WorldWideScience

Sample records for raw milk flushed

  1. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  2. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  3. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  4. Influence of raw milk quality on fluid milk shelf life.

    Science.gov (United States)

    Barbano, D M; Ma, Y; Santos, M V

    2006-03-01

    Pasteurized fluid milk shelf life is influenced by raw milk quality. The microbial count and somatic cell count (SCC) determine the load of heat-resistant enzymes in milk. Generally, high levels of psychrotrophic bacteria in raw milk are required to contribute sufficient quantities of heat-stable proteases and lipases to cause breakdown of protein and fat after pasteurization. Sanitation, refrigeration, and the addition of CO2 to milk are used to control both total and psychrotrophic bacteria count. It is not uncommon for total bacterial counts of raw milk to be milk processors have not focused much attention on milk SCC. Increased SCC is correlated with increased amounts of heat-stable protease (plasmin) and lipase (lipoprotein lipase) in milk. When starting with raw milk that has a low bacterial count, and in the absence of microbial growth in pasteurized milk, enzymes associated with high SCC will cause protein and fat degradation during refrigerated storage, and produce off-flavors. As the ability to kill, remove, or control microbial growth in pasteurized refrigerated milk continues to improve, the original milk SCC will be the factor limiting the time of refrigerated storage before development of an off-flavor in milk. Most healthy cows in a dairy herd have a milk SCC 200,000 cell/mL are usually due to the contribution of high SCC milk from a small number of cows in the herd. Technology to identify these cows and keep their milk out of the bulk tank could substantially increase the value of the remaining milk for use in fluid milk processing. To achieve a 60- to 90-d shelf life of refrigerated fluid milk, fluid processors and dairy farmers need to work together to structure economic incentives that allow farmers to produce milk with the SCC needed for extended refrigerated shelf life.

  5. Determination of essential nutrients in raw milk

    Directory of Open Access Journals (Sweden)

    Penphimon Phongphanphanee

    2006-03-01

    Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.

  6. Food safety hazards associated with consumption of raw milk.

    Science.gov (United States)

    Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E

    2009-09-01

    An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.

  7. Monitoring of psychrotrophic microorganisms in raw milk

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2008-01-01

    Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.

  8. Hygienic and other aspects of raw milk vending machines

    OpenAIRE

    DANIEL, Radovan

    2011-01-01

    The aim of this work was to evaluate opportunities of raw milk sales. The questionnaire was submitted to respondents, which assessed the direct sale of milk, consumption, awareness about milk quality connecting with the sales of raw milk using a vending machines.

  9. The hygienic quality of raw reindeer milk

    Directory of Open Access Journals (Sweden)

    Joanna Kurki

    2004-04-01

    Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten

  10. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  11. Hygienic quality of raw milk with regard to legislation

    Directory of Open Access Journals (Sweden)

    Slavko Kirin

    2001-01-01

    Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.

  12. Microbiological quality and safety of raw and pasteurized milk ...

    African Journals Online (AJOL)

    This requires urgent attention by the appropriate authorities, because the poor microbiological quality of raw milk and pasteurized milk may expose consumers to health risks associated with the consumption of contaminated milk. Key words: Marketed milk, quality, acidity, total viable count, coliforms, enterobacteriaceae, ...

  13. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  14. Seasonal variation in the Dutch bovine raw milk composition

    NARCIS (Netherlands)

    Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.

    2009-01-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main

  15. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    The composition of milk is of most importance to the dairy industry and human health. This study was conducted to provide data on the composition of raw cow milk and artisanal yoghurt collected in Maroua (Cameroon). Milk and yoghurt samples were collected from 11 breeding sites and 12 producers in the city of Maroua, ...

  16. Microbes from raw milk for fermented dairy products

    NARCIS (Netherlands)

    Wouters, J.T.M.; Ayad, E.H.E.; Hugenholtz, J.; Smit, G.

    2002-01-01

    Milk has a high nutritive value, not only For the new-born mammal and for the human consumer, but also for microbes. Raw milk kept at roam temperature will be liable to microbial spoilage. After some days, the milk will spontaneously become sour. This is generally due to the activity of lactic acid

  17. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  18. Encephalitozoon cuniculi in Raw Cow's Milk Remains Infectious After Pasteurization.

    Science.gov (United States)

    Kváč, Martin; Tomanová, Vendula; Samková, Eva; Koubová, Jana; Kotková, Michaela; Hlásková, Lenka; McEvoy, John; Sak, Bohumil

    2016-02-01

    This study describes the prevalence of Encephalitozoon cuniculi in raw cow's milk and evaluates the effect of different milk pasteurization treatments on E. cuniculi infectivity for severe combined immunodeficient (SCID) mice. Using a nested polymerase chain reaction approach, 1 of 50 milking cows was found to repeatedly shed E. cuniculi in its feces and milk. Under experimental conditions, E. cuniculi spores in milk remained infective for SCID mice following pasteurization treatments at 72 °C for 15 s or 85 °C for 5 s. Based on these findings, pasteurized cow's milk should be considered a potential source of E. cuniculi infection in humans.

  19. Consumption of raw or unpasteurized milk and milk products by pregnant women and children.

    Science.gov (United States)

    2014-01-01

    Sales of raw or unpasteurized milk and milk products are still legal in at least 30 states in the United States. Raw milk and milk products from cows, goats, and sheep continue to be a source of bacterial infections attributable to a number of virulent pathogens, including Listeria monocytogenes, Campylobacter jejuni, Salmonella species, Brucella species, and Escherichia coli O157. These infections can occur in both healthy and immunocompromised individuals, including older adults, infants, young children, and pregnant women and their unborn fetuses, in whom life-threatening infections and fetal miscarriage can occur. Efforts to limit the sale of raw milk products have met with opposition from those who are proponents of the purported health benefits of consuming raw milk products, which contain natural or unprocessed factors not inactivated by pasteurization. However, the benefits of these natural factors have not been clearly demonstrated in evidence-based studies and, therefore, do not outweigh the risks of raw milk consumption. Substantial data suggest that pasteurized milk confers equivalent health benefits compared with raw milk, without the additional risk of bacterial infections. The purpose of this policy statement was to review the risks of raw milk consumption in the United States and to provide evidence of the risks of infectious complications associated with consumption of unpasteurized milk and milk products, especially among pregnant women, infants, and children.

  20. Effects of storage on the major constituents of raw milk

    Directory of Open Access Journals (Sweden)

    Peter Zajác

    2015-10-01

    Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an

  1. Seasonal variation in the Dutch bovine raw milk composition.

    Science.gov (United States)

    Heck, J M L; van Valenberg, H J F; Dijkstra, J; van Hooijdonk, A C M

    2009-10-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main components and milk fatty acid composition. Milk lactose concentration was rather constant throughout the season. Milk true protein content was somewhat more responsive to season, with the lowest content in June (3.21 g/100 g) and the highest content in December (3.38 g/100 g). Milk fat concentration increased from a minimum of 4.10 g/100 g in June to a maximum of 4.57 g/100 g in January. The largest (up to 2-fold) seasonal changes in the fatty acid composition were found for trans fatty acids, including conjugated linoleic acid. Milk protein composition was rather constant throughout the season. Milk unsaturation indices, which were used as an indication of desaturase activity, were lowest in spring and highest in autumn. Compared with a previous investigation of Dutch dairy milk in 1992, the fatty acid composition of Dutch raw milk has changed considerably, in particular with a higher content of saturated fatty acids in 2005 milk.

  2. Quality control of raw cows' milk by headspace analysis

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.

    2008-01-01

    This study investigated whether headspace analysis of volatile components can be used for monitoring the quality of raw cows¿ milk. The detection of different quality defects caused by cows¿ feed, microbiological and chemical contamination, as well as enzymatic deterioration was studied. Fresh raw

  3. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Monitoring of foodborne pathogens in raw cow milk in Tuscany

    Directory of Open Access Journals (Sweden)

    Laura Gasperetti

    2014-03-01

    Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.

  5. [Investigation of gestagenic effect of raw drone milk in rats].

    Science.gov (United States)

    Seres, Adrienn; Ducza, Eszter; Gáspár, Róbert

    2014-01-01

    Numerous honeybee products are used in traditional medicine. The best-known honeybee products are the honey, the propolis and the royal jelly. Drone milk is a relatively little-known honeybee product. Although, drone milk is traditionally used to treat infertility and to promote vitality in both men and women in certain countries, the literature furnishes no information concerning effects of the drone milk. The oestrogenic and androgenic effects of drone milk have recently been reported in rats and the effective compounds have also been identified. The aim of this study was to determine the putative gestagenic effect of raw drone milk in rats. Maintenance of pregnancy assays revealed that drone milk was able to increase the number of surviving fetuses. This results suggested some gestagenic effects. This effect was confirmed by RT-PCR and Western blot methods in which the mRNA and protein expressions of gestagen-dependent CRLR (Calcitonin Receptor-Like Receptor) peptide were determined. To determine the efficacy of gestagenic effect of drone milk, spironolactone (weak gestagen compound) was used. The combination of drone milk and spironolactone showed more potent gestagenic effect. These results lead us to suppose that raw drone milk shows weak gestagenic effect and this effect can be increased by another weak gestagen. Further studies are required to clarify the gestagenic mechanisms of action of drone milk.

  6. The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea.

    Science.gov (United States)

    Park, Y K; Koo, H C; Kim, S H; Hwang, S Y; Jung, W K; Kim, J M; Shin, S; Kim, R T; Park, Y H

    2007-12-01

    Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (-0.0149), lactose (-0.8910), and MUN (-0.0096), and those of MUN on milk fat (-0.3125), protein (-0.8012), and SCCt (-0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (-0.0172), protein (-0.2693), and lactose (-0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.

  7. Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines

    Directory of Open Access Journals (Sweden)

    Gheorghe Şteţca

    2014-11-01

    Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain. 

  8. 119-132 Microbiological Quality of Raw Cow Milk across the Milk ...

    African Journals Online (AJOL)

    t

    equipment of producers in rural areas of Babile district; from the equipment of .... pastoral areas is supplied to urban centers through informal milk marketing channels ... raw milk across the milk supply chain to ensure safety and suitability ... Materials and Methods. 2.1. ... Ethiopia at 9°36′ N latitude and 41°52′ E longitude.

  9. Strontium-90 and cesium-137 in raw milk

    International Nuclear Information System (INIS)

    1979-01-01

    Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)

  10. Prevalence of the pathogen microorganisms in raw cow milk

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2009-11-01

    Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

  11. Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk.

    Science.gov (United States)

    Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J

    2011-03-01

    Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Improved growth of preterm infants receiving mother's own raw milk compared with pasteurized donor milk.

    Science.gov (United States)

    Montjaux-Régis, N; Cristini, C; Arnaud, C; Glorieux, I; Vanpee, M; Casper, C

    2011-12-01

    To determine whether growth, feeding tolerance and infectious events of preterm infants is related to the proportion of intake of mother's own raw milk (maternal milk) versus pooled pasteurized banked breast milk (donor milk). This is a prospective observational study of 55 premature infants born less than 32 weeks of gestational age admitted to the neonatal intensive care unit at the Children's Hospital of Toulouse during two 6-month periods from 2003 to 2005. Enrolled infants were exclusively on enteral feeds with maternal milk ± donor milk. Mean gestational age was 28.6 weeks (SD 1.5) and mean birth weight 1105 grams (SD 282). During the time of exclusively breast milk feeds, weight gain (g/kg/day) was correlated to the proportion of maternal milk consumed (p = 0.0048, r = 0.4). Necrotizing enterocolitis was inversely correlated to the amount of maternal milk. The amount of maternal milk did not impact on infectious events. Mother's own raw milk improves weight gain compared with donor milk in preterm infants. Lactation strategies should be sought that helps mothers to increase their milk production. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  13. Quality aspects of raw goat milk in Lower Southern Thailand

    OpenAIRE

    Siriwat Wasiksiri; Usa Chethanond; Sahutaya Pongprayoon; Somjit Srimai; Bunjob Nasae

    2010-01-01

    This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05) on pH and total plate count among samples from eachfarm. However...

  14. Spoilage potential of Paenibacillussp. in Brazilian raw milk

    Directory of Open Access Journals (Sweden)

    José Carlos Ribeiro Júnior

    2016-04-01

    Full Text Available ABSTRACT: Bacterial spores are widespread in the environment and can contaminate milk. Spores are resistant to thermal conditions and your germination reduces milk shelf-life because the aerobic bacteria that are sporulated produce proteases and lipases. The aim of this study was identify Paenibacillus sp., the spoilage microbiota, arising from the germination of spores in raw milk and your spoilage potential. Twenty different milk samples were treated at 80°C/12min and plated to isolate spore-forming bacteria. These strains were picked in milk agar and tributyrin agar for verification of their potential proteolytic and lipolytic activities, respectively. Amplification and sequencing of the 16S rRNA gene of the strains for identification by similarity to the DNA sequences deposited in GenBank was performed. One hundred and thirty-seven isolates were obtained, of which 40 (29.2% showed spoilage activity for milk. Of these, three (7.5% were identified as strains of Paenibacillus sp., and all were lipolytic. Paenibacillus sp. have been identified as primarily responsible for the spoilage of pasteurized milk with a long shelf-life in other countries. To increase the shelf-life of Brazilian pasteurized milk, it is important to identify the sporulated microbes to determine their origin and to control the contamination of milk by vegetative forms such as spores.

  15. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-04-12

    Apr 12, 2010 ... detection and identification of S. aureus in raw milk demonstrated high sensitivity and specificity. Key words: Microarray .... sterile after screening for S. aureus contamination according to the procedure described by Wang ... methods, the microarray method is high throughput, specific, and sensitive and also ...

  16. Effect of leaving milk trucks empty and idle for 6 h between raw milk loads.

    Science.gov (United States)

    Kuhn, Eva; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy G

    2018-02-01

    The US Pasteurized Milk Ordinance (PMO) allows milk tanker trucks to be used repeatedly for 24 h before mandatory clean-in-place cleaning, but no specifications are given for the length of time a tanker can be empty between loads. We defined a worst-case hauling scenario as a hauling vessel left empty and dirty (idle) for extended periods between loads, especially in warm weather. Initial studies were conducted using 5-gallon milk cans (pilot-scale) as a proof-of-concept and to demonstrate that extended idle time intervals could contribute to compromised raw milk quality. Based on pilot-scale results, a commercial hauling study was conducted through partnership with a Pacific Northwest dairy co-op to verify that extended idle times of 6 h between loads have minimal influence on the microbiological populations and enzyme activity in subsequent loads of milk. Milk cans were used to haul raw milk (load 1), emptied, incubated at 30°C for 3, 6, 10, and 20 h, and refilled with commercially pasteurized whole milk (load 2) to measure cross-contamination. For the commercial-scale study, a single tanker was filled with milk from a farm known to have poorer quality milk (farm A, load 1), emptied, and refilled immediately (0 h) or after a delay (6 h) with milk from a farm known to have superior quality milk (farm B, load 2). In both experiments, milk samples were obtained from each farm's bulk tank and from the milk can or tanker before unloading. Each sample was microbiologically assessed for standard plate count (SPC), lactic acid bacteria (LAB), and coliform counts. Selected isolates were assessed for lipolytic and proteolytic activity using spirit blue agar and skim milk agar, respectively. The pilot-scale experiment effectively demonstrated that extended periods of idle (>3 h) of soiled hauling vessels can significantly affect the microbiological quality of raw milk in subsequent loads; however, extended idle times of 6 h or less would not measurably compromise milk

  17. XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK

    Directory of Open Access Journals (Sweden)

    Agnieszka Greń

    2012-12-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1.  Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246

  18. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  19. Quality aspects of raw goat milk in Lower Southern Thailand

    Directory of Open Access Journals (Sweden)

    Siriwat Wasiksiri

    2010-05-01

    Full Text Available This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05 on pH and total plate count among samples from eachfarm. However, acidity, specific gravity, milk fat, solid not fat, and total solid varied between farms depending on feed supplyand management. Means of total bacteria count and Coliform count of most samples were in TACF standard quality (log3.720 cfu/ml and log 1.892 cfu/ml, respectively, except four samples had higher Coliform contamination. Additionally,a higher proportion (22.7 % of samples with antibiotic residue was found.

  20. Factors affecting consumers' preferences for and purchasing decisions regarding pasteurized and raw milk specialty cheeses.

    Science.gov (United States)

    Colonna, A; Durham, C; Meunier-Goddik, L

    2011-10-01

    Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Impact of Freezing Time on Dornic Acidity in Three Types of Milk: Raw Donor Milk, Mother's Own Milk, and Pasteurized Donor Milk.

    Science.gov (United States)

    Vázquez-Román, Sara; Escuder-Vieco, Diana; García-Lara, Nadia Raquel; Alonso-Díaz, Clara; Lora, David; Martín-Pelegrina, María Dolores; Pallás-Alonso, Carmen Rosa

    2016-03-01

    Although under certain circumstances it is necessary to express milk, there are not many recommendations about the ideal storage conditions for human milk. The objectives of this study were to analyze the effects on Dornic acidity of frozen storage at -20 °C in three types of milk: raw donor milk, mother's own raw milk, and pasteurized donor milk. Forty-three samples of raw donor milk, 40 samples of pasteurized donor milk, and 16 samples of mother's own milk were analyzed. Dornic acidity was measured at time 0, before freezing. The remaining aliquots were frozen and analyzed after 1, 2, 3, and 4 weeks and after 2 and 3 months. In raw donor milk, the median acidity at the start was 3 °D (interquartile range [IQR] 2-3 °D); after 3 months, it was 5 °D (IQR 3-7 °D), with a significant increase in acidity after the second week. In mother's own milk, the mean acidity at the start was 3 °D (IQR 2-4 °D) and 7 °D (IQR 4-8 °D) at 3 months. The increase was significant after the third week. In pasteurized donor milk, the mean acidity was 3 °D (IQR 2-3 °D) at the start and 2 °D (IQR 2-3 °D) at the end. When comparing the three types of milk, there were significant differences from the first week between the two types of raw milk and the pasteurized milk (p raw milks (p = 0.77). Dornic acidity in unpasteurized milk significantly increases with the duration of freezing, probably due to the action of lipases, which is lost with pasteurization. It would be advisable to reduce the length of freezing time for unpasteurized milk.

  2. COMPARISON BETWEEN SOME PHYSICAL - CHEMICAL CHARACTERISTICS OF CACAO MILK AND RAW MILK

    OpenAIRE

    Florin Roman

    2009-01-01

    The paper presents a comparison between some physical - chemical characteristics of the cacao milk and of the raw milk. For this comparison we made the following determinations for both types of milk: the determination of the dry substance using the drying oven with a 102 °C temperature, the determination of the proteic substance by titration with sodium hydroxide ( NaOH ) N/10, the milk pasteurization control by the starch and potassium iodide test and the pH determination using the indicato...

  3. Traceability of Plant Diet Contents in Raw Cow Milk Samples

    Science.gov (United States)

    Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

    2009-01-01

    The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

  4. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  5. Chemical Contaminants in Raw and Pasteurized Human Milk.

    Science.gov (United States)

    Hartle, Jennifer C; Cohen, Ronald S; Sakamoto, Pauline; Barr, Dana Boyd; Carmichael, Suzan L

    2018-05-01

    Environmental contaminants ranging from legacy chemicals like p,p'-dichlorodiphenyltrichloroethane (DDT) to emerging chemicals like phthalates are ubiquitous. Research aims/questions: This research aims to examine the presence and co-occurrence of contaminants in human milk and effects of pasteurization on human milk chemical contaminants. We analyzed human milk donated by 21 women to a milk bank for 23 chemicals, including the persistent organic pollutants (POPs) polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDT), and dichlorodiphenyldichloroethylene (DDE) isomers that are known to sequester in adipose tissue, along with the current-use and nonpersistent pesticides chlorpyrifos and permethrin, phthalates, and bisphenol A (BPA). Human milk was analyzed raw and pasteurized for these chemicals using gas chromatography-tandem mass spectrometry for the POPs and high-performance liquid chromatography-tandem mass spectrometry for non-POPs. Within the different chemical classes, PBDE47, PCB153, ppDDE, and MEHHP (phthalate metabolite) had the highest median concentrations and were observed in all samples. We also observed chlorpyrifos and BPA in all samples and permethrin in 90% of the samples tested. Only two chemicals, chlorpyrifos and permethrin, were susceptible to substantial degradation from pasteurization, a standard method for processing donated human milk. We detected 19 of 23 chemicals in all of our prepasteurized milk and 18 of 23 chemicals in all of our pasteurized milk. Pasteurization did not affect the presence of most of the chemicals. Future research should continue to explore human milk for potential chemical contamination and as a means to surveil exposures among women and children.

  6. Radiometric determination of the bacteriological quality of raw milk

    International Nuclear Information System (INIS)

    Cogan, T.M.; O'Connor, F.

    1977-01-01

    The usefulness of 14 CO 2 production from (U- 14 C) glucose, (U- 14 C) glutamate and ( 14 C) formate as an index of raw milk quality was investigated. Development work showed that the volume of milk sample influenced the detection of radioactivity. The regression coefficient between Log 10 of the inital bacterial count and the detection time (the time to reach 2000 cpm) in the presence of 0.13 μCi (U- 14 C) glucose/ml was -0.55 (n=119 samples) and the relationship was y=-0.11x+-0.46. The addition of 0.5 μCi (U- 14 C) glutamate and 0.5 μCi of ( 14 C) formate decreased the detection times but did not result in greater predictability. Further study is required before the method could be used to determine the bacteriological quality of milk

  7. Chosen biotic factors influencing raw cow milk freezing point

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2011-01-01

    Full Text Available The milk freezing point depression (FPD is important physical property. FPD is influenced by milk composition especially by components with osmotic pressure activity and by other physiological factors. There is possible to indicate a foreign (extraneous water addition into milk by FPD. This is necessary to have a good estimated legislative FPD discrimination limit (FPD–L for purpose of milk quality control. This paper was aimed at obtaining information to improve such estimation. Impacts factors as season variations, estimated state of dairy cow nutrition and some milk components and properties on milk FPD and their relations to FPD were quantified (n 11 540 – 72 607 bulk raw cow milk samples. The highest FPD was in Spring (−0.52097 ± 0.004877 °C, the lowest in Autumn (−0.52516 ± 0.005725 °C; P < 0.001. Correlation between FPD and lactose was 0.35 (P < 0.001. 12% and 5.4% of FPD variability is explainable by lactose and casein variability. Relationship between FPD and urea (U was 0.26 (P < 0.001 in March. The worst FPD was in group with presupposed (according to milk urea and protein combination nitrogen matter (NM and energy (E insufficiency (−0.51855 ± 0.007288 °C. The best FPD was in group with presupposed NM and E surplus in feeding ration (−0.52536 ± 0.004785 °C; P < 0.001. The FPD was worse in suspicion on E deficiency (on the basis of fat/crude protein ratio as compared to presumption for balanced E nourishment of dairy herds (−0.52105 ± 0.006436 °C > −0.52244 ± 0.005367 °C; P < 0.001. Results can improve the estimation of objective FPD–L.

  8. Haptoglobin and serum amyloid A in bulk tank milk in relation to raw milk quality.

    Science.gov (United States)

    Akerstedt, Maria; Waller, Karin Persson; Sternesjö, Ase

    2009-11-01

    The aim of the present study was to evaluate relationships between the presence of the two major bovine acute phase proteins haptoglobin (Hp) and serum amyloid A (SAA) and raw milk quality parameters in bulk tank milk samples. Hp and SAA have been suggested as specific markers of mastitis but recently also as markers for raw milk quality. Since mastitis has detrimental effects on milk quality, it is important to investigate whether the presence of Hp or SAA indicates such changes in the composition and properties of the milk. Bulk tank milk samples (n=91) were analysed for Hp, SAA, total protein, casein, whey protein, proteolysis, fat, lactose, somatic cell count and coagulating properties. Samples with detectable levels of Hp had lower casein content, casein number and lactose content, but higher proteolysis than samples without Hp. Samples with detectable levels of SAA had lower casein number and lactose content, but higher whey protein content than samples without SAA. The presence of acute phase proteins in bulk tank milk is suggested as an indicator for unfavourable changes in the milk composition, e.g. protein quality, due to udder health disturbances, with economical implications for the dairy industry.

  9. Microbiological quality of raw donkey milk from Campania Region

    Directory of Open Access Journals (Sweden)

    Nicola Costanzo

    2012-07-01

    Full Text Available Microbiological quality of raw milk from eight healthy donkeys reared in Campania Region was investigated. A total of 152 samples were analyzed in order to evaluate the milk safety status trough monitoring mesophilic total bacterial count (TBC at 32°C and 20°C, psychrophilic TBC at 5°C, Enterobacteriaceae, Salmonella spp., Listeria monocytogenes, Staphylococcus aureus and somatic cell count (SCC. The ranges for mesophilic bacteria at 32°C, 20°C and psychrophilic bacteria at 5°C were, respectively, 2.80-4.00 Log CFU/mL, 2.84-3.92 Log CFU/mL and 1.27-2.12 Log CFU/mL. Enterobacteriaceae showed a load ranging between 0.68-1.93 Log CFU/mL. No pathogenic bacteria were isolated. Estimated SCC values were always under 50,000 cells/mL. Additionally quantitative changes of bacterial population in raw bulk milk during eight storing days at 8°C and 3°C, were evaluated. Firstly, fresh bulk milk was contaminated by bacteria with a mean TBC at 32°C and 20°C of 2.71 Log CFU/mL and 2.64 Log CFU/mL, respectively, whereas TBC at 5°C and Enterobacteriaceae were not detected. After eight days of storage at 8°C, TBC at 32°C, 20°C and Enterobacteriaceae increased by three Log and TBC at 5°C by five Log. On the other side, after eight days of storage at 3°C no gradual Log increase was detected. Our results showed that donkey milk could be a good healthy ingredient for feeding where good hygienic procedures are applied and storage is kept at temperature lower than 3°C.

  10. Viscosity and Analytical Differences between Raw Milk and UHT Milk of Czech Cows

    Directory of Open Access Journals (Sweden)

    Kumbár V.

    2015-06-01

    Full Text Available Viscosity and analytical differences in four milk samples from Czech cows were described. Three samples of UHT milk (0.5%, 1.5%, and 3.5% fat and one sample of raw milk from a Czech bio-farm were analyzed. The following analytical properties were observed: titratable acidity, fat content, dry matter content, and protein content. Titratable acidity and dry matter content decreased in dependence upon the increasing milk fat content. The protein content ranged 3.51-3.57 g per 100 g milk. The milk flow behaviour represented by density, dynamic and kinematic viscosity, as well as the dependence of the milk flow behaviour on temperature were investigated. These properties were measured using a digital densitometer and a rotary viscometer. Milk density was studied at temperatures ranging 0-60 °C and dynamic viscosity at 0-100 °C. With increasing temperature, the density and dynamic viscosity of the studied milk samples decreased. The temperature dependence of dynamic viscosity was manifested in all samples. Kinematic viscosity was calculated from experimental data. Furthermore, mathematical models using Power law and Gaussian fitting were constructed. Determination coefficients achieved high values (0.843-0.997.

  11. Milk production, raw milk quality and fertility of dromedary camels (Camelus Dromedarius) under intensive management.

    Science.gov (United States)

    Nagy, Péter; Thomas, Sonia; Markó, Orsolya; Juhász, Jutka

    2013-03-01

    In many arid countries, dromedaries play an important role as a milk source in rural areas. However, the milk and meat production potential of this species is not well understood and documented. A large-scale camel dairy farm was established in 2006 in the United Arab Emirates. This study summarises the most important data on milk production, raw milk quality and reproductive efficiency collected on this farm during the first three years of operation. The average daily milk production, the mean length of lactation and the mean total milk production per lactation of 174 dromedaries were 6.0 ± 0.12 kg (± SEM), 586 ± 11.0 days (± SEM) and 3314 ± 98.5 kg (± SEM), respectively. The lactation curve reached its peak during the 4th month after parturition (mean ± SEM, 8.9 ± 0.04 kg), then it declined gradually, falling to 50% of the maximum by the 16th month postpartum (mean ± SEM, 4.3 ± 0.06 kg). Milking three times a day did not increase daily milk production compared to two times milking. Mean total viable bacterial count (TVC) and mean somatic cell count (SCC, ± SEM) of bulk raw camel milk were 4,403 ± 94 CFU/cm3 and 392,602 ± 5,999 cells/cm3 for a one-year period, respectively. There was a significant difference among months (P fat, protein, lactose, total solids (TS) and solid-non-fat (SNF) concentrations of individual milk samples were 2.51 ± 0.03%, 2.60 ± 0.01%, 4.03 ± 0.03%, 9.98 ± 0.03% and 7.56 ± 0.03%, respectively. Lactation period, average daily milk production and morning vs. evening milking significantly influenced milk chemical composition. For the 470 camels in the breeding programme, end-of-season pregnancy rate and birth rate were 87.0% and 82.6%, respectively, after natural mating. We have demonstrated that sustainable milk production is possible from a traditional species, the dromedary camel, under an intensive management system.

  12. Protein carbonylation sites in bovine raw milk and processed milk products.

    Science.gov (United States)

    Milkovska-Stamenova, Sanja; Mnatsakanyan, Ruzanna; Hoffmann, Ralf

    2017-08-15

    During thermal treatment of milk, proteins are oxidized, which may reduce the nutritional value of milk, abolish protein functions supporting human health, especially important for newborns, and yield potentially harmful products. The side chains of several amino acids can be oxidized to reactive carbonyls, which are often used to monitor oxidative stress in organisms. Here we mapped protein carbonylation sites in raw milk and different brands of pasteurized, ultra high temperature (UHT) treated milk, and infant formulas (IFs) after digesting the precipitated proteins with trypsin. Reactive carbonyls were derivatized with O-(biotinylcarbazoylmethyl)hydroxylamine to enrich the modified peptides by avidin-biotin affinity chromatography and analyze them by nanoRP-UPLC-ESI-MS. Overall, 53 unique carbonylated peptides (37 carbonylation sites, 15 proteins) were identified. Most carbonyls were derived from dicarbonyls (mainly glyoxal). The number of carbonylation sites increased with the harsher processing from raw milk (4) to pasteurized (16) and UHT milk (16) and to IF (24). Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Quality of raw milk from a farm with automatic milking system in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2011-01-01

    Full Text Available The aim of this study was to assess the quality of raw cow’s milk from an automatic milking system. Samples of milk (48 were analyzed chemically and microbiologically and the somatic cell count, freezing point and inhibitor residues were determined. For comparison purposes, milk analysis data from two farms using conventional machine milking and 2008 milk analysis report data for the Czech Republic were used. All physical and chemical characteristics of the study samples were within the established limits. The average content (% of chemical indicators was following: fat 3.79 ± 0.18, protein 3.46 ± 0.06, casein 2.67 ± 0.09, lactose 4.82 ± 0.04 and NFS 8.96 ± 0.11. The values for freezing point and somatic cells count were 221 ± 46.103·ml-1 and -0.521 ± 0.003 °C respectively. No inhibitor residue was detected in any of the samples. Microbiological values were lower than the limits: the total microbial count (2.3·104 CFU·ml-1, psychrotrophic count (6.3·103 CFU·ml-1, coliform count (2.4·101 CFU·ml-1, Escherichia coli count (3.2·101 CFU·ml-1, enterococci count (8.5·101 CFU·ml-1 and Staphylococcus aureus count (1.1·101 CFU·ml-1. The study provides a comprehensive view on the quality of milk produced by robotic milking. The automatic milking system seems to be excellent in terms of milking and milk hygiene.

  14. Evaluation of the Influence of Frequency of Milk Collection and Milking Dayshift on the Microbiological Quality of Raw Milk

    Directory of Open Access Journals (Sweden)

    Lucía Reguillo

    2018-01-01

    Full Text Available The aim of this study was to analyze the influence of milk collection frequency (24 h versus 48 h and milking dayshift (morning and evening on total mesophilic aerobic bacteria (MAB and psychrotrophic bacteria (PSY counts in raw milk samples. MAB counts were determined by flow cytometry (BactoScan and PSY counts by the plate counting agar method. An univariate statistical analysis was performed to find out significant differences among the studied factors. Results obtained showed that collecting milk every 24 h was effective in reducing MAB and PSY counts by 32 and 18%, respectively, compared to 48 h milk collection. This positive impact allowed reducing up to 4°C the temperature of the heat treatment in the dairy industry, thus involving energy savings of 22%. Milking during the mornings showed a significant reduction of MAB counts in comparison to milking performed during the evenings (P<0.05. These results are highly useful for the improvement of milk quality through the optimization of collection and milking systems set at primary production.

  15. Validation and application of FTIR spectroscopy in raw milk analysis

    Directory of Open Access Journals (Sweden)

    Kučević Denis S.

