study was to evaluate relationships between the presence of the two major bovine acute phase proteins haptoglobin (Hp) and serum amyloid A (SAA) and raw milk quality parameters in bulk tank milk samples. Hp and SAA have been suggested as specific markers of mastitis but recently also as markers for raw milk quality. Since mastitis has detrimental effects on milk quality, it is important to investigate whether the presence of Hp or SAA indicates such changes in the composition and properties of the milk. Bulk tank milk samples (n=91) were analysed for Hp, SAA, total protein, casein, whey protein, proteolysis, fat, lactose, somatic cell count and coagulating properties. Samples with detectable levels of Hp had lower casein content, casein number and lactose content, but higher proteolysis than samples without Hp. Samples with detectable levels of SAA had lower casein number and lactose content, but higher whey protein content than samples without SAA. The presence of acute phase proteins in bulk tank milk is suggested as an indicator for unfavourable changes in the milk composition, e.g. protein quality, due to udder health disturbances, with economical implications for the dairy industry.
Lorusso, Vanessa; Dambrosio, Angela; Quaglia, Nicoletta Cristiana; Parisi, Antonio; La Salandra, Giovanna; Lucifora, Giuseppe; Mula, Giuseppina; Virgilio, Sebastiano; Carosielli, Leonardo; Rella, Addolorata; Dario, Marco; Normanno, Giovanni
2009-08-01
Escherichia coli 026 is known as a verocytotoxin-producing E. coli (VTEC) organism that causes severe foodborne diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Although cattle are the most important reservoir of VTEC, only a few reports on the role of water buffalo (Bubalus bubalis) as a reservoir of VTEC and on the presence of these organisms in their milk are available. However, in Southern Italy, where water buffalo are intensively reared, an outbreak of hemolytic uremic syndrome due to E. coli 026 has recently been reported, in which the consumption of typical dairy products was considered to be a common risk factor. The aims of this work were to assess the prevalence of E. coli O26 in raw water buffalo milk, to characterize the virulence gene profiles of the isolates, and to evaluate their phenotypic antimicrobial resistance pattern. Of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O26, and the isolate showed the stx1+/stx2+/eae-/hlyA+ genotypic profile. The strain showed resistance against glycopeptides, macrolides, and penicillins. The presence of VTEC organisms in raw water buffalo milk could be considered to be a potential threat to consumers; however, the strict adherence to the processes used in the preparation of the most common buffalo dairy products could strongly mitigate the foodborne risk. To our knowledge, this article reports the first isolation and characterization of E. coli O26 VTEC in raw water buffalo milk.
Determination of heavy metals concentration in raw sheep milk from mercury polluted area
Directory of Open Access Journals (Sweden)
Radovan Stanovič
2016-01-01
Full Text Available The paper focuses on determining the content of monitored contaminants (Cd, Cu, Hg, Pb and Zn in 53 samples of raw sheep milk collected in 2013 and 2014 on the sites Poráč and Matejovce nad Hornádom (middle Spiš. The area is characterized by historical mining and metalworking activity (mining and processing of polymetallic ores rich in Hg, Cd and Pb. Currently, the area is one of the most mercury contaminated areas in Central Europe. All statistical analyses were carried out using the statistical software Statistica 10.0 (Statsoft, USA. Descriptive data analysis included minimum value, maximum value, arithmetic mean and standard deviation. The results of the studied contaminant content show that the limit value for cadmium (10 μg.kg-1 was exceeded in 25 samples. In the case of lead, the limit value of 20 μg.kg-1 was exceeded in 16 cases. The limit value for copper (0.4 mg.kg-1 was exceeded in one case. The limit value for zinc is not defined by a legislative standard. The risk level of the studied contaminants in the samples of raw sheep milk decreases as follows: Cd > Pb > Hg > Cu > Zn. It can be concluded that frequent and long-term consumption of the raw sheep milk originating from the studied sites poses a health risk. The content of the contaminants in the milk and their eventual transition into dairy products should be monitored over a longer term in more detail. Normal 0 21 false false false CS JA X-NONE
Quality quantification model of basic raw materials
Directory of Open Access Journals (Sweden)
Š. Vilamová
2016-07-01
Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.
Data extraction from proteomics raw data
DEFF Research Database (Denmark)
Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael
2012-01-01
In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...
Data Quality Objectives For Selecting Waste Samples To Test The Fluid Bed Steam Reformer Test
International Nuclear Information System (INIS)
Banning, D.L.
2010-01-01
This document describes the data quality objectives to select archived samples located at the 222-S Laboratory for Fluid Bed Steam Reformer testing. The type, quantity and quality of the data required to select the samples for Fluid Bed Steam Reformer testing are discussed. In order to maximize the efficiency and minimize the time to treat Hanford tank waste in the Waste Treatment and Immobilization Plant, additional treatment processes may be required. One of the potential treatment processes is the fluid bed steam reformer (FBSR). A determination of the adequacy of the FBSR process to treat Hanford tank waste is required. The initial step in determining the adequacy of the FBSR process is to select archived waste samples from the 222-S Laboratory that will be used to test the FBSR process. Analyses of the selected samples will be required to confirm the samples meet the testing criteria.
Factors affecting adherence to a raw vegan diet
Link, Lilli B.; Jacobson, Judith S.
2007-01-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw ve...
Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z
2013-07-01
The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.
Improving the raw management in Ukraine
Energy Technology Data Exchange (ETDEWEB)
Jung, H.G.; Koever, M. [NUKEM Technologies GmbH, Alzenau (Germany)
2013-07-01
In Ukraine 13 VVER-1000 and 2 VVER-440 reactor units generate about 50 % of the country's energy production. By contrast, when looking at the large volume of radioactive waste of all categories, which is produced by these nuclear power plants (NPP), the radioactive waste (RAW) management - onsite of NPP, towards interim storage as well as towards final disposal - is still not adequately developed. Currently all operational waste of Ukrainian NPP is incompletely treated/conditioned and stored onsite, though insufficient storage capacity is available at the NPP. As no effective Ukraine-wide strategy is yet established to manage RAW beyond NPP a serious situation could arise, which even leads to constrained temporary shut-down of reactor units, threatening the energy supply of whole the country. In addition large quantities of RAW, partly badly sorted, derive from decommissioning of the shut-down Chernobyl NPP. Also other sources of RAW contribute to the whole volume, which has to be managed in Ukraine, as research reactors, reprocessing of spent nuclear fuel and other nuclear facilities and applications. Nevertheless, operational and shut-down NPP in Ukraine are by far the largest producers. To support Ukraine in managing their radioactive waste NUKEM Technologies GmbH was appointed to provide technical support for the improvement of the current situation in cooperation with responsible Ukrainian experts towards a targeted, comprehensive and effective RAW management. (orig.)
Food safety in raw milk production: risk factors associated to bacterial DNA contamination.
Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos
2014-06-01
While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.
Brucella contamination in raw milk by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2016-10-01
Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of
Characterization of silica quartz as raw material in photovoltaic applications
Energy Technology Data Exchange (ETDEWEB)
Boussaa, S. Anas, E-mail: sabiha.anas@gmail.com; Kheloufi, A.; Kefaifi, A.; Kerkar, F. [Division croissance cristalline et procédés métallurgiques CCPM Centre de recherche en technologie des semi-conducteurs pour l’énergétique (C.R.T.S.E) 02 Bd Frantz Fanon BP. 140 Alger 7 merveilles, Alger 16200 (Algeria); Zaourar, N. Boutarek [Laboratoire des technologies des matériaux, USTHB, B.P. 32 El Alia, Bab Ezzouar, Alger, Algérie 16111 (Algeria)
2016-07-25
Raw materials are essential for the functioning of modern societies, and access to these raw materials is vital to the world economy. Sustainable development, both globally level, raises important new challenges associated with access and efficient use of raw materials. High purity quartz, is consider as a critical raw material and it is a rare commodity that only forms under geological conditions where a narrow set of chemical and physical parameters is fulfilled. When identified and following special beneficiation techniques, high purity quartz obtains very attractive prices and is applied in high technology sectors that currently are under rapid expansion such as photovoltaic solar cells, silicon metal - oxide wafers in the semiconductor industry and long distance optical fibers that are used in communication networks. Crystalline silicon remains the principal material for photovoltaic technology. Metallurgical silicon is produced industrially by the reduction of silica with carbon in an electric arc furnace at temperatures higher than 2000 °C in the hottest parts, by a reaction that can be written ideally as: SiO{sub 2} + 2C = Si + 2CO. The aim of this study has been to test experimental methods for investigating the various physical and chemical proprieties of Hoggar quartz with different techniques: X Ray Fluorescence, infra-red spectroscopy, Scanning Electron Microscopy, Optic Microscopy, Carbon Analyzer and Vickers Hardness. The results show finally that the quartz has got good result in purity but need enrichment for the photovoltaic application.
Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah
2018-04-01
The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.
Effect of raw milk on lactose intolerance: a randomized controlled pilot study.
Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D
2014-01-01
This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.
Lin, Hai-Juan; Xian, Liang; Zhang, Qiu-Jiang; Luo, Xue-Mei; Xu, Qiang-Sheng; Yang, Qi; Duan, Cheng-Jie; Liu, Jun-Liang; Tang, Ji-Liang; Feng, Jia-Xun
2011-06-01
A newly isolated strain Penicillium sp. GXU20 produced a raw starch-degrading enzyme which showed optimum activity towards raw cassava starch at pH 4.5 and 50 °C. Maximum raw cassava starch-degrading enzyme (RCSDE) activity of 20 U/ml was achieved when GXU20 was cultivated under optimized conditions using wheat bran (3.0% w/v) and soybean meal (2.5% w/v) as carbon and nitrogen sources at pH 5.0 and 28 °C. This represented about a sixfold increment as compared with the activity obtained under basal conditions. Starch hydrolysis degree of 95% of raw cassava flour (150 g/l) was achieved after 72 h of digestion by crude RCSDE (30 U/g flour). Ethanol yield reached 53.3 g/l with fermentation efficiency of 92% after 48 h of simultaneous saccharification and fermentation of raw cassava flour at 150 g/l using the RCSDE (30 U/g flour), carried out at pH 4.0 and 40 °C. This strain and its RCSDE have potential applications in processing of raw cassava starch to ethanol.
The freezing point of raw and heat treated sheep milk and its variation during lactation
Directory of Open Access Journals (Sweden)
Bohumíra Janštová
2013-01-01
Full Text Available The freezing point of milk is an important indicator of the adulteration of the milk with water, but heat treatment may also affect its value. The aim of this study was determine freezing point of raw and heat treated sheep milk and its variation during lactation. The freezing point was determined in 42 bulk tank raw sheep milk samples and 42 pasteurized milk samples collected during lactation of sheep at one ecofarm in Moravian Walachia (Valašsko in the Czech Republic. The freezing point was determined in accordance with the standard ČSN 57 0538 using a thermistor cryoscope. The average freezing point of raw milk was -0.617 ± 0.052 °C, with a range from -0.560 to -0.875 °C. The freezing point was lower in the first months of lactation and increased at the end of lactation. The freezing point correlated (r = 0.8967 with the content of total non-fat solids. The average freezing point of sheep milk pasteurized at 65 °C for 30 min was -0.614 ± 0.053 °C, with a range from -0.564 to -0.702 °C. The median of freezing point differences between raw and pasteurized milk was 0.004 °C. Our study extends data about physico-chemical properties of sheep milk and registers for the first time specific changes in the freezing point value of sheep milk by heating.
Acceptance test report for core sample trucks 3 and 4
International Nuclear Information System (INIS)
Corbett, J.E.
1996-01-01
The purpose of this Acceptance Test Report is to provide documentation for the acceptance testing of the rotary mode core sample trucks 3 and 4, designated as HO-68K-4600 and HO-68K-4647, respectively. This report conforms to the guidelines established in WHC-IP-1026, ''Engineering Practice Guidelines,'' Appendix M, ''Acceptance Test Procedures and Reports.'' Rotary mode core sample trucks 3 and 4 were based upon the design of the second core sample truck (HO-68K-4345) which was constructed to implement rotary mode sampling of the waste tanks at Hanford. Successful completion of acceptance testing on June 30, 1995 verified that all design requirements were met. This report is divided into four sections, beginning with general information. Acceptance testing was performed on trucks 3 and 4 during the months of March through June, 1995. All testing was performed at the ''Rock Slinger'' test site in the 200 West area. The sequence of testing was determined by equipment availability, and the initial revision of the Acceptance Test Procedure (ATP) was used for both trucks. Testing was directed by ICF-KH, with the support of WHC Characterization Equipment Engineering and Characterization Project Operations. Testing was completed per the ATP without discrepancies or deviations, except as noted
Guo, Jiin-Huarng; Luh, Wei-Ming
2009-05-01
When planning a study, sample size determination is one of the most important tasks facing the researcher. The size will depend on the purpose of the study, the cost limitations, and the nature of the data. By specifying the standard deviation ratio and/or the sample size ratio, the present study considers the problem of heterogeneous variances and non-normality for Yuen's two-group test and develops sample size formulas to minimize the total cost or maximize the power of the test. For a given power, the sample size allocation ratio can be manipulated so that the proposed formulas can minimize the total cost, the total sample size, or the sum of total sample size and total cost. On the other hand, for a given total cost, the optimum sample size allocation ratio can maximize the statistical power of the test. After the sample size is determined, the present simulation applies Yuen's test to the sample generated, and then the procedure is validated in terms of Type I errors and power. Simulation results show that the proposed formulas can control Type I errors and achieve the desired power under the various conditions specified. Finally, the implications for determining sample sizes in experimental studies and future research are discussed.
International Nuclear Information System (INIS)
Dragusin, M.; Rotaru, R.
2000-01-01
use in the production of herbal drugs ought to have an acceptable high microbiological level. In herbal raw materials from first group, according to international requirements the total count of aerobic bacteria can not exceed 10.000 per 1 gram . Fungi and bacilli from the Enterobacteriaceae family should not be higher than 100 per 1 gram. The absence of E.coli, S.aureus and P.aureaginosa are the obligatory requirement. Our investigations have shown conclusively that raw materials in Romania are contaminated by microorganisms in large extent. In all sample number of aerobic bacteria, yeast and moulds, Enterobacteriaceae bacilli exceed permissible level. Decontamination by irradiation is one of the most effective method for decreasing of number of microorganisms in herbal raw materials. The content of biological active substances in many raw herbal materials did not change in a significant degree after irradiation. Radiation treatment can be applied to hermetically packed product, thereby excluding recontamination. (authors)
Estimating waste disposal quantities from raw waste samples
International Nuclear Information System (INIS)
Negin, C.A.; Urland, C.S.; Hitz, C.G.; GPU Nuclear Corp., Middletown, PA)
1985-01-01
Estimating the disposal quantity of waste resulting from stabilization of radioactive sludge is complex because of the many factors relating to sample analysis results, radioactive decay, allowable disposal concentrations, and options for disposal containers. To facilitate this estimation, a microcomputer spread sheet template was created. The spread sheet has saved considerable engineering hours. 1 fig., 3 tabs
Data of the 22nd nuclear explosion test of the People's Republic of China
International Nuclear Information System (INIS)
1978-01-01
US. Energy Research and Development Administration (US ERDA) announced for the 22 nd nuclear explosion test of the People's Republic of China. The radioactivity surveillance was carried out for the period from September 19, to September 28, 1977. From the results of this surveillance, the effects of this nuclear explosion test were detected in the radioactivity measurement of rainwater, dry fallout, air-borne dusts in upper atmosphere, and raw milk samples. Survey on iodine-131 concentrations in raw milk was continued until October 11, 1977. The results of radioactivity surveillance were described in the following articles. (author)
Tests on CANDU fuel elements sheath samples
International Nuclear Information System (INIS)
Ionescu, S.; Uta, O.; Mincu, M.; Prisecaru, I.
2016-01-01
This work is a study of the behavior of CANDU fuel elements after irradiation. The tests are made on ring samples taken from fuel cladding in INR Pitesti. This paper presents the results of examinations performed in the Post Irradiation Examination Laboratory. By metallographic and ceramographic examination we determinate that the hydride precipitates are orientated parallel to the cladding surface. A content of hydrogen of about 120 ppm was estimated. After the preliminary tests, ring samples were cut from the fuel rod, and were subject of tensile test on an INSTRON 5569 model machine in order to evaluate the changes of their mechanical properties as consequence of irradiation. Scanning electron microscopy was performed on a microscope model TESCAN MIRA II LMU CS with Schottky FE emitter and variable pressure. The analysis shows that the central zone has deeper dimples, whereas on the outer zone, the dimples are tilted and smaller. (authors)
Glucose from a cellulose-containing raw material
Energy Technology Data Exchange (ETDEWEB)
Feniksova, R V
1977-01-01
Glucose was produced by mixing the raw material with an enzyme and water, enzymic hydrolysis of raw material, and separation of the hydrolyzate. To increase the yield of glucose, the hydrolysis took place in 2 stages: at the 1st stage, the hydrolysis was continued until the mixture of glucose and oligosaccharides was obtained under the influence of an active enzyme (1 to 20 units/g of cellulose present in the raw material); at the 2nd stage, cellulase immobilized on an insoluble carrier (by covalent bonds) was used for the hydrolysis of oligosaccharides. The hydromodulus of the suspension of cellulose-containing raw material was maintained 5 to 30. A carrier nonhydrolyzable by cellulase, for instance a homogenious macroporous Aerosil gel, a porous glass, or porous ceramics, was used.
Li, Ling; Renye, John A; Feng, Ling; Zeng, Qingkun; Tang, Yan; Huang, Li; Ren, Daxi; Yang, Pan
2016-09-01
The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High-quality samples of raw buffalo milk were obtained from 3 dairy farms in the Guangxi province in southern China. Five liters of each milk sample were pasteurized (72°C; 15 s); and both raw and pasteurized milks were stored at refrigeration temperature (1-4°C) for various times with their microbial communities characterized using the Illumina Miseq platform (Novogene, Beijing, China). Results showed that both raw and pasteurized milks contained a diverse microbial population and that the populations changed over time during storage. In raw buffalo milk, Lactococcus and Streptococcus dominated the population within the first 24h; however, when stored for up to 72h the dominant bacteria were members of the Pseudomonas and Acinetobacter genera, totaling more than 60% of the community. In pasteurized buffalo milk, the microbial population shifted from a Lactococcus-dominated community (7d), to one containing more than 84% Paenibacillus by 21d of storage. To increase the shelf-life of buffalo milk and its products, raw milk needs to be refrigerated immediately after milking and throughout transport, and should be monitored for the presence of Paenibacillus. Results from this study suggest pasteurization should be performed within 24h of raw milk collection, when the number of psychrotrophic bacteria are low; however, as Paenibacillus spores are resistant to pasteurization, additional antimicrobial treatments may be required to extend shelf-life. The findings from this study are expected to aid in improving the quality and safety of raw and pasteurized buffalo milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Biological and physiological changes in raw and radiation-processed legumes
International Nuclear Information System (INIS)
El Wakeil, F.A.; Sharabash, M.T.M.; Farag, M. Diaa El-Din H.; Mahrous, S.R.