    2017-01-01

    Full Text Available The aim of this study was to investigate whether FTIR spectroscopy is an accurate and valid technique for the assessment of quality parameters in raw cow's milk: fat, protein, lactose, and total solids. The assessment was based on calibration series and comparison with reference material. Furthermore, it takes into account the results obtained in the inter-laboratory comparisons (proficiency testing. The calibration samples were purchased from the accredited regional reference laboratories. The validation parameters included linearity, accuracy, repeatability, reproducibility, and robustness. The linearity ratio was 0.95%. The biases calculated for the fat, protein, lactose and dry matter were -0.33, 0.31, -0.25, and 0.06 respectively. The F value from the F-test was used to determine the significant differences between two independent sets of the results. The obtained results were as follows: 1.469 for fat, 1.634 for protein, 1.192 for lactose, and 0.528 for dry matter. The intra-laboratory reproducibility calculated as the Horwitz Ratios for all parameters were within the criterion limits (0.5 to 0.8. The data obtained for carry-over were 0.27% for fat, 0.52% for protein, 0.47% for lactose, and 0.47% for dry matter. Based on the obtained results it can be concluded that the FTIR spectroscopy is a reliable instrumental technique for the determination of fat, protein, lactose and total solids in raw cow's milk.

  16. The effect of raw milk microbial flora on the sensory characteristics of salers-type cheeses

    OpenAIRE

    Callon, Cecile; Berdagué, Jean-Louis; Montel, Marie-Christine

    2005-01-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial cou...

  17. Raw cow’s milk relatively inhibits quorum sensing activity of Cromobacterium violaceum in comparison to raw she-camel’s milk

    Directory of Open Access Journals (Sweden)

    A.A. Moawad

    2011-10-01

    Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.

  18. Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield?

    Science.gov (United States)

    Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin

    2016-12-01

    This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the

  19. Hydrolytic potential of a psychrotrophic Pseudomonas isolated from refrigerated raw milk

    Directory of Open Access Journals (Sweden)

    Ana Paula F. Corrêa

    2011-12-01

    Full Text Available The production of extracellular hydrolases by a psychrotrophic bacterium isolated from refrigerated raw milk, and identified as a Pseudomonas sp. belonging to the Pseudomonas jenssenii group, was studied. This bacterium produced proteolytic and lipolytic enzymes in all media investigated (skim milk, cheese whey, casein broth, and tryptone soy broth. High levels of α-glucosidase were produced in skim milk broth. Hydrolytic enzymes detected in skim milk broth are of particular concern, indicating that these enzymes could be produced by Pseudomonas sp. during the cold storage of raw milk, contributing to the spoilage problem in milk and dairy products.

  20. Allergic reactions to raw, pasteurized, and homogenized/pasteurized cow milk

    DEFF Research Database (Denmark)

    Høst, A; Samuelsson, E G

    1988-01-01

    Five children aged 12-40 months with IgE-mediated adverse reactions to cow milk (immediate onset clinical pattern of cow milk allergy) were orally challenged double-blind in random order with three different milk preparations processed from the same batch of milk 1) raw untreated cow milk, 2......) pasteurized cow milk, 3) homogenized and pasteurized cow milk, and 4) Nutramigen (a commercial hypoallergenic infant formula based on hydrolysed casein) as placebo. Skin prick tests with the same preparations were also performed. On oral challenge the three different processed milk types provoked significant...... and similar allergic reactions in each child, and no adverse reactions followed the challenge with placebo (Nutramigen). Skin prick test with the same milk products were positive in all children and comparable to the results with an extract of purified raw cow milk protein (Soluprick), whereas Nutramigen did...

  1. Proteolysis during ripening of Manchego cheese made from raw or pasteurized ewes' milk. Seasonal variation.

    Science.gov (United States)

    Gaya, Pilar; Sánchez, Carmen; Nuñez, Manuel; Fernández-García, Estrella

    2005-08-01

    Changes in nitrogen compounds during ripening of 40 batches of Manchego cheese made from raw milk (24 batches) or pasteurized milk (16 batches) at five different dairies throughout the year were investigated. After ripening for six months, degradation of p-kappa- and beta-caseins was more intense in raw milk cheese and degradation of alpha(s2)-casein in pasteurized milk cheese. Milk pasteurization had no significant effect on breakdown of alpha(s1)-casein. Hydrophobic peptide content did not differ between raw and pasteurized milk cheese, whereas hydrophilic peptide content was higher in raw milk cheese. There were no significant differences between seasons for residual caseins, but hydrophobic peptides were at a higher level in cheese made in autumn and winter and hydrophilic peptides in cheese made in winter and spring. Raw milk cheese had a higher content of total free amino acids and of most individual free amino acids than pasteurized milk cheese. The relative percentages of the individual free amino acids were significantly different for raw milk and pasteurized milk cheeses. The relative percentages of Lys and lie increased, while those of Val, Leu and Phe decreased during ripening. There were also seasonal variations within the relative percentages of free amino acids. In raw milk cheeses, Asp and Cys were relatively more abundant in those made in autumn, Glu and Arg in cheeses made in winter, and Lys and Ile in cheeses made in spring and summer. Biogenic amines were detected only in raw milk cheese, with the highest levels of histamine, tryptamine and tyramine in cheeses made in spring, winter and spring, respectively.

  2. Prevalence, seasonality, and growth of enterococci in raw and pasteurized milk in Victoria, Australia.

    Science.gov (United States)

    McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M

    2015-12-01

    This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively

  3. Essential elements, cadmium, and lead in raw and pasteurized cow and goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, A.; Collins, W.F.; Williams, H.L.

    1985-08-01

    Fifteen essential elements plus cadmium and lead were determined in raw and pasteurized cow and goat milks by atomic absorption spectrophotometry. When results were compared on a wet weight basis, there were no significant differences between the raw and pasteurized milks except for cobalt, iron, and lead in goat milk. When copper in goat milk was expressed on a dry weight basis, there was a significant difference between raw and pasteurized milk. There were significantly higher amounts of cobalt, copper, iron, lead, magnesium, and phosphorus, wet weight basis, in pasteurized goat milk than in pasteurized cow milk. Significantly more nickel and sodium were in pasteurized cow milk. No difference in the content of chloride, calcium, potassium, and zinc was significant between the two milks. When dry weights of the two milks were compared, statistical differences were the same, except there was significantly more calcium and potassium in pasteurized cow milk than in pasteurized goat milk and there were no significant differences in the content of lead and phosphorus between the two milks. Percentages of the established and estimated recommended daily allowances show both cow and goat milk to be excellent sources of calcium, phosphorus, and potassium and fair sources of iron, magnesium, and sodium.

  4. The continuing debate over increasing consumption of raw (unpasteurised) milk: is it safe?

    DEFF Research Database (Denmark)

    Jordan, K. N.; Hunt, K.; Hoorfar, Jeffrey

    2012-01-01

    The debate on the consumption of raw (unpasteurised) milk continues. On one side there is the risk of illness associated with pathogenic bacteria that may be in the milk, a risk that can be mitigated by pasteurisation of the milk prior to consumption. On the other side, there are those who believ...

  5. Tick-borne Encephalitis Associated with Consumption of Raw Goat Milk, Slovenia, 2012

    Science.gov (United States)

    Hudopisk, Neda; Korva, Miša; Janet, Evgen; Simetinger, Marjana; Grgič-Vitek, Marta; Gubenšek, Jakob; Natek, Vladimir; Kraigher, Alenka; Strle, Franc

    2013-01-01

    Tick-borne encephalitis (TBE) developed in 3 persons in Slovenia who drank raw milk; a fourth person, who had been vaccinated against TBE, remained healthy. TBE virus RNA was detected in serum and milk of the source goat. Persons in TBE-endemic areas should be encouraged to drink only boiled/pasteurized milk and to be vaccinated. PMID:23697658

  6. Raw bovine milk improves gut responses to feeding relative to infant formula in preterm piglets

    DEFF Research Database (Denmark)

    Li, Yanqi; Jensen, Mikkel Lykke; Chatterton, Dereck Edward Winston

    2014-01-01

    For preterm neonates, the quality of the first milk is crucial for intestinal maturation and resistance to necrotizing enterocolitis (NEC). Among other factors, milk quality is determined by the stage of lactation and processing. We hypothesized that unprocessed mature bovine milk (BM, raw bovine...

  7. CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK

    Directory of Open Access Journals (Sweden)

    Lukáčová Anetta

    2012-10-01

    Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.

  8. Aflatoxin M1 levels in raw milk, pasteurised milk and infant formula

    Directory of Open Access Journals (Sweden)

    Sharaf S. Omar

    2016-06-01

    Full Text Available The incidence of contamination of aflatoxin M1 (AFM1 in milk samples collected from the Jordanian market was investigated by using the competitive enzyme linked immunosorbent assay (ELISA technique. A total of 175 samples were collected during 2014-2015. All tested samples were contaminated with various levels of AFM1 ranging from 9.71 to 288.68 ng/kg. The concentration of AFM1 in 66% of fresh milk samples was higher than the maximum tolerance limit accepted by the European Union (50 ng/kg and 23% higher than the maximum tolerance limit accepted by the US (500 ng/kg. Percentages of contaminated raw cow, sheep, goat and camel milk exceeding the European tolerance limit were 60, 85, 75 and 0%, respectively. Of AFM1 contaminated pasteurised cow milk samples, 12% exceeded the European tolerance limit with a range of contamination between 14.60 and 216.78 ng/kg. For infant formula samples, the average concentration of AFM1 was 120.26 ng/kg (range from 16.55 to 288.68 ng/kg, the concentration of AFM1 in 85% of infant formula samples was higher than the maximum tolerance limit accepted by the European Union and the US (25 ng/kg.

  9. Survey of Veterinary Drug Residues in Raw Milk in Hebei Province, China.

    Science.gov (United States)

    Han, Rong-Wei; Yu, Zhong-Na; Zhen, Tian-Yuan; Wang, Jun

    2017-10-17

    The objective of this study was to investigate the occurrence of veterinary drug residues in raw milk from Hebei, the second-largest dairy production province in the People's Republic of China. A total of 192 raw milk samples were collected from 64 milk stations in seven districts. Twenty-eight veterinary drug residues were analyzed by ultraperformance liquid chromatography with tandem mass spectrometry based on a China National Standard. Raw milk samples with multiple residues of veterinary drugs were not found in the present study. Residues of four veterinary drugs, penicillin G, sulfacetamide, trimethoprim, and lincomycin, were detected in 12 (6.25%) raw milk samples, with detection ratios of 1.04, 0.52, 3.13, and 1.56%, respectively. All veterinary drug residues detected were under the maximum residue levels as regulated by China, the European Union, the United States, and the Codex Alimentarius Commission. In general, raw milk from Hebei province was considered relatively safe for human consumption because of the low prevalence of veterinary drug residues. However, stringent control measurements for veterinary drug residues in raw milk are required because some veterinary drugs were detected in milk from some areas of Hebei province.

  10. Comparison of the in vitro digestion of raw pasture milk and commercial HTST and UHT pasteurized milk

    Science.gov (United States)

    Consumption of raw milk from pasture-fed cows, typically purchased at local farms, is steadily increasing in the US because many consumers believe that high-temperature short-time (HTST) or ultrahigh temperature (UHT) pasteurization affects the digestibility of milk proteins and thus the bioavailabi...

  11. Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe

    2013-11-01

    Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.

  12. Determining the source of Bacillus cereus and Bacillus licheniformis isolated from raw milk, pasteurized milk and yoghurt.

    Science.gov (United States)

    Banykó, J; Vyletelová, M

    2009-03-01

    Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.

  13. Raw and Heat-Treated Milk: From Public Health Risks to Nutritional Quality

    Directory of Open Access Journals (Sweden)

    Francesca Melini

    2017-11-01

    Full Text Available Consumers have recently shown a preference for natural food products and ingredients and within that framework, their interest in consuming raw drinking milk has been highlighted, claiming nutritional, organoleptic and health benefits. However, a public debate has simultaneously emerged about the actual risks and benefits of direct human consumption of raw milk. This paper compares the microbiological, nutritional and sensory profile of raw and heat-treated milk, to evaluate the real risks and benefits of its consumption. In detail, it provides an updated overview of the main microbiological risks of raw milk consumption, especially related to the presence of pathogens and the main outputs of risk assessment models are reported. After introducing the key aspects of most commonly used milk heat-treatments, the paper also discusses the effects such technologies have on the microbiological, nutritional and sensory profile of milk. An insight into the scientific evidence behind the claimed protective effects of raw milk consumption in lactose-intolerant subjects and against the onset of asthma and allergy disorders in children is provided. The emergence of novel milk processing technologies, such as ohmic heating, microwave heating, high pressure processing, pulsed electric fields, ultrasound and microfiltration is also presented as an alternative to common thermal treatments.

  14. Raw milk from vending machines: Effects of boiling, microwave treatment, and refrigeration on microbiological quality.

    Science.gov (United States)

    Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena

    2014-01-01

    In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. The raw milk quality from organic and conventional agriculture

    Directory of Open Access Journals (Sweden)

    Juraj Čuboň

    2008-01-01

    Full Text Available In the experiment the parameters of milk quality from organic and conventional dairy farm were analyzed. The number of somatic cells was 219. 103 . ml−1 in the organic milk and 242. 103 . ml−1 in the conventional milk. It seems that conditions of organic farming could be able to have a positive effect of health of mammary gland. We found the highest number of somatic cells at the end of the year (336.103 . ml−1 in organic milk in December, respectively 336.103 . ml−1 in conventional milk in November. The total bacteria count was higher in organic milk (86.103 CFU . ml−1 than conventional (51.103 CFU . ml−1 likewise the number of coliform bacteria. Number of coliform bacteria was by conventional milk under 1000 CFU . ml−1 for all samples. The highest number of coliform bacteria in organic milk was achieved in February (1000 CFU . ml−1. We found higher content of fat (4.23 g . 100g−1 and protein (3.41 g . 100g−1 by organic milk in comparison with the conventional milk (4.11 g . 100g−1, resp. 3.39 g . 100g−1. The higher content of protein and fat in organic milk and the higher protein content in conventional milk were determined in December. The heat resistance was determined by 96 % ethanol required to coagulation of 2 ml of milk. The conventional milk has significantly lower heat resistance (1.38 ml than the organic one (1.86 ml. Better heat stability by organic milk and higher content of Ca (144.29 mg . 100g−1 correspond with higher technological quality of organic milk.

  16. Short communication: Microbial quality of raw milk following commercial long-distance hauling.

    Science.gov (United States)

    Darchuk, Emily M; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy

    2015-12-01

    Hauling is a critical part of the commercial milk supply chain, yet very few studies have aimed to understand its effect on raw milk quality. This study focused on the effect of extended-duration tanker use during hauling on raw milk quality at a commercial facility. Standard tanker use [cleaned-in-place (CIP) once per 24h] served as a control and an incremental between-load water rinse with sanitizer treatment (RS) was evaluated to mitigate any effect from extended duration hauling. During this study, 1 commercial truck with 2 trailers was monitored for 10d. The truck collected milk at a large dairy farm, transported the milk to a manufacturing facility, and then returned to the same farm for a second load. Each round-trip journey took between 10 and 12h, allowing for 2 loads per 24-h use period. Following the second delivery, the truck was cleaned by CIP treatment starting a new treatment day. Producer samples were collected from the raw milk bulk tank on the farm before loading milk into the tanker. The same milk was sampled directly out of the tanker truck before unloading at the manufacturer. Effect on individual bacteria count, thermophilic spore count, and preliminary incubation count was quantified through common industry tests. Surface sponge swabs were also used to monitor tanker sanitation and the efficacy of cleaning treatments. Results did not identify a negative effect on raw milk quality due to extended duration hauling. Whereas the addition of RS did not provide any measurable quality benefits for the microbial milk quality, swab results demonstrated that the RS treatment was able to reduce surface bacteria in the tanker, although not to the same level as the full CIP treatment. Based on this study, current CIP practices for long distance milk hauling appear to be effective in mitigating any measurable effect on raw milk quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... The composition of milk is of most importance to the dairy industry and human health. ... fraction was lower in yoghurt while Fe, Cu and Mn levels were lower in ... elements and water. ... blems result to the deterioration of fresh milk before ... milk was heated to boiling to destroy the pathogenic organisms at.

  18. Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China

    Directory of Open Access Journals (Sweden)

    Li Aijun

    2016-01-01

    Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.

  19. "Don't Have A Cow, Man!": Recognizing Herd Share Agreements for Raw Milk.

    Science.gov (United States)

    Mayer, Timothy J

    2015-01-01

    Dissatisfaction with the industrial model of food production has caused many consumers to seek out food produced on local, family-scale farms that use U.S. Department of Agriculture certified organic or other sustainable practices to grow their food and raise their livestock. While almost all of the types of food that are available at the grocery store can also be found at the local farmers market, one food that is difficult to find in many states is raw milk—that is, milk that has not undergone pasteurization (heat treatment). This difficulty lies in the fact that most states prohibit the direct retail sale of raw milk to the final consumer because public health officials and state legislators fear that raw milk may contain bacteria harmful to human health such as E. coli, Campylobacter, and Listeria. However, some consumers reject these warnings and instead believe that raw milk possesses both nutritional and medicinal qualities. Indeed, an ever-increasing body of scientific research published in peer-reviewed journals supports the claim that raw milk consumption can mitigate or prevent some allergies and infections, especially in young children. In order for consumers to obtain raw milk in states where its sale is prohibited, some consumers have entered into arrangements with farmers known as “herd sharing,” through which the consumer effectively becomes an owner of the herd of cows or goats. For the price of the share and a monthly boarding fee, the shareholder can receive a weekly distribution of the herd’s primary dividend, namely the raw milk. Several states expressly permit this practice while most are silent and still a few prohibit it outright. The three courts in the United States that have ruled on herd share agreements have split, with two courts rejecting the agreements as a circumvention of the state’s prohibition on the sale of raw milk, and the other court assuming the agreement’s validity in light of the state’s failure to adequately

  20. Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

    OpenAIRE

    Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.

    2012-01-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...

  1. Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

    Directory of Open Access Journals (Sweden)

    afshin Nazari

    2007-10-01

    Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

  2. Effects of home-made boiling of bovine raw milk on its microbiological quality

    Directory of Open Access Journals (Sweden)

    Giampaolo Colavita

    2012-10-01

    Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.

  3. Effect of raw milk on lactose intolerance: a randomized controlled pilot study.

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D

    2014-01-01

    This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.

  4. Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.

    2014-01-01

    PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309

  5. Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

    Science.gov (United States)

    Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

    2017-07-01

    Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

  6. Comparative analysis of the microbial communities in raw milk produced in different regions of Korea.

    Science.gov (United States)

    Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung

    2017-11-01

    The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.

  7. Fatty acid profile and health lipid indices in the raw milk of ...

    African Journals Online (AJOL)

    qw-k

    2015-02-26

    Feb 26, 2015 ... in the raw milk of Simmental and Holstein-Friesian cows from an organic farm. ... as an important source of energy, high-quality protein and essential ... Nevertheless, inter-breed differences in the milk fat composition were ...

  8. Draft Genome Sequence of Bacillus sp. FMQ74, a Dairy-contaminating Isolate from Raw Milk

    DEFF Research Database (Denmark)

    Okshevsky, Mira Ursula; Regina, Viduthalai R.; Marshall, Ian

    2017-01-01

    Representatives of the genus Bacillus are common milk contaminants that cause spoilage and flavor alterations of dairy products. Bacillus sp. FMQ74 was isolated from raw milk on a Danish dairy farm. To elucidate the genomic basis of this strain’s survival in the dairy industry, a high-quality draft...

  9. Towards a decision support system for control of multiple food safety hazards in raw milk production

    NARCIS (Netherlands)

    Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.

    2013-01-01

    Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw

  10. THE DIRECT SALE OF RAW MILK: PREVALENCE OF PATHOGENS IN RAW MILK AND BOVINE FAECES COLLECTED IN FARMS WITHIN THE PROVINCE OF PESARO-URBINO

    Directory of Open Access Journals (Sweden)

    F. Tonucci

    2009-09-01

    Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.

  11. ELECTROLYTE AND MINERAL COMPOSITION OF TERM DONOR HUMAN MILK BEFORE AND AFTER PASTEURIZATION AND OF RAW MILK OF PRETERM MOTHERS.

    Science.gov (United States)

    Codo, Carla Regina Bianchi; Caldas, Jamil Pedro de Siqueira; Peixoto, Rafaella Regina Alves; Sanches, Vitor Lacerda; Guiraldelo, Tamara Cristina; Cadore, Solange; Marba, Sérgio Tadeu Martins

    2018-02-22

    To determine and compare the concentrations of electrolytes and minerals in three different types of maternal milk samples: term donor milk before pasteurization, term donor milk after pasteurization and raw milk of mothers of preterm newborns at bedside. Descriptive cross-sectional study. Concentrations of calcium (Ca), phosphorous (P), magnesium (Mg), sodium (Na) and potassium (K) were measured in random samples of three human breast milk groups. Samples were analyzed using acid mineralization assisted by microwave radiation and further analysis by inductively coupled plasma optical emission spectrometry. Concentrations were expressed in mg/L, described as mean and standard deviation. The one-way ANOVA and Tukey's post-test were applied to determine the variability between the means of each group. Significance level was set at 5%. There was a significant reduction in the content of Ca (259.4±96.8 vs. 217.0±54.9; p=0.003), P (139.1±51.7 vs. 116.8±33.3; p=0.004) and K (580.8±177.1 vs. 470.9±109.4; ppasteurization. Samples of raw milk presented higher contents of Na than the donated milk (twice). The elements P and Ca would only reach the daily intake levels recommended by the European Society of Pediatric Gastroenterology, Hepatology and Nutrition if at least 60 mL of milk could be offered every 3 hours. Mg levels were not different between the three groups. There was a significant reduction in Ca, P and K levels in samples after pasteurization. The Na value in raw milk, collected at bedside, was higher than in the samples of donor's milk before pasteurization.

  12. RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2010-06-01

    Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.

  13. Gravity separation of fat, somatic cells, and bacteria in raw and pasteurized milks.

    Science.gov (United States)

    Caplan, Z; Melilli, C; Barbano, D M

    2013-04-01

    The objective of experiment 1 was to determine if the extent of gravity separation of milk fat, bacteria, and somatic cells is influenced by the time and temperature of gravity separation or the level of contaminating bacteria present in the raw milk. The objective of experiment 2 was to determine if different temperatures of milk heat treatment affected the gravity separation of milk fat, bacteria, and somatic cells. In raw milk, fat, bacteria, and somatic cells rose to the top of columns during gravity separation. About 50 to 80% of the fat and bacteria were present in the top 8% of the milk after gravity separation of raw milk. Gravity separation for 7h at 12°C or for 22h at 4°C produced equivalent separation of fat, bacteria, and somatic cells. The completeness of gravity separation of fat was influenced by the level of bacteria in the milk before separation. Milk with a high bacterial count had less (about 50 to 55%) gravity separation of fat than milk with low bacteria count (about 80%) in 22h at 4°C. Gravity separation caused fat, bacteria, and somatic cells to rise to the top of columns for raw whole milk and high temperature, short-time pasteurized (72.6°C, 25s) whole milk. Pasteurization at ≥76.9°C for 25s prevented all 3 components from rising, possibly due to denaturation of native bovine immunoglobulins that normally associate with fat, bacteria, and somatic cells during gravity separation. Gravity separation can be used to produce reduced-fat milk with decreased bacterial and somatic cell counts, and may be a critical factor in the history of safe and unique traditional Italian hard cheeses produced from gravity-separated raw milk. A better understanding of the mechanism of this natural process could lead to the development of new nonthermal thermal technology (that does not involve heating the milk to high temperatures) to remove bacteria and spores from milk or other liquids. Copyright © 2013 American Dairy Science Association. Published by

  14. Comparing the sensitizing capacity of raw and processed cow's milk in a murine sensitization model for food allergy

    NARCIS (Netherlands)

    Abbring, S.; Diks, M.A.P.|info:eu-repo/dai/nl/372617298; Dingjan, G.M.; Baars, T.; Garssen, J.|info:eu-repo/dai/nl/086369962; Van Esch, B.C.A.M.|info:eu-repo/dai/nl/304839256

    2016-01-01

    Background: Epidemiological studies show that the consumption of raw milk early in life is protective against the development of allergies later in life. The effect was found to be limited to raw milk consumption and was not observed when this milk was boiled or when pasteurized and homogenized shop

  15. Microbiological Quality of Raw Goat Milk in Bogor, Indonesia

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2011-08-01

    Full Text Available Milk samples were investigated for counts and prevalence of indicator bacteria, which were TPC, coliforms, coagulase positive Staphylococci (CPS, and coagulase negative Staphylococci (CNS. Ten potential risk factors were also evaluated in relation to the prevalence of indicator bacteria. The results showed that the median values of indicator bacterial counts from overall udder-half milk samples were 3.74, 0.70, 1.70, and 2.52 log cfu/ml and from bulk milk samples were 5.69, 2.98, 3.66 and 3.32 log cfu/ml for TPC, coliforms, CPS, and CNS, respectively. None of the median values of overall udder-half milk samples exceeded the maximum limit of the standards for all indicator bacteria. However, in the bulk milk samples only the median value of TPC below the maximum limit of the standards. Overall prevalence of coliforms, CPS and CNS from udder-half milk samples were 46.3%, 37.7%, and 66.0%, respectively, and from bulk milk samples were 86.7%, 76.7%, and 86.7%, respectively. Saanen crossbreed, fifth parity and udders with inflammation were found to be risk factors. This study results indicated that the hygienic practices in the dairy goat farms are still need to be increased. To increase the hygienic level of the milk, the identified significant risk factors must be controlled.

  16. Bacterial contaminations of informally marketed raw milk in Ghana ...

    African Journals Online (AJOL)

    Background: Milk has an outstanding nutritional quality but is also an excellent medium for bacterial growth and an important source of bacterial infection when consumed without pasteurization. Objective: To estimate the bacterial health risk of milk consumption in Accra and Kumasi, the twomajor cities in Ghana. Method: A ...

  17. Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar

    Directory of Open Access Journals (Sweden)

    A.R Barami

    2012-02-01

    Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p

  18. Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source

    Directory of Open Access Journals (Sweden)

    T Moshtaghi Maleki

    2015-11-01

    Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.

  19. Short communication: The effect of raw milk cooling on sensory perception and shelf life of high-temperature, short-time (HTST)-pasteurized skim milk.

    Science.gov (United States)

    Lee, A P; Barbano, D M; Drake, M A

    2016-12-01

    The cooling rate of raw milk may influence sensory properties and pasteurized shelf life. Under the Pasteurized Milk Ordinance for grade A milk, raw milk may be cooled instantaneously by on-farm heat exchangers but is also acceptable if "cooled to 10°C or less within four (4) hours of the commencement of the first milking." The objective of this study was to determine the effect of raw milk cooling on consumer perception and shelf life. Raw milk (18-21°C) was obtained and transported within 1h of milking to North Carolina State University (Raleigh). The batch of raw milk was split in 2 portions, and a plate heat exchanger was used to quickly cool one portion to <6°C within 1min. The second portion was stored in a jacketed bulk tank and slowly cooled over 4h to <10°C. Milk from 3 consecutive milkings was collected every 12h, with subsequent milkings added to the previous collections. The bulk milk was kept below 10°C while adding milk for the slow cool milk treatment. After 72h, each whole milk was separated; the skim milk was pasteurized at 73 or 78°C for 20 s, homogenized, and held at 4°C. Difference tests (n=75) and consumer acceptance tests (n=100) were conducted to determine if consumers could detect differences among milks. Descriptive analysis and microbial testing for aerobic, psychrotrophic, and psychrotolerant spore counts were conducted through shelf life. The entire experiment was repeated in triplicate. Raw milks averaged 3.3 logcfu/mL by aerobic plate count, <25cfu/mL coliforms, somatic cell count of 300,000 cells/mL, and 3.15±0.07% protein. Psychrotolerant spores were not found in the raw milk. Consumers could not detect differences between cooling treatments of the same pasteurization temperature or between different temperatures of the same cooling treatment. Milks reached sensory failure 49±4d on average after processing, and aerobic counts were between 5 to 7 logcfu/mL. Cooling treatment had no effect on shelf life. These results suggest

  20. The freezing point of raw and heat treated sheep milk and its variation during lactation

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2013-01-01

    Full Text Available The freezing point of milk is an important indicator of the adulteration of the milk with water, but heat treatment may also affect its value. The aim of this study was determine freezing point of raw and heat treated sheep milk and its variation during lactation. The freezing point was determined in 42 bulk tank raw sheep milk samples and 42 pasteurized milk samples collected during lactation of sheep at one ecofarm in Moravian Walachia (Valašsko in the Czech Republic. The freezing point was determined in accordance with the standard ČSN 57 0538 using a thermistor cryoscope. The average freezing point of raw milk was -0.617 ± 0.052 °C, with a range from -0.560 to -0.875 °C. The freezing point was lower in the first months of lactation and increased at the end of lactation. The freezing point correlated (r = 0.8967 with the content of total non-fat solids. The average freezing point of sheep milk pasteurized at 65 °C for 30 min was -0.614 ± 0.053 °C, with a range from -0.564 to -0.702 °C. The median of freezing point differences between raw and pasteurized milk was 0.004 °C. Our study extends data about physico-chemical properties of sheep milk and registers for the first time specific changes in the freezing point value of sheep milk by heating.

  1. Short communication: Microbiological quality of raw cow milk and its association with herd management practices in Northern China.

    Science.gov (United States)

    Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q

    2017-06-01

    Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... cribed as being almost a complete food for man. It contains carbohydrates, protein ... For centuries, milk production in Cameroon has been characterized by a ...... and maintenance of the human body. (FAO/WHO/UNU, 2007).

  3. Assessment of the application of an automated electronic milk analyzer for the enumeration of total bacteria in raw goat milk.

    Science.gov (United States)

    Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A

    2011-07-01

    Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d

  4. CONTRIBUTION TO THE DEBATE ON THE MICROBIOLOGICAL QUALITY OF RAW MILK FROM VENDING MACHINES

    Directory of Open Access Journals (Sweden)

    Ján Šnelcer

    2011-07-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE MicrosoftInternetExplorer4 Microbiological quality or raw milk from vending maschine was analyzed in this work. Despite the pathogenic bacteria may be present in raw milk, the analyses and evaluations were focused to bacterial indicators only. Refer to total bacterial counts, the criterion ≤ 100,000 cfu/ml met 12 from 15 samples (80% and all samples complied with the supplementary criterion of 5×104 cfu/ml for psychrotrophs. Numbers of coagulase-positive staphylococci ranged closely around the average value 2.9×102 cfu/ml. Average numbers of coliforms and E. coli in raw milk were found 4.34 ± 0.42 and 3.25 ± 0.83 log CFU/ml, respectively. These values significantly exceeded even the limits applicable in the past. On the basis of unchanged numbers of these bacteria in milk after 24 h at 6 °C, we assume that the high numbers of coliforms and E. coli present in milk are the result of fecal contamination and not growth. As E. coli is an indicator of faecal contamination of raw milk comprising the possible presence of Salmonella sp. Campylobacter sp. and other pathogens, microbiological survey suggested appropriate preventive measures that should be applied in terms of risk management.doi:10.5219/98

  5. Proteolytic and lipolytic microbiota of refrigerated raw milk from northeast and southern regions of Brazil

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2015-12-01

    Full Text Available The shelf life of milk and milk derivatives is directly related to the microbiological quality of refrigerated raw milk. Spoilage microorganisms with proteolytic and/or lipolytic properties are primarily responsible for the decrease in the quality of milk, which is reflected in the shelf life of pasteurized milk and all derivatives. The aim of this study was to determine the spoilage microbial load of refrigerated raw milk from the northeast and southern regions of Brazil, which have different climatic and technological conditions of production. We evaluated 46 samples of milk from the state of Paraná in the southern region, and 10 samples of milk from the state of Maranhão in the northeast region, totaling 56 samples collected from November 2013 to November 2014. The producers of Paraná were divided into large (20 or small (26 according to the average daily production. All producers of Maranhão were considered small (<500L/day. The proteolytic and lipolytic microorganism counts were conducted in milk agar and tributyrin agar, respectively. Milk from the large producers of Paraná had average counts of 1.4 × 104 CFU/mL for proteolytic microorganisms and 1.2 × 103 CFU/mL for lipolytics microorganisms, significantly (p <0.05 lower than the small producers in the same state, and the producers of Maranhão. Producers of Maranhao had counts of 1.1 × 105 CFU/mL for proteolytic microorganisms and 2 × 105 CFU/mL for lipolytic microorganisms, with the proteolytic count significantly lower than that of small Paraná producers. The amount of proteolytic and lipolytic spoilage microorganisms in milk is influenced by the adaptation of the microorganisms to cold, promoted by the cooling of milk, which is practiced less frequently in the country’s northeastern region. The amount of spoilage microorganisms is also affected by the implementation of milking hygiene practices, which reduce contamination. Such practices are more frequently and efficiently

  6. Assessment of Raw Cow Milk Quality in Smallholder Dairy Farms in Pemba Island Zanzibar, Tanzania

    Directory of Open Access Journals (Sweden)

    S. H. Gwandu

    2018-01-01

    Full Text Available Milk quality depends on the physicochemical characteristics, hygienic standards, and nutritional quality; however, animal husbandry practices, unhygienic harvesting and processing, may affect its quality. A cross-sectional study was conducted between August 2010 and July 2011 to assess the hygiene of cow milk production environment, raw cow milk physicochemical characteristics, and microbial quality and estimate the prevalence of antimicrobial residues using standard methods in Pemba Island. A total of 98 raw cow milk samples from selected smallholder dairy farms were analyzed, and the judgement on the quality used the East African Standards. Generally, the milk production chain was done under the unhygienic condition, and dirty plastic containers were used for collection and storage of milk under room temperature. Some milk samples had abnormal colour (2.1%, abnormal smell (7.1%, and pH below normal (35.7%, clotted on alcohol test (9.2%, and had the specific gravity below normal (13.3%. All the milk samples had mineral contents within the recommended range. Milk samples with butterfat below normal were 29.6%, while 14.3% had total solids below recommended values. The mean total viable count (TVC of milk container surfaces was 9.7±10.5 log CFU/100 cm2, while total coliform count (TCC was 7.8±8.5 log CFU/100 cm2. Up to 55.1% of milk had TVC beyond the recommended levels. The milk mean TVC was 11.02±11.6 log CFU/ml and TCC was 6.7±7.3 log CFU/ml. Up to 26.5% of milk samples had the TCC beyond levels. Results on physicochemical characteristics and nutritional analysis show that the raw cow milk in Pemba Island is of inferior quality. Microbiological results of this study imply heavy contaminations of milk. Antimicrobial residues were detected in 83% of the samples and most of them were from Wete District. Unhygienic milk production chain accelerates microbial contaminations, and antimicrobial residues in milk are a big

  7. Food safety in raw milk production: risk factors associated to bacterial DNA contamination.

    Science.gov (United States)

    Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos

    2014-06-01

    While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

  8. Impact of applying hygienic practices at farm on bacteriological quality of raw milk

    Directory of Open Access Journals (Sweden)

    N. Pandey

    2014-09-01

    Full Text Available Aim: The present study was carried out to explore the potential source of contamination and the efficacy of different washing practices towards quality milk production. Materials and Methods: Probable sources of contamination viz. stored water, potable water, milker’s hands, milking pail, udder of individual buffalo and milk cans were subjected to different types of bacterial counts before the actual experiment to start. Twenty milch buffaloes thereafter were divided randomly into four treatment groups where washing was performed in each step viz. milker hands, udder of individual buffalo, milking pail and milk cans before milking either with water (T0: stored water, T1: potable water or sanitizers (T2: 200 ppm chlorine solution, T3: 50 ppm iodophore solution for 60 days. Bacterial counts again were performed for last 5 alternate days for all the sources involved along with the microbial load of raw milk. Data obtained were subjected to standard statistical analysis. Results: It was found that for all bacterial count stored water contributed significantly higher as compared to the potable water. Among the other potential sources of contamination (log/6 cm2, standard plate count (SPC and coliform count were significantly highest for milking pail (6.73±0.02 and udder of milch buffaloes (3.77±0.12, respectively, while for Staphylococci count both milking pail (3.24±0.02 and milking can (3.22±0.04 were contributed maximally (p0.05 for most of the parameters, even for the raw milk quality. Conclusion: Study revealed that milker hands, milking pails, udder of animals, milk cans and stored water used for washing of equipment are the potential source of contamination in raw milk. These were counted as critical point which needs attention for the production of high-quality milk. Potable water was found to be better than stored water. The use of either chlorine 200 ppm and iodophor 50 ppm is highly effective in reducing the bacterial population for

  9. Escherichia coli O26 IN RAW BUFFALO MILK: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    A. Rella

    2013-02-01

    Full Text Available Escherichia coli O26 is considered to be one of the most important food-borne pathogen. In this study, 120 buffalo milk samples collected in Lazio and in Apulia regions were tested for the presence of E. coli O26. One buffalo milk sample (0,8% tested positive for E. coli O26; the isolate was positive at the verocytotoxicity test and it showed resistance properties to different antimicrobial classes. These preliminary results highlight the need to monitor the foods of animal origin used for production and eaten by a wide range of persons, respect VTEC organism.

  10. Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.

    Science.gov (United States)

    Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A

    2012-08-01

    A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.

  11. Importance of Decision Support Systems About Food Safety in Raw Milk Production

    Directory of Open Access Journals (Sweden)

    Ecem Akan

    2015-12-01

    Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.

  12. Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.

    Science.gov (United States)

    Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J

    2008-04-01

    Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.

  13. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    Staphylococcus aureus causes foodborne diseases if consumed in contaminated milk products. Rapid detection and characterization of foodborne pathogen S. aureus is crucial for epidemiological investigations and food safety surveillance. It is still a challenge to detect and identify bacterial pathogens quickly and ...

  14. Proteolysis produced within biofilms of bacterial isolates from raw milk tankers.

    Science.gov (United States)

    Teh, Koon Hoong; Flint, Steve; Palmer, Jon; Andrewes, Paul; Bremer, Phil; Lindsay, Denise

    2012-06-15

    In this study, six bacterial isolates that produced thermo-resistant enzymes isolated from the internal surfaces of raw milk tankers were evaluated for their ability to produce proteolysis within either single culture biofilms or co-culture biofilms. Biofilms were formed in an in vitro model system that simulated the upper internal surface of a raw milk tanker during a typical summer's day of milk collection in New Zealand. The bacterial isolates were further evaluated for their ability to form biofilms at 25, 30 and 37°C. Mutual and competitive effects were observed in some of the co-culture biofilms, with all isolates being able to form biofilms in either single culture or co-culture at the three temperatures. The proteolysis was also evaluated in both biofilms and corresponding planktonic cultures. The proteolysis per cell decreased as the temperature of incubation (20-37°C) increased. Furthermore, mutualistic interactions in terms of proteolysis were observed when cultures were grown as co-culture biofilms. This is the first study to show that proteolytic enzymes can be produced in biofilms on the internal surfaces of raw milk tankers. This has important implications for the cleaning and the temperature control of raw milk transport tankers. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Selected abiotic factors that influence raw cow milk freezing point depression

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2012-01-01

    Full Text Available Freezing point depression (FPD is an important property of milk that is influenced primarily by milk components connected to osmotic pressure. Under certain conditions it is possible to detect the addition of water to milk. It is necessary to have the right FPD limit in legislation for milk quality control. The aim of this study was to improve the estimation procedure of this limit. Apart from factors related to dairy cow nutrition, cattle breed and milk yield, it is important to take into account CO2 (6%, water steam evaporation and pasteurization under technological conditions. Bulk milk samples (1, 30, 6, 6, 10, 1 according to experiment from Holstein and Czech Fleckvieh breed (1:1 were used in the experiments and technologically treated. The effects of water addition (water saturated and unsaturated by CO2, carbon dioxide evaporation and pasteurization (80 °C for 22 min were quantified. Pasteurization aggravation of FPD was -0.00394 ± 0.00171 ºC (P P < 0.001 depending on practice. Increase in FPD is recorded after milking during technological procedures of milk storage, mixing, pumping, transport shaking and warming. During FPD shift, the acuteness of FPD data sets increases. This fact should be considered in the process of deriving standard raw cow milk FPD limits. Similar experimental analysis of milk FPD technological shifts has not been performed in this way until now.

  16. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  17. Effect of medicinal plants, Heavy metals and antibiotics against pathogenic bacteria isolated from raw, Boiled and pasteurized milk.

    Science.gov (United States)

    Ali, Nazish Mazhar; Sarwar, Khadija; Mazhar, Syed Abdullah; Liaqat, Iram; Andleeb, Saiqa; Mazhar, Bushra; Kalim, Bushra

    2017-11-01

    Present study has been undertaken to isolate and identify the bacterial flora in raw, boiled and pasteurized milk. Agar disc diffusion method was used to determine their sensitivity using medicinal plants, antibiotics and heavy metals. Methylene blue reduction test was used to test the quality of milk samples. Total 10 pathogenic strains were isolated, five strains were isolated from raw milk, three from boiled milk and 2 two from pasteurized milk. To determine optimum conditions for growth, these pathogenic microorganisms were incubated at various temperatures and pH. Gram's staining and biochemical tests revealed that these pathogenic bacteria include Lactobacillus sp., E. coli, Salmonella sp., Pseudomonas sp., Streptococcus sp. and Staphylococcus. Ribotyping revealed S2 as Pseudomonas fluorescens, S5 as Lactococcus lactis and S9 as Lactobacillus acidophilus. Prevalence of pathogenic organisms provided the evidence that contamination of milk arises during milking, transportation and storage of milk. Raw milk is more contaminated than other two types of milk because it contains highest percentage of pathogenic organisms and pasteurized milk was found to be of best quality among three types. So it is recommended to drink milk after proper boiling or pasteurization. Proper pasteurization and hygienic packing of milk is essential to minimize contamination in milk which can save human beings from many milk borne diseases. Our study suggests that antimicrobial use in animal husbandry should be minimized to reduce the hazard of antibiotic resistance. Plant extracts are better alternative against pathogenic bacteria in milk.

  18. Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil

    Directory of Open Access Journals (Sweden)

    Helena Fagundes

    2010-06-01

    Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.

  19. Detection of Listeria in raw milk in Syria

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Abou-Younes, A.

    2010-01-01

    The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)

  20. Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco.

    Science.gov (United States)

    Bendahou, Abdrezzak; Lebbadi, Mariam; Ennanei, Latifa; Essadqui, Fatima Z; Abid, Mohammed

    2008-06-01

    To investigate the incidence and antibiotic resistance of staphylococcal strains isolated from milk and milk products and to trace the ecological origin of the Staphylococcus aureus isolated. Eighty-one samples of raw milk, lben (whey) and jben (cheese) were analyzed for the presence of staphylococcal strains. Isolates were identified by Gram stains, tests for coagulase, the API staph system and the WalkAway 40/96, which also determines the antimicrobial susceptibility profiles. The S. aureus strains were biotyped, and variable regions of the coagulase gene were amplified using the polymerase chain reaction. The identification results showed a predominance of coagulase-negative staphylococci (54 %). Coagulase-positive staphylococci that were identified were divided into 3 groups comprising S. aureus (40%), Staphylococcus intermedius (2 %) and Staphylococcus hyicus (4%). Among the S. aureus that was isolated, biotype C was the predominant biotype. Among 40 coagulase gene PCR-amplification products, 37 produced a single band, while 3 isolates produced two bands. The antimicrobial susceptibility-profile of the staphylococcal strains revealed a high incidence of S. aureus to penicillin G. In addition, Staphylococcus lentus presented considerable resistance to the oxacillin, erythromycin and lincomycin. The presence of staphylococci in raw milk, lben and jben in areas of northern Morocco poses a health hazard, so it is necessary for the public health inspectors to properly examine the conditions during production, storage and commercialization of all products made with unpasteurized milk.

  1. Assessment of raw milk quality and stakeholders' awareness on milk-borne health risks in Arusha City and Meru District, Tanzania.

    Science.gov (United States)

    Ngasala, J Uma Bukuku; Nonga, Hezron Emmanuel; Mtambo, Mkumbukwa Madundo Angelo

    2015-06-01

    A cross-sectional study was conducted to assess the quality of raw milk and stakeholders' awareness on milk-borne health risks and factors for poor milk hygiene in Arusha City and Meru District, Tanzania between October and December 2012. A total of 105 smallholder dairy farmers, milk vendors and milk retailers were interviewed, and milk samples were collected for physical, microbial and antibiotic residue analysis using standard procedures. Questionnaire results indicated high level of awareness (94 %) that drinking raw milk can predispose consumers to milk-borne diseases; nevertheless, 65 % of respondents consumed raw milk. Physicochemical analyses showed some of the milk had sediments (20 %), bad smell (21 %) and had clotted on alcohol test (27 %). About 36 % of milk samples had pH below 6.6, and 25 % had specific gravity below 1.028 g/ml. The mean total viable count (TVC) of milk from vendors is significantly (P milk samples assessed had a higher TVC than the level recommended (2.0 × 10(5) cfu/ml) by the East African Community (EAC) standards. Up to 91 % of the milk samples had bacterial growth that included Eschericia coli (66 %), Staphylococcus aureus (33 %), Corynebacterium (11 %) and Pseudomonas (10 %). All smallholder dairy farmers were aware of drug residues, but majority (57 %) were unaware of human health effects caused by veterinary drug residues in milk. Up to 97 % of respondents reported to comply with drug withdrawal periods. This possibly led to all milk samples analysed to be negative from detectable levels of antibiotic residues. It is concluded that the level of awareness on milk quality is high, although practices associated with milking and post-harvest handling predispose milk to bacterial contamination which is a public health risk to milk consumers.

  2. Lipolytic Changes in the Milk Fat of Raw Milk and Their Effects on the Quality of Milk Products

    OpenAIRE

    Kirst, E.

    1986-01-01

    Lipolytic changes in milk rat affect sensory attributes and techno logicaI properties of milk and milk products. They are affectcd by physiologal, thermal . and biochemical factors as well as by the mechanics of fluids Lipolytic processes in milk are intensified by modern processing methods. In this review. special attention has been paid to runinant- related feeding of dairy cows. foaming of milk. mechanical and thermal influences and the growth of psycllrotrophic bacteria. Feeds defic...

  3. Rapid detection of Streptococcus uberis in raw milk by loop-mediated isothermal amplification

    NARCIS (Netherlands)

    Cornelissen, J.B.W.J.; Greeff, De A.; Heuvelink, A.E.; Swarts, M.; Smith, H.E.; Wal, Van der F.J.

    2016-01-01

    A loop-mediated isothermal amplification (LAMP) method to detect Streptococcus uberis in raw milk was developed and evaluated. Three genes (sodA, pauA, cpn60) were assessed for their suitability as targets in LAMP. The analytical sensitivity was 120, 120, and 12 fg per assay for the sodA, pauA,

  4. Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.

    Science.gov (United States)

    Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D

    2011-06-01

    Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  5. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  6. Evaluation of biogenic amines and microbial counts throughout the ripening of goat cheeses from pasteurized and raw milk.

    Science.gov (United States)

    Novella-Rodríguez, Sonia; Veciana-Nogués, M Teresa; Roig-Sagués, Artur X; Trujillo-Mesa, Antonio J; Vidal-Carou, M Carmen

    2004-05-01

    The effect of the hygienic quality of milk on changes in microbial counts and biogenic amine content was evaluated during ripening of goat cheeses manufactured from pasteurized and raw milks at 1, 14, 30, 60 and 90 d. The original milk, rennet, curd and whey were also included in the study. The pH, salt content and extent of proteolysis in the cheese were also evaluated. Spermidine and spermine were the main amines in raw milk, while they were minor amines in cheeses. Other amines increased markedly during ripening, tyramine being the main amine in cheese made from raw milk and cadaverine and putrescine in those produced from pasteurized milk. Enterobacteriaceae counts decreased during ripening whereas those of lactic acid bacteria increased, especially lactobacilli and enterococci. Cheese made from raw milk showed higher microbial counts during ripening than those made from pasteurized milk, especially for Enterobacteriaceae and enterococci, counts being 2 or 3 log units higher. Raw milk cheese showed remarkably higher biogenic amines compared with pasteurized milk cheeses. Therefore, pasteurization of milk causes a decrease in final biogenic amine content of cheese as a result of the reduction of its microbial counts.

  7. Evaluation of raw milk quality in three subregions of the department of Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Alberto Romero P

    2018-03-01

    Full Text Available The objective was to evaluate the physicochemical, microbiological quality, somatic cell count and presence of inhibitors in raw milks in the department of Sucre. 150 samples of raw milk from six storage centers or processing plants from three subregions of the department of Sucre (Sabanas, San Jorge and Gulf of Morrosquillo were taken using a descriptive cross-sectional study. 25 samples in each collection center that correspond to 25 producers from the different subregions of the department were taken. Microbiological and physiochemical parameters and udder health were determined of a total of 50 samples for each subregion. The data obtained were analyzed according to accepted standards in Colombia. For the most part of the physicochemical parameters, were within the accepted values established in decree 616 of 2006 and decree 1880of 2011(protein ≥2.9%, fat ≥3.0%, density (15oC ≥1.030, TS ≥11.30, SNF ≥8.30. The count of colony forming units (CFU/mL in the different subregions was greater than 600,000 CFU/mL. The somatic cell count (SCC/mL was greater than 500,000 SCC/mL. In 8% of the sampled milks showed presence of inhibitors. Overall, the raw milk had good physicochemical quality but, the microbiological quality and health of the udder were poor, which requires immediate implementation of programs in order to obtain high quality hygienic milk.

  8. Contribution of natural milk culture to microbiota, safety and hygiene of raw milk cheese produced in alpine malga

    Directory of Open Access Journals (Sweden)

    Rosaria Lucchini

    2018-04-01

    Full Text Available Processing of alpine milk in malga farms is carried out under conditions that can favor contamination by coliforms, coagulase-positive staphylococci, or pathogens such as Listeria monocytogenes. With the aim to improve the hygienic characteristics and safety of cheese produced in four malga farms the use of lyophilized Natural Milk Culture prepared with selected strains was tested. Two cheesemaking tests were carried out in the same day always starting from the same milk: in the first case following the malga recipe that uses either Natural Whey Culture or without the addition of a starter, in the second one using a Natural Milk Culture. Cheesemaking were carried out in four malga farms located in the west area of Trentino region within the same week. For hygienic and safety evaluation, aerobic colony count, coagulase-positive staphylococci, Escherichia coli, staphylococcal toxins, Listeria monocytogenes , and Salmonella spp, pH and aw were determined in raw milk from evening and morning milking, curd in vat, curd after extraction and two months-ripened cheese. Pathogens or toxins, high values of coagulase- positive staphylococci and E. coli were not found in cheese samples. However, in the curd coagulase-positive staphylococci reached values almost of 5 Log CFU/g in the two malga without starter cultures. The use of Natural Milk Culture reduced E. coli counts. In addition, DNA was extracted from cheese samples and from Natural Milk Culture and the composition of the microbial community determined by Next Generation Sequencing method. The determination of cheese microbial communities demonstrated that the use of Natural Milk Culture exerted different effects in the different malga, in any case preserving bacterial biodiversity.

  9. RAW MILK AT VENDING MACHINES: EVALUATION OF E. SAKAZAKII, COXIELLA BURNETII AND M. PARATUBERCULOSIS IN PIEDMONT EXPERIENCE

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2009-12-01

    Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.

  10. Microelements and heavy metals in raw cow milk from various regions in Serbia

    Directory of Open Access Journals (Sweden)

    Živkov-Baloš Milica

    2013-01-01

    Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084

  11. Analysis of the Kanamycin in Raw Milk Using the Suspension Array

    Directory of Open Access Journals (Sweden)

    Yanfei Wang

    2013-01-01

    Full Text Available With the monoclonal antibody against kanamycin being prepared successfully, a bead-based indirect competitive fluorescent immunoassay was developed to detect kanamycin in milk. The fact that there was no significant cross-reaction with other aminoglycoside antibiotics implied that the monoclonal antibody was highly specific for kanamycin. The limit of detection (LOD and the 50% inhibition concentration (IC50 in raw milk were 3.2 ng/mL and 52.5 ng/mL, respectively. Using the method developed in this study, the kanamycin concentrations were monitored in raw milk after the intramuscular administration of kanamycin in sick cows. Compared to the conventional enzyme-linked immunosorbent assay (ELISA, the method using the suspension array system was more sensitive. The results obtained in the present study showed a good correlation with that of the ELISA.

  12. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  13. The effect of raw milk microbial flora on the sensory characteristics of Salers-type cheeses.

    Science.gov (United States)

    Callon, C; Berdagué, J L; Dufour, E; Montel, M C

    2005-11-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial counts (on selective media), biochemical tests, and volatile and sensory component analyses at different times of ripening. Adding different microbial communities to specimens of the same (biochemically identical) pasteurized milk lead to different sensory characteristics of the cheeses. Cheeses with fresh cream, hazelnut, and caramel attributes were opposed to those with fermented cream, chemical, and garlic flavors. The aromatic compounds identified (esters, acids, alcohols, and aldehydes) in these cheeses were quite similar. Nevertheless, one milk was distinguished by a higher content of acetoin, and lower 2-butanone and 3-methylpentanone concentrations. Over the production period of 1 mo, the different cheeses were characterized by the same balance of the microbial population assessed by microbial counts on different media. This was associated with the stability of some sensory attributes describing these cheeses. Nevertheless, there was no linear correlation between microbial flora data and sensory characteristics as measured in this study.

  14. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    OpenAIRE

    William van Caenegem; Madeline Elizabeth Taylor

    2017-01-01

    Australia’s regulatory framework has resulted in the standardisation of cheese production based on pasteurisation. Up until early 2015, regulations effectively prohibited raw milk cheese-making in Australia and thus stifled artisanal on-farm production. Although the introduction of Food Standards Australia New Zealand Standard 4.2.4 has allowed the production of certain hard, low-moisture raw milk cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw mil...

  15. The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy

    Directory of Open Access Journals (Sweden)

    Ehsan Sadeghi

    2013-03-01

    Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.

  16. Replacement of raw soybean with roasted soybean increased milk production in Holstein cows

    Directory of Open Access Journals (Sweden)

    Gilson Sebastião Dias Júnior

    Full Text Available ABSTRACT: The aim of this study was to evaluate the effect of total replacement of raw whole soybean (RAW for roastedwhole soybean (ROS on the production performance of Holstein cows. Two experiments were carried out usinga simple reversal design where RAW has been completely replaced by ROS. In experiment 1, 22 cows (175±60 days in milkwere used, and the dietary inclusion level of RAW or ROS was 3.7% of dry matter (DM. In experiment 2, 16 cows (130±50 days in milkwere used, and thedietary inclusion level of RAW or ROS was 11% of DM. In both experiments, ROS increased milk production by 1.1kgday-1 without changing fat and protein production. Dry matter intake or milk urea nitrogenwere not affected by dietary soy source. In experiment 2, plasma glucose concentration was decreased, and allantoin/creatinine ratio in urine tended to decreasein ROS. Experiment 2 also evaluated the nutrient digestibility and ruminal degradation kinetics of crude protein in two soybean sources. Roasting had no effect on the digestibility of DM, organic matter, and neutral detergent fiber. Roasted whole soybean hadgreater fraction B and lower protein degradation rate than did RAW; this showed that heat treatment was effective in increasing therumen undegradable amino acid flowto the animal, which suggesteda potential mechanism of action for improved performance observed in ROS.

  17. Effect of Modified Pre-Milking Sanitizing Approaches on Raw Milk Quality Obtained from the Dairy Farmers of Tawau Area, Sabah

    Directory of Open Access Journals (Sweden)

    Sim Kheng Yuen

    2016-01-01

    Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.

  18. Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province

    Directory of Open Access Journals (Sweden)

    B. A. Abbas

    2012-01-01

    Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.

  19. QUALITY AND SAFETY OF RAW COW’S MILK IN SLOVAKIA IN 2011

    Directory of Open Access Journals (Sweden)

    Jozef Čurlej

    2012-04-01

    Full Text Available The quality and safety of raw cow’s milk is very important for dairy companies and consumers of milk products. Due to the methods of production, it is impossible to completely eliminate contamination of milk with microorganisms, therefore the microbial content of milk is a major feature in determining its quality. Other important factors to consider include somatic cells count, veterinary drug residues, milk composition and freezing point. Somatic cells represent the udder health and can be used for monitoring of subclinical mastitis. A high level of somatic cells can increase proteolysis in milk which affects technological processes. Veterinary drugs administered to cows may lead to residues in the milk which are harmful to humans. The content of fat, protein and solids-non-fat are the main indicators used by dairies for technological purposes. In this article we discuss the quality and safety of raw cow’s milk in Slovakia during 2011. We found that 73.53% of samples tested for somatic cell count, and 84.54% of samples tested for total bacterial count, met the European Union legislation limits. We found the largest decrease in fat and protein content was during the summer period and the largest increase was in the winter period. We found that 92.14 %, 98.7% and 91.38% of samples met the limit presented in STN 570529:1999 for fat content, protein content and freezing point respectively. The percentage of drug positive samples was 0.087%.doi:10.5219/189

  20. β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

    Science.gov (United States)

    Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

    2011-07-01

    Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. The microbial content of raw and pasteurized cow milk as determined by molecular approaches.

    Science.gov (United States)

    Quigley, Lisa; McCarthy, Robert; O'Sullivan, Orla; Beresford, Tom P; Fitzgerald, Gerald F; Ross, R Paul; Stanton, Catherine; Cotter, Paul D

    2013-08-01

    The microbial composition of raw and pasteurized milk is assessed on a daily basis. However, many such tests are culture-dependent, and, thus, bacteria that are present at subdominant levels, or that cannot be easily grown in the laboratory, may be overlooked. To address this potential bias, we have used several culture-independent techniques, including flow cytometry, real-time quantitative PCR, and high-throughput DNA sequencing, to assess the microbial population of milk from a selection of commercial milk producers, pre- and postpasteurization. The combination of techniques employed reveals the presence of a previously unrecognized and diverse bacterial population in unpasteurized cow milk. Most notably, the use of high-throughput DNA sequencing resulted in several bacterial genera being identified in milk samples for the first time. These included Bacteroides, Faecalibacterium, Prevotella, and Catenibacterium. Our culture-independent analyses also indicate that the bacterial population of pasteurized milk is more diverse than previously appreciated, and that nonthermoduric bacteria within these populations are likely to be in a damaged, nonculturable form. It is thus apparent that the application of state-of-the-art approaches can provide a detailed insight into the bacterial composition of milk and could potentially be employed in the future to investigate the factors that influence the composition of these populations. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.

    Science.gov (United States)

    Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T

    2016-04-01

    The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Effect of raw sunflower seeds on goat milk production in different farming systems

    Directory of Open Access Journals (Sweden)

    L. Rapetti

    2010-04-01

    Full Text Available Aim of this study was to test the effect of raw sunflower seeds on goat milk production. Two farms with different farming systems (intensive and semi-intensive participated to the trial. In each farm about 60 mid-lactation Alpine goats were divided in two groups during spring-summer time. A diet containing 5-6% of sunflower seeds on DM basis was compared with a control diet in a change-over design. In the semi-intensive farm milk yield of goats fed sunflower was 3.46 kg/d compared to 3.58 kg/d of goats fed control diet, whereas in the intensive farm milk yield was 4.60 kg/d vs 4.66 kg/d. Fat content increased significantly from 2.99% to 3.23% only in the intensive farm. The research in the intensive farm investigated also milk and cheese fatty acids composition. Medium and short chain fatty acids (C8-C16 content dropped and long chain fatty acids content increased when sunflower was added. In conclusion raw sunflower seed inclusion in dairy goat diets can be useful, in order to limit the inversion of fat and protein percentages in milk.

  4. Iodine in raw and pasteurized milk of dairy cows fed different amounts of potassium iodide.

    Science.gov (United States)

    Norouzian, M A

    2011-02-01

    Relation between iodine (I) intake by lactating Holstein cows and iodine concentrations in raw and pasteurized milk were investigated. Four treatment groups with eight cows assigned to each treatment were fed a basal diet containing 0.534 mg I/kg alone or supplemented with potassium iodide at 2.5, 5 or 7.5 mg/kg in 7-week period. Iodine concentrations in raw milk increased with each increase in dietary I from 162.2 ng/ml for basal diet to 534.5, 559.8 and 607.5 ng/ml when 2.5, 5 and 7.5 mg/kg was fed as potassium iodide (P HTST) pasteurization process reduced I concentration. The mean iodine content found in the milk prior to heating processing was 466.0 ± 205.0 ng/ml, whereas for the processed milk this level was 349.5 ± 172.8 ng/ml. It was concluded that iodine supplementation above of NRC recommendation (0.5 mg/kg diet DM) resulted in significant increases in iodine concentrations in milk, although the effect of heating in HTST pasteurization process on iodine concentration was not negligible.

  5. Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran

    Directory of Open Access Journals (Sweden)

    Mafakheri, Sh.

    2010-07-01

    Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.

  6. Microbiological quality and antibiotic residues in informally marketed raw cow milk within the coastal savannah zone of Ghana.

    Science.gov (United States)

    Addo, K K; Mensah, G I; Aning, K G; Nartey, N; Nipah, G K; Bonsu, C; Akyeh, M L; Smits, H L

    2011-02-01

    To investigate the microbiological quality and the presence of antibiotic residues in raw cow milk and in some indigenous milk products produced and marketed by the informal sector in the coastal savannah zone of Ghana. Milk samples were aseptically collected from 224 kraals and samples of 26 indigenous milk products were purchased from processors and retailers. Total plate counts, total coliform counts and the presence of Escherichia coli and E. coli O157:H7 were determined in all 250 samples. Milk samples were also tested for antibiotic residues. Total plate counts exceeded 10⁵ CFU/ml in 45.2% of the samples while coliforms exceeded 10³ CFU/ml in 66.0% and E. coli was detected in 11.2%. E. coli was present in raw cow milk but not in the indigenous products and all E. coli isolates were negative for E. coli O157:H7. Antibiotic residues were detected in 3.1% of the raw cow milk samples. Bulk milk contains unacceptable levels of hygiene indicators and antibiotic residues and is a potential source of milk-borne infections. The detection of E. coli and antibiotic residues raises public health concerns about the safety of fresh unpasteurized cow milk in the coastal savannah zone of Ghana and calls for improved farm hygiene, the need for milk pasteurization and the sensible use of antibiotics in the milk industry. © 2010 Blackwell Publishing Ltd.

  7. Bacteriological quality of raw camel milk along the market value chain in Fafen zone, Ethiopian Somali regional state.

    Science.gov (United States)

    Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu

    2016-05-26

    The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.

  8. High-throughput metataxonomic characterization of the raw milk microbiota identifies changes reflecting lactation stage and storage conditions.

    Science.gov (United States)

    Doyle, Conor J; Gleeson, David; O'Toole, Paul W; Cotter, Paul D

    2017-08-16

    Low temperature is used to control the growth of bacteria in milk, both pre- and post-pasteurization. As the duration of refrigerated storage extends, psychrotrophs dominate the milk microbiota, that can produce heat stable lipases which negatively impact the organoleptic qualities of milk. Here we examine the influence that refrigeration temperature (2°C, 4°C and 6°C) and storage duration (96h) have on the microbiota composition (16S profiling) of raw bulk tank milk (BTM). To reflect a proposed change to current farming practices, raw milk was blended after each milking (8 milkings) and stored for five consecutive days in each temperature-specific tank. Here 16S rRNA-based microbiota compositional analysis was performed after milk was collected on day 1 and again after the final addition of milk at day 5. In addition to assessing the impact of the duration and temperature of storage, the influence of lactation stage, i.e. mid- versus late-lactation, on the microbiota of the blended BTM was also examined. Overall, both temperature and length of storage had surprisingly little influence on the raw milk microbiota, other than an increase in proportions of Gammaproteobacteria in the blended milk samples collected after pooling on day 5, and in samples stored at 6°C. However, lactation stage had a considerable influence on microbiota composition, with milk from mid-lactation containing higher proportions of Bacteroides, Faecalibacterium, Campylobacter and Rhodanobacter, and late-lactation milk containing higher proportions of Actinobacteria. Overall, the study demonstrates that current temperature and storage duration practises impact the microbiota of raw milk, but these impacts are modest relative to the more considerable differences between mid and late-lactation milk. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    Directory of Open Access Journals (Sweden)

    William van Caenegem

    2017-04-01

    cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw milk cheese consumer market. This article compares the Australian system with the French raw milk cheese regulation and production system, and argues that its approach in encouraging and supporting small farmhouse artisanal traditional raw milk cheese is beneficial to both producer and consumer, and has not resulted in any significant health risks. The Australian approach amounts to a missed opportunity to encourage the emergence of a value-added industry with local and export potential, and is at odds with important movements in food policy, such as recognition of the value of localism and terroir.

  10. Molecular characterization of Aspergillus fumigatus isolated from raw cow milk in Argentina: Molecular typing of A. fumigatus from raw cow milk.