1994-01-01
Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suffered from poor growth due to some antinutritional factors. When the studied legumes were exposed to 10 kGy, the rats gained more weight than those kept on raw legumes. When extracts of raw legumes were intraperitoneally injected, the LD 50 were found to be 125, 300 and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 3000 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 kGy). Meanwhile, after irradiation treatment of kidney beans, soybeans and broad beans, the LD 50 were found to be 250, 400 and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate but significant increase in liver weight only. However, rats fed on both raw and irradiated broad beans, chick peas and lupines in their diets did not suffer any pancreatic and liver hypertrophy or spleen atrophy. The haematological parameters investigated showed that there was no significant differences between rat groups fed on either raw or irradiated legumes. It could be concluded that irradiation offers a good treatment for legumes as it has a beneficial effect to correct the poor growth for rats fed on raw beans during experimental period without any deleterious physiological effects. (author)
DEFF Research Database (Denmark)
Petersen, Heidi Huus; Enemark, Heidi L.; Olsen, Annette
2012-01-01
to determine the effectiveness of different slurry separation technologies to remove oocysts and other pathogens, as well as whether application of separated liquid slurry to agricultural land may represent higher risks for ground water contamination as compared to application of raw slurry.......The potential for transport of viable Cryptosporidium parvum oocysts through soil to land drains and groundwater was studied using simulated rainfall and intact soil columns which were applied raw slurry or separated liquid slurry. Following irrigation and weekly samplings over a four week period......, C. parvum oocysts were detected from all soil columns regardless of slurry type and application method although recovery rates were low (liquid slurry leached 73% and 90% more oocysts compared with columns with injected and surface applied raw slurry, respectively...
Directory of Open Access Journals (Sweden)
Jolanta G. Rola
2016-03-01
Full Text Available This paper describes the results of a 3-year study on the prevalence, enterotoxinogenicity and resistance to antimicrobials of S. aureus isolated on dairy farms with small scale production of raw cow milk cheeses. The samples of raw milk, semi-finished products and the final products as well as swabs were collected between 2011 and 2013 from nine dairy farms in Poland. A total of 244 samples were examined, of which 122 (50.0% were contaminated with S. aureus including 18 of 26 (69.2% mature cheese samples with log10 CFU g−1 between <1- and 7.41. In swabs collected from the staff and production environment the highest contamination rate with coagulase positive staphylococci (CPS was detected on hands of cheese makers (4.34 log10 CFU/swab. None of the cheese samples contaminated with CPS contained staphylococcal enterotoxins (SEs. However, 55 of 122 (45.1% S. aureus isolates possessed SEs genes, mainly (26 of 55; 47.3% a combination of the sed, sej and ser genes. Furthermore, the sep (15 of 55; 27.3% as well as seg and sei (9 of 55; 16.4% genes were also identified. The remaining S. aureus isolates possessed the sea gene (one isolate, the combination of sec, seg and sei (three isolates as well as the sed, sej, sep and ser markers together (one CPS. Resistance to penicillin (62 of 122 isolates; 50.8% was the most common among the tested isolates. Some CPS were also resistant to chloramphenicol (7; 5.7% and tetracycline (5; 4.1%. The obtained results indicated that the analyzed cheeses were safe for consumers. To improve the microbiological quality of traditional cheese products more attention should be paid to animal welfare and hygiene practices during the process of cheese manufacturing in some dairy farms.
Strategic raw materials. Risk management; Strategische Rohstoffe. Risikovorsorge
Energy Technology Data Exchange (ETDEWEB)
Bertau, Martin [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Technische Chemie; Gutzmer, Jens [Helmholtz-Institut fuer Ressourcentechnologie Freiberg (Germany); Matschullat, Joerg (ed.) [Technische Univ. Bergakademie Freiberg (Germany). Interdisziplinaeres Oekologisches Zentrum (IOeZ); Kausch, Peter
2014-07-01
This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [German] Dieser Band gliedert sich in vier Kapitel: (1) Rohstoffwirtschaft, (2) Primaere Rohstoffe, (3) Sekundaere Rohstoffe und Recycling,(4). Verarbeitung und Produkte. Die Themen zum Kapitel ''Rohstoffwirtschaft'' sind: Substitution von Rohstoffen - Rahmenbedingungen und Umsetzung; Thales: Strategische Rohstoffe; Zeit fuer
On Wasserstein Two-Sample Testing and Related Families of Nonparametric Tests
Directory of Open Access Journals (Sweden)
Aaditya Ramdas
2017-01-01
Full Text Available Nonparametric two-sample or homogeneity testing is a decision theoretic problem that involves identifying differences between two random variables without making parametric assumptions about their underlying distributions. The literature is old and rich, with a wide variety of statistics having being designed and analyzed, both for the unidimensional and the multivariate setting. Inthisshortsurvey,wefocusonteststatisticsthatinvolvetheWassersteindistance. Usingan entropic smoothing of the Wasserstein distance, we connect these to very different tests including multivariate methods involving energy statistics and kernel based maximum mean discrepancy and univariate methods like the Kolmogorov–Smirnov test, probability or quantile (PP/QQ plots and receiver operating characteristic or ordinal dominance (ROC/ODC curves. Some observations are implicit in the literature, while others seem to have not been noticed thus far. Given nonparametric two-sample testing’s classical and continued importance, we aim to provide useful connections for theorists and practitioners familiar with one subset of methods but not others.
Treatment and conditioning of solid and liquid raw
International Nuclear Information System (INIS)
Jakubec, R.
2015-01-01
Jadrova a vyradovacia spolocnost, a.s. (JAVYS) implements activities within the processes of treatment and conditioning of radioactive waste (RAW) at two nuclear facilities, one of them located in Bohunice - Technologies for treatment and conditioning of RAW. This nuclear facility includes: Bohunice RAW treatment centre, bituminization lines, waste water purification station and technologies for sorting, fragmentation and decontamination of metallic RAW. The Bohunice RAW treatment centre (BRTC) in Bohunice processes and conditions liquid and solid radioactive waste produced during the A1 NPP and V1 NPP decommissioning, waste from the operation of V2 NPP in Bohunice as well as from the operation of NPP EMO 1,2 in Mochovce. The BRTC includes the following technological facilities: sorting, high-pressure compaction, incineration, concentration and cementation. Treatment of radioactive wastes in the BRTC is described. (authors)
Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy
2016-07-18
Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy
New and non-traditional mineral raw materials deposits, perspectives of use
International Nuclear Information System (INIS)
Beyseev, O.; Beyseev, A.; Baichigasov, I.; Sergev, E.; Shakirova, G.
1996-01-01
Deposits of new and non-traditional kinds of mineral raw material are revealed, explored and prepared to industrial recovery in Kazakstan, that can be used in frames of conversion process to create new materials with unique properties, to prepare base for new technologies elaboration, and to achieve appreciable economic benefit. These deposits are located mostly in geographic and economic conditions of advanced infrastructure and mining works network, favorable for recovery.On the tests results the following is of heaviest interest: RHODUCITE, NEMALITE-CONTAINING CHRYSOTILE-ASBESTOS, NICKEL-CONTAINING SILICATE-ASBOLAN ORES, MEDICINAL MINERALS, SHUNGITES, FULLERENES, RAW QUARTZ MINERALS - the group of deposits containing 5 min tons of high quality quartz good for manufacture of cut-glass and fibre-optical articles, is explored in details. There are also deposits of other kinds of non-traditional strategic mineral raw material in the Republic of Kazakstan - natural fillers, that can be used in the national economy of the country and bring considerable economic benefit: chrysotile-asbestos, amphibole-asbestos, talk, vollastonite, tremolite, actinolite, vermiculite, zeolite, etc
Investigation on pyrolysis of some organic raw materials
Directory of Open Access Journals (Sweden)
Purevsuren B
2017-02-01
Full Text Available We have been working on pyrolysis of some organic raw materials including different rank coals, oil shale, wood waste, animal bone, cedar shell, polypropylene waste, milk casein and characterization of obtained hard residue, tar and pyrolytic water and gas after pyrolysis. The technical characteristics of these organic raw materials have been determined and the thermal stability characteristics such as thermal stability indices (T5% and T25% determined by using thermogravimetric analysis. The pyrolysis experiments were performed at different heating temperatures and the yields of hard residue, tar, pyrolysis water and gaseous products were determined and discussed. The main technical characteristics of hard residue of organic raw materials after pyrolysis have been determined and the adsorption ability of pyrolysis hard residue and its activated carbon of organic raw materials also determined. The pyrolysis tars of organic raw materials were distilled in air condition and determined the yields of obtained light, middle and heavy fractions and bitumen like residue with different boiling temperature. This is the first time to investigate the curing ability of pyrolysis tars of organic raw materials for epoxy resin and the results of these experiments showed that only tar of milk casein has the highest (95.0%, tar of animal bone has certain (18.70% and tars of all other organic raw materials have no curing ability for epoxy resin.
Sasipriya, Gopalakrishnan; Siddhuraju, Perumal
2013-03-01
The experiment was carried out to investigate the inclusion of underutilised legumes, Entada scandens, Canavalia gladiata and Canavalia ensiformis, seed meal in soybean-based diet in broilers. The utilisation of these wild legumes is limited by the presence of antinutrient compounds. Processing methods like soaking followed by autoclaving in sodium bicarbonate solution in E. scandens and C. gladiata and soaking followed by autoclaving in ash solution in C. ensiformis were adopted. The proximate composition of raw and processed samples of E. scandens, C. gladiata and C. ensiformis were determined. The protein content was enhanced in processed sample of E. scandens (46 %) and C. ensiformis (16 %). This processing method had reduced the maximum number of antinutrients such as tannins (10-100 %), trypsin inhibitor activity (99 %), chymotrypsin inhibitor activity (72-100 %), canavanine (60-62 %), amylase inhibitor activity (73-100 %), saponins (78-92 %), phytic acid (19-40 %) and lectins. Hence, the raw samples at 15 % and processed samples at 15 and 30 % were replaced with soybean protein in commercial broiler diet respectively. Birds fed with 30 % processed samples of E. scandens, C. gladiata and C. ensiformis showed significantly similar results of growth performance, carcass characteristics, organ weight, haematological parameters and serum biochemical parameters (cholesterol, protein, bilirubin, albumin, globulin and liver and kidney function parameters) without any adverse effects after 42 days of supplementation. The proper utilisation of these underutilised legumes may act as an alternative protein ingredient in poultry diets.
OZONE ABSORPTION IN RAW WATERS
Directory of Open Access Journals (Sweden)
LJILJANA TAKIĆ
2008-03-01
Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.
International Nuclear Information System (INIS)
Zarzycki, Paweł K.; Ślączka, Magdalena M.; Zarzycka, Magdalena B.; Włodarczyk, Elżbieta; Baran, Michał J.
2012-01-01
The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds’ feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5–8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.
Energy Technology Data Exchange (ETDEWEB)
Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)
2012-02-24
The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.
Mineral raw materials for power production in legislation of the Republic of Croatia
International Nuclear Information System (INIS)
Matisa, Z.
1999-01-01
According to the Constitution of the Republic of Croatia, mineral wealth is a public good of legal interest to the Republic of Croatia and enjoys its special protection. The Mining Law establishes that mineral wealth (including mineral resources that are used for power production) is the property of the Republic of Croatia. Among other mineral raw materials, this refers to mineral raw materials that are used for power production: coal, oil, natural gas, radioactive mineral raw materials and geothermal waters. These mineral resources are as almost all other mineral raw materials with the exception of geothermal waters, an unrecoverable natural resource. The right to use that natural resource may be granted only by a concession. The mining legislation provides for exploration and exploitation of mineral raw materials. Exploration of oil and gas is considered to comprise operations and testing with the aim to establish the existence, position and form of oil and natural gas deposits, their quality and quantity, as well as exploitation conditions. Exploitation of oil and natural gas is considered to comprise extraction from deposits, refining and transport, as well as disposal in geological structures. Mineral raw materials used in power production amount to 63% of national total primary energy production, and they cover 33% of total power consumption in the country. Legislation in the Republic of Croatia, which refers to exploration and exploitation of oil and natural gas, allows economic utilization of that unrecoverable natural wealth to run smoothly and in compliance with practices in our European environment. (author)
Investigation of some additive residues in bulk raw milk collected from Pakdasht area in 2009
Directory of Open Access Journals (Sweden)
T Moosavi
2011-05-01
Full Text Available Milk is one of the most important sources of human nutrition and because of high nutrient content; it is a very suitable medium for microbial growth and spoilage. Sometimes farmers cheat and add some additives to milk in order to cover the spoilage or other defects in milk. In this study 120 samples of bulk raw milk (10 samples each month were collected from dairy farms of Pakdasht under sterile condition and send to veterinary faculty of GarmsarUniversity. The following tests were done on each sample: Anti-microbial residues, residues milk acidity neutralizer, evaluation of sugar, formalin, Hydrogen peroxide, Salicylic acid and salt presence. Results were analyzed with Spss software and the results of the first six months of the year were compared statistically with the results of the second six months of the year. The mean of antimicrobial agents, milk acid neutralizer, formalin, hydrogen peroxide and salicylic acid showed no significant difference. But sugar in first semester were more than second semester (p
Curvelet-based compressive sensing for InSAR raw data
Costa, Marcello G.; da Silva Pinho, Marcelo; Fernandes, David
2015-10-01
The aim of this work is to evaluate the compression performance of SAR raw data for interferometry applications collected by airborne from BRADAR (Brazilian SAR System operating in X and P bands) using the new approach based on compressive sensing (CS) to achieve an effective recovery with a good phase preserving. For this framework is desirable a real-time capability, where the collected data can be compressed to reduce onboard storage and bandwidth required for transmission. In the CS theory, a sparse unknown signals can be recovered from a small number of random or pseudo-random measurements by sparsity-promoting nonlinear recovery algorithms. Therefore, the original signal can be significantly reduced. To achieve the sparse representation of SAR signal, was done a curvelet transform. The curvelets constitute a directional frame, which allows an optimal sparse representation of objects with discontinuities along smooth curves as observed in raw data and provides an advanced denoising optimization. For the tests were made available a scene of 8192 x 2048 samples in range and azimuth in X-band with 2 m of resolution. The sparse representation was compressed using low dimension measurements matrices in each curvelet subband. Thus, an iterative CS reconstruction method based on IST (iterative soft/shrinkage threshold) was adjusted to recover the curvelets coefficients and then the original signal. To evaluate the compression performance were computed the compression ratio (CR), signal to noise ratio (SNR), and because the interferometry applications require more reconstruction accuracy the phase parameters like the standard deviation of the phase (PSD) and the mean phase error (MPE) were also computed. Moreover, in the image domain, a single-look complex image was generated to evaluate the compression effects. All results were computed in terms of sparsity analysis to provides an efficient compression and quality recovering appropriated for inSAR applications
Ethanol is a strategic raw material
Directory of Open Access Journals (Sweden)
Baras Josip K.
2002-01-01
Full Text Available The first part of this review article considers general data about ethanol as an industrial product, its qualities and uses. It is emphasized that, if produced from biomass as a renewable raw material, its perspectives as a chemical raw material and energent are brilliant. Starchy grains, such as corn, must be used as the main raw materials for ethanol production. The production of bioethanol by the enzyme-catalyzed conversion of starch followed by (yeast fermentation, distillation is the process of choice. If used as a motor fuel, anhydrous ethanol can be directly blended with gasoline or converted into an oxygenator such as ETBE. Finally, bioethanol production in Yugoslavia and the possibilities for its further development are discussed.
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine
2016-01-01
ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane
2016-07-01
Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake
Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study
Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.
2014-01-01
PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309
VERAM - Vision and Roadmap for European Raw Materials
Baumgarten, Wibke; Vashev, Boris
2017-04-01
The overall objective of VERAM project is to produce a Vision and Roadmap for European Raw Materials in 2050 based on raw materials research and innovation (R&I) coordination. Two leading European Technology Platforms (ETPs): ETP SMR (Sustainable Minerals Resources) and FTP (Forest Technology Platform) are joining forces to develop a common vison and roadmap with the support of ECTP (European Construction Technology Platform), represented by UNIVPM, SusChem (ETP for Sustainable Chemistry), represented by Cefic, EuMaT (Advanced Materials ETP), represented by VITO, ERAMIN 2, represented by Research Centre JUELICH and WoodWisdom Network Plus represented by the Agency for Renewable Resources (FNR). This partnership provides VERAM with expertise from downstream applications and additional knowledge on non-biotic and biotic raw materials. The project encourages capacity building as well as transfer of knowledge. It expects to provide an innovation reference point for the European Institute of Innovation & Technology (EIT) Raw Materials (formerly the KIC Raw MatTERS), to coordinate the network involved in the European Innovation Partnership (EIP) on Raw Materials Commitments and relevant proposals funded under Horizon 2020. It provides a platform for identifying gaps and complementarities and enables their bridging. VERAM will be able to advise the European Commission and Member States on future research needs and policies to stimulate innovation and assist in overcoming fragmentation in the implementing the EIP Raw Materials Strategic Implementation Plan. VERAM looks for mutually beneficial information exchange, encourages cross-fertilization between actions undertaken by different raw material industries, and expects to accelerate exploitation of breakthrough innovations. One of the main outcomes of the project is the presentation of a common long term 2050 Vision and Roadmap for relevant raw materials including metals, industrial minerals and aggregates and wood. The
VAHEDI, M.; NASROLAHEI, M.; SHARIF, M.; MIRABI, A.M.
2013-01-01
Summary Introduction. The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. Methods. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and List...
Estimation of sample size and testing power (Part 3).
Hu, Liang-ping; Bao, Xiao-lei; Guan, Xue; Zhou, Shi-guo
2011-12-01
This article introduces the definition and sample size estimation of three special tests (namely, non-inferiority test, equivalence test and superiority test) for qualitative data with the design of one factor with two levels having a binary response variable. Non-inferiority test refers to the research design of which the objective is to verify that the efficacy of the experimental drug is not clinically inferior to that of the positive control drug. Equivalence test refers to the research design of which the objective is to verify that the experimental drug and the control drug have clinically equivalent efficacy. Superiority test refers to the research design of which the objective is to verify that the efficacy of the experimental drug is clinically superior to that of the control drug. By specific examples, this article introduces formulas of sample size estimation for the three special tests, and their SAS realization in detail.
Group SkSP-R sampling plan for accelerated life tests
Indian Academy of Sciences (India)
Muhammad Aslam
2017-09-15
Sep 15, 2017 ... SkSP-R sampling; life test; Weibull distribution; producer's risk; ... designed a sampling plan under a time-truncated life test .... adjusted using an acceleration factor. ... where P is the probability of lot acceptance for a single.
Adaptive designs for the one-sample log-rank test.
Schmidt, Rene; Faldum, Andreas; Kwiecien, Robert
2017-09-22
Traditional designs in phase IIa cancer trials are single-arm designs with a binary outcome, for example, tumor response. In some settings, however, a time-to-event endpoint might appear more appropriate, particularly in the presence of loss to follow-up. Then the one-sample log-rank test might be the method of choice. It allows to compare the survival curve of the patients under treatment to a prespecified reference survival curve. The reference curve usually represents the expected survival under standard of the care. In this work, convergence of the one-sample log-rank statistic to Brownian motion is proven using Rebolledo's martingale central limit theorem while accounting for staggered entry times of the patients. On this basis, a confirmatory adaptive one-sample log-rank test is proposed where provision is made for data dependent sample size reassessment. The focus is to apply the inverse normal method. This is done in two different directions. The first strategy exploits the independent increments property of the one-sample log-rank statistic. The second strategy is based on the patient-wise separation principle. It is shown by simulation that the proposed adaptive test might help to rescue an underpowered trial and at the same time lowers the average sample number (ASN) under the null hypothesis as compared to a single-stage fixed sample design. © 2017, The International Biometric Society.
A two-sample Bayesian t-test for microarray data
Directory of Open Access Journals (Sweden)
Dimmic Matthew W
2006-03-01
Full Text Available Abstract Background Determining whether a gene is differentially expressed in two different samples remains an important statistical problem. Prior work in this area has featured the use of t-tests with pooled estimates of the sample variance based on similarly expressed genes. These methods do not display consistent behavior across the entire range of pooling and can be biased when the prior hyperparameters are specified heuristically. Results A two-sample Bayesian t-test is proposed for use in determining whether a gene is differentially expressed in two different samples. The test method is an extension of earlier work that made use of point estimates for the variance. The method proposed here explicitly calculates in analytic form the marginal distribution for the difference in the mean expression of two samples, obviating the need for point estimates of the variance without recourse to posterior simulation. The prior distribution involves a single hyperparameter that can be calculated in a statistically rigorous manner, making clear the connection between the prior degrees of freedom and prior variance. Conclusion The test is easy to understand and implement and application to both real and simulated data shows that the method has equal or greater power compared to the previous method and demonstrates consistent Type I error rates. The test is generally applicable outside the microarray field to any situation where prior information about the variance is available and is not limited to cases where estimates of the variance are based on many similar observations.