    Science.gov (United States)

    Pena, Gabriela A; Alonso, Verónica; Manini, Marina Velasco; Pellegrino, M; Cavaglieri, Lilia R

    2018-06-20

    Aspergillus fumigatus, the major etiological agent of human and animal aspergillosis, is a gliotoxinogenic species into section Fumigati commonly found in contaminated animal environments. In dairy herds, exposed areas of lactating cows, as mammalian glandule, can be easily contaminated by them. This study was aimed to identify A. fumigatus sensu lato strains (identified based on morphology) isolated from raw cow milk at species level, by morphological and molecular techniques, and to estimate their genetic variability. Forty-five A. fumigatus strains showed similar RAPD profiles (generated with PELF and URP1F primers) to each other and to A. fumigatus sensu stricto reference strains; also, they were almost identical to clinical human and feed-borne A. fumigatus strains included in the assay, since their similarity coefficient ranged from 0.7 to 1.00. Therefore, all strains were characterized as belonging to A. fumigatus sensu stricto species. This result was supported by sequencing the benA gene of selected strains and by maximum parsimony analysis. In addition, RAPD fingerprinting demonstrated intra-specific genetic variability into the A. fumigatus sensu stricto cluster. The results found in this study strengthen the fact that A. fumigatus sensu stricto is the predominant species in the Aspergillus section Fumigati found in animal environments such as dairy herd environments, while other species such as A. novofumigatus, A. fumigatiaffinis, A. udagawae and A. lentulus may be rarely isolated. Since no differences between animal and human strains were observed they can become pathogenic also for farm handlers'. Moreover, the presence of A. fumigatus sensu stricto in raw cow milk is probably a very important risk factor since milk and its by-products are generally indented for human consumption, then gliotoxin could be transferred to them. Copyright © 2018. Published by Elsevier B.V.

  11. Research And Practice: Quantification Of Raw And Heat-Treated Cow Milk in Sheep Milk, Cheese And Bryndza By ELISA Method

    Directory of Open Access Journals (Sweden)

    Lucia Zeleňáková

    2016-01-01

    Full Text Available The aim of this study was to test the reliability of commercial ELISA tests (RC-bovino within raw and heat treated cow milk detection in sheep milk and cheese in order to obtain a high-quality, reliable and economically beneficial method suitable for routine application in practice. These tests were subsequently used for quantification of cow milk in commercial "Bryndza". Raw sheep milk, cow milk and heat-treated cow milk (pasteurisation at 72 °C for 15 sec or at 85 °C for 3 sec were mixed in precisely defined proportions (0 - 100% cow milk in sheep milk. The milk mixtures were sampled to detect adulteration and subsequently cheese was made. By ELISA tests was possible to determine these amounts of raw cow milk in sheep milk: 0.5% (0.2%, 5 % (4.81%, 50% (42.08% and 75% (56.52%. The pasteurized samples in different combinations gave lower optical density responses than those prepared from raw milk (by approximately 60%. In context with the above mentioned, the relationship between the real and detected amount of cow milk (% in different production stages (milk, cheese using a regression analysis was examined. However, a lower reliability of the detection was indicated by R2 values, which ranged from 0.4058 (cheese to 0.5175 (milk. In practice this means that although individual percentage (% of cow milk in the sample can be detected, but in the unknown sample it can not be clearly confirm whether the cow milk was raw or heat-treated. In this context, the results can be inaccurate and may not correspond to the real situation. Within monitoring phase of this research, 9 samples of bryndza were analysed with the results of detected cow milk ranged from 11.56% to 14.3%. The obtained results confirm that the appropriate selection of ELISA tests can become an important factor in the setting of analytical capabilities for the detection of milk and cheese adulteration.

  12. Investigation of some additive residues in bulk raw milk collected from Pakdasht area in 2009

    Directory of Open Access Journals (Sweden)

    T Moosavi

    2011-05-01

    Full Text Available Milk is one of the most important sources of human nutrition and because of high nutrient content; it is a very suitable medium for microbial growth and spoilage. Sometimes farmers cheat and add some additives to milk in order to cover the spoilage or other defects in milk. In this study 120 samples of bulk raw milk (10 samples each month were collected from dairy farms of Pakdasht under sterile condition and send to veterinary faculty of GarmsarUniversity. The following tests were done on each sample: Anti-microbial residues, residues milk acidity neutralizer, evaluation of sugar, formalin, Hydrogen peroxide, Salicylic acid and salt presence. Results were analyzed with Spss software and the results of the first six months of the year were compared statistically with the results of the second six months of the year. The mean of antimicrobial agents, milk acid neutralizer, formalin, hydrogen peroxide and salicylic acid showed no significant difference. But sugar in first semester were more than second semester (p

  13. GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS

    Directory of Open Access Journals (Sweden)

    Shanmuga Priya Seshadhri

    2014-12-01

    Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.

  14. Total bacterial count and somatic cell count in refrigerated raw milk stored in communal tanks

    Directory of Open Access Journals (Sweden)

    Edmar da Costa Alves

    2014-09-01

    Full Text Available The current industry demand for dairy products with extended shelf life has resulted in new challenges for milk quality maintenance. The processing of milk with high bacterial counts compromises the quality and performance of industrial products. The study aimed to evaluate the total bacteria counts (TBC and somatic cell count (SCC in 768 samples of refrigerated raw milk, from 32 communal tanks. Samples were collected in the first quarter of 2010, 2011, 2012 and 2013 and analyzed by the Laboratory of Milk Quality - LQL. Results showed that 62.5%, 37.5%, 15.6% and 27.1% of the means for TBC in 2010, 2011, 2012 and 2013, respectively, were above the values established by legislation. However, we observed a significant reduction in the levels of total bacterial count (TBC in the studied periods. For somatic cell count, 100% of the means indicated values below 600.000 cells/mL, complying with the actual Brazilian legislation. The values found for the somatic cell count suggests the adoption of effective measures for the sanitary control of the herd. However, the results must be considered with caution as it highlights the need for quality improvements of the raw material until it achieves reliable results effectively.

  15. Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

    Directory of Open Access Journals (Sweden)

    F Tajbakhsh

    2014-05-01

    Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

  16. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  17. [On-site evaluation of raw milk qualities by portable Vis/NIR transmittance technique].

    Science.gov (United States)

    Wang, Jia-Hua; Zhang, Xiao-Wei; Wang, Jun; Han, Dong-Hai

    2014-10-01

    To ensure the material safety of dairy products, visible (Vis)/near infrared (NIR) spectroscopy combined with che- mometrics methods was used to develop models for fat, protein, dry matter (DM) and lactose on-site evaluation. A total of 88 raw milk samples were collected from individual livestocks in different years. The spectral of raw milk were measured by a porta- ble Vis/NIR spectrometer with diffused transmittance accessory. To remove the scatter effect and baseline drift, the diffused transmittance spectra were preprocessed by 2nd order derivative with Savitsky-Golay (polynomial order 2, data point 25). Changeable size moving window partial least squares (CSMWPLS) and genetic algorithms partial least squares (GAPLS) meth- ods were suggested to select informative regions for PLS calibration. The PLS and multiple linear regression (MLR) methods were used to develop models for predicting quality index of raw milk. The prediction performance of CSMWPLS models were similar to GAPLS models for fat, protein, DM and lactose evaluation, the root mean standard errors of prediction (RMSEP) were 0.115 6/0.103 3, 0.096 2/0.113 7, 0.201 3/0.123 7 and 0.077 4/0.066 8, and the relative standard deviations of prediction (RPD) were 8.99/10.06, 3.53/2.99, 5.76/9.38 and 1.81/2.10, respectively. Meanwhile, the MLR models were also cal- ibrated with 8, 10, 9 and 7 variables for fat, protein, DM and lactose, respectively. The prediction performance of MLR models was better than or close to PLS models. The MLR models to predict fat, protein, DM and lactose yielded the RMSEP of 0.107 0, 0.093 0, 0.136 0 and 0.065 8, and the RPD of 9.72, 3.66, 8.53 and 2.13, respectively. The results demonstrated the usefulness of Vis/NIR spectra combined with multivariate calibration methods as an objective and rapid method for the quality evaluation of complicated raw milks. And the results obtained also highlight the potential of portable Vis/NIR instruments for on-site assessing quality indexes of

  18. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  19. Contamination Level of Staphylococcus spp. in Raw Goat Milk and Associated Risk Factors

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2008-12-01

    Full Text Available This study was aimed to investigate the presence of pathogenic bacteria in raw goat milk by using Staphylococcus spp. as indicator bacteria, and also to evaluate the potential risk factors associated with them. Information regarding potential risk factors was collected by questionnaire. The conventional bacteriological method for bacterial isolation and the indirect test (California Mastitis Test (CMT for determining udder inflammation status were employed. A sample size of 300 udder halves milk samples from three commercial dairy goat farms in the Bogor District, West Java Province, Indonesia were investigated for counts and prevalence of indicator bacteria. Ten potential risk factors were also evaluated in relation to counts and prevalence of indicator bacteria. The results showed that the median value of indicator bacterial count from overall udder-half milk samples was 3.00 log cfu/ml. The indicator bacterial count from udder-half milk samples was significantly different (P<0.05 among farms. Overall prevalence of Staphylococcus spp. was 78.7%. As one of potential risk factors, udder inflammation status was found to be risk factor for Staphylococcus spp. contamination in milk. Udders with inflammation had significant association and a higher chance of having contaminated samples by Staphylococcus spp. as compared to udders without inflammation. Additionally, according to these study results, CMT can be used as an effective, reliable, cheap and “farm and farmer friendly test” for screening test of intramammary infection (IMI or sub clinical mastitis in dairy goats.

  20. Real-time PCR detection of Paenibacillus spp. in raw milk to predict shelf life performance of pasteurized fluid milk products.

    Science.gov (United States)

    Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J

    2012-08-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.

  1. Determination of heavy metals concentration in raw sheep milk from mercury polluted area

    Directory of Open Access Journals (Sweden)

    Radovan Stanovič

    2016-01-01

    Full Text Available The paper focuses on determining the content of monitored contaminants (Cd, Cu, Hg, Pb and Zn in 53 samples of raw sheep milk collected in 2013 and 2014 on the sites Poráč and Matejovce nad Hornádom (middle Spiš. The area is characterized by historical mining and metalworking activity (mining and processing of polymetallic ores rich in Hg, Cd and Pb. Currently, the area is one of the most mercury contaminated areas in Central Europe. All statistical analyses were carried out using the statistical software Statistica 10.0 (Statsoft, USA. Descriptive data analysis included minimum value, maximum value, arithmetic mean and standard deviation. The results of the studied contaminant content show that the limit value for cadmium (10 μg.kg-1 was exceeded in 25 samples. In the case of lead, the limit value of 20 μg.kg-1 was exceeded in 16 cases. The limit value for copper (0.4 mg.kg-1 was exceeded in one case. The limit value for zinc is not defined by a legislative standard. The risk level of the studied contaminants in the samples of raw sheep milk decreases as follows: Cd > Pb > Hg > Cu > Zn. It can be concluded that frequent and long-term consumption of the raw sheep milk originating from the studied sites poses a health risk. The content of the contaminants in the milk and their eventual transition into dairy products should be monitored over a longer term in more detail. Normal 0 21 false false false CS JA X-NONE

  2. Determination of lactose in raw milks by means of the combined He-Ne laser optothermal window

    NARCIS (Netherlands)

    Bakos, P.; Doka, O.; Ajtony, Z.; Bicanic, D.; Szucs, D.

    2002-01-01

    The concept of OW (with 632.8 nm He–Ne laser), combined with colorimetry based on a reaction of anthrone-sulphuric acid, was proposed as a new tool for determination of lactose in raw milk. Data obtained from various milk samples by OW colorimetry were compared to those acquired from the MilkoScan

  3. Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

    Science.gov (United States)

    Eftekhari, Mohsen; Mosavari, Nader

    2016-12-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

  4. Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011

    OpenAIRE

    VAHEDI, M.; NASROLAHEI, M.; SHARIF, M.; MIRABI, A.M.

    2013-01-01

    Summary Introduction. The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. Methods. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and List...

  5. Determination of the concentrations of lead in raw milk in the Valley of Toluca

    International Nuclear Information System (INIS)

    Rosas Vilchis, E.

    1991-01-01

    The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)

  6. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

    Science.gov (United States)

    Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

    2008-12-10

    Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

  7. Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.

    Science.gov (United States)

    Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran

    2007-11-15

    During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.

  8. Contribution of hydrogen peroxide to the inhibition of Staphylococcus aureus by Lactococcus garvieae in interaction with raw milk microbial community

    OpenAIRE

    Delbes, Céline; Dorchies, Géraud; Chaabna, Zineddine; Callon, Cecile; Montel, Marie-Christine

    2010-01-01

    The response of Staphylococcus aureus growth inhibition by Lactococcus garvieae to catalase and milk lactoperoxidase, and its efficiency in raw milk cheese were evaluated. S. aureus and L. garvieae were co-cultivated in broth buffered at pH 6.8, and in raw, pasteurized and microfiltered milk, in presence and absence of catalase. Although H(2)O(2) production by L garvieae was detected only in agitated broth, the inhibition of S. aureus by L garvieae was reduced by catalase both in stati...

  9. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing

    Science.gov (United States)

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...

  10. A new comprehensive index for discriminating adulteration in bovine raw milk.

    Science.gov (United States)

    Liu, Jing; Ren, Jing; Liu, Zhen-Min; Guo, Ben-Heng

    2015-04-01

    This paper proposes a new comprehensive index, called Q, which can effectively discriminate artificial adulterated milk from unadulterated milk. Both normal and adulterated samples of bovine raw milk were analysed by Fourier transform infrared spectroscopic instrument to measure the traditional indices of quality, including fat (FAT), protein (PRO), lactose (LAC), total solids (TS), non-fat solid (NFS), freezing point (FP) and somatic cell counts (SCC). From these traditional indices, this paper elaborates a method to build the index Q. First, correlated analysis and principle component analysis were used to select parameter pairs TS-FAT and FP-LAC as predominant variables. Second, linear-regression analysis and residual analysis are applied to determine the index Q and its discriminating ranges. The verification and two-blind trial results suggested that index Q could accurately detect milk adulteration with maltodextrin and water (as low as 1.0% of adulteration proportions), and with other nine kinds of synthetic adulterants (as low as 0.5% of adulteration proportions). Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

    Directory of Open Access Journals (Sweden)

    Carla Duarte

    2016-04-01

    Full Text Available Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

  12. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  13. Is Leptospira able to survive in raw milk? Study on the inactivation at different storage times and temperatures.

    Science.gov (United States)

    Fratini, Filippo; Turchi, Barbara; Ferrone, Martina; Galiero, Alessia; Nuvoloni, Roberta; Torracca, Beatrice; Cerri, Domenico

    2016-09-01

    The consumption of raw milk is currently increasing due to several beneficial aspects, such as nutritional qualities, taste, and health benefits. However, some authors highlight the potential risk associated with raw milk consumption. In Italy, while the absence of some pathogen microorganisms is set by the regional regulation DGR 381/2007, for other microorganisms, such as Leptospira, no recommendations are provided. Leptospira is not ascribed among classical milk pathogens; however, it can potentially be present in raw milk. The aim of this study was to evaluate the survival in raw milk of six serovars of Leptospira after storage at different temperatures (4 °C ± 2 °C, 20 °C ± 2 °C, and 30 °C ± 2 °C) for different incubation times (20 min, 45 min, 1 h, and 1 h and 30 min), in order to determine the potential risk for consumers. Moreover, the immediate effect of bovine, goat, and donkey raw milk on tested Leptospira serovars was visually evaluated. After incubation, all samples were subcultured in EMJH and incubated aerobically at 30 °C for 3 months. All inoculated media were weekly examined by dark-field microscope in order to assess Leptospira survival. Extemporary observation of strains' behavior in milk allowed to detect an almost immediate motility loss, and no leptospires were detected by microscopic observations carried out weekly during the trial period. According to our results, it could be possible to exclude raw milk as a source of Leptospira infection for consumers.

  14. RESEARCHES REGARDING THE MICROBIOLOGIC PARAMETERS VALUE FROM RAW MILK USED IN TELEMEA CHEESE TECHNOLOGICAL PROCESS

    Directory of Open Access Journals (Sweden)

    ANDRA SULER

    2008-10-01

    Full Text Available An important faze for food quality control is verification of microbiological parameters of food products. In this way is assuring the prevention of alimentation toxicological infections to consumer, avoiding the technological and economical losses as well as increasing the products conservation period. In this paper are presents the microbiological exam results from raw milk used in Telemea cheese technological process, for 5 stations studied. The determinations were made on 2 series with 57 samples each of them, prelevated in reception fase, in summer and winter season.

  15. Effect of seasonal variation on the composition and properties of raw milk destined for processing in the UK.

    Science.gov (United States)

    Chen, Biye; Lewis, Michael J; Grandison, Alistair S

    2014-09-01

    The composition and physical properties of raw milk from a commercial herd were studied over a 1 year period in order to understand how best to utilise milk for processing throughout the year. Protein and fat levels demonstrated seasonal trends, while minerals and many physical properties displayed considerable variations, which were apparently unrelated to season. However, rennet clotting time, ethanol stability and foaming ability were subject to seasonal variation. Many significant interrelationships in physico-chemical properties were found. It is clear that the milk supply may be more suited to the manufacture of different products at different times of the year or even on a day to day basis. Subsequent studies will report on variation in production and quality of products manufactured from the same milk samples described in the current study and will thus highlight potential advantages of seasonal processing of raw milk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. A systematic review and meta-analysis of the effects of pasteurization on milk vitamins, and evidence for raw milk consumption and other health-related outcomes.

    Science.gov (United States)

    Macdonald, Lauren E; Brett, James; Kelton, David; Majowicz, Shannon E; Snedeker, Kate; Sargeant, Jan M

    2011-11-01

    Pasteurization of milk ensures safety for human consumption by reducing the number of viable pathogenic bacteria. Although the public health benefits of pasteurization are well established, pro-raw milk advocate organizations continue to promote raw milk as "nature's perfect food." Advocacy groups' claims include statements that pasteurization destroys important vitamins and that raw milk consumption can prevent and treat allergies, cancer, and lactose intolerance. A systematic review and meta-analysis was completed to summarize available evidence for these selected claims. Forty studies assessing the effects of pasteurization on vitamin levels were found. Qualitatively, vitamins B12 and E decreased following pasteurization, and vitamin A increased. Random effects meta-analysis revealed no significant effect of pasteurization on vitamin B6 concentrations (standardized mean difference [SMD], -2.66; 95% confidence interval [CI], -5.40, 0.8; P = 0.06) but a decrease in concentrations of vitamins B1 (SMD, -1.77; 95% CI, -2.57, -0.96; P pasteurization on milk's nutritive value was minimal because many of these vitamins are naturally found in relatively low levels. However, milk is an important dietary source of vitamin B2, and the impact of heat treatment should be further considered. Raw milk consumption may have a protective association with allergy development (six studies), although this relationship may be potentially confounded by other farming-related factors. Raw milk consumption was not associated with cancer (two studies) or lactose intolerance (one study). Overall, these findings should be interpreted with caution given the poor quality of reported methodology in many of the included studies.

  17. Surveillance of bulk raw and commercially pasteurized cows' milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis.

    Science.gov (United States)

    O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-09-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.

  18. Behavior of Arcobacter butzleri and Arcobacter cryaerophilus in ultrahigh-temperature, pasteurized, and raw cow's milk under different temperature conditions.

    Science.gov (United States)

    Giacometti, Federica; Serraino, Andrea; Pasquali, Frederique; De Cesare, Alessandra; Bonerba, Elisabetta; Rosmini, Roberto

    2014-01-01

    The growth and survival of Arcobacter butzleri and Arcobacter cryaerophilus in milk were investigated at different storage temperatures. Three strains of each Arcobacter species were inoculated into ultrahigh-temperature (UHT), pasteurized, and raw cow's milk and stored at 4, 10, and 20°C for 6 days. The survival of Arcobacter spp. during storage was evaluated by a culture method. Results clearly showed that A. butzleri and A. cryaerophilus remained viable in milk when stored at 4°C and 10°C for a period of 6 days. When UHT and pasteurized milk were stored at 20°C, the A. butzleri count increased, with a longer lag-phase in pasteurized milk, whereas the A. cryaerophilus count increased in the first 48 h and then rapidly decreased to below the detection limit on the sixth storage day. When raw milk was stored at 20°C, the A. butzleri and A. cryaerophilus counts decreased from the first day of storage and no viable bacteria were recovered on the last day of storage. Generally, A. butzleri displayed a significantly better growth and survival capacity than A. cryaerophilus in milk. The present study is the first to assess the survival and/or growth of A. butzleri and A. cryaerophilus in milk. The evidence suggests that in case of primary contamination of milk or secondary contamination due to postprocessing contamination, milk can act as a potential source of Arcobacter infection in humans and could have public health implications, especially for raw milk consumption.

  19. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  20. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  1. Quantitative assessment of Lactococcus lactis subsp. cremoris present in artisanal raw cow’s milk cheese

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2018-01-01

    Full Text Available Lactococcus lactis subsp. cremoris belongs to lactic acid bacteria that play a crucial role in cheese production and it is known to be beneficial to human health. The aim of the study was to establish a rapid and accurate quantitative real-time polymerase chain reaction (qPCR method to detect and enumerate L. lactis subsp. cremoris in artisanal raw cow’s milk cheese. Artisanal raw cow’s milk cheese samples were used to check for presence and number of L. lactis subsp. cremoris strains. The method applies a set of target-specific PCR (polymerase chain reaction primers and a fluorogenic probe, and amplifies a part of the LACR_RS01280 gene that encodes the aminoacetone oxidase family flavin adenine dinucleotide (FAD binding enzyme. All 5 L. lactis subsp. cremoris strains examined were found to be qPCR positive. There was no signal recorded for 8 strains which belong to closely related species. The limit of detection amounted to ten copies per reaction and the assay indicated a linear dynamic range of seven logs. This method may be applied in detection and enumeration of L. lactis subsp. cremoris in cheese during its ripening. Moreover, it may be applied to examine the distribution of L. lactis subsp. cremoris during the cheese production and ripening.

  2. A Study on the Occurrence of Aflatoxin M1 in Raw and Pasteurized Milk Produced in Rafsanjan, Iran

    Directory of Open Access Journals (Sweden)

    FaAkrami Mohajeri Akrami Mohajeri

    2015-12-01

    Full Text Available Introduction: Aflatoxins, known as causative factors of hepatic and extra-hepatic carcinogenesis within humans, are extremely teratogenic, mutagenic, toxic, and carcinogenic compounds. Materials & Methods: This study was undertaken to determine the occurrence of aflatoxin M1 (AFM1 in 40 raw milk and 47 pasteurized milk samples collected during spring and winter. In order to analyze the samples, the Enzyme-linked Immunosorbent Assay (ELISA procedure was used. The statistical methods used in this study were based on normal confidence intervals and analysis of variance (ANOVA. Results: Aflatoxin M1 was detected in 97.5% of the raw milk ranging from 6.52 to 68.17 ng/l and 95.7% of the pasteurized milk, ranging from 0.8 to 58.13 ng/l. Toxin levels in 10% of the raw milk and 2.1% of the pasteurized milk samples exceeded the Iranian national standard limit i.e. 50 ng/l.  Due to seasonal variations, mean concentration of AFM1 in the samples collected in winter was significantly (P < 0.03 higher than those collected in the summer. Conclusion: Large amount of AFM1 in milk samples might be a potential hazard for the public health. Reducing the levels of AFB1 in animal feedstuffs can be regarded as the initial step to control the transfer of AFM1 to humans.

  3. Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

    Science.gov (United States)

    Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

    2011-06-01

    The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

  4. The inhibitory effect of sodium thiocyanate and sodium percarbonate ratios on microorganism growth in raw milk samples as an effective treatment to extend milk quality during storage

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-02-01

    Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.

  5. Rate of inactivation of cytomegalovirus in raw banked milk during storage at -20 degrees C and pasteurisation

    DEFF Research Database (Denmark)

    Friis, Henrik; Andersen, H K

    1982-01-01

    Samples of milk from 23 mothers attending the department of obstetrics and gynaecology and 36 who donated milk to the department's milk bank were cultured for cytomegalovirus. Virus was isolated from samples from 12 of the milk donors but none of the mothers attending the department; follow......-up studies during lactation in seven of these 12 women showed that five continued to excrete the virus. Samples were taken on three occasions from one woman who regularly excreted high titres of the virus. Storage at -20 degrees C for over three days reduced the titre by over 99%; after pasteurisation at 63...... degrees C for eight minutes the milk did not contain any viable virus. It is recommended that raw banked milk used for feeding preterm babies should be kept frozen for at least 72 hours before feeding....

  6. Surveillance of Bulk Raw and Commercially Pasteurized Cows' Milk from Approved Irish Liquid-Milk Pasteurization Plants To Determine the Incidence of Mycobacterium paratuberculosis

    OpenAIRE

    O'Reilly, Ciara E.; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R.; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-01-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of ...

  7. The use of the Fourier Transform Infrared spectroscopy to determine adulterants in raw milk

    Directory of Open Access Journals (Sweden)

    Laerte Dagher Cassoli

    2011-11-01

    Full Text Available The objective of this study was to develop calibrations to determine the concentration of some milk adulterants by using the automated methodology of Fourier Transform Infrared (FTIR. For construction of calibrations, samples were collected from 100 farms in the states of São Paulo and Minas Gerais. Samples were tainted with three different adulterants commonly used in the adulteration of raw milk: sodium bicarbonate (SB, sodium citrate (SC and cheese whey (W. Each adulterant was used at three different concentrations (SB: 0.05, 0.10 and 0.25%; SC: 0.025, 0.050 and 0.075% and W: 5, 10 and 20%. For validation, 60 samples were collected in other farms, which were not considered at the development stage of calibration. Adulterants were added at the following concentrations: 0.03, 0.06, 0.10 and 0.12% for SB; 0.02, 0.04, 0.06 and 0.08% for SC and 5, 10 and 20% for W. Performance of each calibration was evaluated in terms of accuracy (Se, detection limit (DL and determination coefficient (R². All calibrations presented R² higher than 0.91 with DL of 0.015%; 0.017% and 3.9% for SB, SC and W, respectively. Accuracy was 0.005%, 0.009% and 2.26% for SB, SC and W, respectively. Results show that the FTIR methodology can be used for determining the concentration of sodium bicarbonate, sodium citrate and whey in raw milk. Associated with automated equipment, it is a viable option for monitoring these adulterants, having low operational costs and high analytical performance as additional features.

  8. Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk

    Directory of Open Access Journals (Sweden)

    Milan Vasiľ

    2016-12-01

    Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics.  Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.

  9. Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Dressed Beef Carcasses and Raw Milk in Tanzania.

    Science.gov (United States)

    Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh

    2016-01-01

    Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.

  10. Evaluation of raw milk quality in different production systems and periods of the year

    Directory of Open Access Journals (Sweden)

    Marcos Inácio Marcondes

    2014-12-01

    Full Text Available The objective of this study was to evaluate the quality of raw milk in different production systems and its variation throughout the year. The data were collected from 943 dairy farms in the South, Central-West and Central regions of the state of Minas Gerais, and in Vale do Paraíba, in the state of São Paulo, Brazil. The data were collected in the period from January 2009 to September 2011, in a total of 18,206 samples. The properties were divided into confinement, semi-confinement and extensive production systems. The evaluated factors were somatic cell count (SCC, total bacterial count (TBC and protein and fat contents. There was no effect of production system on the contents of protein, fat and SCC. Total bacterial count, however, was affected by production. Seasonal variations were found for SCC, TBC, protein and fat; the highest protein values were found from March to June; the highest fat contents were obtained from May to August; and TBC and SCC, from December to March. The production system does not interfere with the percentage of fat and protein and SCC of the milk. However, confinement systems present a better TBC content. Both month and year are factors that interfere with TBC, SCC, protein and milk fat, and the best patterns are found in the coldest periods of the year.

  11. Quantitative Determination of Ivermectin in Raw Milk Using Positive ESI LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Meenakshi Dahiya

    2010-01-01

    Full Text Available Ivermectin, a veterinary drug, is commonly used endectocide for animal husbandry. The drug is available in the form of subcutaneous or topical formulations. Its application may cause accumulation of its residues into the animal tissues, which ultimately find their way into the food products, such as milk and meat products. In order to determine the residues of ivermectin in milk, a comparatively simple, sensitive and rapid method was developed and validated using LC-MS/MS. The MRM transitions corresponding to m/z 892.71>569.6, 892.71>551.5 and 892.71>307.3 were used for the purpose of quantification and evaluation of other parameters of the method. The limit of detection of the method was found to be 0.1 μg/kg and the limit of quantitation was calculated as 0.2 μg/kg. The method was found to be linear in the range of 1.0 ng/mL to 100.0 ng/mL with correlation coefficient of 0.9992 for pure calibration curve and 0.9990 for the matrix- matched calibration curve. The recoveries of ivermectin from the spiked samples of raw milk were found between 85 to 105%.

  12. Incidence of Nocardia species in raw milk collected from different localities of Assiut City of Egypt

    Directory of Open Access Journals (Sweden)

    Nahed Mohamad Wahba

    2011-10-01

    Full Text Available This study aimed to isolate and enumerate Nocardiae from the examined raw milk samples. 240 random milk samples were collected from cows, buffaloes, sheep and goats from different localities in Assiut city- Egypt. The incidences of Nocardia spp. were 47.8, 43.3, 53.3 and 66.7% with average counts of 3.8 x104, 4.5x104, 1.4x104 and 7.6x103/CFUmL of the examined samples, respectively. Pathogenicity of the isolates was also studied. N. otitidiscavarium and N. brasiliensis caused sudden death of rats while, N. farcinica and N. carnea strains were non pathogenic. Other species caused several lesions. It was concluded from the study that, Nocardia species are existed in retailed and fresh milk of different farm animals. Most of the isolated strains were highly pathogenic to rats. Consequently, preventive measures should be taken to protect consumers from being infected. [Vet. World 2011; 4(5.000: 201-204

  13. Visible and near-infrared spectroscopic analysis of raw milk for cow health monitoring: reflectance or transmittance?

    Science.gov (United States)

    Aernouts, B; Polshin, E; Lammertyn, J; Saeys, W

    2011-11-01

    The composition of produced milk has great value for the dairy farmer. It determines the economic value of the milk and provides valuable information about the metabolism of the corresponding cow. Therefore, online measurement of milk components during milking 2 or more times per day would provide knowledge about the current health and nutritional status of each cow individually. This information provides a solid basis for optimizing cow management. The potential of visible and near-infrared (Vis/NIR) spectroscopy for predicting the fat, crude protein, lactose, and urea content of raw milk online during milking was, therefore, investigated in this study. Two measurement modes (reflectance and transmittance) and different wavelength ranges for Vis/NIR spectroscopy were evaluated and their ability to measure the milk composition online was compared. The Vis/NIR reflectance measurements allowed for very accurate monitoring of the fat and crude protein content in raw milk (R(2)>0.95), but resulted in poor lactose predictions (R(2)milk samples gave accurate fat and crude protein predictions (R(2)>0.90) and useful lactose predictions (R(2)=0.88). Neither Vis/NIR reflectance nor transmittance spectroscopy lead to an acceptable prediction of the milk urea content. Transmittance spectroscopy can thus be used to predict the 3 major milk components, but with lower accuracy for fat and crude protein than the reflectance mode. Moreover, the small sample thickness (1mm) required for NIR transmittance measurement considerably complicates its online use. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Prevalence, characterization, and antimicrobial resistance of Yersinia species and Yersinia enterocolitica isolated from raw milk in farm bulk tanks.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Radmehr, Behrad; Ismail, Salmah

    2015-02-01

    The aims of this study were to investigate the prevalence and to characterize and determine the antibiotic resistance of Yersinia spp. isolates from raw milk. From September 2008 to August 2010, 446 raw milk samples were obtained from farm bulk milk tanks in Varamin, Iran. Yersinia spp. were detected in 29 (6.5%) samples, out of which 23 (79.3%), 5 (17.2%), and 1 (3.4%) were isolated from cow, sheep, and goat raw milk, respectively. The most common species isolated was Yersinia enterocolitica (65.5%), followed by Yersinia frederiksenii (31%), and Yersinia kristensenii (3.4%). Of the 19 Y. enterocolitica isolates, 14 (73.7%) were grouped into bioserotype 1A/O:9, 4 (21.1%) belonged to bioserotype 1B:O8, 1 (5.3%) belonged to bioserotype 4/O:3, and 1 isolate (biotype 1A) was not typable. All the isolates of biotypes 1B and 4harbored both the ystA and ail genes. However, all the isolates of biotype 1A were only positive for the ystB gene. The tested Yersinia spp. showed the highest percentages of resistance to tetracycline (48.3%), followed by ciprofloxacin and cephalothin (each 17.2%), ampicillin (13.8%), streptomycin (6.9%), and amoxicillin and nalidixic acid (each 3.4%). All of the tested isolates demonstrated significant sensitivity to gentamicin and chloramphenicol. Recovery of potentially pathogenic Y. enterocolitica from raw milk indicates high risks of yersiniosis associated with consumption of raw milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Sanitary Quality of Raw Milk within the Commodity Subsector in Mbarara District and Kampala City in Uganda

    Directory of Open Access Journals (Sweden)

    N. Grillet

    2005-04-01

    Full Text Available The sanitary quality of raw milk is an important issue in Uganda for social, economical and health reasons. The present study carried out on the informal raw milk subsector of Uganda highlighted two main issues: (i poor hygiene conditions from the production location all the way to the consumer; (ii lack of an efficient preservation system to limit bacteria development during transportation to Kampala. The bacteria population reached very high levels close to 2 x 106 colony forming units per milliliter on the farm milk of Mbarara District in the southwestern region of the country, and these levels increased 150-fold during transportation to Kampala. The sector also includes rudimentary pasteurization units, where the overheated milk comes out bacteria-free. However, conservation over several days of the overheated milk makes this process potentially more dangerous than beneficial. Thus, the need for all the players of the sector to implement a strategy to improve milk quality can be two ways: (i by changing common practices to ensure better hygiene conditions; (ii by improving milk preserving through new methods such as cooling, small-scale pasteurization, or the use of the lactoperoxidase system. This study can help develop a technical and scientific basis to generate quality improvement actions in Uganda. But, whatever the strategy adopted by decision makers, it can only be implemented if all the stakeholders of the sector are involved.