Centers for Disease Control (CDC) Podcasts
2013-08-05
Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters. Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Date Released: 8/7/2013.
Bovine milk sampling efficiency for pregnancy-associated glycoproteins (PAG) detection test
Energy Technology Data Exchange (ETDEWEB)
Silva, H. K. da; Cassoli, L.D.; Pantoja, J.F.C.; Cerqueira, P.H.R.; Coitinho, T.B.; Machado, P.F.
2016-07-01
Two experiments were conducted to verify whether the time of day at which a milk sample is collected and the possible carryover in the milking system may affect pregnancy-associated glycoproteins (PAG) levels and, consequently, the pregnancy test results in dairy cows. In experiment one, we evaluated the effect of time of day at which the milk sample is collected from 51 cows. In experiment two, which evaluated the possible occurrence of carryover in the milk meter milking system, milk samples from 94 cows belonging to two different farms were used. The samples were subjected to pregnancy test using ELISA methodology to measure PAG concentrations and to classify the samples as positive (pregnant), negative (nonpregnant), or suspicious (recheck). We found that the time of milking did not affect the PAG levels. As to the occurrence of carryover in the milk meter, the PAG levels of the samples collected from Farm-2 were heavily influenced by a carryover effect compared with the samples from Farm-1. Thus, milk samples submitted to a pregnancy test can be collected during the morning or the evening milking. When the sample is collected from the milk meters, periodic equipment maintenance should be noted, including whether the milk meter is totally drained between different animals’ milking and equipment cleaning between milking is performed correctly to minimize the occurrence of carryover, thereby avoiding the effect on PAG levels and, consequently, the pregnancy test results. Therefore, a single milk sample can be used for both milk quality tests and pregnancy test.
Bovine milk sampling efficiency for pregnancy-associated glycoproteins (PAG) detection test
International Nuclear Information System (INIS)
Silva, H. K. da; Cassoli, L.D.; Pantoja, J.F.C.; Cerqueira, P.H.R.; Coitinho, T.B.; Machado, P.F.
2016-01-01
Two experiments were conducted to verify whether the time of day at which a milk sample is collected and the possible carryover in the milking system may affect pregnancy-associated glycoproteins (PAG) levels and, consequently, the pregnancy test results in dairy cows. In experiment one, we evaluated the effect of time of day at which the milk sample is collected from 51 cows. In experiment two, which evaluated the possible occurrence of carryover in the milk meter milking system, milk samples from 94 cows belonging to two different farms were used. The samples were subjected to pregnancy test using ELISA methodology to measure PAG concentrations and to classify the samples as positive (pregnant), negative (nonpregnant), or suspicious (recheck). We found that the time of milking did not affect the PAG levels. As to the occurrence of carryover in the milk meter, the PAG levels of the samples collected from Farm-2 were heavily influenced by a carryover effect compared with the samples from Farm-1. Thus, milk samples submitted to a pregnancy test can be collected during the morning or the evening milking. When the sample is collected from the milk meters, periodic equipment maintenance should be noted, including whether the milk meter is totally drained between different animals’ milking and equipment cleaning between milking is performed correctly to minimize the occurrence of carryover, thereby avoiding the effect on PAG levels and, consequently, the pregnancy test results. Therefore, a single milk sample can be used for both milk quality tests and pregnancy test.
Quality standards for sample collection in coagulation testing.
Lippi, Giuseppe; Salvagno, Gian Luca; Montagnana, Martina; Lima-Oliveira, Gabriel; Guidi, Gian Cesare; Favaloro, Emmanuel J
2012-09-01
Preanalytical activities, especially those directly connected with blood sample collection and handling, are the most vulnerable steps throughout the testing process. The receipt of unsuitable samples is commonplace in laboratory practice and represents a serious problem, given the reliability of test results can be adversely compromised following analysis of these specimens. The basic criteria for an appropriate and safe venipuncture are nearly identical to those used for collecting blood for clinical chemistry and immunochemistry testing, and entail proper patient identification, use of the correct technique, as well as appropriate devices and needles. There are, however, some peculiar aspects, which are deemed to be particularly critical when collecting quality specimens for clot-based tests, and these require clearer recognition. These include prevention of prolonged venous stasis, collection of nonhemolyzed specimens, order of draw, and appropriate filling and mixing of the primary collection tubes. All of these important preanalytical issues are discussed in this article, and evidence-based suggestions as well as recommendations on how to obtain a high-quality sample for coagulation testing are also illustrated. We have also performed an investigation aimed to identify variation of test results due to underfilling of primary blood tubes, and have identified a clinically significant bias in test results when tubes are drawn at less than 89% of total fill for activated partial thromboplastin time, less than 78% for fibrinogen, and less than 67% for coagulation factor VIII, whereas prothrombin time and activated protein C resistance remain relatively reliable even in tubes drawn at 67% of the nominal volume. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Mineralogic and petrologic investigation of post-test core samples from the Spent Fuel Test - Climax
International Nuclear Information System (INIS)
Ryerson, F.J.; Beiriger, J.
1985-02-01
We have characterized a suite of samples taken subsequent to the end of the Spent Fuel Test - Climax by petrographic and microanalytical techniques and determined their mineral assemblage, modal properties, and mineral chemistry. The samples were obtained immediately adjacent to the canister borehole at a variety of depths and positions within the canister drift, as well as radially outward from each canister hole. This method of sampling allows variations in post-test mineralogic properties to be evaluated on the basis of (1) depth along a particular canister hole and (2) position within the canister drift, with respect to the heat and radiation sources, and with respect to the pre - test samples. In no case did we find any significant correlation between the mineralogical properties and variables listed above. In short, the Spent Fuel Test - Climax has produced no identifiable mineralogical response in the Climax quartz monzonite. 12 refs., 11 figs., 5 tabs
Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.
Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D
2011-06-01
Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.
Seidel, Kathrin; Kahl, Johannes; Paoletti, Flavio; Birlouez, Ines; Busscher, Nicolaas; Kretzschmar, Ursula; Särkkä-Tirkkonen, Marjo; Seljåsen, Randi; Sinesio, Fiorella; Torp, Torfinn; Baiamonte, Irene
2015-02-01
The market for processed food is rapidly growing. The industry needs methods for "processing with care" leading to high quality products in order to meet consumers' expectations. Processing influences the quality of the finished product through various factors. In carrot baby food, these are the raw material, the pre-processing and storage treatments as well as the processing conditions. In this study, a quality assessment was performed on baby food made from different pre-processed raw materials. The experiments were carried out under industrial conditions using fresh, frozen and stored organic carrots as raw material. Statistically significant differences were found for sensory attributes among the three autoclaved puree samples (e.g. overall odour F = 90.72, p processed from frozen carrots show increased moisture content and decrease of several chemical constituents. Biocrystallization identified changes between replications of the cooking. Pre-treatment of raw material has a significant influence on the final quality of the baby food.
A Study on the Occurrence of Aflatoxin M1 in Raw and Pasteurized Milk Produced in Rafsanjan, Iran
Directory of Open Access Journals (Sweden)
FaAkrami Mohajeri Akrami Mohajeri
2015-12-01
Full Text Available Introduction: Aflatoxins, known as causative factors of hepatic and extra-hepatic carcinogenesis within humans, are extremely teratogenic, mutagenic, toxic, and carcinogenic compounds. Materials & Methods: This study was undertaken to determine the occurrence of aflatoxin M1 (AFM1 in 40 raw milk and 47 pasteurized milk samples collected during spring and winter. In order to analyze the samples, the Enzyme-linked Immunosorbent Assay (ELISA procedure was used. The statistical methods used in this study were based on normal confidence intervals and analysis of variance (ANOVA. Results: Aflatoxin M1 was detected in 97.5% of the raw milk ranging from 6.52 to 68.17 ng/l and 95.7% of the pasteurized milk, ranging from 0.8 to 58.13 ng/l. Toxin levels in 10% of the raw milk and 2.1% of the pasteurized milk samples exceeded the Iranian national standard limit i.e. 50 ng/l. Due to seasonal variations, mean concentration of AFM1 in the samples collected in winter was significantly (P < 0.03 higher than those collected in the summer. Conclusion: Large amount of AFM1 in milk samples might be a potential hazard for the public health. Reducing the levels of AFB1 in animal feedstuffs can be regarded as the initial step to control the transfer of AFM1 to humans.
ISOLOK VALVE ACCEPTANCE TESTING FOR DWPF SME SAMPLING PROCESS
Energy Technology Data Exchange (ETDEWEB)
Edwards, T.; Hera, K.; Coleman, C.; Jones, M.; Wiedenman, B.
2011-12-05
Evaluation of the Defense Waste Processing Facility (DWPF) Chemical Process Cell (CPC) cycle time identified several opportunities to improve the CPC processing time. Of the opportunities, a focus area related to optimizing the equipment and efficiency of the sample turnaround time for DWPF Analytical Laboratory was identified. The Mechanical Systems & Custom Equipment Development (MS&CED) Section of the Savannah River National Laboratory (SRNL) evaluated the possibility of using an Isolok{reg_sign} sampling valve as an alternative to the Hydragard{reg_sign} valve for taking process samples. Previous viability testing was conducted with favorable results using the Isolok sampler and reported in SRNL-STI-2010-00749 (1). This task has the potential to improve operability, reduce maintenance time and decrease CPC cycle time. This report summarizes the results from acceptance testing which was requested in Task Technical Request (TTR) HLW-DWPF-TTR-2010-0036 (2) and which was conducted as outlined in Task Technical and Quality Assurance Plan (TTQAP) SRNL-RP-2011-00145 (3). The Isolok to be tested is the same model which was tested, qualified, and installed in the Sludge Receipt Adjustment Tank (SRAT) sample system. RW-0333P QA requirements apply to this task. This task was to qualify the Isolok sampler for use in the DWPF Slurry Mix Evaporator (SME) sampling process. The Hydragard, which is the current baseline sampling method, was used for comparison to the Isolok sampling data. The Isolok sampler is an air powered grab sampler used to 'pull' a sample volume from a process line. The operation of the sampler is shown in Figure 1. The image on the left shows the Isolok's spool extended into the process line and the image on the right shows the sampler retracted and then dispensing the liquid into the sampling container. To determine tank homogeneity, a Coliwasa sampler was used to grab samples at a high and low location within the mixing tank. Data from
International Nuclear Information System (INIS)
Abed EI-Gawad, E.I.; Aiad, S.K.
2008-01-01
This Study was established to assess the effect of supplemental dietary raw green snap (Phaseolus vulgaris) for three months to overcome gamma-irradiation induced alterations on some oxidant/ antioxidant parameters (Fe 3+ , Cu 2+ , total iron, ferritin, transferrin and ceruloplasmin) and the hyper lipidemic state (triglycerides, cholesterol, high- and low density lipoprotein (HDL-c and LDL-c) in aged male rats. Raw green snap is an indigenous plant used in Unani and Ayurvedic medicine in India. The study also aimed to estimate the effect of dietary raw green snap on general health through the follow up of body weight and mortality during the course of supplementation. Thirty-two aged male rats (24 months, 370-375 g) were divided equally into four groups. 1- Control group, the animals fed on a balanced diet for 3 months. 2- Supplemented group, the animals balanced diet was supplemented with raw green snap (70 g / kg body wt/ day) for 3 months. 3- Irradiated group, the animals fed on a balanced diet for 3 months were then exposed to whole body y-radiation at a dose level of 4 Gy. 4-Supplemented-irradiated group, the animals' balanced diet was supplemented with raw green snap (70 g/ kg/ day) for three months and then exposed to whole body gamma irradiation at a dose level of 4 Gy. The blood samples were taken from orbital venous plexuses after 48 h of stopping green snap supplementation (supplemented group) or after irradiation (irradiated and supplemented gamma-irradiated groups). The results obtained showed reduction in the body wt in green snap supplemented group which increased gradually concomitant with occurrence of animal mortality on week 7 reaching II) maximal values (-32.79 and 33.33 %) respectively, on week 12 of supplementation. Also, the supplemented group showed non significant changes in tested parameters although the level of total iron and triglycerides recorded noticeable changes as compared with controls
Fault Diagnosis from Raw Sensor Data Using Deep Neural Networks Considering Temporal Coherence.
Zhang, Ran; Peng, Zhen; Wu, Lifeng; Yao, Beibei; Guan, Yong
2017-03-09
Intelligent condition monitoring and fault diagnosis by analyzing the sensor data can assure the safety of machinery. Conventional fault diagnosis and classification methods usually implement pretreatments to decrease noise and extract some time domain or frequency domain features from raw time series sensor data. Then, some classifiers are utilized to make diagnosis. However, these conventional fault diagnosis approaches suffer from the expertise of feature selection and they do not consider the temporal coherence of time series data. This paper proposes a fault diagnosis model based on Deep Neural Networks (DNN). The model can directly recognize raw time series sensor data without feature selection and signal processing. It also takes advantage of the temporal coherence of the data. Firstly, raw time series training data collected by sensors are used to train the DNN until the cost function of DNN gets the minimal value; Secondly, test data are used to test the classification accuracy of the DNN on local time series data. Finally, fault diagnosis considering temporal coherence with former time series data is implemented. Experimental results show that the classification accuracy of bearing faults can get 100%. The proposed fault diagnosis approach is effective in recognizing the type of bearing faults.
Directory of Open Access Journals (Sweden)
Renato G. Zanoni
2012-01-01
Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.
Microfluidic devices for sample clean-up and screening of biological samples
Tetala, K.K.R.
2009-01-01
Analytical chemistry plays an important role in the separation and identification of analytes from raw samples (e.g. plant extracts, blood), but the whole analytical process is tedious, difficult to automate and time consuming. To overcome these drawbacks, the concept of μTAS (miniaturized total
Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.
Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott
2014-02-05
Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.
Lee, Kathryn; Lankers, Markus; Valet, Oliver
2018-02-01
Raw materials need to be of a certain quality with respect to physical and chemical composition. They also need to have no contaminants, including particles, because these could indicate raw material impurities or contaminate the product. Particle identification allows determination of process conditions that caused them and whether the quality of the final product is acceptable. Particles may appear to the eye to be very different things than they actually are. They may be coated with the raw material and may consist of several components; therefore, chemical and elemental analyses are required for accuracy in proper identification and definitive information about their source. Thus, microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and infrared (IR) spectroscopy are excellent tools for identifying particles in materials. Those tools are fast and accurate, and can provide chemical and elemental composition as well as images that can aid identification. The micro-analysis capabilities allow for easy analysis of different portions of samples so that multiple components can be identified and sample preparation can be reduced or eliminated. The differences in sensitivities of Raman and IR spectroscopies to different functional groups as well as the elemental analysis provided by LIBS and the image analysis provided by the microscopy makes these complementary techniques and provides the advantage of identifying various chemical components. Proper spectral searching techniques and interpretation of the results are important for interpretation and identification of trace contaminants.
Viral RNA testing and automation on the bead-based CBNE detection microsystem.
Energy Technology Data Exchange (ETDEWEB)
Galambos, Paul C.; Bourdon, Christopher Jay; Farrell, Cara M.; Rossito, Paul (University of California at Davis); McClain, Jaime L.; Derzon, Mark Steven; Cullor, James Sterling (University of California at Davis); Rahimian, Kamayar
2008-09-01
We developed prototype chemistry for nucleic acid hybridization on our bead-based diagnostics platform and we established an automatable bead handling protocol capable of 50 part-per-billion (ppb) sensitivity. We are working towards a platform capable of parallel, rapid (10 minute), raw sample testing for orthogonal (in this case nucleic acid and immunoassays) identification of biological (and other) threats in a single sensor microsystem. In this LDRD we developed the nucleic acid chemistry required for nucleic acid hybridization. Our goal is to place a non-cell associated RNA virus (Bovine Viral Diarrhea, BVD) on the beads for raw sample testing. This key pre-requisite to showing orthogonality (nucleic acid measurements can be performed in parallel with immunoassay measurements). Orthogonal detection dramatically reduces false positives. We chose BVD because our collaborators (UC-Davis) can supply samples from persistently infected animals; and because proof-of-concept field testing can be performed with modification of the current technology platform at the UC Davis research station. Since BVD is a cattle-prone disease this research dovetails with earlier immunoassay work on Botulinum toxin simulant testing in raw milk samples. Demonstration of BVD RNA detection expands the repertoire of biological macromolecules that can be adapted to our bead-based detection. The resources of this late start LDRD were adequate to partially demonstrate the conjugation of the beads to the nucleic acids. It was never expected to be adequate for a full live virus test but to motivate that additional investment. In addition, we were able to reduce the LOD (Limit of Detection) for the botulinum toxin stimulant to 50 ppb from the earlier LOD of 1 ppm. A low LOD combined with orthogonal detection provides both low false negatives and low false positives. The logical follow-on steps to this LDRD research are to perform live virus identification as well as concurrent nucleic acid and
Modeling to control spores in raw milk
Vissers, M.
2007-01-01
A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type
CHARACTERIZATION AND ACTUAL WASTE TEST WITH TANK 5F SAMPLES
International Nuclear Information System (INIS)
Fletcher, D.
2007-01-01
The initial phase of bulk waste removal operations was recently completed in Tank 5F. Video inspection of the tank indicates several mounds of sludge still remain in the tank. Additionally, a mound of white solids was observed under Riser 5. In support of chemical cleaning and heel removal programs, samples of the sludge and the mound of white solids were obtained from the tank for characterization and testing. A core sample of the sludge and Super Snapper sample of the white solids were characterized. A supernate dip sample from Tank 7F was also characterized. A portion of the sludge was used in two tank cleaning tests using oxalic acid at 50 C and 75 C. The filtered oxalic acid from the tank cleaning tests was subsequently neutralized by addition to a simulated Tank 7F supernate. Solids and liquid samples from the tank cleaning test and neutralization test were characterized. A separate report documents the results of the gas generation from the tank cleaning test using oxalic acid and Tank 5F sludge. The characterization results for the Tank 5F sludge sample (FTF-05-06-55) appear quite good with respect to the tight precision of the sample replicates, good results for the glass standards, and minimal contamination found in the blanks and glass standards. The aqua regia and sodium peroxide fusion data also show good agreement between the two dissolution methods. Iron dominates the sludge composition with other major contributors being uranium, manganese, nickel, sodium, aluminum, and silicon. The low sodium value for the sludge reflects the absence of supernate present in the sample due to the core sampler employed for obtaining the sample. The XRD and CSEM results for the Super Snapper salt sample (i.e., white solids) from Tank 5F (FTF-05-07-1) indicate the material contains hydrated sodium carbonate and bicarbonate salts along with some aluminum hydroxide. These compounds likely precipitated from the supernate in the tank. A solubility test showed the material
A balancing method for calculating a component raw involving CGF
Energy Technology Data Exchange (ETDEWEB)
Kim, K.; Kang, D.; Yang, J.E. [Integrated Safety Assessment Division, Korea Atomic Energy Research Institute, Daejon (Korea, Republic of)
2004-07-01
In this paper, a method called the 'Balancing Method' to derive a component RAW (Risk Achievement Worth) with basic event RAWs including a CCF (Common Cause Failure) RAW is summarized, and compared with the method proposed by the NEI (Nuclear Energy Institute) by mathematically checking the background on which the two methods are based. It is proved that the Balancing Method has a strong mathematically background. While the NEI method significantly underestimates the component RAW and is a little bit ad hoc in handling CCF RAW, the Balancing Method estimates the true component RAW very closely. Validity of the Balancing Method is based on the fact that if an component is out-of-service, it does not mean that the component is non-existent, but integrates the possibility that the component might fail due to CCF. The validity of the Balancing Method is proved by comparing it to the exact component RAW generated from the fault tree model.