  16. Status of food and raw milk supply and problem just after the reactor accident

    International Nuclear Information System (INIS)

    Hirakawa, Sachiko; Murakami, Kana; Yoshizawa, Nobuaki; Takizawa, Mari; Kawai, Masaki; Sato, Osamu; Takagi, Syunji; Nakamura, Takashi

    2014-01-01

    Iodine 131 was detected in the environment and the food such as vegetables, raw milk and tap water just after the reactor accident following the East Japan Great Earthquake occurred in March 11, 2011. This article investigated status of refuge of Fukushima residents, their dietary life and food distribution from March 11 to 31 just after the accident so as to reevaluate internal exposure dose with Iodine 131. Investigation results showed most of food taken by refugees was confirmed food stock or relief supplies outside from the disaster area and suggested food contaminated with Iodine 131 was not widely consumed and distributed due to limit to send designated vegetables, restriction of tap water intake, damaged distribution facilities and closing down of retail stores. Restriction of tap water intake was only applied partly, so this might cause internal exposure dose due to tap water. (T. Tanaka)

  17. Concerns about the microbiological quality of traditional raw milk cheeses: a worldwide issue

    Directory of Open Access Journals (Sweden)

    Erica Tirloni

    2014-11-01

    Full Text Available Six types of unripened raw milk fresh (Robiola, Crescenza, Primo sale and Formaggella and  “pasta filata” cheeses (Mozzarella and Burrata were evaluated for microbiological parameters. No Listeria monocytogenes or Salmonella spp. were detected, but high microbial counts were revealed. Significantly higher Total Viable Counts (TVC and Enterobacteriaceae counts were observed in “fresh cheese” than in “pasta filata” samples. Values > 6 Log CFU/g were found in 81.3% of fresh vs 50% in pasta filata for TVC and 65.6% vs 12.5% for Enterobacteriaceae, respectively. An evident contamination by Escherichia coli, Coagulase-positive Staphylococci and Pseudomonas spp. was detected in all the cheeses: the causes could be the improper hygiene of the artisanal production practices and the permanence of the cheeses on the refrigerated shelves. A careful attention to the respect of the good manufacturing practices is suggested to avoid the presence of initial high bacterial loads.

  18. Determination of total bacterial count in raw milk by flow cytometry

    Directory of Open Access Journals (Sweden)

    Dubravka Samaržija

    2004-01-01

    Full Text Available The automatic flow cytometry as routine method for total bacterial count determination of raw ex-farm milk has recently been accepted in Croatia. This method significantly differs from the reference method (Standard Plate Count mostly in the presentation of the results obtained. Therefore, this paper summarized experiences in the application of flow cytometry in the dairy laboratories practice. The principle and the practice of the method, methodological details and factors influencing the results were described. In order to avoid problems regarding the interpretation of the results, which aregeneral problems of the quantitative microbiology, this article try to explain an appropriate conversion of the results with regards to SPC/ml, as an official method for the bacteriological quality proposal by the national legislation.

  19. Invited review: Microbial evolution in raw-milk, long-ripened cheeses produced using undefined natural whey starters.

    Science.gov (United States)

    Gatti, Monica; Bottari, Benedetta; Lazzi, Camilla; Neviani, Erasmo; Mucchetti, Germano

    2014-02-01

    The robustness of the starter culture during cheese fermentation is enhanced by the presence of a rich consortium of microbes. Natural starters are consortia of microbes undoubtedly richer than selected starters. Among natural starters, natural whey starters (NWS) are the most common cultures currently used to produce different varieties of cheeses. Undefined NWS are typically used for Italian cooked, long-ripened, extra-hard, raw milk cheeses, such as Parmigiano Reggiano and Grana Padano. Together with raw milk microbiota, NWS are responsible for most cheese characteristics. The microbial ecology of these 2 cheese varieties is based on a complex interaction among starter lactic acid bacteria (SLAB) and nonstarter lactic acid bacteria (NSLAB), which are characterized by their different abilities to grow in a changing substrate. This review aims to summarize the latest findings on Parmigiano Reggiano and Grana Padano to better understand the dynamics of SLAB, which mainly arise from NWS, and NSLAB, which mainly arise from raw milk, and their possible role in determining the characteristics of these cheeses. The review is presented in 4 main sections. The first summarizes the main microbiological and chemical properties of the ripened cheese as determined by cheese-making process variables, as these variables may affect microbial growth. The second describes the microbiota of raw milk as affected by specific milk treatments, from milking to the filling of the cheese milk vat. The third describes the microbiota of NWS, and the fourth reviews the knowledge available on microbial dynamics from curd to ripened cheese. As the dynamics and functionality of complex undefined NWS is one of the most important areas of focus in current food microbiology research, this review may serve as a good starting point for implementing future studies on microbial diversity and functionality of undefined cheese starter cultures. Copyright © 2014 American Dairy Science Association

  20. Effective heat inactivation of Mycobacterium avium subsp. paratuberculosis in raw milk contaminated with naturally infected feces.

    Science.gov (United States)

    Rademaker, Jan L W; Vissers, Marc M M; Te Giffel, Meike C

    2007-07-01

    The effectiveness of high-temperature, short holding time (HTST) pasteurization and homogenization with respect to inactivation of Mycobacterium avium subsp. paratuberculosis was evaluated quantitatively. This allowed a detailed determination of inactivation kinetics. High concentrations of feces from cows with clinical symptoms of Johne's disease were used to contaminate raw milk in order to realistically mimic possible incidents most closely. Final M. avium subsp. paratuberculosis concentrations varying from 10(2) to 3.5 x 10(5) cells per ml raw milk were used. Heat treatments including industrial HTST were simulated on a pilot scale with 22 different time-temperature combinations, including 60 to 90 degrees C at holding (mean residence) times of 6 to 15 s. Following 72 degrees C and a holding time of 6 s, 70 degrees C for 10 and 15 s, or under more stringent conditions, no viable M. avium subsp. paratuberculosis cells were recovered, resulting in >4.2- to >7.1-fold reductions, depending on the original inoculum concentrations. Inactivation kinetic modeling of 69 quantitative data points yielded an E(a) of 305,635 J/mol and an lnk(0) of 107.2, corresponding to a D value of 1.2 s at 72 degrees C and a Z value of 7.7 degrees C. Homogenization did not significantly affect the inactivation. The conclusion can be drawn that HTST pasteurization conditions equal to 15 s at > or =72 degrees C result in a more-than-sevenfold reduction of M. avium subsp. paratuberculosis.

  1. Effective Heat Inactivation of Mycobacterium avium subsp. paratuberculosis in Raw Milk Contaminated with Naturally Infected Feces▿

    Science.gov (United States)

    Rademaker, Jan L. W.; Vissers, Marc M. M.; te Giffel, Meike C.

    2007-01-01

    The effectiveness of high-temperature, short holding time (HTST) pasteurization and homogenization with respect to inactivation of Mycobacterium avium subsp. paratuberculosis was evaluated quantitatively. This allowed a detailed determination of inactivation kinetics. High concentrations of feces from cows with clinical symptoms of Johne's disease were used to contaminate raw milk in order to realistically mimic possible incidents most closely. Final M. avium subsp. paratuberculosis concentrations varying from 102 to 3.5 × 105 cells per ml raw milk were used. Heat treatments including industrial HTST were simulated on a pilot scale with 22 different time-temperature combinations, including 60 to 90°C at holding (mean residence) times of 6 to 15 s. Following 72°C and a holding time of 6 s, 70°C for 10 and 15 s, or under more stringent conditions, no viable M. avium subsp. paratuberculosis cells were recovered, resulting in >4.2- to >7.1-fold reductions, depending on the original inoculum concentrations. Inactivation kinetic modeling of 69 quantitative data points yielded an Ea of 305,635 J/mol and an lnk0 of 107.2, corresponding to a D value of 1.2 s at 72°C and a Z value of 7.7°C. Homogenization did not significantly affect the inactivation. The conclusion can be drawn that HTST pasteurization conditions equal to 15 s at ≥72°C result in a more-than-sevenfold reduction of M. avium subsp. paratuberculosis. PMID:17496131

  2. Occurrence of Staphylococcus aureus on Farms with Small Scale Production of Raw Milk Cheeses in Poland

    Directory of Open Access Journals (Sweden)

    Jolanta G. Rola

    2016-03-01

    Full Text Available This paper describes the results of a 3-year study on the prevalence, enterotoxinogenicity and resistance to antimicrobials of S. aureus isolated on dairy farms with small scale production of raw cow milk cheeses. The samples of raw milk, semi-finished products and the final products as well as swabs were collected between 2011 and 2013 from nine dairy farms in Poland. A total of 244 samples were examined, of which 122 (50.0% were contaminated with S. aureus including 18 of 26 (69.2% mature cheese samples with log10 CFU g−1 between <1- and 7.41. In swabs collected from the staff and production environment the highest contamination rate with coagulase positive staphylococci (CPS was detected on hands of cheese makers (4.34 log10 CFU/swab. None of the cheese samples contaminated with CPS contained staphylococcal enterotoxins (SEs. However, 55 of 122 (45.1% S. aureus isolates possessed SEs genes, mainly (26 of 55; 47.3% a combination of the sed, sej and ser genes. Furthermore, the sep (15 of 55; 27.3% as well as seg and sei (9 of 55; 16.4% genes were also identified. The remaining S. aureus isolates possessed the sea gene (one isolate, the combination of sec, seg and sei (three isolates as well as the sed, sej, sep and ser markers together (one CPS. Resistance to penicillin (62 of 122 isolates; 50.8% was the most common among the tested isolates. Some CPS were also resistant to chloramphenicol (7; 5.7% and tetracycline (5; 4.1%. The obtained results indicated that the analyzed cheeses were safe for consumers. To improve the microbiological quality of traditional cheese products more attention should be paid to animal welfare and hygiene practices during the process of cheese manufacturing in some dairy farms.

  3. Nitrogen gas flushing can be bactericidal: the temperature-dependent destiny of Bacillus weihenstephanensis KBAB4 under a pure N2 atmosphere.

    Science.gov (United States)

    Munsch-Alatossava, Patricia; Alatossava, Tapani

    2014-01-01

    Gram-negative Pseudomonas and Gram-positive Bacillus are the most common spoilage bacteria in raw and pasteurized milk, respectively. In previous studies, nitrogen (N2) gas flushing treatments of raw and pasteurized milk at cold chain-temperatures inhibited bacterial spoilage and highlighted different susceptibilities to the N2 treatment with the exclusion of certain bacterial types. Here, we investigated the effects of pure N2 gas flushing on representative strains of these genera grown in mono- or co-cultures at 15 and 25°C. Bacillus weihenstephanensis, a frequent inhabitant of fluid dairy products, is represented by the genome-sequenced KBAB4 strain. Among Pseudomonas, P. tolaasii LMG 2342(T) and strain C1, a raw milk psychrotroph, were selected. The N2 gas flushing treatment revealed: (1) temperature-dependent responses; (2) inhibition of the growth of both pseudomonads; (3) emergence of small colony variants (SCVs) for B. weihenstephanensis strain KBAB4 at 15°C induced by the N2 treatment or when grown in co-culture with Pseudomonas strains; (4) N2 gas flushing modulates (suppressed or stimulated) bacterial antagonistic reactions in co-cultures; (5) most importantly, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analyses revealed that at 25°C the majority of the KBAB4 cells were killed by pure N2 gas flushing. This observation constitutes the first evidence that N2 gas flushing has bactericidal effects.

  4. Competitive advantage of bacteriocinogenic strains within lactic acid bacteria consortium of raw milk cheese

    Directory of Open Access Journals (Sweden)

    Irena Rogelj

    2011-03-01

    Full Text Available The presence of gene determinants for different bacteriocins has been already demonstrated in traditional Slovenian types of raw milk cheeses ‘Tolminc’ and ‘Kraški’. These genes were present also in the cultivable microbiota. In this research the aim was to establish how the presence of gene determinants for bacteriocins in microbial consortia is reflected in its antimicrobial activity. In addition, one of the goals was to determine whether the strains that carry gene determinants for bacteriocins have any competitive growth advantage in microbial population. Microbial consortium of ‘Tolminc’ cheese was propagated in milk and examined at the end of propagation its antimicrobial activity and the presence of gene determinants for bacteriocins. Comparison of the results obtained before and after propagation leaded to the conclusion that most of the strains possessing gene determinants for bacteriocins were unable to persist during propagation. The strains which did persist during propagation carried gene determinants for enterocins P, L50B and cytolysin. Antimicrobial activity of consortium before and after propagation was not substantially different and cannot be attributed to any of detected bacteriocins.

  5. Molecular screening of bovine raw milk for the presence of Shiga toxin-producing Escherichia coli (STEC on dairy farms

    Directory of Open Access Journals (Sweden)

    Tatiane Vendramin

    2014-09-01

    Full Text Available Milkborne transmission of Shiga toxin- producing Escherichia coli (STEC has raised considerable concern due to recent outbreaks worldwide and poses a threat to public health. The aim of this study was to develop a sensitive and specific multiplex PCR assay to detect the presence of STEC in bovine raw milk. To identify E. coli (ATCC 25922 contamination, the gene uspA was used, and PCR sensitivity and specificity were accessed by testing diluted samples ranging from 2 to 2.0 × 10(6 CFU/mL. To detect STEC, the stx1 and stx2 genes were selected as targets. After reaction standardization, the multiplex assay was tested in raw milk collected from 101 cows on dairy farms. PCR assay for E. coli detection had a specificity of 100% and sensitivity of 79% (P<0.0001, with a lower detection limit of 2 CFU/mL. Multiplex PCR assay had 100% sensitivity for E. coli positive raw milk samples, and 31.1% were contaminated with STEC, 28.3% of stx2, and 1.9% of stx1. The multiplex PCR assay described in the present study can be employed to identify and screen E. coli harboring stx1 and stx2 genes in raw milk on dairy farms and in industries.

  6. Effects of somatic cell count in subclinical mastitis on raw milk quality in dairy farms of Khuzestan province

    Directory of Open Access Journals (Sweden)

    mohammad Hossieni nejad

    2016-01-01

    Full Text Available Mastitis is an infectious disease that is spread in livestock and can cause cattle mortality. Generally a cow with mastitis has a 15 per cent decrease in milk production. In addition, losses from changes in some components of milk should also be considered. Any change in milk properties can be severe hazard for milk producers, dairy factories and consumers. In this study, the effect of somatic cell count on row milk quality of cows affected by subclinical mastitis was studied. For this purpose 240 milk samples were collected from dairy farms with subclinical mastitis (traditional and industrial of Khuzestan province in 2014 and their somatic cell count, protein and lipid contact and acidity determined. The mean±SD for somatic cells, acidity, protein and fat were 3.20×105±1.37×105 SCC/ml, 14.50±0.62 D°, 3.12±0.06% and 3.23±0.14% respectively. After statistical analysis, reverse correlation were found between somatic cell count with milk fat and protein. However, direct correlation was observed between range of milk fat and protein (p>0.01. Furthermore the results indicated that the range of acidity in spring and winter, protein and fat in winter and somatic cell in summer and autumn were more than the other seasons. According to statistical analysis, protein percent of milk samples in industrial farms were higher than traditional farms although the range of somatic cells was higher for traditional milk samples ‏p>0.05 According to the result, it seems that the somatic cell count of milk influences raw milk fat and protein content and acidity.

  7. [Determination of fat, protein and DM in raw milk by portable short-wave near infrared spectrometer].

    Science.gov (United States)

    Li, Xiao-yun; Wang, Jia-hua; Huang, Ya-wei; Han, Dong-hai

    2011-03-01

    Near infrared diffuse reflectance spectroscopy calibrations of fat, protein and DM in raw milk were studied with partial least-squares (PLS) regression using portable short-wave near infrared spectrometer. The results indicated that good calibrations of fat and DM were found, the correlation coefficients were all 0.98, the RMSEC were 0.187 and 0.217, RMSEP were 0.187 and 0.296, the RPDs were 5.02 and 3.20 respectively; the calibration of protein needed to be improved but can be used for practice, the correlation coefficient was 0.95, RMSEC was 0.105, RMSEP was 0.120, and RPD was 2.60. Furthermore, the measuring accuracy was improved by analyzing the correction relation of fat and DM in raw milk This study will probably provide a new on-site method for nondestructive and rapid measurement of milk.

  8. Analysis of the Storage Methods for Raw Human Milk from Mothers with Infants Admitted to a Neonatal Intensive Care Unit, According to Brazilian Regulations.

    Science.gov (United States)

    Grazziotin, Maria Celestina Bonzanini; Grazziotin, Ana Laura; Vidal, Newton Medeiros; Freire, Marcia Helena de Souza; da Silva, Regina Paula Guimarães Vieira Cavalcante

    2016-08-01

    Milk safety is an important concern in neonatal units and human milk banks. Therefore, evidence-based recommendations regarding raw milk handling and storage are needed to safely promote supplying hospitalized infants with their mother's own milk. To evaluate raw human milk storage methods according to Brazilian milk management regulations by investigating the effects of refrigeration (5°C) for 12 hours and freezing (-20°C) for 15 days on the acidity and energy content in a large number of raw milk samples. Expressed milk samples from 100 distinct donors were collected in glass bottles. Each sample was separated into 3 equal portions that were analyzed at room temperature and after either 12 hours of refrigeration or 15 days of freezing. Milk acidity and energy content were determined by Dornic titration and creamatocrit technique, respectively. All samples showed Dornic acidity values within the established acceptable limit (≤ 8°D), as required by Brazilian regulations. In addition, energy content did not significantly differ among fresh, refrigerated and frozen milk samples (median of ~50 kcal/100 mL for each). Most samples tested (> 80%) were considered top quality milk (milk energy content was preserved after storage. We conclude that the storage methods required by Brazilian regulations are suitable to ensure milk safety and energy content of stored milk when supplied to neonates. © The Author(s) 2016.

  9. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing.

    Science.gov (United States)

    Li, Ling; Renye, John A; Feng, Ling; Zeng, Qingkun; Tang, Yan; Huang, Li; Ren, Daxi; Yang, Pan

    2016-09-01

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High-quality samples of raw buffalo milk were obtained from 3 dairy farms in the Guangxi province in southern China. Five liters of each milk sample were pasteurized (72°C; 15 s); and both raw and pasteurized milks were stored at refrigeration temperature (1-4°C) for various times with their microbial communities characterized using the Illumina Miseq platform (Novogene, Beijing, China). Results showed that both raw and pasteurized milks contained a diverse microbial population and that the populations changed over time during storage. In raw buffalo milk, Lactococcus and Streptococcus dominated the population within the first 24h; however, when stored for up to 72h the dominant bacteria were members of the Pseudomonas and Acinetobacter genera, totaling more than 60% of the community. In pasteurized buffalo milk, the microbial population shifted from a Lactococcus-dominated community (7d), to one containing more than 84% Paenibacillus by 21d of storage. To increase the shelf-life of buffalo milk and its products, raw milk needs to be refrigerated immediately after milking and throughout transport, and should be monitored for the presence of Paenibacillus. Results from this study suggest pasteurization should be performed within 24h of raw milk collection, when the number of psychrotrophic bacteria are low; however, as Paenibacillus spores are resistant to pasteurization, additional antimicrobial treatments may be required to extend shelf-life. The findings from this study are expected to aid in improving the quality and safety of raw and pasteurized buffalo milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Pathogenic bacteria and heavy metals toxicity assessments in evaluating unpasteurized raw milk quality through biochemical tests collected from dairy cows

    Directory of Open Access Journals (Sweden)

    Hamid Iqbal

    2016-11-01

    Full Text Available Objective: To evaluate the hygienic quality by determining the presence of predominant pathogenic microbial contaminants (contagious or environmental and indiscriminate heavy metals contained in unpasteurized milk samples collected from cattle specie of cow. Methods: Raw milk samples were collected in October, 2014 from different regions of District Kohat, Khyber Pakhtunkhwa, Pakistan and cultured on the selective media plates according to the manufacturer instructions to observe pathogenic microbial flora and confirm it with relevant biochemical tests to specify bacterial specie. Results: Milk samples analyzed on MacConkey and nutrient agar media were found contaminated mostly with coliform, Staphylococcus aureus, Enterobacter aerogenes and Proteus vulgaris. Similarly, result of the heavy metals analysis performed using atomic absorption spectrophotometer flame photometry showed that raw milk contains heavy metals residues of lead and cadmium contents at higher levels while copper, zinc and chromium were observed lower than permissible limits whereas manganese within specified recommended values. Conclusions: Microbial contamination of milk and toxic metals is mainly accredited to the scrupulous unhygienic measures during processing of milk exhibiting a wide array of hazardous impacts on human health.

  11. Verocytotoxin-producing Escherichia coli O26 in raw water buffalo (Bubalus bubalis) milk products in Italy.

    Science.gov (United States)

    Lorusso, Vanessa; Dambrosio, Angela; Quaglia, Nicoletta Cristiana; Parisi, Antonio; La Salandra, Giovanna; Lucifora, Giuseppe; Mula, Giuseppina; Virgilio, Sebastiano; Carosielli, Leonardo; Rella, Addolorata; Dario, Marco; Normanno, Giovanni

    2009-08-01

    Escherichia coli 026 is known as a verocytotoxin-producing E. coli (VTEC) organism that causes severe foodborne diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Although cattle are the most important reservoir of VTEC, only a few reports on the role of water buffalo (Bubalus bubalis) as a reservoir of VTEC and on the presence of these organisms in their milk are available. However, in Southern Italy, where water buffalo are intensively reared, an outbreak of hemolytic uremic syndrome due to E. coli 026 has recently been reported, in which the consumption of typical dairy products was considered to be a common risk factor. The aims of this work were to assess the prevalence of E. coli O26 in raw water buffalo milk, to characterize the virulence gene profiles of the isolates, and to evaluate their phenotypic antimicrobial resistance pattern. Of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O26, and the isolate showed the stx1+/stx2+/eae-/hlyA+ genotypic profile. The strain showed resistance against glycopeptides, macrolides, and penicillins. The presence of VTEC organisms in raw water buffalo milk could be considered to be a potential threat to consumers; however, the strict adherence to the processes used in the preparation of the most common buffalo dairy products could strongly mitigate the foodborne risk. To our knowledge, this article reports the first isolation and characterization of E. coli O26 VTEC in raw water buffalo milk.

  12. Evaluation of Antibiotic Residues in Pasteurized and Raw Milk Distributed in the South of Khorasan-e Razavi Province, Iran.

    Science.gov (United States)

    Moghadam, Mortez Mohammadzadeh; Amiri, Mostafa; Riabi, Hamed Ramezani Awal; Riabi, Hamid Ramezani Awal

    2016-12-01

    The presence of antibiotic residues in milk and other products livestock is a health problem which can endanger public health. Antibiotics are used widely in animal husbandry to treat diseases related to bacterial infections. Antimicrobial drugs have been in use for decades in industry. They are commonly used in livestock facilities to treat mastitis. This study aimed to investigate antibiotic residues in pasteurized milk distributed in schools, in milk collection centers, and in milk production factories in Gonabad city. This cross-sectional study was conducted on 251 samples of commercial pasteurized milk packet distributed in schools (code A), raw milk collection centers in Gonabad city (code B), and pasteurized milk production factories (code C) in Gonabad city. The Copan test kit of Denmark Christian Hansen Company was used to monitor antibiotic residues in milk. The data were analysed employing Chi-square test and one-way analysis of variance (ANOVA) to determine significant differences using SPSS software version 20. The significant level was considered at pmilk samples were collected out of which 143 (57%) were code A, 84 (33.5%) code B and 24 (9.6%) code C. Total number of 189 samples (75.2%) were negative and 62 (24.8%) were positive. From the three types of milk samples, 41 samples (28.7%) of the code A, 18 samples (21.4%) of the code B and 3 samples (12.5%) of the code C were positive. In general, from the milk samples most contaminated with antibiotics, 17 samples were positive in January and regarding code A, 13 samples were positive in the same month. There was not a significant difference among the three types of milk (p>0.05). The highest number of milk samples (n=7) contaminated with antibiotics were related to code B (38.5%). Most positive cases were related to code A in winter. Also, there was no significant difference among the three types of contaminated milk regarding the year and month (p=0.164 and p=0.917, respectively). Pasteurized milk

  13. Pseudomonas helleri sp. nov. and Pseudomonas weihenstephanensis sp. nov., isolated from raw cow's milk.

    Science.gov (United States)

    von Neubeck, M; Huptas, C; Glück, C; Krewinkel, M; Stoeckel, M; Stressler, T; Fischer, L; Hinrichs, J; Scherer, S; Wenning, M

    2016-03-01

    Analysis of the microbiota of raw cow's milk and semi-finished milk products yielded seven isolates assigned to the genus Pseudomonas that formed two individual groups in a phylogenetic analysis based on partial rpoD and 16S rRNA gene sequences. The two groups could be differentiated from each other and also from their closest relatives as well as from the type species Pseudomonas aeruginosa by phenotypic and chemotaxonomic characterization and average nucleotide identity (ANIb) values calculated from draft genome assemblies. ANIb values within the groups were higher than 97.3 %, whereas similarity values to the closest relatives were 85 % or less. The major cellular lipids of strains WS4917T and WS4993T were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol; the major quinone was Q-9 in both strains, with small amounts of Q-8 in strain WS4917T. The DNA G+C contents of strains WS4917T and WS4993T were 58.08 and 57.30 mol%, respectively. Based on these data, strains WS4917T, WS4995 ( = DSM 29141 = LMG 28434), WS4999, WS5001 and WS5002 should be considered as representatives of a novel species of the genus Pseudomonas, for which the name Pseudomonas helleri sp. nov. is proposed. The type strain of Pseudomonas helleri is strain WS4917T ( = DSM 29165T = LMG 28433T). Strains WS4993T and WS4994 ( = DSM 29140 = LMG 28438) should be recognized as representing a second novel species of the genus Pseudomonas, for which the name Pseudomonas weihenstephanensis sp. nov. is proposed. The type strain of Pseudomonas weihenstephanensis is strain WS4993T ( = DSM 29166T = LMG 28437T).

  14. Effects of seasonal change and parity on raw milk composition and related indices in Chinese Holstein cows in northern China.

    Science.gov (United States)

    Yang, L; Yang, Q; Yi, M; Pang, Z H; Xiong, B H

    2013-01-01

    This study was to investigate the effects of seasonal change and parity on milk composition and related indices, and to analyze the relationships among milk indices in Chinese Holstein cows from an intensive dairy farm in northern China. The 6,520 sets of complete Dairy Herd Improvement data were obtained and grouped by natural month and parity. The data included daily milk yield (DMY), milk solids percentage (MSP), milk fat percentage (MFP), milk protein percentage (MPP), milk lactose percentage (MLP), somatic cell count (SCC), somatic cell score (SCS), milk production loss (MPL), and fat-to-protein ratio (FPR). Data analysis showed that the above 9 indices were affected by both seasonal change and parity. However, the interaction between parity and seasonal change showed effects on MLP, SCS, MPL, and DMY, but no effects on MFP, MPP, MSP, and FPR. Duncan's multiple comparison on seasonal change showed that DMY (23.58 kg/d), MSP (12.35%), MPP (3.02%), and MFP (3.81%) were the lowest in June, but SCC (288.7 × 10(3)/mL) and MPL (0.69 kg/d) were the lowest in January; FPR (1.32) was the highest in February. Meanwhile, Duncan's multiple comparison on parities showed that MSP, MPP, and MLP were reduced rapidly in the fourth lactation, but SCC and MPL increased with increasing parities. The canonical correlation analysis for indices showed that SCS had high positive correlation with MPL (0.8360). Therefore, a few models were developed to quantify the effects of seasonal change and parity on raw milk composition using the Wood model. The changing patterns of milk composition and related indices in different months and parities could provide scientific evidence for improving feeding management and nutritional supplementation of Chinese Holstein cows. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Extension of raw milk quality through supplementation of hydrocyanic acid from fresh cassava peel in dairy cattle diet

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-12-01

    Full Text Available The objective of this study was to evaluate the effects on the extension of raw milk quality through supplementation of hydrocyanic acid (HCN levels from fresh cassava peel (FCPe in dairy cattle diet by increasing the milk thiocyanate (SCN concentration and lactoperoxidase (LP activity. The sample was twenty-four Holstein Friesian crossbred lactating dairy cows, averaging 87±31 days in milk (DIM, 13.4±2.9 kg of milk and 397±52 kg body weight (BW. All cows were fed the control diet with 6.5 kg/d of 21% crude protein (CP concentrate and ad libitum grass silage (GS. The treatments groups were as follows: 1 the control diet for the 1st group, the 2nd group received the control diet supplemented with 400 g/d of FCPe (75 ppm HCN and the 3rd group received the control diet supplemented with 800 g/d of FCPe (150 ppm HCN. The results showed that 800 g/h/d FCPe enhanced the efficiency of LP activity in raw milk to reduce total bacterial count (TBC and coliform count (CC; therefore, 400 g/h/d FCPe can be used in the concentrate for lactating dairy cows.

  16. Compositional and biochemical changes in Genestoso cheese, a Spanish raw cow's milk variety, during ripening.

    Science.gov (United States)

    Arenas, Ricardo; González, Leticia; Sacristán, Noelia; Tornadijo, María E; Fresno, José M

    2015-03-15

    Physicochemical characteristics, proteolysis and lipolysis were studied throughout the ripening of eight batches of a traditional Spanish variety made from raw cow's milk, in order to establish a basis for its industrial production. The main compositional characteristics of this cheese after 60 days of ripening were its high proportion of total solids (TS; 752 g kg⁻¹ of cheese), an average content of protein (452.8 g kg⁻¹ TS) and fat (475.1 g kg⁻¹ TS) and the presence of residual lactose (12.5 g kg⁻¹ TS). Its pH value (4.04) was extremely low. Phosphorus (5.13 g kg⁻¹ TS) and sodium (8.29 g kg⁻¹ TS) were the most abundant mineral elements in cheese, whereas calcium levels (1.92 g kg⁻¹ TS) were very low. Proteolysis extension and depth were very low, which resulted in almost zero degradation of αs1- and β-casein. Fat acidity increased during ripening, reaching final values of 50.1 mg KOH kg⁻¹ of fat. The main free fatty acid was C16:0, followed by C18:1 and C14:0. These results suggest that this variety undergoes a limited proteolysis and moderate lipolysis during ripening. The low pH, low calcium content and limited proteolysis led to a crumbly texture in this cheese variety. © 2014 Society of Chemical Industry.

  17. Monitoring of aflatoxin M1 in raw cow milk in Croatia during winter 2015

    Directory of Open Access Journals (Sweden)

    Nina Bilandžić

    2016-01-01

    Full Text Available A total of 548 raw milk samples were collected in the western, central and eastern regions of Croatia during February and March 2015. Aflatoxin M1 (AFM1 concentrations were quantified by the enzyme immunoassay method. The method limits of detection (LOD and quantification (LOQ were 22.2 and 34.2 ng/kg, respectively. The mean AFM1 levels measured in the three regions were (ng/kg as follows: western 3.69, central 3.11 and eastern 4.14. In total, the 548 samples analysed concentrations were below the LOD value and accordingly below the European Union maximum residue level (EU MRL of 50 ng/kg. The results suggest an absence of use of contaminated with aflatoxin B1 supplementary feedstuff for lactating cows in winter 2015. Such results might be related to the improved storage conditions for feed as well as to the enhanced and more stringent feed control system for mycotoxins in Croatia.