A balancing method for calculating a component raw involving CGF
International Nuclear Information System (INIS)
Kim, K.; Kang, D.; Yang, J.E.
2004-01-01
In this paper, a method called the 'Balancing Method' to derive a component RAW (Risk Achievement Worth) with basic event RAWs including a CCF (Common Cause Failure) RAW is summarized, and compared with the method proposed by the NEI (Nuclear Energy Institute) by mathematically checking the background on which the two methods are based. It is proved that the Balancing Method has a strong mathematically background. While the NEI method significantly underestimates the component RAW and is a little bit ad hoc in handling CCF RAW, the Balancing Method estimates the true component RAW very closely. Validity of the Balancing Method is based on the fact that if an component is out-of-service, it does not mean that the component is non-existent, but integrates the possibility that the component might fail due to CCF. The validity of the Balancing Method is proved by comparing it to the exact component RAW generated from the fault tree model
Radioactive contaminants in raw materials and foodstuffs of plant origin
International Nuclear Information System (INIS)
Stankovicj, S.; Krainchanicj, M.; Stankovicj, A.
1990-01-01
The paper concentrates on the results of activity level of radioactive caesium 134 and 137 in the samples of raw materials (barley, oats, soybean, sunflower, pumpkin seed, hops, shreded sugar beet, maize), animal feedstuffs (alfalfa, alfalfa meal, rape, concentrates fed to chickens, pigs or bpvines, dry turnip shreds) and foodstuff of plant origin (lettuce, spinach, cabbage, carrot, celery, cucumber, tomato, olives, sesame). All samples - produced locally on the major part but also including some imported stuff -have been subjected to continuous gamma spectrometry starting with the Chernobyl accident in 1986 through 1989. The highest activity of caesium was recorded in the samples of animal feedstuffs (alfalfa, alfalfa meal, rape) in the years 1986 and 1987. In time, however, the activity tends to drop considerably. (author) 4 refs.; 3 tabs
Factors affecting adherence to a raw vegan diet.
Link, Lilli B; Jacobson, Judith S
2008-02-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be 80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (beta=0.95), severity of disease (beta=0.98), and self-efficacy to adhere (beta=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence.
Factors affecting adherence to a raw vegan diet
Link, Lilli B.; Jacobson, Judith S.
2008-01-01
The purpose of this study was to evaluate adherence and identify predictors of adherence to a raw vegan diet (i.e., uncooked plant foods) following a stay at a raw vegan institute. In this cohort study of guests at a raw vegan institute, subjects completed written questionnaires upon arrival and 12 weeks later. Of 107 eligible guests, 84 participated. Mean age was 54 years, 23 were male, and 73 white. Fifty-one completed the 12-week follow-up. Eight (16%) reported their diet to be ≥80% raw vegan at baseline and 14 (28%) at follow-up. Based on a raw vegan dietary adherence score (range 0-42) created for this study, mean adherence (SD) increased from 15.1 (5.4) to 17.0 (5.8) over 12 weeks (p=0.03). Baseline predictors of adherence included: education (β=0.95), severity of disease (β=0.98), and self-efficacy to adhere (β=0.72). Future interventions that evaluate this diet should address self-efficacy, an important, potentially remediable predictor of adherence. PMID:18243943
Quality aspects of raw goat milk in Lower Southern Thailand
Directory of Open Access Journals (Sweden)
Siriwat Wasiksiri
2010-05-01
Full Text Available This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05 on pH and total plate count among samples from eachfarm. However, acidity, specific gravity, milk fat, solid not fat, and total solid varied between farms depending on feed supplyand management. Means of total bacteria count and Coliform count of most samples were in TACF standard quality (log3.720 cfu/ml and log 1.892 cfu/ml, respectively, except four samples had higher Coliform contamination. Additionally,a higher proportion (22.7 % of samples with antibiotic residue was found.
Directory of Open Access Journals (Sweden)
Sônia Aparecida Sgarioni
2014-06-01
Full Text Available Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA and Mycolic acids analysis. Thirteen (25% raw and 2 (4% pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum. M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.
Sgarioni, Sônia Aparecida; Hirata, Rosario Dominguez Crespo; Hirata, Mario Hiroyuki; Leite, Clarice Queico Fujimura; de Prince, Karina Andrade; de Andrade Leite, Sergio Roberto; Filho, Dirceu Vedovello; Siqueira, Vera Lucia Dias; Caleffi-Ferracioli, Katiany Rizzieri; Cardoso, Rosilene Fressatti
2014-01-01
Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw) from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA) and Mycolic acids analysis. Thirteen (25%) raw and 2 (4%) pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum). M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.
International Nuclear Information System (INIS)
Zhao Weijuan; Li Guoxia; Xie Jianzhong; Guo Min; Gao Zhengyao
2004-01-01
The 28 samples from Jiaotan Guan kiln, one sample of mud material in jar from ruins of Jiaotan Guan kiln, one sample of mud material in pool of practice mud, one sample of violet-golden clay near Guan kiln and four samples of glazes and bodies of the modern imitative ancient Chinese guan porcelain were analyzed by neutron activation analysis (NAA). The contents of 36 elements in each sample were measured. The NAA data were statistically treated by fuzzy cluster method and the trend cluster diagram was obtained. The results show that the raw material origin of the bodies of Jiaotan Guan porcelain is evidently different from those of glazes, the source of raw material of bodies and glazes of Jiaotan Guan kiln are stable, and the iron is assured as main coloring element. The reflecting spectrum and main wavelength of Guan porcelain glazes are determined by color analysis instrument. The relative content of structural iron (Fe 2+ , Fe 3+ ) in the glaze and the quantitative relationship between the main wavelength of glaze in various colors are determined by Moessbauer spectrum. Thus the coloring mechanism of Guan porcelain is investigated
Test plan for evaluating the performance of the in-tank fluidic sampling system
International Nuclear Information System (INIS)
BOGER, R.M.
1999-01-01
The PHMC will provide Low Activity Wastes (LAW) tank wastes for final treatment by a privatization contractor from double-shell feed tanks, 241-AP-102 and 241-AP-104, Concerns about the inability of the baseline ''grab'' sampling to provide large volume samples within time constraints has led to the development of a conceptual sampling system that would be deployed in a feed tank riser, This sampling system will provide large volume, representative samples without the environmental, radiation exposure, and sample volume impacts of the current base-line ''grab'' sampling method. This test plan identifies ''proof-of-principle'' cold tests for the conceptual sampling system using simulant materials. The need for additional testing was identified as a result of completing tests described in the revision test plan document, Revision 1 outlines tests that will evaluate the performance and ability to provide samples that are representative of a tanks' content within a 95 percent confidence interval, to recovery from plugging, to sample supernatant wastes with over 25 wt% solids content, and to evaluate the impact of sampling at different heights within the feed tank. The test plan also identifies operating parameters that will optimize the performance of the sampling system
Gómez-Aldapa, Carlos A; Gutiérrez-Alcántara, Eduardo J; Torres-Vitela, M Refugio; Rangel-Vargas, Esmeralda; Villarruel-López, Angelica; Castro-Rosas, Javier
2017-09-01
The presence of multidrug-resistant Salmonella in vegetables is a significant public health concern. Nopalito is a cactaceous that is commonly consumed either raw or cooked in Mexico and other countries. The presence of antibiotic-resistant Salmonella strains on raw whole nopalitos (RWN, without prickles), raw nopalitos cut into squares (RNCS) and in cooked nopalitos salads (CNS) samples was determined. In addition, the behavior of multidrug-resistant Salmonella isolates on RWN, RNCS and CNS at 25° ± 2 °C and 3° ± 2 °C was investigated. One hundred samples of RWN, 100 of RNCS and 100 more of CNS were collected from public markets. Salmonella strains were isolated and identified in 30, 30 and 10% of the samples, respectively. Seventy multidrug-resistant Salmonella strains were isolated from all the nopalitos samples. Multidrug-resistant Salmonella isolates survived at least 15 days on RWN at 25° ± 2 °C or 3° ± 2 °C. Multidrug-resistant Salmonella isolates grew in the RNCS and CNS samples at 25° ± 2 °C. However, at 3° ± 2 °C the bacterial growth was inhibited. This is the first report about multidrug-resistant Salmonella isolation from raw nopalitos and nopalitos salads. Nopalitos from markets are very likely to be an important factor contributing to the endemicity of multidrug-resistant Salmonella-related gastroenteritis in Mexico. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Vázquez-Román, Sara; Escuder-Vieco, Diana; García-Lara, Nadia Raquel; Alonso-Díaz, Clara; Lora, David; Martín-Pelegrina, María Dolores; Pallás-Alonso, Carmen Rosa
2016-03-01
Although under certain circumstances it is necessary to express milk, there are not many recommendations about the ideal storage conditions for human milk. The objectives of this study were to analyze the effects on Dornic acidity of frozen storage at -20 °C in three types of milk: raw donor milk, mother's own raw milk, and pasteurized donor milk. Forty-three samples of raw donor milk, 40 samples of pasteurized donor milk, and 16 samples of mother's own milk were analyzed. Dornic acidity was measured at time 0, before freezing. The remaining aliquots were frozen and analyzed after 1, 2, 3, and 4 weeks and after 2 and 3 months. In raw donor milk, the median acidity at the start was 3 °D (interquartile range [IQR] 2-3 °D); after 3 months, it was 5 °D (IQR 3-7 °D), with a significant increase in acidity after the second week. In mother's own milk, the mean acidity at the start was 3 °D (IQR 2-4 °D) and 7 °D (IQR 4-8 °D) at 3 months. The increase was significant after the third week. In pasteurized donor milk, the mean acidity was 3 °D (IQR 2-3 °D) at the start and 2 °D (IQR 2-3 °D) at the end. When comparing the three types of milk, there were significant differences from the first week between the two types of raw milk and the pasteurized milk (p raw milks (p = 0.77). Dornic acidity in unpasteurized milk significantly increases with the duration of freezing, probably due to the action of lipases, which is lost with pasteurization. It would be advisable to reduce the length of freezing time for unpasteurized milk.
Cloke, Jonathan; Clark, Dorn; Radcliff, Roy; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-01-01
The Thermo Scientific SureTect Salmonella species Assay is a new real-time PCR assay for the detection of Salmonellae in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested Methods program to validate the SureTect Salmonella species Assay in comparison to the reference method detailed in International Organization for Standardization 6579:2002 in a variety of food matrixes, namely, raw ground beef, raw chicken breast, raw ground pork, fresh bagged lettuce, pork frankfurters, nonfat dried milk powder, cooked peeled shrimp, pasteurized liquid whole egg, ready-to-eat meal containing beef, and stainless steel surface samples. With the exception of liquid whole egg and fresh bagged lettuce, which were tested in-house, all matrixes were tested by Marshfield Food Safety, Marshfield, WI, on behalf of Thermo Fisher Scientific. In addition, three matrixes (pork frankfurters, lettuce, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled laboratory study by the University of Guelph, Canada. No significant difference by probability of detection or McNemars Chi-squared statistical analysis was found between the candidate or reference methods for any of the food matrixes or environmental surface samples tested during the validation study. Inclusivity and exclusivity testing was conducted with 117 and 36 isolates, respectively, which demonstrated that the SureTect Salmonella species Assay was able to detect all the major groups of Salmonella enterica subspecies enterica (e.g., Typhimurium) and the less common subspecies of S. enterica (e.g., arizoniae) and the rarely encountered S. bongori. None of the exclusivity isolates analyzed were detected by the SureTect Salmonella species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation (enrichment time
Directory of Open Access Journals (Sweden)
Bychkov Aleksey
2017-01-01
Full Text Available The possibilities of mechanochemistry in processing of renewable lignocellulose raw material into solid kinds of biofuel are demonstrated in this work. A review of lignocellulose raw materials promising for our country is presented. These raw materials include wastes from agriculture and forestry, and the biomass of rapidly growing plants. The physicochemical properties of lignocellulose materials with different delignification degrees were modeled with the help of the artificial mixtures of plant raw material with purified cellulose and lignin. The data illustrating the effect of disperse state and lignin content on the reactivity of the material in subsequent combustion are presented. The tests at the combustion bench with the thermal power up to 5 MW allowed determining the optimal combustion parameters for the obtained biofuel in the autothermal mode.
The raw, takes off a weight of above
International Nuclear Information System (INIS)
Carta Petrolera
1998-01-01
With the technology of the deasphalted in Colombia, advance investigations that allow improving the quality of heavy raw. A new possibility opens up to market that type of petroleum. The Colombian Institute of the Petroleum developed a simple and more economic technology for deasphalted the heavy raw, using temperatures and moderate pressures. It is a deasphalted process to convert the raw weighed in light, facilitating their transport and improving their quality, using the traditional method, using commercial solvents but with different proportions, optimizing the relationship cost / benefit
PERSPECTIVE NONMETALLIC RAW MATERIALS AND THEIR UTILIZATION
Directory of Open Access Journals (Sweden)
Havelka Jaroslav
1997-10-01
Full Text Available It is the existence of the domestic base of raw materials and stable or growing markets that are a precondition for the prospectiveness industrial minerals. Traditional and non-traditional prospective nonmetal-liferous raw materials can be distinguished. The main trends in new industrial applications of industrial minerals are being stated. In the Czech Republic, the following may be ranked among the traditional prospective nonme-talliferous raw materials: kaoline, refractory clays, ceramic and expandable clays, glass and foundry sands, li-mestones, building stones, gypsum, cast basalt, bentonite, diatomite, feldspars, graphite. Alkali rocks, industrial garnets, flaky mica, wollastonite and yet unmined staurolite, minerals of the sillimanite group and others belong to the non-traditional prospective industrial minerals.
Lykomitros, Dimitrios; Fogliano, V.; Capuano, E.
2016-01-01
Flavor and color of roasted peanuts have a strong impact on consumer acceptability. They can be influenced by
raw material and processing technology. Raw peanuts of various market types, origins and grades were processed
by different technologies to produce 134 unique samples, which were
Almeida-Warren, Katarina; Sommer, Volker; Piel, Alex K; Pascual-Garrido, Alejandra
2017-10-01
Chimpanzee termite fishing has been studied for decades, yet the selective processes preceding the manufacture of fishing tools remain largely unexplored. We investigate raw material selection and potential evidence of forward planning in the chimpanzees of Issa valley, western Tanzania. Using traditional archaeological methods, we surveyed the location of plants from where chimpanzees sourced raw material to manufacture termite fishing tools, relative to targeted mounds. We measured raw material abundance to test for availability and selection. Statistics included Chi-Squared, two-tailed Wilcoxon, and Kruskall-Wallace tests. Issa chimpanzees manufactured extraction tools only from bark, despite availability of other suitable materials (e.g., twigs), and selected particular plant species as raw material sources, which they often also exploit for food. Most plants were sourced 1-16 m away from the mound, with a maximum of 33 m. The line of sight from the targeted mound was obscured for a quarter of these plants. The exclusive use of bark tools despite availability of other suitable materials indicates a possible cultural preference. The fact that Issa chimpanzees select specific plant species and travel some distance to source them suggests some degree of selectivity and, potentially, forward planning. Our results have implications for the reconstruction of early hominin behaviors, particularly with regard to the use of perishable tools, which remain archaeologically invisible. © 2017 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Sørensen, Klavs Martin; Khakimov, Bekzod; Engelsen, Søren Balling
2016-01-01
with chemometrics appears to be an efficient first choice for testing incoming raw materials and ingredients in the food production. However, in order to realize its full potential, it is necessary to move away from the current thoughts at the Parnassus, namely the targeted approach. This review will focus......International trade in food commodities will continue to increase and the complex food supply chains make adulteration detection and traceability a technical, logistical and financial challenge. There is no magic solution for adulteration testing, but NIR spectroscopy in combination...... on the exploitation of the capability of NIR spectroscopy to fingerprint incoming raw materials and ingredients as an integrated part of the industry's self-monitoring program typically called process analytical technology....
Cho, T J; Kim, N H; Kim, S A; Song, J H; Rhee, M S
2016-12-05
Knowing the survival characteristics of foodborne pathogens in raw ready-to-eat (RTE) seafood is the key to predicting whether they pose a microbiological hazard. The present study examined the survival of Escherichia coli O157:H7, Salmonella Typhimurium, Vibrio parahaemoliticus, Listeria monocytogenes, and Staphylococcus aureus in raw RTE crab marinated in soy sauce. Inoculated crabs (initial bacterial population=4.1-4.4logCFU/g) were immersed in soy sauce and then stored at refrigeration (5°C) or room temperature (22°C) for up to 28days. At 5°C, all bacteria (except V. parahaemolyticus) survived in crab samples until Day 28 (counts of 1.4, 1.6, 3.1, 3.2 log CFU/g for E. coli O157:H7, S. Typhimurium, L. monocytogenes, and S. aureus, respectively). However, at 22°C, all tested bacteria were more susceptible to the antimicrobial effects of marination. Regardless of temperature, foodborne pathogens attached to crab samples were more resistant to marination than those suspended in soy sauce samples; however, the survival pattern for each species was different. Gram-positive bacteria were most resistant to marination conditions (high salinity, low pH), whereas V. parahaemolyticus was extremely susceptible. Marination is the only antibacterial step in the manufacturing processes; however, the results presented herein reveal that this is not sufficient to inactivate foodborne pathogens. In particular, the survival of pathogens on crabs at refrigeration temperature may pose a major hazard for the consumption of raw RTE seafood. Thus, appropriate decontamination methods and implementation of safety management practices are needed. This study provides predictive microbiological information of foodborne pathogens in raw RTE seafood with marination. Copyright © 2016 Elsevier B.V. All rights reserved.
HS-SPME GC/MS characterization of volatiles in raw and dry-roasted almonds (Prunus dulcis).
Xiao, Lu; Lee, Jihyun; Zhang, Gong; Ebeler, Susan E; Wickramasinghe, Niramani; Seiber, James; Mitchell, Alyson E
2014-05-15
A robust HS-SPME and GC/MS method was developed for analyzing the composition of volatiles in raw and dry-roasted almonds. Almonds were analyzed directly as ground almonds extracted at room temperature. In total, 58 volatiles were identified in raw and roasted almonds. Straight chain aldehydes and alcohols demonstrated significant but minimal increases, while the levels of branch-chain aldehydes, alcohols, heterocyclic and sulfur containing compounds increased significantly (500-fold) in response to roasting (palmonds) to 315.8±70.0 ng/g (averaged across the roasting treatments evaluated i.e. 28, 33 and 38 min at 138 °C) after roasting. Pyrazines were detected in only the roasted almonds, with the exception of 2,5-dimethylpyrazine, which was also found in raw almonds. The concentration of most alcohols increased in the roasted samples with the exception of 2-methyl-1-propanol, 3-methyl-1-butanol and 2-phenylethyl alcohol, which decreased 68%, 80%, and 86%, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.
Natural radioactivity measurement in pumice samples used raw materials in Turkey
International Nuclear Information System (INIS)
Turhan, S.; Yuecel, H.; Guenduez, L.; Sahin, S.; Vural, M.; Parmaksiz, A.; Demircioglu, B.
2007-01-01
The activity concentrations of 232 Th, 226 Ra, and 4 K in different pumice samples have been determined by high-resolution γ-ray spectrometry using a 110% HpGe detector. The radium equivalent activities (Ra eq ), external hazard index (H ex ), and internal hazard index (H in ) associated with the natural radionuclides and representative level index (I γ r ) are calculated to assess the radiation hazard of the natural radioactivity in the pumice samples. The mean values of the measured radioactivity concentrations of 232 Th, 226 Ra, and 4 K for pumice samples from the region of lakes (ROL) are 232.4±8.0, 196.9±7.8, and 1325.8±20.4 Bq kg -1 and for pumice samples from Cukurova region (CR) 16.3±4.0, 16.1±4.9, and 479.7±170.4 Bq kg -1 , respectively. The calculated Ra eq values vary from 435.9±12.5 to 883.6±41.5 Bq kg -1 with a mean of 630.9±20.2 Bq kg -1 for the ROL samples and from 49.7±3.3 to 101.9±7.2 Bq kg -1 with a mean of 76.3±23.7 Bq kg -1 for the CR samples. For the ROL samples, Ra eq are above the limit of 370 Bq kg -1 , equivalent to external γ dose of 1.5 mSv yr -1 , recommended for the safe use of construction materials by NEA-OECD, while for the CR samples, Ra eq values are lower than the limit
Raw material ‘criticality’—sense or nonsense?
International Nuclear Information System (INIS)
Frenzel, M; Kullik, J; Reuter, M A; Gutzmer, J
2017-01-01
The past decade has seen a resurgence of interest in the supply security of mineral raw materials. A key to the current debate is the concept of ‘criticality’. The present article reviews the criticality concept, as well as the methodologies used in its assessment, including a critical evaluation of their validity in view of classical risk theory. Furthermore, it discusses a number of risks present in global raw materials markets that are not captured by most criticality assessments. Proposed measures for the alleviation of these risks are also presented. We find that current assessments of raw material criticality are fundamentally flawed in several ways. This is mostly due to a lack of adherence to risk theory, and highly limits their applicability. Many of the raw materials generally identified as critical are probably not critical. Still, the flaws of current assessments do not mean that the general issue of supply security can simply be ignored. Rather, it implies that new assessments are required. While the basic theoretical framework for such assessments is outlined in this review, detailed method development will require a major collaborative effort between different disciplines along the raw materials value chain. In the opinion of the authors, the greatest longer-term challenge in the raw materials sector is to stop, or counteract the effects of, the escalation of unit energy costs of production. This issue is particularly pressing due to its close link with the renewable energy transition, requiring more metal and mineral raw materials per unit energy produced. The solution to this problem will require coordinated policy action, as well as the collaboration of scientists from many different fields—with physics, as well as the materials and earth sciences in the lead. (topical review)
Raw material ‘criticality’—sense or nonsense?
Frenzel, M.; Kullik, J.; Reuter, M. A.; Gutzmer, J.
2017-03-01
The past decade has seen a resurgence of interest in the supply security of mineral raw materials. A key to the current debate is the concept of ‘criticality’. The present article reviews the criticality concept, as well as the methodologies used in its assessment, including a critical evaluation of their validity in view of classical risk theory. Furthermore, it discusses a number of risks present in global raw materials markets that are not captured by most criticality assessments. Proposed measures for the alleviation of these risks are also presented. We find that current assessments of raw material criticality are fundamentally flawed in several ways. This is mostly due to a lack of adherence to risk theory, and highly limits their applicability. Many of the raw materials generally identified as critical are probably not critical. Still, the flaws of current assessments do not mean that the general issue of supply security can simply be ignored. Rather, it implies that new assessments are required. While the basic theoretical framework for such assessments is outlined in this review, detailed method development will require a major collaborative effort between different disciplines along the raw materials value chain. In the opinion of the authors, the greatest longer-term challenge in the raw materials sector is to stop, or counteract the effects of, the escalation of unit energy costs of production. This issue is particularly pressing due to its close link with the renewable energy transition, requiring more metal and mineral raw materials per unit energy produced. The solution to this problem will require coordinated policy action, as well as the collaboration of scientists from many different fields—with physics, as well as the materials and earth sciences in the lead.
On the Representativeness of Norming Samples for Aptitude Test
National Research Council Canada - National Science Library
Sims, William
2003-01-01
...). We regressed aptitude test scores on demographics and concluded that: ̂ Norming sample for aptitude tests must be representative of the target population with respect to age, race"ethnicity, gender, respondent's education, and mother's...
A novel PMT test system based on waveform sampling
Yin, S.; Ma, L.; Ning, Z.; Qian, S.; Wang, Y.; Jiang, X.; Wang, Z.; Yu, B.; Gao, F.; Zhu, Y.; Wang, Z.
2018-01-01
Comparing with the traditional test system based on a QDC and TDC and scaler, a test system based on waveform sampling is constructed for signal sampling of the 8"R5912 and the 20"R12860 Hamamatsu PMT in different energy states from single to multiple photoelectrons. In order to achieve high throughput and to reduce the dead time in data processing, the data acquisition software based on LabVIEW is developed and runs with a parallel mechanism. The analysis algorithm is realized in LabVIEW and the spectra of charge, amplitude, signal width and rising time are analyzed offline. The results from Charge-to-Digital Converter, Time-to-Digital Converter and waveform sampling are discussed in detailed comparison.
International Nuclear Information System (INIS)
Cunha, R.A.; Roveri, C.D.; Maestrelli, S.C.
2016-01-01
The Santa Gertrudes Ceramic Polo (PCSG) is the largest national producer of ceramic tiles, located in east-central region of Sao Paulo, encompassing different cities. PCSG uses various clays as the main raw material from the Corumbatai Formation, which is inserted in the Sedimentary Basin of Parana, with more than 1.5 square kilometers. In this context, X-ray diffractograms of samples from different areas of PCSG were used for application of the cluster analysis. Aiming to group the samples in families and subsequently to seek the most representative for the complete analysis. Also, ceramic tests were made by the following methods: the green bulk density after pressing, flexural strength modulus for green. , tests were conducted after firing at 1070 °C and 1120 °C: apparent density after drying, flexural modulus; after firing: apparent density after firing, water absorption linear shrinkage sintering, apparent porosity, modulus of resistance to bending after burning. Further, from the georeferenced sample were created tables for industry in the area, to facilitate the identification of new sample by XRD. Furthermore, the 3D model of the region was developed from the interesting characteristics for ceramic use, using Micromine Mining Software, Enterprise Micromine. (author)
Municipal solid waste combustion: Fuel testing and characterization
Energy Technology Data Exchange (ETDEWEB)
Bushnell, D.J.; Canova, J.H.; Dadkhah-Nikoo, A.
1990-10-01
The objective of this study is to screen and characterize potential biomass fuels from waste streams. This will be accomplished by determining the types of pollutants produced while burning selected municipal waste, i.e., commercial mixed waste paper residential (curbside) mixed waste paper, and refuse derived fuel. These materials will be fired alone and in combination with wood, equal parts by weight. The data from these experiments could be utilized to size pollution control equipment required to meet emission standards. This document provides detailed descriptions of the testing methods and evaluation procedures used in the combustion testing and characterization project. The fuel samples will be examined thoroughly from the raw form to the exhaust emissions produced during the combustion test of a densified sample.
Radiation decontamination (hygienisation) of cosmetic raw materials and products
International Nuclear Information System (INIS)
Malec-Czechowska, K.; Migdal, W.; Owczarczyk, H.B.
1998-01-01
Microbiological purity of cosmetics is a problem of today because of growing hygienic requirements to these products. The demand for high hygienic purity from one side and the limitation in the use of conservants to cosmetics from the other side stimulate the research activity, the aim of which is to satisfy present requirements in this field. The application of radiation decontamination (hygienisation) seems to be one of solutions. In present report were present the results of the study on the effect of electron beam irradiation on microbial contamination of selected cosmetics and some raw materials used in cosmetic industry. Radiation doses applied were not higher than 6.0 kGy. The level of microbial contamination in both unirradiated and irradiated samples was determined by applying the standard microbiological methods. In addition, the quality and usefulness of irradiated cosmetics were examined by methods used in cosmetic industry. The results obtained show conclusively that radiation treatment can be successfully used for the decontamination (hygienisation) of cosmetics and some raw materials used in their production, without changing the quality and the usefulness of the product released. (author)
Samsung Salmonella Detection Kit. AOAC Performance Tested Method(SM) 021203.
Li, Jun; Cheung, Win Den; Opdyke, Jason; Harvey, John; Chong, Songchun; Moon, Cheol Gon
2012-01-01
Salmonella, one of the most common causes of foodborne illness, is a significant public health concern worldwide. There is a need in the food industry for methods that are simple, rapid, and sensitive for the detection of foodborne pathogens. In this study, the Samsung Salmonella Detection Kit, a real-time PCR assay for the detection of Salmonella, was evaluated according to the current AOAC guidelines. The validation consisted of lot-to-lot consistency, stability, robustness, and inclusivity/exclusivity studies, as well as a method comparison of 10 different food matrixes. In the validation, the Samsung Salmonella Detection Kit was used in conjunction with the Applied Biosystems StepOnePlus PCR system and the Samsung Food Testing Software for the detection of Salmonella species. The performance of the assays was compared to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG) 4.05: Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg, and Catfish and the and U.S. Food and Drug Administration/Bacteriological Analytical Manual (FDA/BAM) Chapter 5 Salmonella reference methods. The validation was conducted using an unpaired study design for detection of Salmonella spp. in raw ground beef, raw pork, raw ground pork, raw chicken wings, raw salmon, alfalfa sprouts, pasteurized orange juice, peanut butter, pasteurized whole milk, and shell eggs. The Samsung Salmonella Detection Kit demonstrated lot-to-lot consistency among three independent lots as well as ruggedness with minor modifications to changes in enrichment incubation time, enrichment incubation temperature, and DNA sample volume for PCR reaction. Stability was observed for 13 months at -20 degrees C and 3 months at 5 degrees C. For the inclusivity/exclusivity study, the Samsung Salmonella Detection Kit correctly identified 147 Salmonella species isolates out of 147 isolates tested from each of three different enrichment
Commutability of food microbiology proficiency testing samples.
Abdelmassih, M; Polet, M; Goffaux, M-J; Planchon, V; Dierick, K; Mahillon, J
2014-03-01
Food microbiology proficiency testing (PT) is a useful tool to assess the analytical performances among laboratories. PT items should be close to routine samples to accurately evaluate the acceptability of the methods. However, most PT providers distribute exclusively artificial samples such as reference materials or irradiated foods. This raises the issue of the suitability of these samples because the equivalence-or 'commutability'-between results obtained on artificial vs. authentic food samples has not been demonstrated. In the clinical field, the use of noncommutable PT samples has led to erroneous evaluation of the performances when different analytical methods were used. This study aimed to provide a first assessment of the commutability of samples distributed in food microbiology PT. REQUASUD and IPH organized 13 food microbiology PTs including 10-28 participants. Three types of PT items were used: genuine food samples, sterile food samples and reference materials. The commutability of the artificial samples (reference material or sterile samples) was assessed by plotting the distribution of the results on natural and artificial PT samples. This comparison highlighted matrix-correlated issues when nonfood matrices, such as reference materials, were used. Artificially inoculated food samples, on the other hand, raised only isolated commutability issues. In the organization of a PT-scheme, authentic or artificially inoculated food samples are necessary to accurately evaluate the analytical performances. Reference materials, used as PT items because of their convenience, may present commutability issues leading to inaccurate penalizing conclusions for methods that would have provided accurate results on food samples. For the first time, the commutability of food microbiology PT samples was investigated. The nature of the samples provided by the organizer turned out to be an important factor because matrix effects can impact on the analytical results. © 2013
Connections between borehole geophysical parameters of the quality of cement raw materials
International Nuclear Information System (INIS)
Szabo, L.; Illes, A.
1978-01-01
The raw materials for the cement industry are prospected - according to the recommendations of national authorities - by geophysical methods, too. These include not the determination of the deposit boundary, but also an estimation of the quality of limestone and clay from the point of cement manufacture. No forerunners of such tests exist, so new methods were elaborated. After 12 years of site tests it was found that the correlation between laboratory quality tests and certain geophysical parameters of clay deposits is fair but less close in case of limestone deposits. (author)
Pyrolysis and Combustion Kinetics of Raw and Carbonized Cottonwood and Switchgrass Agroforests
Directory of Open Access Journals (Sweden)
Sammy Sadaka
2015-06-01
Full Text Available Raw biomass is not commonly suitable as feedstock for existing power plants, mainly because of the substantial required infrastructural changes. As a result, most raw feedstock requires pre-treatment to improve its physical and thermal characteristics. Biomass carbonization is one of the pre-treatments that produces charcoal-like feedstock. This paper explores the effects of the carbonization process on the physiochemical characteristics of biomass produced from two cottonwood clones, S7C20 and ST66, and switchgrass (var. Alamo. Additionally, it studies the thermal degradation kinetics of raw and carbonized agroforestry products in nitrogen and air environments. Feedstock samples were carbonized in a batch reactor at 400 °C in an oxygen-free environment for 2 hours. Carbonization decreased biomass bulk density, moisture content, and volatile solids while increasing fixed carbon, ash content, pH, and heating values. The heating value of S7C20, ST66, and switchgrass increased by 58.6%, 60.3%, and 69.7%, respectively. Carbonization increased the activation energy values under the condition of pyrolysis and decreased these values under the condition of combustion. The carbonization process produced a charcoal-like feedstock that may be processed with coal or even replace it.
EARLINET Single Calculus Chain - technical - Part 1: Pre-processing of raw lidar data
D'Amico, Giuseppe; Amodeo, Aldo; Mattis, Ina; Freudenthaler, Volker; Pappalardo, Gelsomina
2016-02-01
In this paper we describe an automatic tool for the pre-processing of aerosol lidar data called ELPP (EARLINET Lidar Pre-Processor). It is one of two calculus modules of the EARLINET Single Calculus Chain (SCC), the automatic tool for the analysis of EARLINET data. ELPP is an open source module that executes instrumental corrections and data handling of the raw lidar signals, making the lidar data ready to be processed by the optical retrieval algorithms. According to the specific lidar configuration, ELPP automatically performs dead-time correction, atmospheric and electronic background subtraction, gluing of lidar signals, and trigger-delay correction. Moreover, the signal-to-noise ratio of the pre-processed signals can be improved by means of configurable time integration of the raw signals and/or spatial smoothing. ELPP delivers the statistical uncertainties of the final products by means of error propagation or Monte Carlo simulations. During the development of ELPP, particular attention has been payed to make the tool flexible enough to handle all lidar configurations currently used within the EARLINET community. Moreover, it has been designed in a modular way to allow an easy extension to lidar configurations not yet implemented. The primary goal of ELPP is to enable the application of quality-assured procedures in the lidar data analysis starting from the raw lidar data. This provides the added value of full traceability of each delivered lidar product. Several tests have been performed to check the proper functioning of ELPP. The whole SCC has been tested with the same synthetic data sets, which were used for the EARLINET algorithm inter-comparison exercise. ELPP has been successfully employed for the automatic near-real-time pre-processing of the raw lidar data measured during several EARLINET inter-comparison campaigns as well as during intense field campaigns.
Hygienic quality of raw milk with regard to legislation
Directory of Open Access Journals (Sweden)
Slavko Kirin
2001-01-01
Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.
Tracer gas diffusion sampling test plan
International Nuclear Information System (INIS)
Rohay, V.J.
1993-01-01
Efforts are under way to employ active and passive vapor extraction to remove carbon tetrachloride from the soil in the 200 West Area an the Hanford Site as part of the 200 West Area Carbon Tetrachloride Expedited Response Action. In the active approach, a vacuum is applied to a well, which causes soil gas surrounding the well to be drawn up to the surface. The contaminated air is cleaned by passage through a granular activated carbon bed. There are questions concerning the radius of influence associated with application of the vacuum system and related uncertainties about the soil-gas diffusion rates with and without the vacuum system present. To address these questions, a series of tracer gas diffusion sampling tests is proposed in which an inert, nontoxic tracer gas, sulfur hexafluoride (SF 6 ), will be injected into a well, and the rates of SF 6 diffusion through the surrounding soil horizon will be measured by sampling in nearby wells. Tracer gas tests will be conducted at sites very near the active vacuum extraction system and also at sites beyond the radius of influence of the active vacuum system. In the passive vapor extraction approach, barometric pressure fluctuations cause soil gas to be drawn to the surface through the well. At the passive sites, the effects of barometric ''pumping'' due to changes in atmospheric pressure will be investigated. Application of tracer gas testing to both the active and passive vapor extraction methods is described in the wellfield enhancement work plan (Rohay and Cameron 1993)
Surface discharge of raw wastewater among unsewered homes in central Alabama
Elliott, M.; Das, P.; Blackwell, A.; Aytekin, E.; Hu, Y.; White, K.; Jones, R.; Lu, Y.
2017-12-01
Discussions of future water and wastewater challenges in the US typically focus on crumbling infrastructure. However, another major challenge has been almost entirely neglected. A growing body of evidence indicates that household discharge of untreated wastewater to the surface (through so-called "straight pipes") is widespread in poor rural communities of Appalachia and the southeastern US. The US Census included water and wastewater questions until 1990. However, the census questions do not appear to differentiate clearly between legal onsite treatment and discharge of raw wastewater to the ground (EPA, 1999; US Census, 2015). Although straight pipes are illegal, many reports from the southern US and Appalachia indicate that the practice is still common in poor rural areas (e.g., EPA Region 4, 2002; du Albuquerque, 2011). A representative, county-scale report on straight pipes in Madison County, NC (Baldwin, 2000) found that 5.6% of unsewered rural households directly discharged raw wastewater and a 2005 study of Bibb County, AL, reported 15% straight pipe among households not connected to sewer (White and Jones, 2006). We focused on two Alabama counties (Hale and Wilcox) with high rates of rural poverty (26.6% and 39.2% of households in poverty, respectively) and soils unsuited for conventional septic systems. We used two main methods (1) site-by-site inspections of a random sample of unsewered rural homes and (2) water sample collection and analysis from impacted streams. We found high rates of straight pipe use and substantial impacts on water quality in local streams. For example, in Wilcox Co., 60% of unsewered households had a visible straight pipe; conservatively, these homes discharge 500,000 gallons of raw sewage to the ground in Wilcox Co. each day. Water sampling upstream and downstream of an unsewered town with many straight pipes indicated major impacts on surface water quality. Additionally, the literature reveals possible health impacts from onsite
Women’s experience with home-based self-sampling for human papillomavirus testing
International Nuclear Information System (INIS)
Sultana, Farhana; Mullins, Robyn; English, Dallas R.; Simpson, Julie A.; Drennan, Kelly T.; Heley, Stella; Wrede, C. David; Brotherton, Julia M. L.; Saville, Marion; Gertig, Dorota M.
2015-01-01
Increasing cervical screening coverage by reaching inadequately screened groups is essential for improving the effectiveness of cervical screening programs. Offering HPV self-sampling to women who are never or under-screened can improve screening participation, however participation varies widely between settings. Information on women’s experience with self-sampling and preferences for future self-sampling screening is essential for programs to optimize participation. The survey was conducted as part of a larger trial (“iPap”) investigating the effect of HPV self-sampling on participation of never and under-screened women in Victoria, Australia. Questionnaires were mailed to a) most women who participated in the self-sampling to document their experience with and preference for self-sampling in future, and b) a sample of the women who did not participate asking reasons for non-participation and suggestions for enabling participation. Reasons for not having a previous Pap test were also explored. About half the women who collected a self sample for the iPap trial returned the subsequent questionnaire (746/1521). Common reasons for not having cervical screening were that having Pap test performed by a doctor was embarrassing (18 %), not having the time (14 %), or that a Pap test was painful and uncomfortable (11 %). Most (94 %) found the home-based self-sampling less embarrassing, less uncomfortable (90 %) and more convenient (98 %) compared with their last Pap test experience (if they had one); however, many were unsure about the test accuracy (57 %). Women who self-sampled thought the instructions were clear (98 %), it was easy to use the swab (95 %), and were generally confident that they did the test correctly (81 %). Most preferred to take the self-sample at home in the future (88 %) because it was simple and did not require a doctor’s appointment. Few women (126/1946, 7 %) who did not return a self-sample in the iPap trial returned the questionnaire
Directory of Open Access Journals (Sweden)
TOMÁŠ IFKA
2012-03-01
Full Text Available The influence of CaO and P2O5 upon the reactivity of cement raw meal was investigated in this paper. Ash of bone meal containing Ca3(PO42 - 3CaO·P2O5 was used as the source of P2O5. Two series of samples with different content of the ash of bone meal were prepared. In the first series, the ash of bone was added into cement raw meal. The second series of samples were prepared by considering ash as one of CaO sources. Therefore, the total content of CaO in cement raw meal was kept constant, while the amount of P2O5 increased. These different series of samples were investigated by analyzing free lime content in the clinkers. The XRD analysis and Electron Micro Probe Analyzer analysis of the clinkers were also carried out. Two parameters were used to characterize the reactivity of cement raw meal: content of free lime and Burnability Index (BI calculated from free lime content in both series of samples burnt at 1350 ºC, 1400 ºC, 1450 ºC and 1500 ºC. According to the first parameter, P2O5 content that drastically makes worse the reactivity of cement raw meal was found at 1.11 wt.% in the first series, while this limit has reached 1.52 wt.% in the second one. According to the BI, the limit of P2O5 was found at 1.42 wt. % in the first series and 1, 61 wt.% in the second one. Furthermore, EPMA has demonstrated the presence of P2O5 in both calcium silicate phases forming thus solid solutions.