  18. Bacteriocin-Producing Enterococcus faecium LCW 44: A High Potential Probiotic Candidate from Raw Camel Milk.

    Science.gov (United States)

    Vimont, Allison; Fernandez, Benoît; Hammami, Riadh; Ababsa, Ahlem; Daba, Hocine; Fliss, Ismaïl

    2017-01-01

    Bacterial isolates from raw camel milk were screened for antibacterial activity using the agar diffusion assay. Ten isolates selected for their inhibition of Gram-positive bacteria were identified by 16S sequencing as Enterococcus faecium or durans . An isolate named E. faecium LCW 44 exhibited the broadest antibacterial spectrum with an inhibitory activity against several Gram-positive strains belonging to the genera Clostridium , Listeria , Staphylococcus , and Lactobacillus. E. faecium LCW 44 was shown to produce N-formylated enterocins L50A and L50B, as revealed by mass spectrometry and PCR analyses. This isolate did not harbor any of the virulence factors tested and was shown to be sensitive to all tested antibiotics. It showed high resistance to gastric and intestinal conditions (78 ± 4% survival). Its adhesion index was evaluated at 176 ± 86 and 24 ± 86 on Caco-2 cells and HT-29 cells, respectively, and it significantly reduced adhesion of Listeria monocytogenes by 65 and 49%, respectively. In Macfarlane broth (simulating the nutrient content of the colon), counts of L. monocytogenes were reduced by 2 log 10 cycles after 24 h in co-culture with E. faecium LCW 44, compared to the increase of 4 log 10 cycles when cultured alone. Comparison with a bacteriocin-non-producing mutant of E. faecium LCW 44 strongly suggests that inhibition of L. monocytogenes was due to bacteriocin production. Altogether, E. faecium LCW 44 thus has potential for use as a probiotic for humans and veterinary medicine.

  19. Raw drone milk of honeybees elicits uterotrophic effect in rats: evidence for estrogenic activity.

    Science.gov (United States)

    Seres, Adrienn B; Ducza, Eszter; Báthori, Mária; Hunyadi, Attila; Béni, Zoltán; Dékány, Miklós; Gáspár, Róbert

    2013-05-01

    Numerous honeybee products are used in medicine, but the literature furnishes no information concerning the effects of the drone milk (DM), although drone brood, which is similar to DM, was reported to elicit a hormone-like strengthening effect. In certain countries, DM is traditionally used to treat infertility and to promote vitality in both men and women. The aim of this study was to determine the putative estrogen hormone-like effect of raw DM in rats and to identify the effective compounds. Uterotrophic assays revealed that DM increased the relative weight of the immature rat uterus. This effect was confirmed by reverse transcription polymerase chain-reaction and Western blot methods, in which the mRNA and protein expression of the estrogen-dependent peptide complement component C3 was determined. Column chromatography and uterotrophic assays were used to fractionate and check bioactivity, respectively. The active compound after the last fractionation was identified by the nuclear magnetic resonance and mass spectrometry techniques as E-dec-2-enedioic acid, which is very similar to the fatty acids with estrogenic activity that were previously isolated from royal jelly. These results lead us to suppose that E-dec-2-enedioic acid is responsible for the estrogen-like effect of DM. This appears to be the first report on the pharmacological effects of DM and E-dec-2-enedioic acid in mammals.

  20. Bacteriocin-Producing Enterococcus faecium LCW 44: A High Potential Probiotic Candidate from Raw Camel Milk

    Directory of Open Access Journals (Sweden)

    Allison Vimont

    2017-05-01

    Full Text Available Bacterial isolates from raw camel milk were screened for antibacterial activity using the agar diffusion assay. Ten isolates selected for their inhibition of Gram-positive bacteria were identified by 16S sequencing as Enterococcus faecium or durans. An isolate named E. faecium LCW 44 exhibited the broadest antibacterial spectrum with an inhibitory activity against several Gram-positive strains belonging to the genera Clostridium, Listeria, Staphylococcus, and Lactobacillus. E. faecium LCW 44 was shown to produce N-formylated enterocins L50A and L50B, as revealed by mass spectrometry and PCR analyses. This isolate did not harbor any of the virulence factors tested and was shown to be sensitive to all tested antibiotics. It showed high resistance to gastric and intestinal conditions (78 ± 4% survival. Its adhesion index was evaluated at 176 ± 86 and 24 ± 86 on Caco-2 cells and HT-29 cells, respectively, and it significantly reduced adhesion of Listeria monocytogenes by 65 and 49%, respectively. In Macfarlane broth (simulating the nutrient content of the colon, counts of L. monocytogenes were reduced by 2 log10 cycles after 24 h in co-culture with E. faecium LCW 44, compared to the increase of 4 log10 cycles when cultured alone. Comparison with a bacteriocin-non-producing mutant of E. faecium LCW 44 strongly suggests that inhibition of L. monocytogenes was due to bacteriocin production. Altogether, E. faecium LCW 44 thus has potential for use as a probiotic for humans and veterinary medicine.

  1. CHARACTERIZATION OF AUTOCHTHONUS LACTIC FLORA OF A CAMPANIAN CHILLI CHEESE PRODUCED FROM RAW SHEEP MILK

    Directory of Open Access Journals (Sweden)

    A. Mormile

    2012-08-01

    Full Text Available The natural lactic flora of the artisanal chilli “Tramonti” cheese, a typical product manufactured in the “Lattari mountains”, area of Salerno province (Italy, was investigated. Particular attention was paid to the growth dynamics assessment and to the molecular identification of the indigenous lactic acid bacteria involved in the ripening of this cheese made with raw sheep milk without starter cultures. One batch was monitored taking 4 sample on 0, 30, 50 and 105 ripening days. Lactobacillus and Lactococcus were enumerated and randomly isolated on MRS and LM17 agar (32ºC x 48h -mesophilic flora- and 42°C x 48h -thermophilic flora, respectively. N. 66 presumptive lactic acid bacteria isolates, gram positive and catalase negative, were genotipically identified by Ribotyping. Mesophilic Lactobacillus remained at levels of 107 cfu/g during whole maturation time and thermophilic Lactobacillus, from initial values of 105 cfu/g, reached concentratios of 106 cfu/g at the end of maturation. Mesophilic and thermophilic Lactococcus showed, on average, levels of 106 since the beginning of the ripening. Ribotyping allowed to detect 4 lactic acid bacteria species: Enterococcus faecium (65,15%, Lactococcus lactis spp. cremoris (24,24%, Enterococcus faecalis (6,06% and Enterococcus durans (4,54%, showing the diversity of indigenous lactic acid bacteria of chilli “Tramonti” cheese.

  2. Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk.

    Science.gov (United States)

    Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter

    2014-07-01

    Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

  3. Quality of raw cow milk in Republic of Macedonia determined through the testing of somatic cell count and total viable count

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2008-11-01

    Full Text Available Somatic cells count and total viable count are criteria used to estimate the compliance of raw cow milk with the Book of rules for demands for safety and hygiene and procedures for official controls of milk and milk products, Official Gazette of RM 157/2007. According to the given demands, raw milk operators are obliged to conduct all procedures and to guarantee that milk is in compliance with the criteria laid down in Book of rules. At the same time, Republic of Macedonia have to fulfill EU criteria laid down in Directive 92/46 (Council directive 92/46/EEC laying down the health rules for the production and placing on the market of raw milk, heat-treated milk and milkbased products for quality of raw milk as part of implementation of community legislation and milk production. The independent laboratory for milk quality control at FVM-Skopje, in frame of its activities in the period February- August 2008 has conducted a study for obtaining preliminary results for the situation with raw milk quality produced in R. of Macedonia for somatic cells counts and total viable count. In the study we analyzed 2065 samples for TVC and 1625 samples for SCC of raw milk samples produced in different parts of the country. From the tested samples only 41,8% fulfill criteria for SCC and 41,45% criteria for TVC lay down in Book of rules for 2008. Assessment of the results in light of Council Directive it is obvious that only 42,7% of the samples for SCC and 10,7% for TVC fulfill the criteria of Council Directive having in mind different requirements vs. Book of rules.

  4. Raw Cow’s Milk Prevents the Development of Airway Inflammation in a Murine House Dust Mite-Induced Asthma Model

    Directory of Open Access Journals (Sweden)

    Suzanne Abbring

    2017-08-01

    Full Text Available Epidemiological studies show an inverse relation between raw cow’s milk consumption and the development of asthma. This protective effect seems to be abolished by milk processing. However, evidence for a causal relationship is lacking, and direct comparisons between raw and processed milk are hardly studied. Therefore, this study investigated the preventive capacity of raw and heated raw milk on the development of house dust mite (HDM-induced allergic asthma in mice. Six- to seven-week-old male BALB/c mice were intranasally (i.n. sensitized with 1 µg HDM or PBS on day 0, followed by an i.n. challenge with 10 µg HDM or PBS on days 7–11. In addition, mice were fed 0.5 mL raw cow’s milk, heated raw cow’s milk, or PBS three times a week throughout the study, starting 1 day before sensitization. On day 14, airway hyperresponsiveness (AHR in response to increasing doses of methacholine was measured to assess lung function. Bronchoalveolar lavage fluid (BALF and lungs were furthermore collected to study the extent of airway inflammation. Raw milk prevented both HDM-induced AHR and pulmonary eosinophilic inflammation, whereas heated raw milk did not. Both milk types suppressed the Th2-polarizing chemokine CCL17 in lung homogenates and reduced lung Th2 and Th17 cell frequency. IL-4 and IL-13 production after ex vivo restimulation of lung T cells with HDM was also reduced by both milk types. However, local IL-5 and IL-13 concentrations were only suppressed by raw milk. These findings support the asthma-protective capacity of raw cow’s milk and show the importance of reduced local type 2 cytokine levels. Heated raw milk did not show an asthma-protective effect, which indicates the involvement of heat-sensitive components. Besides causal evidence, this study provides the basis for further mechanistic studies.

  5. EFFECTIVENESS OF RISK MANAGEMENT IN DIRECTLY RAW MILK SELLING AT “E. AVANZI” CENTER OF PISA UNIVERSITY

    Directory of Open Access Journals (Sweden)

    S. Rindi

    2010-03-01

    Full Text Available Authors show the results about the effectiveness verification of prevention measures adopted in raw milk directly selling at “E. Avanzi” Centre of Pisa University. The good hygienic practices applied during production, storage and selling phases demonstrated to guarantee, in raw milk, conditions complying to hygienic criteria provided for the current regulation in Tuscany. The effectiveness verification about risk communication, carried out interviewing a sample of buyers, shows as, beside a predominant attitude towards attention to potential hygienic risks, overstay areas of reduced awareness about food risk and the ways to manage prevention. Authors hope for, in this context, such as in other similar productions, the approach yet launched towards continuous improvement of good hygienic practices adopted by businesses, could be extended to risk communication, with the aim to promote conscious and responsable choices of consumer.

  6. Occurrence of aflatoxin M(1) in some samples of UHT, raw & pasteurized milk from Indian states of Karnataka and Tamilnadu.

    Science.gov (United States)

    Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema

    2012-11-01

    Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. The potential of the endolysin Lysdb from Lactobacillus delbrueckii phage for combating Staphylococcus aureus during cheese manufacture from raw milk.

    Science.gov (United States)

    Guo, Tingting; Xin, YongPing; Zhang, Chenchen; Ouyang, Xudong; Kong, Jian

    2016-04-01

    Phage endolysins have received increased attention in recent times as potential antibacterial agents and the biopreservatives in food production processes. Staphylococcus aureus is one of the most common pathogens in bacterial food poisoning outbreaks. In this study, the endolysin Lysdb, one of the two-component cell lysis cassette of Lactobacillus delbrueckii phage phiLdb, was shown to possess a muramidase domain and catalytic sites with homology to Chalaropsis-type lysozymes. Peptidoglycan hydrolytic bond specificity determination revealed that Lysdb was able to cleave the 6-O-acetylated peptidoglycans present in the cell walls of S. aureus. Turbidity reduction assays demonstrated that Lysdb could effectively lyse the S. aureus live cells under acidic and mesothermal conditions. To further evaluate the ability of Lysdb as a potential antibacterial agent against S. aureus in cheese manufacture, Lactobacillus casei BL23 was engineered to constitutively deliver active Lysdb to challenge S. aureus in lab-scale cheese making from raw milk. Compared with the raw milk, the viable counts of S. aureus were reduced by 10(5)-fold in the cheese inoculated with the engineered L. casei strain during the fermentation process, and the pathogenic bacterial numbers remained at a low level (10(4) CFU/g) after 6 weeks of ripening at 10 °C. Taken together, all results indicated that the Lysdb has the function as an effective tool for combating S. aureus during cheese manufacture from raw milk.

  8. Exploratory analysis of dynamics of frequency distribution of raw cow milk quality indicators in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2011-01-01

    Full Text Available A consistent link of the raw milk quality (RMQ to the farmer price is essential. The aim was to analyse the properties of milk quality indicators (MQIs and propose a new synthetic relative MQI (SQSM from among various individual MQIs. SQSM could serve for consistent inclusion each quality change into the price. The paper was focused on exploratory analysis (normality (N testing of files of MQIs. On the basis of the results, the MQIs were divided into two groups without and with necessity of original data transformation (TRN. Log and Box–Cox TRNs were tested in terms of possibilities of the files approach to the normal data frequency distribution (FD. The compositional MQIs deviated less and health and hygienic MQIs more from normal FD in original data (P < 0.05. The TRNs approached the data files to N very markedly in health and hygienic MQIs. The synthesis of various values of MQIs into SQSM was proposed. SQSM values were derived from model file of real data about MQIs and validated for use at farmer milk price modifications by the normality FD test. 33.3% of month SQSM files were normal (P > 0.05, the other were very close to the N with negligible deviations. The useability of the SQSM system for the balancing of raw milk purchase price premiums and penalties was tentatively confirmed.

  9. Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011.

    Science.gov (United States)

    Vahedi, M; Nasrolahei, M; Sharif, M; Mirabi, A M

    2013-06-01

    The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes by culture methods and biochemical tests. Data analysis was performed by SPSS software using Chi2 test and described in percentage. In the raw milk, contamination with E. coli, coliforms and Staphylococcus aureus was observed in 42 (42%), 36 (36%) and 22 (22%) of samples respectively, and the same for the pasteurized milk samples was 9 (9%), 2 (2%) and 2 (2%), respectively. Listeria monocytogenes was not detected in any sample. Presence of E. coli in the milk could be due to contamination with waste water and fecal materials. Considering the contamination of raw and pasteurized milk with E. coli and coliforms, sanitary practice during collecting and transporting, particularly in the summer season is recommended.

  10. High-pressure homogenization of raw and pasteurized milk modifies the yield, composition, and texture of queso fresco cheese.

    Science.gov (United States)

    Escobar, D; Clark, S; Ganesan, V; Repiso, L; Waller, J; Harte, F

    2011-03-01

    High-pressure homogenization (HPH) of milk was studied as an alternative processing operation in the manufacturing of queso fresco cheese. Raw and pasteurized (65°C for 30 min) milks were subjected to HPH at 0, 100, 200, and 300 MPa and then used to manufacture queso fresco. The cheeses were evaluated for yield, moisture content, titratable acidity, nitrogen content, whey protein content, yield force, yield strain, and tactile texture by instrumental or trained panel analyses. The combination of HPH and thermal processing of milk resulted in cheeses with increased yield and moisture content. The net amount of protein transferred to the cheese per kilogram of milk remained constant for all treatments except raw milk processed at 300 MPa. The highest cheese yield, moisture content, and crumbliness were obtained for thermally processed milk subjected to HPH at 300 MPa. The principal component analysis of all measured variables showed that the variables yield, moisture content, and crumbliness were strongly correlated to each other and negatively correlated to the variables yield strain, protein content (wet basis), and sensory cohesiveness. It is suggested that the combination of thermal processing and HPH promotes thermally induced denaturation of whey protein, together with homogenization-induced dissociation of casein micelles. The combined effect results in queso fresco containing a thin casein-whey matrix that is able to better retain sweet whey. These results indicate that HPH has a strong potential for the manufacture of queso fresco with excellent yield and textural properties. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Human campylobacteriosis related to the consumption of raw milk sold by vending machines in Italy: Quantitative risk assessment based on official controls over four years.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Losio, Marina Nadia; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Merialdi, Giuseppe; Mioni, Renzo; Peli, Angelo; Petruzzelli, Annalisa; Tonucci, Franco; Piva, Silvia; Serraino, Andrea

    2015-09-01

    A quantitative risk assessment (RA) model was developed to describe the risk of campylobacteriosis linked to consumption of raw milk sold in vending machines in Italy. Exposure assessment was based on the official microbiological records of raw milk samples from vending machines monitored by the regional Veterinary Authorities from 2008 to 2011, microbial growth during storage, destruction experiments, consumption frequency of raw milk, serving size, consumption preference and age of consumers. The differential risk considered milk handled under regulation conditions (4°C throughout all phases) and the worst time-temperature field handling conditions detected. Two separate RA models were developed, one for the consumption of boiled milk and the other for the consumption of raw milk, and two different dose-response (D-R) relationships were considered. The RA model predicted no human campylobacteriosis cases per year either in the best (4°C) storage conditions or in the case of thermal abuse in case of boiling raw milk, whereas in case of raw milk consumption the annual estimated campylobacteriosis cases depend on the dose-response relationships used in the model (D-R I or D-R II), the milk time-temperature storage conditions, consumer behaviour and age of consumers, namely young (with two cut-off values of ≤5 or ≤6 years old for the sensitive population) versus adult consumers. The annual estimated cases for young consumers using D-R II for the sensitive population (≤5 years old) ranged between 1013.7/100,000 population and 8110.3/100,000 population and for adult consumers using D-R I between 79.4/100,000 population and 333.1/100,000 population. Quantification of the risks associated with raw milk consumption is necessary from a public health perspective and the proposed RA model represents a useful and flexible tool to perform future RAs based on local consumer habits to support decision-making on safety policies. Further educational programmes for raw milk

  12. Pseudomonas lactis sp. nov. and Pseudomonas paralactis sp. nov., isolated from bovine raw milk.

    Science.gov (United States)

    von Neubeck, Mario; Huptas, Christopher; Glück, Claudia; Krewinkel, Manuel; Stoeckel, Marina; Stressler, Timo; Fischer, Lutz; Hinrichs, Jörg; Scherer, Siegfried; Wenning, Mareike

    2017-06-01

    Five strains, designated WS 4672T, WS 4998, WS 4992T, WS 4997 and WS 5000, isolated from bovine raw milk formed two individual groups in a phylogenetic analysis. The most similar species on the basis of 16S rRNA gene sequences were Pseudomonas azotoformans IAM 1603T, Pseudomonas gessardii CIP 105469T and Pseudomonas libanensis CIP 105460T showing 99.7-99.6 % similarity. Using rpoD gene sequences Pseudomonas veronii LMG 17761T (93.3 %) was most closely related to strain WS 4672T and Pseudomonas libanensis CIP 105460T to strain WS 4992T (93.3 %). The five strains could be differentiated from their closest relatives and from each other by phenotypic and chemotaxonomic characterization and ANIb values calculated from draft genome assemblies. ANIb values of strains WS 4992T and WS4671T to the closest relatives are lower than 90 %. The major cellular polar lipids of both strains are phosphatidylethanolamine, phosphatidylglycerol, a phospholipid and diphosphatidylglycerol, and their major quinone is Q-9. The DNA G+C content of strains WS 4992T and WS 4672T were 60.0  and 59.7  mol%, respectively. Based on these genotypic and phenotypic traits two novel species of the genus Pseudomonas are proposed: Pseudomonas lactis sp. nov. [with type strain WS 4992T (=DSM 29167T=LMG 28435T) and the additional strains WS 4997 and WS 5000], and Pseudomonasparalactis sp. nov. [with type strain WS 4672T (=DSM 29164T=LMG 28439T) and additional strain WS 4998].

  13. Virulence factors and genetic variability of Staphylococcus aureus strains isolated from raw sheep's milk cheese.

    Science.gov (United States)

    Spanu, Vincenzo; Spanu, Carlo; Virdis, Salvatore; Cossu, Francesca; Scarano, Christian; De Santis, Enrico Pietro Luigi

    2012-02-01

    Contamination of dairy products with Staphylococcus aureus can be of animal or human origin. The host pathogen relationship is an important factor determining genetic polymorphism of the strains and their potential virulence. The aim of the present study was to carry out an extensive characterization of virulence factors and to study the genetic variability of S. aureus strains isolated from raw ewe's milk cheese. A total of 100 S. aureus strains isolated from cheese samples produced in 10 artisan cheese factories were analyzed for the presence of enterotoxins (sea-see) and enterotoxins-like genes (seh, sek, sel, sem, seo, sep), leukocidins, exfoliatins, haemolysins, toxic shock syndrome toxin 1 (TSST-1) and the accessory gene regulator alleles (agr). Strains were also typed using pulsed-field gel electrophoresis (PFGE). AMOVA analysis carried out on PFGE and PCR data showed that the major component explaining genetic distance between strains was the dairy of origin. Of the total isolates 81% had a pathogenicity profile ascribable to "animal" biovar while 16% could be related to "human" biovar. The biovar allowed to estimate the most likely origin of the contamination. Minimum inhibitory concentrations (MICs) of nine antimicrobial agents and the presence of the corresponding genes coding for antibiotic resistance was also investigated. 18 strains carrying blaZ gene showed resistance to ampicillin and penicillin and 6 strains carrying tetM gene were resistant to tetracycline. The presence of mecA gene and methicillin resistance, typical of strains of human origin, was never detected. The results obtained in the present study confirm that S. aureus contamination in artisan cheese production is mainly of animal origin. Copyright © 2011. Published by Elsevier B.V.

  14. Milk-run kanban system for raw printed circuit board withdrawal to surface-mounted equipment

    Directory of Open Access Journals (Sweden)

    Swee Li Chee

    2012-12-01

    Full Text Available Purpose:  The paper aims to present a case study and later simulation analysis on a kanban system that incorporating milk-run operation to draw in raw material to the process. Design/methodology/approach:  Data collection at the case study company for ten weeks followed by a process study called value stream mapping. The proposed kanban model is simulated to test its various performances including total output, average flow time, average work-in-process, SME utilization, and average waiting time. Response surface methodology is adopted to generate suitable representative regression models.  Findings: For all performance measures, simulation results showed that the proposed system consistently outperforms the push system currently practiced. Second, the system indicates the advantages of leveling, particularly in the event of machine failure and blockage. Third, operator in the proposed kanban system has a lower utilization, even with the additional material handling task.   Research limitations/implications: This study only begins to reveal the implication of leveling for production control on multi-machine scenario. The simulation of the system is solely based only the case study. The control parameters critical to the case study, were naturally used. The furtherance of the research should include generalizing the system and devising the respective methodology to facilitate wider applications. Practical implications: Originality/value:  The kanban system is proposed in the light of conflicting interests in handling the surface mounting and the related upstream processes. Such aspect is common to electronics assembly industry.

  15. Synergistic Effect of the Lactoperoxidase System and Cinnamon Essential Oil on Total Flora and Salmonella Growth Inhibition in Raw Milk

    Directory of Open Access Journals (Sweden)

    Chiraz Abbes

    2018-01-01

    Full Text Available Despite its antibacterial and antipathogenic effects, the heat treatment of milk induces undesirable changes that can be noted in the overall properties of ultrahigh temperature (UHT milk, such as changes in nutritional and organoleptic properties. Our goal is to find new nonthermal antibacterial technologies for the preservation of raw milk (RM. This study investigates the possible synergistic effect of using a combination of the lactoperoxidase system (LS and 3 μg mL−1 of cinnamon essential oil (cinnamon EO to inactivate the total flora of milk and Salmonella Hadar (S. Hadar. The LS was activated with 30 mg L−1 sodium percarbonate and 14 mg L−1 of sodium thiocyanate. Using this approach, we obtained a synergistic effect with a complete inhibition of the activity of the total flora of the milk and S. Hadar after 12 hours at 25°C. In addition, the attainment of synergy was defined when the inhibitory effect of the two compounds together was greater than the effect observed by each compound added alone. Moreover, the monitoring of the synergistic effect at 4°C for 5 days showed complete inhibition of total flora for 3 days and for S. Hadar it was up to 5 days. To summarize, the current study clearly identified a new inhibitory combination that may be used in food-based applications.

  16. Determination of protein concentration in raw milk by mid-infrared fourier transform infrared/attenuated total reflectance spectroscopy.

    Science.gov (United States)

    Etzion, Y; Linker, R; Cogan, U; Shmulevich, I

    2004-09-01

    This study investigates the potential use of attenuated total reflectance spectroscopy in the mid-infrared range for determining protein concentration in raw cow milk. The determination of protein concentration is based on the characteristic absorbance of milk proteins, which includes 2 absorbance bands in the 1500 to 1700 cm(-1) range, known as the amide I and amide II bands, and absorbance in the 1060 to 1100 cm(-1) range, which is associated with phosphate groups covalently bound to casein proteins. To minimize the influence of the strong water band (centered around 1640 cm(-1)) that overlaps with the amide I and amide II bands, an optimized automatic procedure for accurate water subtraction was applied. Following water subtraction, the spectra were analyzed by 3 methods, namely simple band integration, partial least squares (PLS) and neural networks. For the neural network models, the spectra were first decomposed by principal component analysis (PCA), and the neural network inputs were the spectra principal components scores. In addition, the concentrations of 2 constituents expected to interact with the protein (i.e., fat and lactose) were also used as inputs. These approaches were tested with 235 spectra of standardized raw milk samples, corresponding to 26 protein concentrations in the 2.47 to 3.90% (weight per volume) range. The simple integration method led to very poor results, whereas PLS resulted in prediction errors of about 0.22% protein. The neural network approach led to prediction errors of 0.20% protein when based on PCA scores only, and 0.08% protein when lactose and fat concentrations were also included in the model. These results indicate the potential usefulness of Fourier transform infrared/attenuated total reflectance spectroscopy for rapid, possibly online, determination of protein concentration in raw milk.

  17. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  18. Proteolysis, lipolysis, volatile compounds and sensory characteristics of Hispánico cheeses made using frozen curd from raw and pasteurized ewe milk.

    Science.gov (United States)

    Alonso, Rocío; Picon, Antonia; Gaya, Pilar; Nuñez, Manuel

    2013-02-01

    Hispánico cheese, manufactured from a mixture of cow and ewe milk, is representative of cheese varieties made using milk from more than one animal species in Mediterranean countries. The shortage of ewe milk production in autumn hinders the uniformity of Hispánico cheese composition throughout the year. To surmount this inconvenience of ewe milk seasonality, curds made in spring from raw and pasteurized ewe milk were stored frozen and used four months later for the manufacture of Hispánico cheese. Experimental cheeses were made by mixing fresh curd from pasteurized cow milk with thawed curd from raw or pasteurized ewe milk, and control cheese from a mixture of pasteurized cow and ewe milk in the same proportion. Characteristics of experimental and control cheeses throughout a 60-d ripening period were investigated. On the one hand, the experimental cheese containing frozen curd from raw ewe milk showed the highest counts of staphylococci, Gram-negative bacteria and coliforms, the highest levels of aminopeptidase and esterase activity, and the highest concentrations of free amino acids, free fatty acids, alcohols and esters. On the other, the experimental cheese containing frozen curd from pasteurized ewe milk had concentrations of free amino acids, free fatty acids and volatile compounds similar to those of control cheese, with the only exception being a higher level of ketones. Flavour intensity reached the highest scores in the experimental cheese containing frozen curd from raw ewe milk, followed by the experimental cheese containing frozen curd from pasteurized ewe milk. Flavour quality scores of both experimental cheeses were similar, and lower than those of control cheese.

  19. Recovering traditional raw-milk Tetilla cheese flavour and sensory attributes by using Kocuria varians and Yarrowia lipolytica adjunct cultures.

    Science.gov (United States)

    Centeno, J A; Garabal, J I; Docampo, F; Lorenzo, J M; Carballo, J

    2017-06-19

    The rationale of the present study was to evaluate the potential of microbial adjunct cultures including Kocuria varians and/or Yarrowia lipolytica strains in the recovery of the typical sensory profile of traditional (raw-milk) Tetilla cheese. Four batches of Tetilla cheese, a short ripened cows' milk cheese produced in Galicia (NW Spain), were made in duplicate from pasteurized milk inoculated with different microbial cultures. A control batch was manufactured by adding a mesophilic commercial D-starter only. The other three batches were made with the same starter after a cheese-milk pre-ripening step carried out with (i) an adjunct culture of K. varians, (ii) an adjunct culture of Y. lipolytica, or (iii) a combination of both adjunct cultures. The highest pH and water activity values, associated with softer textures were determined in the cheeses manufactured with the Y. lipolytica adjunct after 21days of ripening. The contents of the volatile compounds 3-methylbutanol, dimethyl disulfide and dimethyl trisulfide were higher in the cheeses made with only the K. varians adjunct than in the cheeses made with the only yeast adjunct and in the control cheeses. The contents of hexanoic and octanoic acids were highest in the cheeses made with the Y. lipolytica adjunct, and levels of ethyl hexanoate, ethyl octanoate and ethyl decanoate were higher in the cheeses made with only the yeast adjunct than in the other batches of cheese. The cheeses manufactured with both adjunct cultures were awarded the highest scores for flavour and overall sensory parameters (considering the standards of the traditional product) and were considered very similar to 'good quality' artisanal raw-milk cheeses. We conclude that use of selected Micrococcaceae and Y. lipolytica strains as adjunct cultures would differentiate the sensory properties and contribute to the quality and typicality of the short-ripened rennet-curd Galician Tetilla and Arzúa-Ulloa cheeses. Copyright © 2017 Elsevier B

  20. Prevalence and molecular characteristics of Staphylococcus aureus, including methicillin resistant strains, isolated from bulk can milk and raw milk products in pastoral communities of South-West Uganda.

    Science.gov (United States)

    Asiimwe, Benon B; Baldan, Rossella; Trovato, Alberto; Cirillo, Daniela M

    2017-06-13

    Staphylococcus aureus strains are now regarded as zoonotic agents. In pastoral settings where human-animal interaction is intimate, multi-drug resistant microorganisms have become an emerging zoonotic issue of public health concern. The study of S. aureus prevalence, antimicrobial resistance and clonal lineages in humans, animals and food in African settings has great relevance, taking into consideration the high diversity of ethnicities, cultures and food habits that determine the lifestyle of the people. Little is known about milk carriage of methicillin resistant S. aureus strains (MRSA) and their virulence factors in Uganda. Here, we present the prevalence of MRSA in bulk can milk and raw milk products in pastoral communities of south-west Uganda. We also present PFGE profiles, spa-types, as well as frequency of enterotoxins genes. S. aureus was identified by the coagulase test, susceptibility testing by the Kirby-Bauer disc diffusion and E-test methods and MRSA by detection of the mecA gene and SCCmec types. The presence of Panton - Valentine Leucocidin (PVL) genes and staphylococcal enterotoxins was determined by PCR, while genotyping was by PFGE and spa typing. S. aureus were isolated from 30/148 (20.3%) milk and 11/91(12%) sour milk samples. mecA gene carriage, hence MRSA, was detected in 23/41 (56.1%) of the isolates, with 21 of the 23 (91.3%) being SCCmec type V; while up to 30/41 (73.2%) of the isolates were resistant to tetracycline. Only five isolates carried the PVL virulence gene, while PFGE typing revealed ten clusters (ranging from two seven isolates each) that comprised 83% of the sample, and only eight isolates with unique pulsotypes. The largest PFGE profile (E) consisted of seven isolates while t7753, t1398, and t2112 were the most common spa-types. Thirty seven of the 41 strains (90.2%) showed at least one of the eight enterotoxin genes tested, with sem 29 (70.7%), sei 25 (61%) and seg 21 (51.2%) being the most frequently observed genes. This

  1. INTERNAL MILIEAU OF DAIRY COWS AT THE BEGINNING OF LACTATION AND ITS INFLUENCE ON COMPOSITION OF RAW MILK

    Directory of Open Access Journals (Sweden)

    Tušimová Eva

    2015-02-01

    between serum ALT and milk sodium (0.738; P<0.05, what points to close relationship between hepatic enzymes and mineral composition of raw milk.