Phytochemical and Nutritional Evaluation of Raw and Fermented ...
African Journals Online (AJOL)
Raw Alchornea seed meal contains phytic acids, tannins, saponins, cardiac glycosides, steroids, flavnoids, alkaloids and anthraquinone. Fermenting the seed meal caused 56.2% reduction in the phytic acid content and totally eliminated its anthraquinone content. With 10% raw Alchornea seed meal, broilers grew ...
Supply optimization for the production of raw sugar
DEFF Research Database (Denmark)
Grunow, Martin; Günther, H.O.; Westinner, R.
2007-01-01
Based on a case study from Venezuela, the production of raw sugar is investigated. Ideally, sugar mills operate at a constant production rate. However, safety stocks of the raw material cannot be maintained as sugar cane quality deteriorates very rapidly. Sugar cane is therefore continuously...
Test plan for the Sample Transfer Canister system
International Nuclear Information System (INIS)
Flanagan, B.D.
1998-01-01
The Sample Transfer Canister will be used by the Waste Receiving and Processing Facility (WRAP) for the transport of small quantity liquid samples that meet the definition of a limited quantity radioactive material, and may also be corrosive and/or flammable. These samples will be packaged and shipped in accordance with the US Department of Transportation (DOT) regulation 49 CFR 173.4, ''Exceptions for small quantities.'' The Sample Transfer Canister is of a ''French Can'' design, intended to be mated with a glove box for loading/unloading. Transport will typically take place north of the Wye Barricade between WRAP and the 222-S Laboratory. The Sample Transfer Canister will be shipped in an insulated ice chest, but the ice chest will not be a part of the small quantity package during prototype testing
Effect Of Dietary Raw, Cooked And Toasted Mucuna Pruriens Seeds ...
African Journals Online (AJOL)
A 5-week feeding trial was conducted to determine the effect or dietary raw, cooked and toasted Mucuna pruriens seeds (velvet bean) on the performance of finisher broilers. Raw Mucuna pruriens seeds contained 30.3% crude protein. At 10% dietary level, raw and toasted Mucuna pruriens seed meals significantly (P ...
Directory of Open Access Journals (Sweden)
Márcia de Aguiar Ferreira Barros
2010-04-01
Full Text Available The poor quality of raw milk is the main problem in dairy industries, once it can directly interfere in the productivity and quality of dairy products. The Pernambuco is not different. located between the Zona da Mata and the Sertão regions, is responsible for a daily milk production of 980,000 liters, and presented an increase of 23% in the last two years. This study aimed the evaluation of the microbiological and physical-chemical quality of raw milk produced in the Agreste region of Pernambuco. Raw milk samples were collected from 53 dairy farms located at the following cities: Saloá, Águas Belas, São Bento do Una and Bom Conselho. For microbiological analysis, all samples were plated for mesophilic aerobes, total coliforms, Escherichia coli and DNase positive staphylococci in specific Petrifilm™ (3M Microbiology, St. Paul, USA. Listeria monocytogenes and Salmonella spp. were detected using VIDAS system (bioMérieux SA, Marcy l'Etoile, France. Organophosphorade and carbamates were detected by thin layer chromatography. Fat, protein, and lactose contents, total and non-fat solids, and density were obtained by ultrasound method using am automatic milk analyzer (Boecolac-60, Boeco, Hamburg, Germany. In addition, the raw milk samples were evaluated to cryoscopic, California Mastitis Test (CMT, peroxidase, Dornic acidity and Ring-test to brucellosis status of herds. In microbiological analysis, all samples presented high counts of the researched indicators microorganisms. The average of mesophilic aerobes was 1.68 X 107 with 83% of samples over 106. Listeria monocytogenes and Salmonella spp were not found, 47% of the samples were positive for organophosphates and/or carbamates, 67.9% of the samples were positive for CMT and 26.4% for ring test. Thus, only 2 (3.77% samples were accordance with the established parameters of Instrução Normativa 51.,P.A qualidade do leite é um dos maiores problemas da cadeia do leite no Brasil, interferindo
The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea.
Park, Y K; Koo, H C; Kim, S H; Hwang, S Y; Jung, W K; Kim, J M; Shin, S; Kim, R T; Park, Y H
2007-12-01
Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (-0.0149), lactose (-0.8910), and MUN (-0.0096), and those of MUN on milk fat (-0.3125), protein (-0.8012), and SCCt (-0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (-0.0172), protein (-0.2693), and lactose (-0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.
Pellet production from agricultural raw materials - A systems study
Energy Technology Data Exchange (ETDEWEB)
Nilsson, Daniel; Bernesson, Sven; Hansson, Per-Anders [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-75007 Uppsala (Sweden)
2011-01-15
The demand for biofuel pellets has increased considerably in recent years, causing shortage of the traditional raw materials sawdust and wood shavings. In this study, the costs and energy requirements for the production of pellets from agricultural raw materials were analysed. The materials studied were Salix, reed canary grass, hemp, straw, screenings, rape-seed meal, rape cake and distiller's waste. Four production scales were analysed, having an annual output of 80,000, 8000, 800 and 80 tonnes of pellets per year. It was concluded that the raw materials of greatest interest were Salix and reed canary grass. They had competitive raw material costs and acceptable fuel properties and could be mixed with sawdust in existing large-scale pelleting factories. Straw had low production costs but can cause serious ash-related problems and should, as also is the case for screenings, be avoided in small-scale burners. Hemp had high raw material costs and is of less commercial interest, while distiller's waste, rape-seed meal and rape cake had higher alternative values when used as protein feed. The scale of production had a crucial influence on production costs. The machinery was used much more efficiently in large-scale plants, resulting in clear cost savings. Small-scale pelleting, both static and mobile, required cheap raw materials, low labour costs and long utilisation times to be profitable. In most cases, briquetting would be more commercially viable. The energy use in manufacturing pellets from air-dried crops was generally no higher than when moist sawdust was used as the raw material. (author)
Zeinhom, Mohamed M A; Abdel-Latef, Gihan K; Jordan, Kieran
2015-12-01
Staphylococcus aureus (S. aureus) can cause mastitis in cattle and, therefore, can be present in milk. This study was undertaken to determine the prevalence of coagulase positive S. aureus and its enterotoxin genes sea, seb, and sec in isolates recovered from raw milk, feta cheese, and human hand swabs of milk and cheese handlers in Beni-Suef province, Egypt. A total of 100 samples of raw milk and 50 samples of pasteurized-milk feta cheese were collected. In addition, 50 hand swabs from milk handlers and 25 hand swabs from cheese handlers were examined for the presence of coagulase positive S. aureus. The isolates were characterized by multiplex PCR for detection of sea, seb, and sec genes, and for resistance to 5 classes of commonly used antibiotics. Twelve (12/100), 12 (6/50), and 17% (13/75) of milk, cheese, and hand swab samples, respectively, were positive for coagulase positive S. aureus. One isolate was obtained from each positive sample (31 isolates), and none contained genes for SEA or SEC production. Twenty-five percent, 33%, and 31%, respectively, of the isolates contained the genes for SEB, resulting in 3%, 4%, and 5% of samples being positive for toxin producing coagulase positive S. aureus, respectively. At least one isolate was resistant to each of the antibiotics tested. Despite the low potential for SEB production shown, preventative measures, such as maintenance of the cold-chain and good hygienic practices should be implemented to further reduce the potential risk to public health from SEB, and to reduce the spread of antimicrobial resistance. © 2015 Institute of Food Technologists®
Evaluation of raw rock phosphate as substitute for bone meal in diet ...
African Journals Online (AJOL)
Experiment was conducted to determine the optimal replacement level of Raw Rock Phosphate (RRP) for bone meal in layers diet. A total of 144, 55 week-old shavers X Hubbard cross-strain laying hens were used for the study. Triplicate groups of 12 hens per replicate were placed on four test diets containing 0, 1, 1.5 and ...
Ngamsom, Bongkot; Lopez-Martinez, Maria J; Raymond, Jean-Claude; Broyer, Patrick; Patel, Pradip; Pamme, Nicole
2016-04-01
Pathogen analysis in food samples routinely involves lengthy growth-based pre-enrichment and selective enrichment of food matrices to increase the ratio of pathogen to background flora. Similarly, for blood culture analysis, pathogens must be isolated and enriched from a large excess of blood cells to allow further analysis. Conventional techniques of centrifugation and filtration are cumbersome, suffer from low sample throughput, are not readily amenable to automation and carry a risk of damaging biological samples. We report on-chip acoustophoresis as a pre-analytical technique for the resolution of total microbial flora from food and blood samples. The resulting 'clarified' sample is expected to increase the performance of downstream systems for the specific detection of the pathogens. A microfluidic chip with three inlets, a central separation channel and three outlets was utilized. Samples were introduced through the side inlets, and buffer solution through the central inlet. Upon ultrasound actuation, large debris particles (10-100 μm) from meat samples were continuously partitioned into the central buffer channel, leaving the 'clarified' outer sample streams containing both, the pathogenic cells and the background flora (ca. 1 μm) to be collected over a 30 min operation cycle before further analysis. The system was successfully tested with Salmonella typhimurium-spiked (ca. 10(3)CFU mL(-1)) samples of chicken and minced beef, demonstrating a high level of the pathogen recovery (60-90%). When applied to S. typhimurium contaminated blood samples (10(7)CFU mL(-1)), acoustophoresis resulted in a high depletion (99.8%) of the red blood cells (RBC) which partitioned in the buffer stream, whilst sufficient numbers of the viable S. typhimurium remained in the outer channels for further analysis. These results indicate that the technology may provide a generic approach for pre-analytical sample preparation prior to integrated and automated downstream detection of
Manganese Ores from South Sulawesi: Their Potential Uses as Raw Materials for Metallurgical Industry
Directory of Open Access Journals (Sweden)
Sufriadin Sufriadin
2017-03-01
Full Text Available Characterization of manganese ores from Barru and Bone regencies of South Sulawesi has been conducted with the aim at clarification of their mineralogical and chemical composition for their potential uses as the raw materials for metallurgical industry. Mineralogical properties of the ores analyzed by means of optical microscopy and X-ray diffractometry (XRD show that samples from Barru consist mainly of rhodochrosite (MnCO3 with less cryptomelane, groutite, bixbyite, and todorokite. Goethite, calcite and small amount of quartz present as impurities. Manganese ore samples from Bone are predominantly composed of pyrolusite (MnO2 with subordinate ramsdellite and hollandite. Barite, quartz, hematite and clay are present as gangue minerals. Chemical compositions determined by using XRF method revealed that Barru samples contain higher in MnO (average is 40.07 wt% than the Bone samples (average is 34.36 wt%. Similarly, Fe2O3 and CaO are also higher in Barru than those of the Bone samples. In contrast, concentrations of SiO2 and total alkali (K2O + Na2O are lower in the Barru samples. The average P2O5 content of samples in both areas is low (<0.2 wt%. Relatively higher grade of Fe2O3 in the Barru ore implies that it has potential application for ferromanganese production; whereas the elevated SiO2 content of the Bone ore is a good indication for silicomanganese manufacture. However, both ores may not favorable to be directly used as raw materials in metallurgical uses. Prior to be used, the ores should be treated by applying physical beneficiation in order to reduce deleterious elements.
Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J
2012-08-01
Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.
Radiometric determination of the bacteriological quality of raw milk
International Nuclear Information System (INIS)
Cogan, T.M.; O'Connor, F.
1977-01-01
The usefulness of 14 CO 2 production from (U- 14 C) glucose, (U- 14 C) glutamate and ( 14 C) formate as an index of raw milk quality was investigated. Development work showed that the volume of milk sample influenced the detection of radioactivity. The regression coefficient between Log 10 of the inital bacterial count and the detection time (the time to reach 2000 cpm) in the presence of 0.13 μCi (U- 14 C) glucose/ml was -0.55 (n=119 samples) and the relationship was y=-0.11x+-0.46. The addition of 0.5 μCi (U- 14 C) glutamate and 0.5 μCi of ( 14 C) formate decreased the detection times but did not result in greater predictability. Further study is required before the method could be used to determine the bacteriological quality of milk
International Nuclear Information System (INIS)
Shi Yi; Wu Yu; Liu Huajun; Long Feng; Qian Li; Ren Zhibin; Li Shaolei; Liu Bo; Chen Jinglin
2012-01-01
Highlights: ► In this study the first DC performance experiments of ITER correction coil conductor short sample have been carried out in ASIPP test facility. ► A CC conductor short sample was fabricated and tested to confirm the capability of this test facility for qualification tests of CC conductors. ► There is no obvious impact of cycling on DC performance measurement. ► Those measured results of current sharing temperature are in agreement with the expected results from strand scaling - Abstract: The first DC performance experiments of ITER correction coil (CC) conductor short sample have been carried out in the conductor test facility of Institute of Plasma Physics, CAS (ASIPP) in January this year. Those experiments aim to investigate the DC performance of ITER CC conductor. The tested conductor short sample is bended as a half circle with the diameter of 270 mm to meet the background magnetic field shape. The half circle part of sample is longer than the final twist pitch. The current sharing temperature (T cs ) in the 3.86 T external magnetic field (B ex ), ≤12 kA could be measured including the critical current (I c ) run. There is no obvious impact of 1000 cycles on DC performance. Those measured T cs results are in agreement with the expected results from strand scaling.
Maurice, P.A.; Pullin, M.J.; Cabaniss, S.E.; Zhou, Q.; Namjesnik-Dejanovic, K.; Aiken, G.R.
2002-01-01
This research compared raw filtered waters (RFWs), XAD resin isolates (XAD-8 and XAD-4), and reverse osmosis (RO) isolates of several surface water samples from McDonalds Branch, a small freshwater fen in the New Jersey Pine Barrens (USA). RO and XAD-8 are two of the most common techniques used to isolate natural organic matter (NOM) for studies of composition and reactivity; therefore, it is important to understand how the isolates differ from bulk (unisolated) samples and from one another. Although, any comparison between the isolation methods needs to consider that XAD-8 is specifically designed to isolate the humic fraction, whereas RO concentrates a broad range of organic matter and is not specific to humics. The comparison included for all samples: weight average molecular weight (Mw), number average molecular weight (Mn), polydispersity (??), absorbance at 280nm normalized to moles C (??280) (RFW and isolates); and for isolates only: elemental analysis, % carbon distribution by 13C NMR, and aqueous FTIR spectra. As expected, RO isolation gave higher yield of NOM than XAD-8, but also higher ash content, especially Si and S. Mw decreased in the order: RO>XAD-8>RFW>XAD-4. The Mw differences of isolates compared with RFW may be due to selective isolation (fractionation), or possibly in the case of RO to condensation or coagulation during isolation. 13C NMR results were roughly similar for the two methods, but the XAD-8 isolate was slightly higher in 'aromatic' C and the RO isolate was slightly higher in heteroaliphatic and carbonyl C. Infrared spectra indicated a higher carboxyl content for the XAD-8 isolates and a higher ester:carboxyl ratio for the RO isolates. The spectroscopic data thus are consistent with selective isolation of more hydrophobic compounds by XAD-8, and also with potential ester hydrolysis during that process, although further study is needed to determine whether ester hydrolysis does indeed occur. Researchers choosing between XAD and RO
Laboratory Tests of Bitumen Samples Elasticity
Ziganshin, E. R.; Usmanov, S. A.; Khasanov, D. I.; Khamidullina, G. S.
2018-05-01
This paper is devoted to the study of the elastic and acoustic properties of bitumen core samples. The travel velocities of the ultrasonic P- and S-waves were determined under in-situ simulation conditions. The resulting data were then used to calculate dynamic Young's modulus and Poisson's ratio. The authors studied the correlation between the elasticity and the permeability and porosity. In addition, the tests looked into how the acoustic properties had changed with temperature rise.
40 CFR 63.1347 - Standards for raw and finish mills.
2010-07-01
... 40 Protection of Environment 11 2010-07-01 2010-07-01 true Standards for raw and finish mills. 63... and Operating Limits § 63.1347 Standards for raw and finish mills. The owner or operator of each new or existing raw mill or finish mill at a facility which is a major source subject to the provisions...
Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza
2010-04-01
Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.
Identification of raw as a regulator of glial development.
Directory of Open Access Journals (Sweden)
Diana Luong
Full Text Available Glial cells perform numerous functions to support neuron development and function, including axon wrapping, formation of the blood brain barrier, and enhancement of synaptic transmission. We have identified a novel gene, raw, which functions in glia of the central and peripheral nervous systems in Drosophila. Reducing Raw levels in glia results in morphological defects in the brain and ventral nerve cord, as well as defects in neuron function, as revealed by decreased locomotion in crawling assays. Examination of the number of glia along peripheral nerves reveals a reduction in glial number upon raw knockdown. The reduced number of glia along peripheral nerves occurs as a result of decreased glial proliferation. As Raw has been shown to negatively regulate Jun N-terminal kinase (JNK signaling in other developmental contexts, we examined the expression of a JNK reporter and the downstream JNK target, matrix metalloproteinase 1 (mmp1, and found that raw knockdown results in increased reporter activity and Mmp1 levels. These results are consistent with previous studies showing increased Mmp levels lead to nerve cord defects similar to those observed upon raw knockdown. In addition, knockdown of puckered, a negative feedback regulator of JNK signaling, also causes a decrease in glial number. Thus, our studies have resulted in the identification of a new regulator of gliogenesis, and demonstrate that increased JNK signaling negatively impacts glial development.
Chemical composition of raw and deresinated peat waxes
Energy Technology Data Exchange (ETDEWEB)
Bel' kevich, P I; Ivanova, L A; Piskunova, T A; Tserlyukevich, Ya V; Yurkevich, E A
1980-01-01
Research was conducted using absorption chromatography and spectroscopy to study the changes in the chemical composition of raw peat wax taking place in the deresination process. Characteristics of the raw, deresinated waxes and resins removed are given. The fractions obtained showed that both raw and deresinated wax contain the same basic compound classes: hydrocarbons, alcohols, complex ether and acids; but their proportions in the waxes are different. After deresination most of the dark-colored polyfunctional compounds, a portion of the soluble unsaturated hydrocarbons and alcohols, and all the sterenes transfer into the resin. This causes the light color and specific physical properties of deresinated wax. (13 refs.) (In Russian)
Microelements and heavy metals in raw cow milk from various regions in Serbia
Directory of Open Access Journals (Sweden)
Živkov-Baloš Milica
2013-01-01
Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084
Investigations of radioactivity of building raw and materials
International Nuclear Information System (INIS)
Zak, A.; Biernacka, M.; Jagielak, J.; Lipinski, P.
1993-01-01
In 1980, Ministry of Building and Building Materials Industry, the Central Laboratory for Radiological Protection (abbreviated as CLRP), Ministry of Health and Social Welfare have agreed to issue the compulsory regulation of performing the validation of investigations of building raw and materials. Methods of measurement, apparatus and method of evaluation of results of the investigations have been recommended for the whole country. The following two criteria of usefulness of a building material for housing and public building have been accepted, f 1 = 0.00027 S K + 0.0027 S Ra0 .0043 S Th ≤ 1 (this one limit exposition of the whole body to gamma radiation); f 2 = S Ra ≤ 185 Bq/kg (this one limits exposition of lung epithelium to progeny of radon 222 Rn exhaled from the building walls). The CLRP and Institute of Building Technology supervise over correctness (agreement with the regulations) of operation of laboratories in Departments of Building Industry and Energy, organize training of the personnel and collect results of the measurements. From 1980 till 1991, results of measurements of 6550 samples from 550 localities were collected in computer data base organized in CLRP. In this paper, results of examination of selected groups of building raw and materials have been presented. Annual average values of the qualification coefficients f 1 and f 2 have been also analyzed. (author). 7 refs, 13 figs, 2 tabs
Transfer of test samples and wastes between post-irradiation test facilities (FMF, AGF, MMF)
International Nuclear Information System (INIS)
Ishida, Yasukazu; Suzuki, Kazuhisa; Ebihara, Hikoe; Matsushima, Yasuyoshi; Kashiwabara, Hidechiyo
1975-02-01
Wide review is given on the problems associated with the transfer of test samples and wastes between post-irradiation test facilities, FMF (Fuel Monitoring Facility), AGF (Alpha Gamma Facility), and MMF (Material Monitoring Facility) at the Oarai Engineering Center, PNC. The test facilities are connected with the JOYO plant, an experimental fast reactor being constructed at Oarai. As introductory remarks, some special features of transferring irradiated materials are described. In the second part, problems on the management of nuclear materials and radio isotopes are described item by item. In the third part, the specific materials that are envisaged to be transported between JOYO and the test facilities are listed together with their geometrical shapes, dimensions, etc. In the fourth part, various routes and methods of transportation are explained with many block charts and figures. Brief explanation with lists and drawings is also given to transportation casks and vessels. Finally, some future problems are discussed, such as the prevention of diffusive contamination, ease of decontamination, and the identification of test samples. (Aoki, K.)
In-Pipe Wireless Communication for Underground Sampling and Testing
Nguyen, Nhan D.T.; Le, Duc V.; Meratnia, Nirvana; Havinga, Paul J.M.
2017-01-01
In this paper, we present an effective and low- cost wireless communication system for extremely long and narrow pipes that can replay the extant wire system in underground sensor network applications such as soil sampling and testing with the Cone Penetration Test (CPT), the most widely used
Test plan for K Basin Sludge Canister and Floor Sampling Device
International Nuclear Information System (INIS)
Meling, T.A.
1995-01-01
This document provides the test plan and procedure forms for conducting the functional and operational acceptance testing of the K Basin Sludge Canister and Floor Sampling Device(s). These samplers samples sludge off the floor of the 100K Basins and out of 100K fuel storage canisters
DEFF Research Database (Denmark)
Esbensen, Kim Harry; Petersen, Lars
2005-01-01
A basic knowledge of the Theory of Sampling (TOS) and a set of only eight sampling unit operations is all the practical sampler needs to ensure representativeness of samples extracted from all kinds of lots: production batches, - truckloads, - barrels, sub-division in the laboratory, sampling...... in nature and in the field (environmental sampling, forestry, geology, biology), from raw materials or manufactory processes etc. We here can only give a brief introduction to the Fundamental Sampling Principle (FSP) and these eight Sampling Unit Operations (SUO’s). Always respecting FSP and invoking only...... the necessary SUO’s (dependent on the practical situation) is the only prerequisite needed for eliminating all sampling bias and simultaneously minimizing sampling variance, and this is in addition a sure guarantee for making the final analytical results trustworthy. No reliable conclusions can be made unless...
Raw material supply: challenge and chance for economy and state
Energy Technology Data Exchange (ETDEWEB)
Casper, W
1976-01-01
The imprint left by the 1973 oil embargo makes all nations aware of their dependence upon this and other raw materials. The author says the brunt of the embargo has dealt a heavier blow than has been realized on industrial nations and developing countries alike. The drastic decline of raw material prices has had threatening consequences for a number of raw-material-producing developing countries, making some nations unite for the purpose of market regulation. The cartel-like union of copper-producing countries is cited; producers of bauxite, iron ore, and tungsten have united; and some producers of tin have united. So far, the attempt to apply the oil strategy to other raw materials has not achieved the desired results; however, raw materials are no longer just a phase of the industrial process but have become a political matter of prime importance. (MCW)
Hermann, N; Schubert, I
2015-07-01
A notification from a laboratory concerning the detection of Campylobacter jejuni in a 6-year-old boy initiated the investigation carried out by the health authorities from Stendal district, in order to explain the morbidity rate caused by the germ. The day after the boy's pediatrician informed about a visit to a farm, which was confirmed by the head of the nursery. She told the health authorities about the consumption of raw milk during their visit at the farm.The following days more children fell sick. Within 10 days the total number of diseased children was 21. The health authorities asked for stool samples of the diseased children, nursery nurses and the head of the farm since raw milk presents a potential cause of infection. The health authorities together with the Saxony-Anhalt State Office for Consumer Protection conducted a retrospective cohort study. The aim was to explain the association between the exposure from raw milk consumption and the occurrence of the disease from C. jejuni. Based on a questionnaire data about the food and milk intake at the nursery and at home and about the trip to the farm were collected. 91% of the children's cohort and 86% of the adults' cohort were captured.The exposed group at risk showed a higher risk of falling ill than the group, which was not exposed. The risk factor raw milk explained the difference. Furthermore, the analysis of milk samples taken by the district veterinary office from 2 cows and from the farm's tank was able to detect the germs. The correlation of the illness, the consumption of raw milk, the detection of C. jejuni in the samples taken from the children and the samples taken from the cows was evident. Based on the case the health authorities recommended that heads of nurseries as well as heads of dairy farming in the district of Stendal needed to be advised on raw milk. Nurseries are still allowed to take trips to farms. However, raw animal derivates including milk must not be consumed. © Georg Thieme
Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V
2008-05-10
Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.
Qin, Kunming; Liu, Qidi; Cai, Hao; Cao, Gang; Lu, Tulin; Shen, Baojia; Shu, Yachun; Cai, Baochang
2014-01-01
Background: In traditional Chinese medicine (TCM), raw and processed herbs are used to treat the different diseases. Fructus Arctii, the dried fruits of Arctium lappa l. (Compositae), is widely used in the TCM. Stir-frying is the most common processing method, which might modify the chemical compositions in Fructus Arctii. Materials and Methods: To test this hypothesis, we focused on analysis and identification of the main chemical constituents in raw and processed Fructus Arctii (PFA) by high-performance liquid chromatography/diode array detection-electrospray ionization-mass spectrometry. Results: The results indicated that there was less arctiin in stir-fried materials than in raw materials. however, there were higher levels of arctigenin in stir-fried materials than in raw materials. Conclusion: We suggest that arctiin reduced significantly following the thermal conversion of arctiin to arctigenin. In conclusion, this finding may shed some light on understanding the differences in the therapeutic values of raw versus PFA in TCM. PMID:25422559
International Nuclear Information System (INIS)
Zhang Hongyu; Yang Dawei; Guo Wenyu
2009-01-01
Dangyangyu kiln was an important civil porcelain production place in the North China during the Song Dynasty. In order to find out the source of raw materials of the porcelain body and glaze and their classification relationship so as to correctly distinguish them, we have used XRF to determine the major chemical elements of some porcelain samples with light brown and samples with black flower on a white background. Dynamic fuzzy cluster analysis was applied to the data. Results indicate that the origin of raw materials of light brown porcelain body samples is comparatively more concentrated, while that of the porcelain with black flower on a white background is scattered about. The origin of the body materials of those two kinds of porcelain samples is obviously different. The origin of raw materials of light brown porcelain samples is comparatively concentrated and stable, while that of the porcelain with black flower on a white background is scattered about, moreover, the origin of glaze raw materials and the formula of the two kinds are obviously different. The origin and formula of the light brown porcelain with white glaze in the interior are close to those of the white glaze of porcelain with black flower on a white background, but they are not entirely identical. (author)
The Bootstrap, the Jackknife, and the Randomization Test: A Sampling Taxonomy.
Rodgers, J L
1999-10-01
A simple sampling taxonomy is defined that shows the differences between and relationships among the bootstrap, the jackknife, and the randomization test. Each method has as its goal the creation of an empirical sampling distribution that can be used to test statistical hypotheses, estimate standard errors, and/or create confidence intervals. Distinctions between the methods can be made based on the sampling approach (with replacement versus without replacement) and the sample size (replacing the whole original sample versus replacing a subset of the original sample). The taxonomy is useful for teaching the goals and purposes of resampling schemes. An extension of the taxonomy implies other possible resampling approaches that have not previously been considered. Univariate and multivariate examples are presented.
Banykó, J; Vyletelová, M
2009-03-01
Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.
7 CFR 58.332 - Segregation of raw material.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Segregation of raw material. 58.332 Section 58.332... Specifications for Dairy Plants Approved for USDA Inspection and Grading Service 1 Operations and Operating Procedures § 58.332 Segregation of raw material. The milk and cream received at the dairy plant shall meet...
Price stabilization for raw jute in Bangladesh
Takamasa Akiyama; Varangis, Panos
1991-01-01
Fluctuating prices for raw jute have been viewed as contributing to economic problems in the jute subsector. Price fluctuations were thought to reduce the jute farmers'welfare and there has been concern about the costs of parastatals'stocking operations in attempts to stabilize jute prices and incomes. The authors examine these fluctuations and analyze policies that might reduce them. They find that price fluctuations for raw jute reduce farmers'welfare only slightly because farmers'activitie...
Gas liquid sampling for closed canisters in KW Basin - test plan
International Nuclear Information System (INIS)
Pitkoff, C.C.
1995-01-01
Test procedures for the gas/liquid sampler. Characterization of the Spent Nuclear Fuel, SNF, sealed in canisters at KW-Basin is needed to determine the state of storing SNF wet. Samples of the liquid and the gas in the closed canisters will be taken to gain characterization information. Sampling equipment has been designed to retrieve gas and liquid from the closed canisters in KW basin. This plan is written to outline the test requirements for this developmental sampling equipment
21 CFR 864.3260 - OTC test sample collection systems for drugs of abuse testing.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false OTC test sample collection systems for drugs of abuse testing. 864.3260 Section 864.3260 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Pathology...
Laurinavichius, K S
1998-01-01
Experimental Investigation Of Microbially Induced Corrosion Of Test Samples And Effect Of Self-assembled Hydrophobic Monolayers. Exposure Of Test Samples To Continuous Microbial Cultures, Chemical Analysis, And Biochemical Studies
Biological and physiological changes in rats fed some raw and irradiated legumes
International Nuclear Information System (INIS)
Elwakeil, F.A.; Farag, H.; Sharabash, M.T.M.; Diaa Eldin, M.; Mahrous, S.R.
1995-01-01
Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suftered from poor growth due to the presence of some anti nutritional factors in these pulses. The processed soybeans, kidney beans, bread beans and lupines at 10 KGy could not correct the growth of rats kept on their diets for 8 weeks while irradiated chick beans at 10 KGy indicating some effect of the irradiation in this respect. When extracts of raw legumes were injected by intraperitoneal route, Ld 5 0 were found to be 125, 300, and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting the extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 300 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 KGy). Meanwhile, post irradiation treatment of kidney beans, soybeans, and broad beans caused the Ld 5 0 to be 250,400, and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate, but significant, increase in liver weight only. However, rats which received both raw and irradiated broad beans, chick peas and lupins in their diets did not suffer any pancreatic, liver hypertrophy or spleen atrophy. The hematological parameters investigated showed that there was no significant differences between rat groups fed on either the raw or the irradiated legumes. 5 tabs
Detection of horse meat contamination in raw and heat-processed meat products.
Hsieh, Yun-Hwa P; Ofori, Jack A
2014-12-31
Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.
Acceptability of self-collected vaginal samples for HPV testing in an ...
African Journals Online (AJOL)
Objective: To evaluate the acceptability of self-collected vaginal samples for HPV testing in women living in rural and urban areas of ... Conclusion: Acceptability of self-sampling for HPV testing was similarly excellent in both groups despite their difference in terms ... cancer is the leading cause of death caused by cancer in.
Seasonal variation in the Dutch bovine raw milk composition.
Heck, J M L; van Valenberg, H J F; Dijkstra, J; van Hooijdonk, A C M
2009-10-01
In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main components and milk fatty acid composition. Milk lactose concentration was rather constant throughout the season. Milk true protein content was somewhat more responsive to season, with the lowest content in June (3.21 g/100 g) and the highest content in December (3.38 g/100 g). Milk fat concentration increased from a minimum of 4.10 g/100 g in June to a maximum of 4.57 g/100 g in January. The largest (up to 2-fold) seasonal changes in the fatty acid composition were found for trans fatty acids, including conjugated linoleic acid. Milk protein composition was rather constant throughout the season. Milk unsaturation indices, which were used as an indication of desaturase activity, were lowest in spring and highest in autumn. Compared with a previous investigation of Dutch dairy milk in 1992, the fatty acid composition of Dutch raw milk has changed considerably, in particular with a higher content of saturated fatty acids in 2005 milk.
Effect of ionising radiation on shelf life and potency of herbal raw materials
International Nuclear Information System (INIS)
Rama Bhat, P.; Prajna, P.S.; Sanjeev, Ganesh; Padyana, Subramanya; Maurya, D.K.
2013-01-01
Medicinal herbs are involving from fringe to mainstream use with a greater number of people seeking remedies and health approaches free from side effects caused by synthetic chemicals. Unfortunately, the number of reports of people experiencing negative effects, caused by the use of herbal drugs, has also been increasing. There may be various reasons for such problems, poor quality of herbal medicines due to insufficient attention being paid to the quality assurance and control of these products. Plants are associated with their own microflora, in addition to that soil and air act as main inoculum source for causing contamination in crude herbs along with other field practices like harvesting, handling and packing. The study was aimed to determine the type, level of bacterial and fungal load and feasibility of electron beam irradiation to hygenise the commonly used herbal raw materials using electron beam radiation with three different dosages viz., 8 kGy, 12 kGy, 15 kGy. Irradiated and control samples were analysed for microbial load and biochemical compositions. In present study, microbial load was proportionately reduced with increase in dosage compared to non-irradiated samples. Results indicated that non-irradiated samples were highly contaminated with microbial load. E. coli and Staphylococcus spp. were predominant among the bacterial contaminants at varying levels. The fungi enumerated from raw materials includes species of Penicillium, Rhizopus, Mucor and Aspergillus. Minimum variation was recorded in the carbohydrate, protein, phenolic, tannin and ascorbic acid content of the herb samples with irradiation treatment. (author)
Sevenier, V; Delannoy, S; André, S; Fach, P; Remize, F
2012-04-16
Two categories of vegetables (carrots and green beans) that are widely used in the manufacture of canned food were surveyed for their spore contamination. Samples were recovered from 10 manufactures spread over all producing areas in France. Two samples over 316 raw vegetables collected were found positive for botulinum neurotoxin producing Clostridia spores as tested by PCR-based GeneDisc assay. Both positive samplestested positive for the type B neurotoxin gene (bont/B). In parallel, heat-resistant spores of thermophilic bacteria that are likely to be associated with canned food spoilage after prolonged incubation at 55 °C were surveyed after specific enrichment. Prevalence varied between 1.6% for Moorella thermoacetica/thermoautotrophica in green bean samples and 8.6% for either Geobacillus stearothermophilus or Thermoanaerobacterium spp. in carrot samples. Vegetable preparation, e.g. washing and edge cutting, considerably reduced spore contamination levels. These data constitute the first wide examination of vegetables specifically cultivated for industrialpurposes for their contamination by spores of thermophilic bacterial species. Copyright © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Oden, L.L.; O'Connor, W.K.; Turner, P.C.; Soelberg, N.R.; Anderson, G.L.
1993-01-01
This report presents field results and raw data from the Buried Waste Integrated Demonstration (BWID) Arc Melter Vitrification Project Phase 1 baseline test series conducted by the Idaho National Engineering Laboratory (INEL) in cooperation with the U.S. Bureau of Mines (USBM). The baseline test series was conducted using the electric arc melter facility at the USBM Albany Research Center in Albany, Oregon. Five different surrogate waste feed mixtures were tested that simulated thermally-oxidized, buried, TRU-contaminated, mixed wastes and soils present at the INEL. The USBM Arc Furnace Integrated Waste Processing Test Facility includes a continuous feed system, the arc melting furnace, an offgas control system, and utilities. The melter is a sealed, 3-phase alternating current (ac) furnace approximately 2 m high and 1.3 m wide. The furnace has a capacity of 1 metric ton of steel and can process as much as 1,500 lb/h of soil-type waste materials. The surrogate feed materials included five mixtures designed to simulate incinerated TRU-contaminated buried waste materials mixed with INEL soil. Process samples, melter system operations data and offgas composition data were obtained during the baseline tests to evaluate the melter performance and meet test objectives. Samples and data gathered during this program included (a) automatically and manually logged melter systems operations data, (b) process samples of slag, metal and fume solids, and (c) offgas composition, temperature, velocity, flowrate, moisture content, particulate loading and metals content. This report consists of 2 volumes: Volume I summarizes the baseline test operations. It includes an executive summary, system and facility description, review of the surrogate waste mixtures, and a description of the baseline test activities, measurements, and sample collection. Volume II contains the raw test data and sample analyses from samples collected during the baseline tests
Fatigue testing on samples from Zircaloy-4 tubes type SEU-43
International Nuclear Information System (INIS)
Olaru, V.; Ionescu, V.; Nitu, A.; Ionescu, D.; Voicu, F.
2016-01-01
The paper presents the testing of samples worked from Zicaloy-4 tubes (as-received.. metallurgical state), utilized in the composition of the CANDU SEU-43 fuel bundle. These tests are intended to simulate their behaviour in a power cycling process inside the reactor. The testing process is of low cycle fatigue type, done outside of the reactor, on ''C-ring'' samples, cut along the transversal direction. These samples are tested at 1%, 2% and 3% amplitude deformation, at room temperature. The calibration curves for both types of tube (small and big diameter) are determined by using the finite element analyses with the ANSYS computer code. The cycling test results are in the form of a fatigue life curve (N-e) for zircaloy-4 used in the SEU-43 fuel bundle. The curve is determined by the experimental dependency between the number of cycles to fracture and the deformation amplitude. The low cycle fatigue mechanical tests done at room temperature together with electronic microscopy analyses have reflected the characteristic behaviour of the zircaloy-4 metal in the given environment conditions. (authors)
Effects of gamma irradiation on raw materials and perfumes
International Nuclear Information System (INIS)
Guillot, M.; Pelpel, A.
1983-01-01
In order to enlight the strange problem of apparent perfume stability observed in manufactured talc powders sterilized by gamma rays, investigations were made on samples of odorant substances (raw materials, essential oils, or elaborated mixtures). As a rule, no immediate adulteration of olfactive caracteristics resulted at once from gamma irradiation. In several cases, a stabilizing effect appeared immediately and remained effective after long storage in various conditions (of temperature, or light, or oxygen exposure). This unexpected effect seems to be in accordance with previous experiments on gamma or electron irradiations of mixtures of organic molecules, reported in litterature: a mutual inhibition was observed to take place [fr
Analytical techniques for characterization of raw materials in cell culture media
Directory of Open Access Journals (Sweden)
Sharma Chandana
2011-11-01
Full Text Available Abstract Raw materials are a critical part of any cell culture medium; therefore, it is of utmost importance to understand and characterize them for high-quality product. The raw material characterization (RMC program at SAFC focuses on individual screening of raw materials both analytically and biologically. The goal of the program is to develop the best-in-class knowledge base of the raw materials used in SAFC’s media formulations and their impact on performance of products.