  2. Seasonal Variability of Thermophilic Campylobacter Spp. in Raw Milk Sold by Automatic Vending Machines in Lombardy Region.

    Science.gov (United States)

    Bertasi, Barbara; Losio, Marina Nadia; Daminelli, Paolo; Finazzi, Guido; Serraino, Andrea; Piva, Silvia; Giacometti, Federica; Massella, Elisa; Ostanello, Fabio

    2016-06-03

    In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1%) in different months during the three years considered. The statistical analysis showed a significant difference (P<0.01) of the prevalence of positive samples for thermophilic Campylobacter spp. between warmer and cooler months (2.3 vs 0.6%). The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

  3. Seasonal variability of thermophilic Campylobacter spp. in raw milk sold by automatic vending machines in Lombardy Region

    Directory of Open Access Journals (Sweden)

    Barbara Bertasi

    2016-06-01

    Full Text Available In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1% in different months during the three years considered. The statistical analysis showed a significant difference (PCampylobacter spp. between warmer and cooler months (2.3 vs 0.6%. The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

  4. Total tract nutrient digestion and milk fatty acid profile of dairy cows fed diets containing different levels of whole raw soya beans.

    Science.gov (United States)

    Venturelli, B C; de Freitas Júnior, J E; Takiya, C S; de Araújo, A P C; Santos, M C B; Calomeni, G D; Gardinal, R; Vendramini, T H A; Rennó, F P

    2015-12-01

    Whole oilseeds such as soya beans have been utilized in dairy rations to supply additional fat and protein. However, antinutritional components contained in soya beans, such as trypsin inhibitors and haemagglutinins (lectins) may alter digestibility of nutrients and consequently affect animal performance. The objective of the present experiment was to quantify the effect of different levels of whole raw soya beans in diets of dairy cows on nutrient intake, total tract digestion, nutrient balances and milk yield and composition. Sixteen mid to late-lactation cows (228 ± 20 days in milk; mean ± SD) were used in four replicated 4 × 4 Latin square design experiment with 21-d periods. Cows were assigned to each square according to milk yield and DIM. The animals were randomly allocated to treatments: control (without soya beans addition; CO), WS9, WS18 and WS27, with addition of 9%, 18% and 27% of whole raw soya bean in diet on a dry matter (DM) basis respectively. All diets contained identical forage and concentrate components and consisted of maize silage and concentrate based on ground corn and soya beans at a ratio of 60:40. There were no differences in OM, CP, NDF and NEL intakes (kg/day and MJ/day) among the treatments (p > 0.05). However, DM and NFC intakes were negatively affected (p = 0.04 and p raw soya beans for EE (p raw soya beans. However, the nutritive characteristics of excreted grains were not altered. Milk (kg), milk lactose (kg) and protein (kg) yield decreased linearly (p milk fat content (%) increased linearly (p raw soya beans inclusion. Increasing addition of whole raw soya beans affected milk fatty acid profile with a linear decrease of cis-9-trans 11CLA and total saturated FA; and linear increase of total unsaturated and C18:3 FA. Energy balance was positively affected (p = 0.03) by whole raw soya beans as well as efficiency of NEL milk/DE intake (p = 0.02). Nitrogen balance and microbial protein synthesis were not affected by whole raw soya

  5. Assess the prevalence rate of Campylobacter genus and Campylobacter jejuni species in raw milk collected from the Amol City by Multiplex- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ali Dabiri

    2016-03-01

    Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.

  6. Fatty acid profile and health lipid indices in the raw milk of ewes ...

    African Journals Online (AJOL)

    indoor or part-time grazing) of ewes and dietary supplementation with hemp seed (non-drug varieties of Cannabis sativa L.) on milk production and the composition of milk fatty acids (FAs). The experimental diets were constituted as a 2 x 2 factorial ...

  7. Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk in the northwestern region of Paraná, Brazil.

    Science.gov (United States)

    Sgarioni, Sônia Aparecida; Hirata, Rosario Dominguez Crespo; Hirata, Mario Hiroyuki; Leite, Clarice Queico Fujimura; de Prince, Karina Andrade; de Andrade Leite, Sergio Roberto; Filho, Dirceu Vedovello; Siqueira, Vera Lucia Dias; Caleffi-Ferracioli, Katiany Rizzieri; Cardoso, Rosilene Fressatti

    2014-01-01

    Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw) from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA) and Mycolic acids analysis. Thirteen (25%) raw and 2 (4%) pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum). M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

  8. Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk in the northwestern region of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Sônia Aparecida Sgarioni

    2014-06-01

    Full Text Available Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA and Mycolic acids analysis. Thirteen (25% raw and 2 (4% pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum. M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

  9. The effect of parity on the proportion of important healthy fatty acids in raw milk of Holstein cows

    Directory of Open Access Journals (Sweden)

    Luděk Stádník

    2013-11-01

    Full Text Available The objective of this study was to determine and evaluate the effect of parity on the fatty acids groups’ proportion in Holstein cows’ milk during the first phase of lactations, with an emphasis on its potential importance for consumer health. A total of 25 Holstein cows, 9 primiparous, 9 in the 2nd, and 7 in the 3rd and subsequent parity, were observed and sampled at 7-day intervals through the first 17 weeks of lactation. The percentage proportion of saturated (hypercholesterolemic and volatile as its components and unsaturated (monounsaturated and polyunsaturated as its components fatty acids in the samples of milk fat (n=425 was determined. The effects of parity and negative energy balance, as well as regression, on the lactation week and the fat to protein ratio were evaluated using SAS 9.3. A significantly (P<0.01 lower proportion of unhealthy hypercholesterolemic fatty acids was detected in primiparous cows (-2.67 % and those in the 3rd and subsequent lactation (-2.94 % compared to the 2nd lactation, as well as a simultaneously higher proportion of healthy unsaturated fatty acids (+2.07, respectively +3.08 %. The determined relationships corresponded to organism stress evoked by the initiation of milk production and its maintenance in higher parities. Therefore, the generally required prolongation of dairy cows’ longevity can influence on the quality of raw milk, especially considering composition of fatty acids.

  10. Correlation between somatic cell count and chemical composition of cooled raw milk in properties of Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Adriano Henrique do Nascimento Rangel

    2014-06-01

    Full Text Available Due to the damage caused by subclinical mastitis in loss of production and quality of milk, the present study aimed to verify the correlation between somatic cell count (SCC and the chemical composition of cooled raw milk collected in the Agreste region of Rio Grande do Norte, Brazil, in drought and rain seasons. Samples were collected in seven dairy farms during morning time, between January 2010 and March 2012, and sent to the Brazilian et of Milk Quality Laboratory (ESALQ/USP. The contents of protein, fat, lactose, casein, total solids, nonfat dry extract and urea nitrogen, besides of SCC and total bacterial count were performed. Data were submitted to analysis of variance, correlation analysis and comparison of means by Tuckey test , 5%. The average SCC was 604,000 cells/mL and had significant variation in the dry period (558 000 cells/mL and rainy (650 000 cells/mL. The SCC was positively correlated with fat and total solids but negatively with the lactose cow’s milk of bulk tank, regardless of the season in the Agreste of Rio Grande do Norte.

  11. Molecular characterization and antibiotic resistance of enterotoxigenic and entero-aggregative Escherichia coli isolated from raw milk and unpasteurized cheeses

    Directory of Open Access Journals (Sweden)

    Mojtaba Bonyadian

    2014-04-01

    Full Text Available The aim of this study was to determine the occurrence of enterotoxigenic and enteroaggregative Escherichia coli strains and antibiotic resistance of the isolates in raw milk and unpasteurized cheese. Out of 200 samples of raw milk and 50 samples of unpasteurized cheeses, 96 and 24 strains of E. coli were isolated, respectively. Polymerase chain reaction (PCR was used to detect the genes encoding heat-stable enterotoxin a (STa, heat-stable enterotoxin b (STb, heat labile toxin (LT and enteroaggregative heat-stable toxin1 (EAST1. Twelve out of 120 (10.00% isolates harbored the gene for EAST1, 2(1.66% isolates were detected as producing STb and LT toxins and 12 (10.00% strains contained STb and EAST1 genes. None of the strains contain the STa gene. All of the strains were tested for antibiotic resistance by disk diffusion method. Disks included: ciprofloxacin (CFN, trimetoprim-sulfamethoxazole (TSX, oxytetracycline (OTC, gentamicin (GMN, cephalexin (CPN, nalidixic acid (NDA and nitrofurantoin (NFN, ampicillin (AMP, neomycin (NEO and streptomycin (STM. Among 120 isolated strains of E. coli, the resistance to each antibiotics were as follows: OTC100%, CPN 86.00%, NDA 56.00%, NFN 42.00%, GMN 30.00%, TSX 28.00%, CFN 20%, AM 23.40% and STM 4.25%. None of the isolates were resistant to NEO. The present data indicate that different resistant E. coli pathogens may be found in raw milk and unpasteurized cheese. It poses an infection risk for human and transferring the resistant factors to microflora of the consumers gut.

  12. Detection of Salmonella spp., Candida albicans, Aspergillus spp., and Antimicrobial Residues in Raw and Processed Cow Milk from Selected Smallholder Farms of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Tryness Anastazia Mhone

    2012-01-01

    Full Text Available A cross-sectional study was conducted to detect the presence of Salmonella spp., Candida albicans, Aspergillus spp., and antimicrobial residues in raw milk (n=120 and processed cow milk (n=20 from smallholder dairy farms from three sites in Zimbabwe. Culture and isolation of Salmonella spp., C. albicans, and Aspergillus spp. were performed using selective media, while antimicrobial residues were detected by a dye reduction test. No Salmonella, but C. albicans (17.5%; 21/120, Aspergillus spp. (0.8%; 1/120, and antimicrobial residues (2.5%; 3/120 were detected from raw milk. C. albicans was isolated from all three sites, while Aspergillus spp. and antimicrobial residues were detected from sites 1 and 3, respectively. From processed milk, only C. albicans (5% was isolated while Aspergillus spp. and antimicrobial residues were not detected. These results suggested low prevalence of Salmonella spp. and Aspergillus spp. and a relatively high prevalence of C. albicans in raw milk from the smallholder farms. The potential public health risks of C. albicans and the detected antimicrobial residues need to be considered. Thus, educating farmers on improving milking hygiene and storage of milk and establishing programmes for monitoring antimicrobial residues may help to improve the safety of milk from smallholder farms.

  13. Evaluation of Brucella contamination in raw milk in Kerman dairy farms by PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. In endemic developing countries, dairy products produced from untreated milk are a potential threat to public health. The aim of this study was to detect brucellae in milk from dairy cattle farms in Kerman (Iran. Methods: Forthy and eight Bulk Tank Milk (BTM  were collected from 48 dairy cattle farm including 4200 cow. All milk samples were examined by PCR to detect Brucella-specific DNA. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp from 48 BTM samples in this area.. Conclusions: The detection of Brucella DNA in milk for human consumption, especially the highly pathogenic species B. melitensis, is of obvious concern. The shedding of Brucella spp. in milk poses an increasing threat to consumers in Iran. Consumption of dairy products produced from non-pasteurized milk by individual farmers operating under poor hygienic conditions represents an unacceptable risk to public health.

  14. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia.

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-03-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher ( p milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats.

  15. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-01-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher (p < 0.05) milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats. PMID:29644024

  16. Effects of different pasteurizers on the nutritional quality of raw milk ...

    African Journals Online (AJOL)

    ) of local and exotic cow breeds (White Fulani, New Jersey and Mixture of the two breeds) were investigated before and after pasteurization of milk samples from the breeds in aluminium, stainless and galvanized steel pasteurizers that was ...

  17. Raw milk consumption and other early-life farm exposures and adult pulmonary function in the Agricultural Lung Health Study.

    Science.gov (United States)

    Wyss, Annah B; House, John S; Hoppin, Jane A; Richards, Marie; Hankinson, John L; Long, Stuart; Henneberger, Paul K; Beane Freeman, Laura E; Sandler, Dale P; O'Connell, Elizabeth Long; Cummings, Christie Barker; Umbach, David M; London, Stephanie J

    2018-03-01

    Literature suggests that early exposure to the farming environment protects against atopy and asthma; few studies have examined pulmonary function. We evaluated associations between early-life farming exposures and pulmonary function in 3061 adults (mean age=63) from a US farming population using linear regression. Childhood raw milk consumption was associated with higher FEV 1 (β=49.5 mL, 95% CI 2.8 to 96.1 mL, p=0.04) and FVC (β=66.2 mL, 95% CI 13.2 to 119.1 mL, p=0.01). We did not find appreciable associations with other early-life farming exposures. We report a novel association between raw milk consumption and higher pulmonary function that lasts into older adulthood. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  18. Effect of organic farming on selected raw cow milk components and properties

    Directory of Open Access Journals (Sweden)

    Ivana Cermanová

    2011-01-01

    Full Text Available Organic dairying is an alternative for friendly exploitation of environment. This paper was focused on impacts of organic dairying on milk composition and properties. The conventional (C cow milk was compared to organic (O milk. Holstein bulk milk samples (BMSs from winter and summer season in 4 C and 4 O (n = 32 and 32 BMSs; 2 years herds were investigated. 6 herds were grazed and 2 C herds were not grazed. Mean O cow milk yield (MY, 305 lactation days was 7037.3 ± 421.5 and C MY 7015.8 ± 1068.1 kg. Higher values (P < 0.05 in O milk had: log acetone (0.7321 > 0.6048; titration acidity (8.34 > 7.82 ml 0.25 mol.l−1 NaOH; alcohol stability (0.6 > 0.44 ml; time for enzymatic coagulation (150.75 > 115.03 second; whey protein (0.54 > 0.49%; fat/crude protein (1.2 > 1.15; milk fermentation ability (FAM by titration (31.45 > 22.18 ml 0.25 mol.l−1 NaOH. Lower values (P < 0.05 in O milk had: solids–not–fat (8.64 < 8.73%; urea content (19.91 < 29.03 mg.100ml−1; electrical conductivity (3.66 < 4.08 mS.cm−1; whey volume (32.03 < 34.53 ml; crude protein (3.16 < 3.25%; casein (2.47 < 2.58%; non–protein nitrogen compounds (0.15 < 0.18%; urea nitrogen in non-protein nitrogen ratio (40.81 < 49.0%; casein numbers for crude protein and true protein (78.12 < 79.58 and 81.99 < 84.11%; coli bacteria count in normal and logarithm form (330.56 < 1502.92 CFU.ml−1 and 1.484 < 2.5823; actual yoghurt acidity (4.71 < 4.8. O cows suffered probably from lower energy and nitrogen compounds intake due to feeding under mentioned conditions. O milk could be a little better environment for yoghurt cultivation.

  19. Effect of humates in diet of dairy cows on the raw milk main components

    Directory of Open Access Journals (Sweden)

    Miroslava Potůčková

    2017-01-01

    Full Text Available The effect of supplemental humic substances (HS on the main milk components was investigated. A total of 10 dairy cows (Czech pied cattle, crossbred Czech pied cattle ´ Ayrshire and crossbred Czech pied cattle ´ Red Holstein were tested. Animals were randomly divided into 2 groups, control (C and experimental (E. Animals fed the same feed mixture and group E was additionally supplemented with HS (200 mg.kg-1 of product Humafit prepared from the Sakhalin Leonardite. The experimental period took 3 months. Cows were milked twice a day. The milk composition (lactose, fat, crude protein, pure protein and casein of every cow was monitored on days 0, 14, 28, 42, 56, 70 and 84 of the experiment. Pure protein content was determined by Kjeldahl method, other components were analysed using an infrared analyserMilkoScan FT 120. It was found that the crude protein, pure protein and casein content in milk of group E significantly (p <0.05 increased from the 56th day of the experimental period. Differences of the protein fraction contents in group C and of the dry matter, non-fat dry matter, lactose and fat content in both groups were non-significant (p <0.05.Higher protein and especially casein content in milk could be very important for the cheesemaking as it could increase the cheese yield. Normal 0 21 false false false CS X-NONE X-NONE

  20. Nitrogen gas flushing can be bactericidal: The temperature-dependent destiny of Bacillus weihenstephanensis KBAB4 under a pure N2 atmosphere

    Directory of Open Access Journals (Sweden)

    Patricia eMunsch-Alatossava

    2014-11-01

    Full Text Available Tremendous food spoilage on one side and increased concern about the incidence of food-borne pathogens on the other side urge the development of additional steps to ensure food safety and quality. In previous studies, nitrogen (N2 gas flushing treatments of raw and pasteurized milk at cold chain-temperatures inhibited bacterial spoilage and highlighted different susceptibilities to the N2 treatment with the exclusion of certain bacterial types. Gram-negative Pseudomonas and Gram-positive Bacillus are the most common spoilage bacteria in raw and pasteurised milk, respectively. Here, we investigated the effects of pure N2 gas flushing on representative strains of these genera grown in mono- or co-cultures at 15°C and 25°C. Bacillus weihenstephanensis, which is a frequent inhabitant of fluid dairy products, is represented by the genome-sequenced KBAB4 strain. Among Pseudomonas, P. tolaasii LMG 2342T and strain C1, a raw milk psychrotroph, were selected. The N2 gas flushing treatment revealed: 1 temperature-dependent responses; 2 inhibition of the growth of both pseudomonads; 3 emergence of small colony variants for B. weihenstephanensis strain KBAB4 at 15°C induced by the N2 treatment or when grown in co-culture with Pseudomonas strains; 4 N2 gas flushing modulates (suppressed or stimulated bacterial antagonistic reactions in co-cultures; 5 most importantly, SEM and TEM analyses revealed that at 25°C the majority of the KBAB4 cells were killed by pure N2 gas flushing. This observation constitutes the first evidence that N2 gas flushing has bactericidal effects.

  1. Continuous raw skim milk processing by pulsed electric field at non-lethal temperature: effect on microbial inactivation and functional properties

    OpenAIRE

    Floury , Juliane; Grosset , Noël; Leconte , Nadine; Pasco , Maryvonne; Madec , Marie-Noëlle; Jeantet , Romain

    2006-01-01

    International audience; Pulsed electric field (PEF) is an emerging non-thermal processing technology used to inactivate microorganisms in liquid foods such as milk. The objective of this research was to study the effectiveness of continuous PEF equipment (square wave pulses) on total microorganisms of raw skim milk and on Salmonella enteritidis inactivation under moderate temperatures (T < 50 °C). Processing parameters (electric field and pulse width) were chosen as follows: 45 kV*cm-1/500 ns...

  2. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes

    Directory of Open Access Journals (Sweden)

    Tahlina Tanzin

    2016-03-01

    Conclusion: Two different species of bacteria i.e., S. aureus and E. coli are contaminating with milk samples. The pathogenic bacteria can be controlled effectively by using Ciprofloxacin and Levofloxacin in the case of mastitis in cattle and buffaloes in Bangladesh. [J Adv Vet Anim Res 2016; 3(1.000: 62-67

  3. Raw Camel Milk Properties on Alloxan-Induced Diabetic Wistar Rats

    Directory of Open Access Journals (Sweden)

    Kebir Nasr-Eddine

    2017-03-01

    Full Text Available Background and aims: Diabetes is one of the most frequent and serious chronic diseases in humans all over the world. The aim of our study was to evaluate the antidiabetic activity of camel milk on serum glucose and lipid profile of alloxan-induced diabetic rats.

  4. Fatty acid profile and health lipid indices in the raw milk of ewes ...

    African Journals Online (AJOL)

    Daniel

    2016-08-02

    Aug 2, 2016 ... Feeding the I diets increased the proportion of short-chain FAs (C4:0 - ..... in milk short- and medium-chain FAs with an increased fresh pasture supply in ... to SFA above 0.45 and a ratio of n-6/n-3 below 4.0 are required in the ...

  5. STUDY REGARDING THE CORELATION BETWEEN SOMATIC CELLS COUNT AND MAJOR CHEMICAL COMPOUNDS IN RAW MILK

    Directory of Open Access Journals (Sweden)

    S. ACATINCĂI

    2008-10-01

    Full Text Available This study approaches the dynamic of somatic cells number and chemical composition of milk during 13 months of control. The study also investigates the correlations between the number of somatic cells and some chemical parameters in milk. Studies were carried out on Romanian Black and White cows between March 2005 and March 2006 at the Didactical farm of the Banat University of Agricultural Sciences Timisoara. As quality indicator, the number of somatic cells has different values among the controls. Average values for the 13 months of control, with the exception of three controls, were below maximum limit admitted from 1th of January 2007 (600000 SCC/ml milk. There weren’t any significant differences for SCC between the two seasons. Chemical parameters in milk varied in close limits and the differences were not significant, with one exception for fat percent. Fat percent is higher (p<0.05 in the cold season 3.87% compared with 3.55% during the warm season. Somatic cells number is weak correlated with lactose and strong correlated with proteins.

  6. [Detection of a Disease Cluster by the Health Authorities of Stendal District due to Campylobacter jejuni in a Nursery After the Consumption of Raw Milk].

    Science.gov (United States)

    Hermann, N; Schubert, I

    2015-07-01

    A notification from a laboratory concerning the detection of Campylobacter jejuni in a 6-year-old boy initiated the investigation carried out by the health authorities from Stendal district, in order to explain the morbidity rate caused by the germ. The day after the boy's pediatrician informed about a visit to a farm, which was confirmed by the head of the nursery. She told the health authorities about the consumption of raw milk during their visit at the farm.The following days more children fell sick. Within 10 days the total number of diseased children was 21. The health authorities asked for stool samples of the diseased children, nursery nurses and the head of the farm since raw milk presents a potential cause of infection. The health authorities together with the Saxony-Anhalt State Office for Consumer Protection conducted a retrospective cohort study. The aim was to explain the association between the exposure from raw milk consumption and the occurrence of the disease from C. jejuni. Based on a questionnaire data about the food and milk intake at the nursery and at home and about the trip to the farm were collected. 91% of the children's cohort and 86% of the adults' cohort were captured.The exposed group at risk showed a higher risk of falling ill than the group, which was not exposed. The risk factor raw milk explained the difference. Furthermore, the analysis of milk samples taken by the district veterinary office from 2 cows and from the farm's tank was able to detect the germs. The correlation of the illness, the consumption of raw milk, the detection of C. jejuni in the samples taken from the children and the samples taken from the cows was evident. Based on the case the health authorities recommended that heads of nurseries as well as heads of dairy farming in the district of Stendal needed to be advised on raw milk. Nurseries are still allowed to take trips to farms. However, raw animal derivates including milk must not be consumed. © Georg Thieme

  7. RESEARCH ON ENVIRONMENTAL CONTAMINATION IN RAW MILK IN TURIN DEPARTEMENT : HEAVY METALS, P.C.B, ORGANOCHLORINE AND ORGANOPHOSPHORUS PESTICIDES – YEARS 2005 – 2008

    Directory of Open Access Journals (Sweden)

    S. Cavallera

    2013-02-01

    Full Text Available In the period between 2005 and 2008 was carried out a survey on 252 samples of raw bovine milk collected in Turin departement to certain levels of contamination by heavy metals (Cd, Cr, Fe, Hg, Pb, Zn, PCB and organophosphorus and organochlorine pesticides. These results argue that the levels of heavy metals, PCB and pesticides are well below what is expected by the European legislation and that the situation is under control and that raw milk meets the hygiene requirements for human health.

  8. Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Berhanu, Ayalew; Mengesha, Desalegne; Tsegay, Getachew

    2012-11-06

    Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder's milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%), Pseudomonas aeruginosa (18.5%), and Klebsiella pneumoniae (16.7%), were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. This study showed the presence of diverse pathogenic gram-negative staining bacterial species in raw

  9. Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia

    Directory of Open Access Journals (Sweden)

    Garedew Legesse

    2012-11-01

    Full Text Available Abstract Background Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. Methods This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder’s milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. Results The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%, Pseudomonas aeruginosa (18.5%, and Klebsiella pneumoniae (16.7%, were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. Conclusion This study showed the presence of

  10. Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2018-06-01

    Full Text Available The colonization of dairy herds and subsequent contamination of raw milk by Staphylococcus aureus (S. aureus, especially those expressing a multi-drug resistance (MDR, biofilm and toxins producing ability, remains an important issue for both the dairy producer and public health. In this study, we investigated the prevalence, antimicrobial resistance, virulence, and genetic diversity of S. aureus in raw milk taken from 2 dairy farms in Beijing, China. Ninety (46.2%, 90/195 samples were positive for S. aureus. Resistant to penicillin (PEN (31.3%, ciprofloxacin (18.8% and enrofloxacin (15.6% were the most often observed. Isolates cultured from farm B showed significantly higher resistance to penicillin (73.9%, ciprofloxacin (34.8%, enrofloxacin (34.8%, tilmicosin (17.4%, and erythromycin (17.4% than those from farm A (p < 0.05. Totally, 94.8% S. aureus harbored at least one virulence gene and the pvl (93.8%, sec (65.6%, and sea (60.4% genes were the most frequently detected. The pvl and sec genes were more often detected in isolates from farm A (97.3% and 84.9% respectively than those from farm B (p < 0.05. Of all 77 staphylococcus enterotoxin (SE-positive isolates, more than 90% could produce enterotoxins and 70.1% could produce two types. Biofilm related genes (icaA/D, clf/B, can, and fnbA were detected in all96 isolates. All 96 isolates could produce biofilm with 8.3, 70.8, and 18.8% of the isolates demonstrating weak, moderate and strong biofilm formation, respectively. A total of 5 STs, 7 spa types (1 novel spa type t17182, 3agr types (no agrII, and 14 SmaI-pulso-types were found in this study. PFGE cluster II-CC1-ST1-t127-agr III was the most prevalent clone (56.3%. Isolates of agr III (PFGE Cluster I/II-CC1-ST1-t127/2279 had higher detection of virulence genes than those of agr I and agr IV. TheMSSA-ST398-t1456-agr I clone expressed the greatest MDRbut with no virulence genes and weakly biofilm formation. Our finding indicated a relatively

  11. Characterization of Staphylococcus aureus isolates from raw milk sources in Victoria, Australia.

    Science.gov (United States)

    McMillan, Kate; Moore, Sean C; McAuley, Catherine M; Fegan, Narelle; Fox, Edward M

    2016-07-29

    Highly pathogenic strains of Staphylococcus aureus can cause disease in both humans and animals. In animal species, including ruminants, S. aureus may cause severe or sub-clinical mastitis. Dairy animals with mastitis frequently shed S. aureus into the milk supply which can lead to food poisoning in humans. The aim of this study was to use genotypic and immunological methods to characterize S. aureus isolates from milk-related samples collected from 7 dairy farms across Victoria. A total of 30 S. aureus isolates were collected from milk and milk filter samples from 3 bovine, 3 caprine and 1 ovine dairy farms across Victoria, Australia. Pulsed Field Gel Electrophoresis (PFGE) identified 11 distinct pulsotypes among isolates; all caprine and ovine isolates shared greater than 80 % similarity regardless of source. Conversely, bovine isolates showed higher diversity. Multi-Locus Sequence Typing (MLST) identified 5 different sequence types (STs) among bovine isolates, associated with human or ruminant lineages. All caprine and ovine isolates were ST133, or a single allele variant of ST133. Two new novel STs were identified among isolates in this study (ST3183 and ST3184). With the exception of these 2 new STs, eBURST analysis predicted all other STs to be founding members of their associated clonal complexes (CCs). Analysis of genetic markers revealed a diverse range of classical staphylococcal enterotoxins (SE) among isolates, with 11 different SEs identified among bovine isolates, compared with just 2 among caprine and ovine isolates. None of the isolates contained mecA, or were resistant to oxacillin. The only antibiotic resistance identified was that of a single isolate resistant to penicillin; this isolate also contained the penicillin resistance gene blaZ. Production of SE was observed at 16 °C and/or 37 °C in milk, however no SE production was detected at 12 °C. Although this study characterized a limited number of isolates, bovine-associated isolates

  12. Cyclic lipodepsipeptides produced by Pseudomonas spp. naturally present in raw milk induce inhibitory effects on microbiological inhibitor assays for antibiotic residue screening.

    Directory of Open Access Journals (Sweden)

    Wim Reybroeck

    Full Text Available Two Pseudomonas strains, identified as closely related to Pseudomonas tolaasii, were isolated from milk of a farm with frequent false-positive Delvotest results for screening putative antibiotic residues in raw milk executed as part of the regulatory quality programme. Growth at 5 to 7°C of these isolates in milk resulted in high lipolysis and the production of bacterial inhibitors. The two main bacterial inhibitors have a molecular weight of 1168.7 and 1140.7 Da respectively, are heat-tolerant and inhibit Geobacillus stearothermophilus var. calidolactis, the test strain of most of the commercially available microbiological inhibitor tests for screening of antibiotic residues in milk. Furthermore, these bacterial inhibitors show antimicrobial activity against Staphylococcus aureus, Bacillus cereus and B. subtilis and also interfere negatively with yoghurt production. Following their isolation and purification with RP-HPLC, the inhibitors were identified by NMR analysis as cyclic lipodepsipeptides of the viscosin group. Our findings bring to light a new challenge for quality control in the dairy industry. By prolonging the refrigerated storage of raw milk, the keeping quality of milk is influenced by growth and metabolic activities of psychrotrophic bacteria such as pseudomonads. Besides an increased risk of possible spoilage of long shelf-life milk, the production at low temperature of natural bacterial inhibitors may also result in false-positive results for antibiotic residue screening tests based on microbial inhibitor assays thus leading to undue production loss.

  13. Nutritional and hygienic quality of raw milk in the mid-northern region of Algeria: correlations and risk factors.

    Science.gov (United States)

    Adjlane-Kaouche, Soumeya; Benhacine, Rafik; Ghozlane, Faiçal; Mati, Abderrahmane

    2014-01-01

    This paper aims to study the overall quality of raw milk in the mid-northern region of Algeria. The analysis results showed a decrease in the average temperature for the delivery of 1,54°C with P0.05) was observed in almost all the physical and nutritional parameters studied (pH, fat content, and protein content) between M1 and M2. The average contamination by total mesophilic aerobic bacteria (TMAB), coliforms, yeasts, molds, and different pathogens in samples taken at M1 showed significant changes at M2. This was confirmed by the decrease of reduction time of methylene blue (RTMB), about 54%. The variation was described as follows: (P>0.05) for yeasts and (Pmilks delivered. In conclusion, several risk factors have been identified in this study, namely, the effect of the season and the distance between the farm and the dairy unit.

  14. High-pressure processing of a raw milk cheese improved its food safety maintaining the sensory quality.

    Science.gov (United States)

    Delgado, Francisco José; Delgado, Jonathan; González-Crespo, José; Cava, Ramón; Ramírez, Rosario

    2013-12-01

    The effect of high-pressure treatment (400 or 600 MPa for 7 min) on microbiology, proteolysis, texture and sensory parameters was investigated in a mature raw goat milk cheese. At day 60 of analysis, Mesophilic aerobic, Enterobacteriaceae, lactic acid bacteria and Listeria spp. were inactivated after high-pressure treatment at 400 or 600 MPa. At day 90, mesophilic aerobic, lactic acid bacteria and Micrococacceae counts were significantly lower in high-pressure-treated cheeses than in control ones. In general, nitrogen fractions were significantly modified after high-pressure treatment on day 60 at 600 MPa compared with control cheeses, but this effect was not found in cheeses after 30 days of storage (day 90). On the other hand, high-pressure treatment caused a significant increase of some texture parameters. However, sensory analysis showed that neither trained panellists nor consumers found significant differences between control and high-pressure-treated cheeses.

  15. Isolation and characterization of large spectrum and multiple bacteriocin-producing Enterococcus faecium strain from raw bovine milk.

    Science.gov (United States)

    Gaaloul, N; ben Braiek, O; Hani, K; Volski, A; Chikindas, M L; Ghrairi, T

    2015-02-01

    To assess the antimicrobial properties of lactic acid bacteria from Tunisian raw bovine milk. A bacteriocin-producing Enterococcus faecium strain was isolated from raw cow milk with activity against Gram-positive and Gram-negative bacteria. Antimicrobial substances produced by this strain were sensitive to proteolytic enzymes and were thermostable and resistant to a broad range of pH (2-10). Mode of action of antimicrobial substances was determined as bactericidal. Maximum activity was reached at the end of the exponential growth phase when checked against Listeria ivanovii BUG 496 (2366.62 AU ml(-1)). However, maximum antimicrobial activity against Pseudomonas aeruginosa 28753 was recorded at the beginning of the exponential growth phase. Enterococcus faecium GGN7 was characterized as free from virulence factors and was susceptible to tested antibiotics. PCR analysis of the micro-organism's genome revealed the presence of genes coding for enterocins A and B. Mass spectrometry analysis of RP-HPLC active fractions showed molecular masses corresponding to enterocins A (4835.77 Da) and B (5471.56 Da), and a peptide with a molecular mass of 3215.5 Da active only against Gram-negative indicator strains. The latter was unique in the databases. Enterococcus faecium GGN7 produces three bacteriocins with different inhibitory spectra. Based on its antimicrobial properties and safety, Ent. faecium GGN7 is potentially useful for food biopreservation. The results suggest the bacteriocins from GGN7 strain could be useful for food biopreservation. © 2014 The Society for Applied Microbiology.