Plastic raw materials in Neolithic pottery production
Directory of Open Access Journals (Sweden)
Alexander A. Bobrinsky
2012-12-01
Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.
Directory of Open Access Journals (Sweden)
C.D. Kelly-Cirino
2017-06-01
Full Text Available OMNIgene·SPUTUM (OM-S is a sample transport reagent designed to work with all tuberculosis diagnostics while eliminating the need for cold chain. OM-S-treated sputum samples were assayed in several tests after multiday holds. Raw sputa from 100 patients underwent direct smear microscopy, were manually split and assigned to the OM-S group [OM-S added at collection (no other processing required and tested after 0- to 5-day holds at room temperature] or standard-of-care (SOC group (NaOH/N-acetyl l-cysteine decontamination, all tested on day of collection. Concentrated smear microscopy, Lowenstein Jensen (LJ culture, and mycobacteria growth indicator tube (MGIT culture were performed. For patients with negative direct smear, a second sample was split, with SOC (raw sputum and OM-S portions (sediment tested in the Xpert MTB/RIF (Xpert assay. OM-S group and SOC group results were strongly concordant on all four tests [range, 89% (MGIT–97% (Xpert]. OM-S MGIT, LJ, and Xpert tests were in statistical agreement with SOC MGIT as reference. OM-S specimens had lower culture contamination rates (3% vs. 10% LJ; 2% vs. 5% MGIT but required, on average, 5.6 additional days to become MGIT-positive. The findings suggest that samples held/transported in OM-S are compatible with smear microscopy, LJ or MGIT culture, and Xpert, and perform comparably to fresh sputum samples. Larger feasibility studies are warranted.
The genome of the horn fly, Haematobia irritans, was sequenced using Illumina- and Pac Bio-based protocols. Following quality filtering, the raw reads have been deposited at NCBI under the BioProject and BioSample accession numbers PRJNA30967 and SAMN07830356, respectively. The Illumina reads are un...
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Order acceptance in food processing systems with random raw material requirements
Kilic, Onur A.; van Donk, Dirk Pieter; Wijngaard, Jacob; Tarim, S. Armagan
This study considers a food production system that processes a single perishable raw material into several products having stochastic demands. In order to process an order, the amount of raw material delivery from storage needs to meet the raw material requirement of the order. However, the amount
Comparison of Biochars Characteristics from Different Raw Materials
Directory of Open Access Journals (Sweden)
SUN Tao
2017-10-01
Full Text Available Biochar is the carbon-rich product from biomass under limited supply of oxygen. Biochar has been well recognized in enhancing terrestrial carbon sequestration and greenhouse gas mitigation as well as in improving soil fertility and plant productivity. To explore the differences of biochars produced from different raw materials, six biochar samples made from alfalfa straw, wheat straw, cotton straw, grape vines, sludge and lignite were selected as test material. Qualitative and quantitative analysis by fourier transform infrared spectroscopy(FTIR and Boehm titration were used to determine the amount of the surface functional groups of biochars. Meanwhile the scanning electron microscopy(SEM was used to characterize the surface morphology of biochar samples. In addition, the basic physicochemical characteristics of biochar samples, such as pH value, organic carbon content and cation exchange capacity were also determined. The results showed that all of the biochar were alkaline except the sludge biochar was acidic. The organic carbon content of alfalfa biochar was the highest(588.43 g·kg-1 and sludge biochar was the lowest(168.17 g·kg-1. Furthermore, the rank of cation exchange capacity was alfalfa straw biochar, cotton straw biochar > grape vine biochar > wheat straw biochar > sludge biochar > lignite biochar. FTIR spectrum showed that there were the aromatic hydrocarbon and the oxygen group on the surface of biochar and the structure of biochar was mainly based on the aromatic rings skeleton. The total functional groups content of alfalfa straw biochar was the highest, but that of sludge biochar was the lowest. The SEM results showed that there were obvious pore structure on the surface of plant-based biochar, but none on the surface of mineral-based biochar. Alfalfa straw biochar, wheat straw biochar, cotton straw biochar and grape vine biochar can be applied to improve farmland soil quality and increase soil fertility, and lignite biochar
Klein, Günter; Pack, Alexander; Reuter, Gerhard
1998-01-01
The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958
Solubility testing of actinides on breathing-zone and area air samples
International Nuclear Information System (INIS)
Metzger, R.L.; Jessop, B.H.; McDowell, B.L.
1996-02-01
A solubility testing method for several common actinides has been developed with sufficient sensitivity to allow profiles to be determined from routine breathing zone and area air samples in the workplace. Air samples are covered with a clean filter to form a filter-sample-filter sandwich which is immersed in an extracellular lung serum simulant solution. The sample is moved to a fresh beaker of the lung fluid simulant each day for one week, and then weekly until the end of the 28 day test period. The soak solutions are wet ashed with nitric acid and hydrogen peroxide to destroy the organic components of the lung simulant solution prior to extraction of the nuclides of interest directly into an extractive scintillator for subsequent counting on a Photon-Electron Rejecting Alpha Liquid Scintillation (PERALS reg-sign) spectrometer. Solvent extraction methods utilizing the extractive scintillators have been developed for the isotopes of uranium, plutonium, and curium. The procedures normally produce an isotopic recovery greater than 95% and have been used to develop solubility profiles from air samples with 40 pCi or less of U 3 O 8 . Profiles developed for U 3 O 8 samples show good agreement with in vitro and in vivo tests performed by other investigators on samples from the same uranium mills
Compressive and Flexural Tests on Adobe Samples Reinforced with Wire Mesh
Jokhio, G. A.; Al-Tawil, Y. M. Y.; Syed Mohsin, S. M.; Gul, Y.; Ramli, N. I.
2018-03-01
Adobe is an economical, naturally available, and environment friendly construction material that offers excellent thermal and sound insulations as well as indoor air quality. It is important to understand and enhance the mechanical properties of this material, where a high degree of variation is reported in the literature owing to lack of research and standardization in this field. The present paper focuses first on the understanding of mechanical behaviour of adobe subjected to compressive stresses as well as flexure and then on enhancing the same with the help of steel wire mesh as reinforcement. A total of 22 samples were tested out of which, 12 cube samples were tested for compressive strength, whereas 10 beams samples were tested for modulus of rupture. Half of the samples in each category were control samples i.e. without wire mesh reinforcement, whereas the remaining half were reinforced with a single layer of wire mesh per sample. It has been found that the compressive strength of adobe increases by about 43% after adding a single layer of wire mesh reinforcement. The flexural response of adobe has also shown improvement with the addition of wire mesh reinforcement.
Raw materials for aluminium production
International Nuclear Information System (INIS)
Galushkin, N.V.
1995-01-01
This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.
Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.
van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M
2018-01-01
Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and
Effect of sweet yeast bread formula on evaluating rapid mix test
Directory of Open Access Journals (Sweden)
Petra Dvořáková
2011-01-01
Full Text Available The aim of this work was to detect how different sweet yeast bread formulas influence results of rapid mix test and by the help of sensory analysis to discover consumer preferences and possible benefit and use in bakery industry. Applied raw materials (ground wheat flour T 530, yeast, sugar, salt, oil, egg, improver Hit along with basic formula were taken from the Varmužova bakery in Boršice by Buchlovice. The basic formula served as a standard (I, other six formulas were then determined (II–VII. In each formula, the rate of yeast, sugar or oil was altered in the range of ± 10% compared with the standard. Flour bread-making quality – Hagberg Falling number [s], Sedimentation index [ml], wet gluten [%], ash [%], moisture [%], binding capacity [%], granulation [%], alveographic energy [10−4J] and alveographic rate P/L – was measured. Rapid mix test and parameters like pastry weight, volume, shape, dough yield, pastry yield, baking loss, penetration and sensory analysis were determined. To establish yeast fermentation activity, Engelke fermentation test was applied. The most evident differences among the samples appeared in the volume and shape. The results of sensory analysis showed that the samples with higher rate of altered raw materials were evaluated as the best.
Inert medium (helium) irradiation testing of pressure tube samples
International Nuclear Information System (INIS)
Ancuta, M.; Radu, V.; Stefan, V.; Preda, M.
2001-01-01
Irradiation tests currently performed in C-5 capsule aim at obtaining data and information concerning behavior to irradiation of pressure tubes of CANDU type fuel channel, to evidence the factors limiting operation life span. A calculation code for analysis and prediction of pressure tube behavior should be based upon periodical inspection results, post irradiation examination of the removed from reactor pressure tubes as well as on the experimental results obtained with materials subjected to irradiation conditions identical with the operational ones. Mechanical behavior analysis should focus both complex thermal-mechanical type stresses and mechanical properties alteration under irradiation. The experimental results should be applied: - to evaluate the irradiation effects upon mechanical properties of Zr-2.5% Nb exposed to fluences up to 10 21 n·cm -2 ; - to gather data concerning the real stress / real deformation characteristic from which characteristic quantities can be deduced as, for instance, elasticity modulus, plasticity modulus, exponent of stress term in the Tsu-Berteles relation, to be used within the CANTUP simulation code describing pressure tube behavior, currently developed at INR Pitesti; - to develop prediction methods of pressure tube behavior and merging with in-service inspection procedure in order to forecast the life span and the proper timing for replacement before major failures occur. The samples irradiated in C-5 capsule were extracted from the ends of Zr-2.5% Nb pressure tubes resulting from Cernavoda NPP Unit 1. The samples for tensile tests were extracted on longitudinal and transversal directions of the pressure tube. The tests were carried out under following conditions: - test environment temperature, 260 - 280 deg.C; - testing medium, helium at 1 - 6 b pressure; - neutron flux (E n > 1 MeV), 1 - 2 · 10 13 ncm -2 s -1 ; - neutron fluence (E n > 1 MeV), 4 · 10 20 ncm -2 . The following characteristics were obtained from tensile
Volatiles in raw and cooked meat from lambs fed olive cake and linseed.
Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A
2015-04-01
This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.
Hygienic and other aspects of raw milk vending machines
DANIEL, Radovan
2011-01-01
The aim of this work was to evaluate opportunities of raw milk sales. The questionnaire was submitted to respondents, which assessed the direct sale of milk, consumption, awareness about milk quality connecting with the sales of raw milk using a vending machines.
High temperature cement raw meal flowability
DEFF Research Database (Denmark)
Maarup, Claus; Hjuler, Klaus; Dam-Johansen, Kim
2014-01-01
The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated by incre......The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated...
Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk
Directory of Open Access Journals (Sweden)
Carla Duarte
2016-04-01
Full Text Available Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.
Estimation of sample size and testing power (Part 4).
Hu, Liang-ping; Bao, Xiao-lei; Guan, Xue; Zhou, Shi-guo
2012-01-01
Sample size estimation is necessary for any experimental or survey research. An appropriate estimation of sample size based on known information and statistical knowledge is of great significance. This article introduces methods of sample size estimation of difference test for data with the design of one factor with two levels, including sample size estimation formulas and realization based on the formulas and the POWER procedure of SAS software for quantitative data and qualitative data with the design of one factor with two levels. In addition, this article presents examples for analysis, which will play a leading role for researchers to implement the repetition principle during the research design phase.
Traceability System Model for Quality Gelatin Raw Material of Cattle Hides
Directory of Open Access Journals (Sweden)
S Nur
2010-09-01
Full Text Available Several criteria must be accomplished within the provision of quality products in terms of the types of materials, the processing methods and effort to get it. Traceability system involves various parties that have different needs and goals in the process of supplying raw materials. Hence, there is a need for institutional systems engineering that can organize and manage the tracking process, the procurement of raw materials that guarantee the origin of gelatin raw materials, and facilitate the industry and customer to create a standardized quality of product. The purpose of the study formulates the institutional tracking models of gelatin raw material from cattle hide based on various criteria and assessment of the expert opinion. The methods used in this study were Interpretative structural modeling to formulate a representation of institutional tracking efficiently and analytical hierarchy process to determine the tracking strategy of industrial gelatin raw materials from cowhide. The results obtained from the study were some key elements of institutional tracking model for industrial gelatin raw materials from cowhide and the traceability strategies for industrial raw materials from cattle hide gelatin Indonesia. (Animal Production 12(3: 190-198 (2010 Key Words: traceability, institutional model, cattle hide, gelatin
Raw starch digestion by. alpha. -amylase and glucoamylase from Chalara paradoxa
Energy Technology Data Exchange (ETDEWEB)
Monma, Mitsura; Yamamoto, Yoshihiro; Kagei, Norio; Kainuma, Keiji
1989-10-01
Glucoamylase and {alpha}-amylase of Chalara paradoxa were separated by hydrophobic column chromatography using butyl-Toyopearl 650M. The {alpha}-amylase showed the highest activity at pH 5.5 and 45{sup 0}C, and was stable in the pH range of 5.5-6.5 and at temperatures lower than 40{sup 0}C. The glucoamylase showed the highest activity at pH 5.0 and 45{sup 0}C, and was stable in the pH range of 4.0-7.5 and at temperatures lower than 45{sup 0}C. The molecular mass of the {alpha}-amylase and glucoamylase estimated by SDS polyacrylamide gel electrophoresis was 80,000 and 68,000, respectively. Both glucoamylase and {alpha}-amylase could digest more effectively raw rice starch and raw corn starch than raw sago starch and raw potato starch. 2% raw rice starch in 10 ml solution was digested by more than 90% by 100 units of each amylase. When these amylases were used combined, raw corn starch was more effectively digested than they were used singly. This cooperative action in raw corn starch digestion was also observed when C. paradoxa {alpha}-amylase and R. niveus glucoamylase were combined. (orig.).
Quality control of raw cows' milk by headspace analysis
Hettinga, K.A.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.
2008-01-01
This study investigated whether headspace analysis of volatile components can be used for monitoring the quality of raw cows¿ milk. The detection of different quality defects caused by cows¿ feed, microbiological and chemical contamination, as well as enzymatic deterioration was studied. Fresh raw
Microbiological analyses of samples from the H-Area injection well test site
International Nuclear Information System (INIS)
Wilde, E.W.; Franck, M.M.
1997-01-01
Microbial populations in well water from monitoring wells at the test site were one to three orders of magnitude higher than well water from the Cretaceous aquifer (used as dilution water for the tests) or from a control well adjacent to the test site facility. Coupons samples placed in monitoring and control wells demonstrated progressive adhesion by microbes to materials used in well construction. Samples of material scraped from test well components during abandonment of the test site project revealed the presence of a variety of attached microbes including iron bacteria. Although the injection wells at the actual remediation facility for the F- and H-Area seepage basins remediation project are expected to be subjected to somewhat different conditions (e.g. considerably lower iron concentrations) than was the case at the test site, the potential for microbiologically mediated clogging and fouling within the process should be considered. A sampling program that includes microbiological testing is highly recommended
Kim, H W; Hong, Y J; Jo, J I; Ha, S D; Kim, S H; Lee, H J; Rhee, M S
2017-01-01
Microbiological quality of 206 raw ready-to-eat seafood samples was investigated according to species (gizzard shad, halibut, rockfish, tuna, oyster and squid) and distribution channels (fishery, hyper and online market). Enumeration of aerobic plate count and total coliforms (TC) and pathogenic bacteria (Bacillus cereus, Staphylococcus aureus and Vibrio parahaemolyticus) was performed, and level of microbiological quality was classified into four groups: satisfactory, acceptable, unsatisfactory and unacceptable. Qualitative analysis was also performed for Escherichia coli and eight foodborne pathogens (B. cereus, E. coli O157:H7, Listeria monocytogenes, Salmonella spp., S. aureus, Vibrio cholerae, V. parahaemolyticus, and Vibrio vulnificus). Raw ready-to-eat seafood products revealed 0·5% at an unsatisfactory level and 4·9% at an unacceptable level due to ≥4 log CFU g -1 of TC in squid and ≥3 log CFU g -1 of V. parahaemolyticus in gizzard shad respectively. Gizzard shad was shown to be potentially hazardous, as its sashimi is eaten with its skin attached. Bacillus cereus, E. coli, S. aureus, V. parahaemolyticus and V. vulnificus were qualitatively detected. Samples from the fishery market showed higher detection rate especially in V. parahaemolyticus (21·6%) and V. vulnificus (1·7%) which indicates the need to improve microbiological safety of raw ready-to-eat seafood products in fishery market. Raw ready-to-eat seafood products like sashimi can be easily contaminated with various bacteria from aquatic environments and human reservoirs, which subsequently bring about a risk in food poisoning due to no heating process before consumption. The results of this study provide comprehensive microbiological data on various species of raw ready-to-eat seafood from various distribution channels. It may contribute to establish reasonable standard and effective strategies to ensure a good microbiological quality of raw ready-to-eat seafood for the
Aldabsheh, Islam; Garcia-Valles, Maite; Martinez, Salvador
2014-05-01
Environmental preservation has become a driving force behind the search for new sustainable and environmentally friendly composites to replace conventional concrete produced from ordinary Portland cement (OPC). Current researches concentrate on developing building products (geopolymers) through geopolymerization. The goal is to produce low cost construction materials for green housing. Geopolymerization is the process of polymerizing minerals with high silica and alumina at low temperature by the use of alkali solutions. Dissolution is the most important process for supplying the high initial Al and Si concentrations to produce the gel phase that is responsible for geopolymerization. This study has been focused on the influence of different micrometric particle sizes of three Jordanian raw materials on their dissolution behavior in sodium hydroxide solution. The samples are kaolinite, volcanic tuff and silica sand. The dissolution properties of each material, alone and mixed with the other two materials were studied in different concentrations (5 and 10 M) using (NaOH) at 25ºC, and shaking time for 24 and 168 h. To better understand the dissolution process, the alkaline solution was renewed after the desired time in order to know if the Al-Si raw material is completely dissolved or not. Different analytical techniques were used to characterize raw materials physically, mineralogically, chemically and thermally. All processed samples either centrifuged solutions or solid residues were fully characterized. The leached concentrations of Al and Si were determined by inductively coupled plasma (ICP). X-ray Diffraction Technique (XRD), Scanning Electron Microscopy (SEM), and Thermo Gravimetric Analysis (TGA) were used to evaluate the solid residue characterization compared with the original ones. The three aluminosilicate raw materials have indicated variable degrees of solubility under highly alkaline conditions. The method for the size reduction of the used raw
Etzion, Y; Linker, R; Cogan, U; Shmulevich, I
2004-09-01
This study investigates the potential use of attenuated total reflectance spectroscopy in the mid-infrared range for determining protein concentration in raw cow milk. The determination of protein concentration is based on the characteristic absorbance of milk proteins, which includes 2 absorbance bands in the 1500 to 1700 cm(-1) range, known as the amide I and amide II bands, and absorbance in the 1060 to 1100 cm(-1) range, which is associated with phosphate groups covalently bound to casein proteins. To minimize the influence of the strong water band (centered around 1640 cm(-1)) that overlaps with the amide I and amide II bands, an optimized automatic procedure for accurate water subtraction was applied. Following water subtraction, the spectra were analyzed by 3 methods, namely simple band integration, partial least squares (PLS) and neural networks. For the neural network models, the spectra were first decomposed by principal component analysis (PCA), and the neural network inputs were the spectra principal components scores. In addition, the concentrations of 2 constituents expected to interact with the protein (i.e., fat and lactose) were also used as inputs. These approaches were tested with 235 spectra of standardized raw milk samples, corresponding to 26 protein concentrations in the 2.47 to 3.90% (weight per volume) range. The simple integration method led to very poor results, whereas PLS resulted in prediction errors of about 0.22% protein. The neural network approach led to prediction errors of 0.20% protein when based on PCA scores only, and 0.08% protein when lactose and fat concentrations were also included in the model. These results indicate the potential usefulness of Fourier transform infrared/attenuated total reflectance spectroscopy for rapid, possibly online, determination of protein concentration in raw milk.