  16. An ecological study of lactococci isolated from raw milk in the camembert cheese registered designation of origin area.

    Science.gov (United States)

    Corroler, D; Mangin, I; Desmasures, N; Gueguen, M

    1998-12-01

    The genetic diversity of lactococci isolated from raw milk in the Camembert cheese Registered Designation of Origin area was studied. Two seasonal samples (winter and summer) of raw milk were obtained from six farms in two areas (Bessin and Bocage Falaisien) of Normandy. All of the strains analyzed had a Lactococcus lactis subsp. lactis phenotype, whereas the randomly amplified polymorphic DNA (RAPD) technique genotypically identified the strains as members of L. lactis subsp. lactis or L. lactis subsp. cremoris. The genotypes were confirmed by performing standard PCR with primers corresponding to a region of the histidine biosynthesis operon. The geographic distribution of each subspecies of L. lactis was determined; 80% of the Bocage Falaisien strains were members of L. lactis subsp. lactis, and 30.5% of the Bessin strains were members of L. lactis subsp. lactis. A dendrogram was produced from a computer analysis of the RAPD profiles in order to evaluate the diversity of the lactococci below the subspecies level. The coefficient of similarity for 117 of the 139 strains identified as members of L. lactis subsp. cremoris was as high as 66%. The L. lactis subsp. lactis strains were more heterogeneous and formed 10 separate clusters (the level of similarity among the clusters was 18%). Reference strains of L. lactis subsp. lactis fell into 2 of these 10 clusters, demonstrating that lactococcal isolates are clearly different. As determined by the RAPD profiles, some L. lactis subsp. lactis strains were specific to the farms from which they originated and were recovered throughout the year (in both summer and winter). Therefore, the typicality of L. lactis subsp. lactis strains was linked to the farm of origin rather than the area. These findings emphasize the significance of designation of origin and the specificity of "Camembert de Normandie" cheese.

  17. Field handling conditions of raw milk sold in vending machines: experimental evaluation of the behaviour of Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni

    Directory of Open Access Journals (Sweden)

    Renato G. Zanoni

    2012-01-01

    Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.

  18. Conjugated linolenic acid (CLnA), conjugated linoleic acid (CLA) and other biohydrogenation intermediates in plasma and milk fat of cows fed raw or extruded linseed.

    Science.gov (United States)

    Akraim, F; Nicot, M C; Juaneda, P; Enjalbert, F

    2007-07-01

    Thirty lactating dairy cows were used in a 3 × 3 Latin-square design to investigate the effects of a raw or extruded blend of linseed and wheat bran (70:30) on plasma and milk fatty-acids (FA). Linseed diets, containing 16.6% linseed blend on a dry-matter basis, decreased milk yield and protein percentage. They decreased the proportions of FA with less than 18 carbons in plasma and milk and resulted in cis-9, cis-12, cis-15 18:3 proportions that were more than three and four times higher in plasma and milk, respectively, whereas cis-9, cis-12 18:2 proportions were decreased by 10-15%. The cis-9, trans-11, cis-15 18:3 isomer of conjugated linolenic acid was not detected in the milk of control cows, but was over 0.15% of total FA in the milk fat of linseed-supplemented cows. Similarly, linseed increased plasma and milk proportions of all biohydrogenation (BH) intermediates in plasma and milk, including the main isomer of conjugated linoleic acid cis-9, trans-11 18:2, except trans-4 18:1 and cis-11, trans-15 18:2 in plasma lipids. In milk fat, compared with raw linseed, extruded linseed further reduced 6:0-16:0 even-chain FA, did not significantly affect the proportions of 18:0, cis-9 18:1 and cis-9, cis-12 18:2, tended to increase cis-9, cis-12, cis-15 18:3, and resulted in an additional increase in the proportions of most BH intermediates. It was concluded that linseed addition can improve the proportion of conjugated linoleic and linolenic acids, and that extrusion further increases the proportions of intermediates of ruminal BH in milk fat.

  19. Validation of a rapid lateral flow test for the simultaneous determination of β-lactam drugs and flunixin in raw milk.

    Science.gov (United States)

    Douglas, David; Banaszewski, Katie; Juskelis, Rima; Al-Taher, Fadwa; Chen, Yang; Cappozzo, Jack; McRobbie, Lindsay; Salter, Robert S

    2012-07-01

    β-Lactam antibiotics are the most commonly used drugs on dairy farms. β-Lactam residues in milk are kept out of the human milk supply with good agricultural practices and mandatory truck screening performed by the dairy industry under Appendix N of the Pasteurized Milk Ordinance. Flunixin, a nonsteroidal and anti-inflammatory drug, appears in dairy cattle tissue residues with a frequency similar to the occurrence of penicillin G. This creates concern that flunixin residues could be in milk and would go undetected under current milk screening programs. A single test that combines mandatory β-lactam screening with voluntary flunixin screening is an economical approach for monitoring and controlling for potential flunixin or 5-hydroxyflunixin, the primary flunixin metabolite marker in milk. The objective of this study was to validate a β-lactam and flunixin rapid lateral flow test (LFT) and compare the results obtained with a liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS) method for the simultaneous determination of flunixin and 5-hydroxyflunixin in raw milk with a limit of detection of , 1 ppb, equivalent to 1 ng/ml. Using the LFT, three combined manufactured lots of test strips detected penicillin G at 2.0 ppb, ampicillin at 6.8 ppb, amoxicillin at 5.9 ppb, cephapirin at 13.4 ppb, ceftiofur (total metabolites) at 63 ppb, and 5-hydroxyflunixin at 1.9 ppb at least 90% of the time with 95% confidence. The LFT also detected incurred flunixin milk samples that were analyzed with the LC-MS/MS and diluted to tolerance in raw milk. The detection levels for the LFT are lower than the U.S. safe levels or tolerances and qualify the test to be used in compliance with U.S. milk screening programs.

  20. Nutritional and Hygienic Quality of Raw Milk in the Mid-Northern Region of Algeria: Correlations and Risk Factors

    Directory of Open Access Journals (Sweden)

    Soumeya Adjlane-Kaouche

    2014-01-01

    Full Text Available This paper aims to study the overall quality of raw milk in the mid-northern region of Algeria. The analysis results showed a decrease in the average temperature for the delivery of 1,54°C with P0.05 was observed in almost all the physical and nutritional parameters studied (pH, fat content, and protein content between M1 and M2. The average contamination by total mesophilic aerobic bacteria (TMAB, coliforms, yeasts, molds, and different pathogens in samples taken at M1 showed significant changes at M2. This was confirmed by the decrease of reduction time of methylene blue (RTMB, about 54%. The variation was described as follows: (P>0.05 for yeasts and (P<0.05 for molds in M1 and M2, (P<0.05 for TMAB in M1, and (P<0.001 for TC, FC, and TMAB in M2. The analysis for the detection of Salmonella spp. showed no contamination in all samples tested, while antibiotic residues were detected in 35% of milks delivered. In conclusion, several risk factors have been identified in this study, namely, the effect of the season and the distance between the farm and the dairy unit.

  1. Schiff base: A high affinity chemical agent to decrease the concentration of aflatoxin M1 in raw milk contaminated artificially

    Directory of Open Access Journals (Sweden)

    Frane Delaš

    2012-03-01

    Full Text Available In the present study were conducted the effect of pH (5.5, 6.0 and 6.5 and concentration of new synthesized 3-/2-aminophenylimino-(p-toluoyl/-4-hydroxy-6-(p-tolyl-2H-pyrane-2-one (Schiff base on decrease the concentration of aflatoxin M1 (AFM1 in raw milk contaminated with known concentration of this toxin. Experiments were carried out at temperature of 4 °C during 35 days. At pH 5.5 Schiff base concentration of 0.1 µmol/L was lessening the concentration of AFM1 after 35 days by 55 %. However, at pH 6.5 the most effective concentration for lessening of AFM1 was 0.5 µmol/L. Schiff base was not effective at pH value of 7 or higher. The ability of Schiff base to act as antimycotoxigenic agent provides new perspective for possibly using this compound to control AFM1 contamination in milk and to extent shelf lives of this food. Detection of toxicity of investigated Schiff base was performed by using the brine shrimp (Artemia salina larvae as an biological indicator to determine their sensitivity to this chemical agent.

  2. Short communication: Postpasteurization hold temperatures of 4 or 6°C, but not raw milk holding of 24 or 72 hours, affect bacterial outgrowth in pasteurized fluid milk.

    Science.gov (United States)

    Andrus, Alexis D; Campbell, Brynne; Boor, Kathryn J; Wiedmann, Martin; Martin, Nicole H

    2015-11-01

    As fluid milk processors continue to reduce microbial spoilage in fluid milk through improved control of postpasteurization contamination and psychrotolerant sporeformer outgrowth, it is necessary to identify strategies to further improve the quality and extend the shelf life of fluid milk products that are high-temperature, short-time pasteurized. Solutions that optimize product quality, and are economically feasible, are of particular interest to the dairy industry. To this end, this study examined the effects of raw milk holding time and temperature of pasteurized milk storage over shelf life on bacterial growth. In 3 independent replicates, raw milk was stored for 24 and 72 h before pasteurization at 76°C for 25s and then incubated at 3 different storage conditions: (1) 4°C for 21d; (2) 4°C for the first 48 h, then 6°C for the duration of the 21-d shelf life; or (3) 6°C for 21d. Total bacteria counts were assessed initially and on d 7, 14, and 21. No substantial difference in bacterial growth over shelf life was observed between samples processed from raw milk held for 24 versus 72 h. A significantly lower bacterial load was seen at d 21 after pasteurization in samples held at 4°C, versus 4°C for the first 48 h followed by 6°C for the duration of the 21-d shelf life and samples held at 6°C for 21d. This work demonstrates the importance of maintaining control of the fluid milk cold chain throughout postpasteurization, transportation, and retail storage on fluid milk microbial quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Effects of raw milk and starter feed on intake and body composition of Holstein x Gyr male calves up to 64 days of age

    NARCIS (Netherlands)

    Silva, A.L.; Marcondes, M.I.; Detmann, E.; Machado, F.S.; Valadares Filho, S.C.; Trece, A.S.; Dijkstra, J.

    2015-01-01

    The objective was to evaluate the effect of supplying different levels of raw milk, alone or in combination, with access to a starter feed, on the intake, digestibility, daily gain, N balance, and body composition of Holstein × Gyr crossbred suckling calves until 64 d of age. Thirty-nine male calves

  4. Suitability of the charm HVS and a microbiological multiplate system for detection of residues in raw milk at EU maximum residue levels

    NARCIS (Netherlands)

    Nouws, J.F.M.; Egmond, van H.; Loeffen, G.; Schouten, J.; Keukens, H.; Smulders, I.; Stegeman, H.

    1999-01-01

    In this paper we assessed the suitability of the Charm HVS and a newly developed microbiological multiplate system as post-screening tests to confirm the presence of residues in raw milk at or near the maximum permissible residue level (MRL). The multiplate system is composed of Bacillus

  5. INTRODUCTION OF PASTEURIZED/RAW COW'S MILK DURING THE SECOND SEMESTER OF LIFE AS A RISK FACTOR OF TYPE 1 DIABETES MELLITUS IN SCHOOL CHILDREN AND ADOLESCENTS.

    Science.gov (United States)

    Villagrán-García, Edna F; Hurtado-López, Erika F; Vasquez-Garibay, Edgar M; Troyo-Sanromán, Rogelio; Aguirre-Salas, Liuba M; Larrosa-Haro, Alfredo; León-Robles, Ruth V

    2015-08-01

    to demonstrate that type 1 diabetes mellitus (T1DM) in school children and adolescents is associated with the early introduction of pasteurized/raw cow's milk in the second semester of life. this non-probabilistic study included 150 subjects (75 patients and 75 controls), divided according to sex and age (range, 6 to 16 years). T1DM was considered to be a dependent variable, and pasteurized/ raw cow's milk (P/RCM) was considered to be an independent variable in the study. The statistical analyses included chi-squared test, odds ratio and 95% confidence intervals. the subjects were 51% male, age 11 ± 3.2 years, and 80% were breastfed, 18% were exclusively breastfed, and 13% received pasteurized/raw cow's milk. The children receiving P/RCM had a higher risk of T1DM [OR, 3.9 (1.2-12.8)]. The presence of T1DM was three times higher in those consuming P/RCM vs. those receiving follow-up formula [RM, 3.2 (1.03-10.07)]. introducing pasteurized/raw cow's milk in the second semester of life increased by four times the likelihood of developing T1DM in children and adolescents. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  6. OXA-48 and CTX-M-15 extended-spectrum beta-lactamases in raw milk in Lebanon: epidemic spread of dominant Klebsiella pneumoniae clones.

    Science.gov (United States)

    Diab, Mohamad; Hamze, Monzer; Bonnet, Richard; Saras, Estelle; Madec, Jean-Yves; Haenni, Marisa

    2017-11-01

    Raw milk has recently been reported as a source of extended-spectrum beta-lactamase (ESBL) and carbapenemase genes. We thus investigated the prevalence of ESBL- and carbapenemase-producing Enterobacteriaceae in raw milk in Lebanon in order to assess the risk of transfer of these bacteria to humans. A high prevalence (30.2 %) of CTX-M-15-producing K. pneumoniae was detected in raw bovine milk. Three main K. pneumoniae clones were identified by PFGE and MLST typing. Southern blot experiments revealed that one of these clones carried the blaCTX-M-15 gene chromosomally. Moreover, one OXA-48-producing K. pneumoniae ST530 and seven CTX-M-15-producing Escherichia coli sharing the same ST were also detected. These findings highlight the spread of dominant CTX-M-15-producing K. pneumoniae clones and OXA-48-producing isolates in the food chain. Milk, which is mostly consumed raw in Lebanon, may be a source of human exposure to ESBLs and carbapenemases.

  7. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.

    2004-01-01

    the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...

  8. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

    Science.gov (United States)

    Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

    2008-05-10

    Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

  9. Outbreak of Human Brucellosis from Consumption of Raw Goats' Milk in Penang, Malaysia.

    Science.gov (United States)

    Leong, Kar Nim; Chow, Ting Soo; Wong, Peng Shyan; Hamzah, Siti Hawa; Ahmad, Norazah; Ch'ng, Chin Chin

    2015-09-01

    We report the largest outbreak of brucellosis in Penang, Malaysia. Brucellosis is not endemic in this region. The index case was a 45-year-old goat farm owner presented with 3 weeks of fever, headache, severe lethargy, poor appetite, and excessive sweating. He claimed to have consumed unpasteurized goat's milk that he had also sold to the public. Tests were negative for tropical diseases (i.e., dengue fever, malaria, leptospirosis and scrub typhus) and blood culture showed no growth. Based on epidemiological clues, Brucella serology was ordered and returned positive. Over a period of 1 year, 79 patients who had consumed milk bought from the same farm were diagnosed with brucellosis. Two of these patients were workers on the farm. Four laboratory staff had also contracted the disease presumably through handling of the blood samples. The mean duration from onset of symptoms to diagnosis was 53 days with a maximum duration of 210 days. A combination treatment of rifampin and doxycycline for 6 weeks was the first line of treatment in 90.5% of patients. One-third of the patients had sequelae after recovering and 21% had a relapse. We highlight the importance of Brucellosis as a differential diagnosis when a patient has unexplained chronic fever. © The American Society of Tropical Medicine and Hygiene.

  10. BOX & JENKINS METHODOLOGY: AN APLICATION IN RAW MILK DATA FROM THE STATE OF MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    Eduardo Campana Barbosa

    2014-04-01

    Full Text Available The Box & Jenkins methodology was used to obtain a statistical model for estimate the production in liters of milk of the 6 first months of 2013 in Minas Gerais state, adjusting SARIMA (p, d, q x (P, D, Qs models, where d and D are the number of differences to remove the trend and seasonality of time series, p and q are the order of the autoregressive and moving average operators, P and Q are the order of the autoregressive and moving average seasonal operators and s is the seasonal periodicity. The Akaike Criterion Information (AIC procedure was used to select the 6 most parsimonious models and to find the best one the error indicators Mean Squared Error (EQM and Mean Absolute Percent Error (MAPE were analyzed, in addition to the assumptions of residues white noise. The Seasonal Autoregressive Integrated Moving Average SARIMA (3,1,2 x (0,1,212 was upper, view of the principle of parsimony and with more precise estimates. The forecast was more adjusted to the real values of milk production in Minas Gerais state and the model had smaller error indicators. The residues estimated were by this model white noise.

  11. Bacteriological quality of raw human milk: effect of storage in a refrigerator.

    Science.gov (United States)

    Olowe, S A; Ahmed, I; Lawal, S F; Ransome-Kuti, S

    1987-12-01

    Eighty-seven breast milk samples were obtained from 63 mothers of infants on the neonatal intensive care unit of the Lagos University Teaching Hospital. The samples were cultured for bacteria immediately after collection (0 h) and then stored in a domestic refrigerator from where cultures were repeated at 6-hourly intervals for 24 h. At 0 h, three (3.4%) of the samples were sterile; 56 (64%) grew coagulase negative staphylococci, and one (1.1%) Streptococcus viridans. Thus, 60 (69%) of the samples were either sterile or contained only skin commensals. Twenty-nine (31%) grew potential pathogens--coagulase positive staphylococci in two (2.3%) and mixed growth of staphylococci, coliforms and klebsiella in 25 (28.3%). During the 24 h storage in the refrigerator, bacteria multiplied in 50 and their growth was inhibited in 32 of the samples. But the mean bacterial count at any time during the 24 h was not significantly different from that at the beginning of the storage in the refrigerator. It is proposed that expressed breast milk stored in a domestic refrigerator can be given safely to infants within 24 h of collection if heavy contamination is prevented at the time of collection.

  12. A Raman-spectroscopy-based approach for detection and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages at low titer in raw milk.

    Science.gov (United States)

    Tayyarcan, Emine Kübra; Acar Soykut, Esra; Boyaci, Ismail Hakki

    2018-04-11

    In this study, a method combining Raman spectroscopy with chemometric analysis was developed for detection of phage presence in raw milk and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages which are among the main phages causing problems in dairy industry. For this purpose, S. thermophilus and L. bulgaricus phages were added into raw milk separately, and then some pretreatments such as fat separation, removal of casein, and filtration were applied to the raw milk samples. Raman spectra of the samples were collected and then analyzed using principal component analysis in order to discriminate these phages in raw milk. In the next step, dilutions of S. thermophilus phages in pretreated raw milk were prepared, and Raman spectra were collected. These spectra were analyzed by using partial least squares method to quantify phages in low titer. Consequently, it has been demonstrated that S. thermophilus and L. bulgaricus phages, which have titers sufficient to fail the fermentation (~ 10 7  pfu/mL) and have lower titers (10 2 -10 3  pfu/mL), could be discriminated from antibiotic and each other. Additionally, low concentrations of S. thermophilus phages (10 2  pfu/mL) could be detected through Raman spectroscopy with a short analysis time (60 min) and high coefficient of determination (R 2 ) values for both calibration (0.985) and validation (0.906) with a root mean square error of calibration of 70.54 and root mean square error of prediction of 165.47. However, a lower success was achieved with L. bulgaricus phages and the obtained coefficient of determination values were not sufficiently high (0.649).

  13. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    Science.gov (United States)

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

    Science.gov (United States)

    Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

    2014-01-01

    In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

  15. Ptaquiloside, the major carcinogen of bracken fern, in the pooled raw milk of healthy sheep and goats: an underestimated, global concern of food safety.

    Science.gov (United States)

    Virgilio, Antonella; Sinisi, Annamaria; Russo, Valeria; Gerardo, Salvatore; Santoro, Adriano; Galeone, Aldo; Taglialatela-Scafati, Orazio; Roperto, Franco

    2015-05-20

    Bracken fern (Pteridium aquilinum) is a worldwide plant containing toxic substances, which represent an important chemical hazard for animals, including humans. Ptaquiloside, 1, a norsesquiterpenoid glucoside, is the major carcinogen of bracken detected in the food chain, particularly in the milk from farm animals. To date, ptaquiloside has been shown in the milk of cows feeding on a diet containing bracken fern. This is the first study that shows the systematic detection of ptaquiloside, 1, and reports its direct quantitation in pooled raw milk of healthy sheep and goats grazing on bracken. Ptaquiloside, 1, was detected by a sensitive method based on the chemical conversion of ptaquiloside, 1, into bromopterosine, 4, following gas chromatography-mass spectrometry (GC-MS) analysis. The presence of ptaquiloside, 1, possibly carcinogenic to humans, in the milk of healthy animals is an unknown potential health risk, thus representing a harmful and potential global concern of food safety.

  16. Evaluation of sensitivity of modified star protocol microbiological method for beta-lactame antibiotics detection in raw cow milk

    Directory of Open Access Journals (Sweden)

    Borović Branka

    2013-01-01

    Full Text Available Antibiotic residues when present in animal tissues, through food chain, can enter human body, causing allergic reactions or facilitating the development of resistant bacterial strains. In order to determine the presence of antibiotics in animal tissues, it is appropriate to use convenient, reliable and sensitive methods. Microbiological methods applied for the detection of antibiotic residues in primary products of animal origin are based on the sensitivity of specific bacterial strains to a particular group of antibiotics. Regulatives on the amount of pesticides, metals and metalloids and other toxic substances, chemotherapeutics, anabolics and other substances which can be found in food ("Off. Gazette", No. 5/92, 11/92 - corr. and 32/02, state that milk and milk products can be used in commercial purposes only if not contain antibiotics in quantities that can be detected by reference methods. The applied method is modified STAR (Screening test for detection of antibiotics protocol, regulated by the CRL (Community Reference Laboratory Fougeres, France, in which the initial validation of the method had been carried out. In accordance with the demands of Regulative Commission EC No657/2002, the sensitivity of modified STAR protocol for beta lactam antibiotics group was examined , that is, there was carried out a contracted validation of the method, which initial validation had been performed at CRL. In a couple of series of experiments, 20 blank samples of raw cow milk originating from animals not treated by antibiotics, had been examined. By the beginning of the experiment samples were stored in a freezer at -20ºC. Samples of raw cow milk enriched by working solutions of seven beta-lactam antibiotics, in order to obtain concentrations at the level of 0.5, 1 and 1.5 MRL (Maximmum Residue Limit for each given antibiotic (Commission Regulation EC No. 37/2010. For detection of beta-lactam antibiotics, there was used Kundrat agar test with

  17. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  18. Farm to Fork Quantitative Risk Assessment of Listeria monocytogenes Contamination in Raw and Pasteurized Milk Cheese in Ireland.

    Science.gov (United States)

    Tiwari, Uma; Cummins, Enda; Valero, Antonio; Walsh, Des; Dalmasso, Marion; Jordan, Kieran; Duffy, Geraldine

    2015-06-01

    The objective of this study was to model and quantify the level of Listeria monocytogenes in raw milk cheese (RMc) and pasteurized milk cheese (PMc) from farm to fork using a Bayesian inference approach combined with a quantitative risk assessment. The modeling approach included a prediction of contamination arising from the farm environment as well from cross-contamination within the cheese-processing facility through storage and subsequent human exposure. The model predicted a high concentration of L. monocytogenes in contaminated RMc (mean 2.19 log10 CFU/g) compared to PMc (mean -1.73 log10 CFU/g). The mean probability of illness (P1 for low-risk population, LR) and (P2 for high-risk population, HR, e.g., immunocompromised) adult Irish consumers following exposure to contaminated cheese was 7 × 10(-8) (P1 ) and 9 × 10(-4) (P2 ) for RMc and 7 × 10(-10) (P1 ) and 8 × 10(-6) (P2 ) for PMc, respectively. In addition, the model was used to evaluate performance objectives at various stages, namely, the cheese making and ripening stages, and to set a food safety objective at the time of consumption. A scenario analysis predicted various probabilities of L. monocytogenes contamination along the cheese-processing chain for both RMc and PMc. The sensitivity analysis showed the critical factors for both cheeses were the serving size of the cheese, storage time, and temperature at the distribution stage. The developed model will allow food processors and policymakers to identify the possible routes of contamination along the cheese-processing chain and to reduce the risk posed to human health. © 2015 Society for Risk Analysis.

  19. Technological Aptitude and Applications of Leuconostoc mesenteroides Bioactive Strains Isolated from Algerian Raw Camel Milk

    Directory of Open Access Journals (Sweden)

    Zineb Benmechernene

    2013-01-01

    Full Text Available Two strains (B7 and Z8 of the Leuconostoc mesenteroides subspecies mesenteroides that were isolated from Algerian camel milk from an initial pool of 13 strains and demonstrated a high ability to inhibit the growth of Listeria spp. were selected and characterised at the phenotypic and genotypic levels. Probiotic profiling and inhibition spectra against food borne pathogens in mixed cultures were also investigated. The bacteriocin produced by L. mesenteroides strain B7 was identified as leucocin B by specific PCR. In vitro studies demonstrated that both Leuconostoc mesenteroides strains exhibited a marked probiotic profile, showing high survival at low pH (2-3 and 4 in the presence of 0.5%, 1%, and 2% of bile salts and at pH 3 in the presence of 3 mg/mL pepsin. Susceptibility testing against antimicrobial agents was also performed for both strains. When tested in a mixed culture with Listeria innocua, Listeria ivanovii, or Staphylococcus aureus, strain B7 reduced the numbers of these species by 1.87, 1.78, and 1.38 log units, respectively. Consequently, these two strains were found to possess good probiotic properties in vitro and a high capacity for Listeria spp. inhibition in mixed cultures. Therefore, these strains have a favourable technological aptitude and a potential application as novel probiotic starters.

  20. Lactic acid bacteria from raw milk as potentially beneficial strains to prevent bovine mastitis.

    Science.gov (United States)

    Espeche, M Carolina; Pellegrino, Matías; Frola, Ignacio; Larriestra, Alejandro; Bogni, Cristina; Nader-Macías, M E Fátima

    2012-02-01

    Bovine mastitis produces a wide variety of problems in the dairy farm. The treatment of this disease is based on the use of antibiotics which are not always effective. These drugs are also responsible for the presence of residues in the milk and the increase of antibiotic-resistant strains. Probiotic products were proposed as a valid alternative to antibiotic therapies and are also useful for the prevention of infectious syndromes. With the aim of designing a probiotic product to prevent bovine mastitis, lactic acid bacteria (LAB) were isolated from foremilk samples from different dairy farms in Córdoba-Argentina. One hundred and seventeen LAB were isolated and their beneficial characteristics such as the production of inhibitory substances, surface properties and production of exopolysaccharides (EPS) were assessed. Most of them displayed low degree of hydrophobicity, autoaggregation, EPS negative phenotype and were identified as Enterococcus hirae and Pediococcus pentosaceus. Nine LAB strains inhibited three indicator bacteria. Some isolates were pre-selected and genetically identified according to the results obtained. Antibiotic resistance and virulence factors were studied for the assessment of the safety of the strains. The results obtained were compared to those reported previously from samples obtained in the North-western area of the country and some differences were found. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Effects of seasonal changes in feeding management under part-time grazing on the evolution of the composition and coagulation properties of raw milk from ewes.

    Science.gov (United States)

    Abilleira, E; Virto, M; Nájera, A I; Salmerón, J; Albisu, M; Pérez-Elortondo, F J; Ruiz de Gordoa, J C; de Renobales, M; Barron, L J R

    2010-09-01

    Ewe raw milk composition, rennet coagulation parameters, and curd texture were monitored throughout the milk production season in 11 commercial flocks reared under a part-time grazing system. Milking season lasted from February to July. During that period, the diet of the animals shifted from indoor feeding, consisting of concentrate and forage, to an outdoor grazing diet. Lean dry matter, fat, protein, calcium, and magnesium contents increased throughout the milking season, as did rennet coagulation time, curd firmness, and curd resistance to compression. However, lean dry matter, protein content, and curd resistance to compression stabilized when sheep started to graze. Principal component analysis correlated curd resistance to compression and proteins, whereas curd firmness was highly correlated with fat content and minerals. Discriminant analysis distributed milk samples according to the feeding management. Curd firmness, fat, and magnesium turned out to be discriminant variables. Those variables reflected the evolution of the composition and coagulation parameters when fresh pasture prevailed over other feeds in the diet of the flocks. The present study shows that seasonal changes associated with feeding management influence milk technological quality and that milk of good processing quality can be obtained under part-time grazing. Copyright (c) 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Correlation between mastitis occurrence and the count of microorganisms in bulk raw milk of bovine dairy herds in four selective culture media.

    Science.gov (United States)

    Souto, Luís I M; Minagawa, Clarice Y; Telles, Evelise O; Garbuglio, Márcio A; Amaku, Marcos; Melville, Priscilla A; Dias, Ricardo A; Sakata, Sonia T; Benites, Nilson R

    2010-02-01

    Milk is the normal secretion of the mammary gland, practically free of colostrum and obtained by the complete milking of one or more healthy animals. Mastitis is an inflammatory process of the mammary gland and it may cause alterations in the milk. The present work aimed to verify whether it is possible, by means of the counts of microorganism in the bulk raw milk in four selective culture media, to establish a correlation with the occurrence of mastitis and therefore, to monitor this disease in bovine dairy herds. The following selective culture media were used: KF Streptococcus Agar, Edwards Agar, Baird-Parker Agar, Blood Agar plus potassium tellurite. Spearman's correlation coefficient was calculated in order to compare the occurrence of mastitis (percentage) in each herd with respective selective culture media counts of microorganisms in bulk raw milk. Thirty-six possibilities were analysed (Tamis and CMT-positive rates were compared with the log-transformed count in four selective culture media) and there was a negative correlation between Tamis 3 and the Baird-Parker Agar plate count. The total results of microbiological tests showed that there were three correlations of the counts in selective culture media. Fifty-two possibilities were analysed and there was a negative correlation between no-bacterial-growth mastitis rates and log10 of KF Streptoccocus Agar plate count and there were two positive correlations between coagulase-positive staphylococci and log10 of Baird-Parker Agar plate count and Blood Agar plus potassium tellurite plate count.

  3. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2015. Scientific Opinion on the public health risks related to the consumption of raw drinking milk

    DEFF Research Database (Denmark)

    Hald, Tine

    Raw drinking milk (RDM) has a diverse microbial flora which can include pathogens transmissible to humans. The main microbiological hazards associated with RDM from cows, sheep and goats, horses and donkeys and camels were identified using a decision tree approach. This considered evidence of milk...... can arise from animals with systemic infection as well as from localised infections such as mastitis. Extrinsic contamination can arise from faecal contamination and from the wider farm environment. It was not possible to rank control options as no single step could be identified which would...

  4. Short communication: Characterization of methicillin-resistant Staphylococcus aureus isolated from raw milk fresh cheese in Colombia.

    Science.gov (United States)

    Herrera, Fanny C; García-López, María-Luisa; Santos, Jesús A

    2016-10-01

    The aim of this study was the characterization of a collection of 8 methicillin-resistant Staphylococcus aureus (MRSA) isolates, obtained from samples of fresh cheese (Doble Crema) produced from raw cow milk in small dairies in Colombia. All the isolates harbored the mecA and Panton-Valentine leukocidin (PVL) genes, presented with SCCmec type IV, and belonged to multilocus sequence type 8 and spa type 024. Seven isolates presented 3 closely related pulsed-field gel electrophoresis profiles. Three of them carried the staphylococcal enterotoxin B gene. The isolates were resistant to cefoxitin, oxacillin, penicillin, and ampicillin and susceptible to all non-β-lactams antibiotics tested, with minimum inhibitory concentration values for oxacillin of 4 to 8mg/L. The isolates belonged to the community-acquired MRSA group, suggesting a human source of contamination. The risk of human infection by MRSA via contaminated foods is considered low, but contaminated food commodities can contribute to the worldwide dissemination of clones of community-acquired MRSA. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Biodiversity and γ-aminobutyric acid production by lactic acid bacteria isolated from traditional alpine raw cow's milk cheeses.

    Science.gov (United States)

    Franciosi, Elena; Carafa, Ilaria; Nardin, Tiziana; Schiavon, Silvia; Poznanski, Elisa; Cavazza, Agostino; Larcher, Roberto; Tuohy, Kieran M

    2015-01-01

    "Nostrano-cheeses" are traditional alpine cheeses made from raw cow's milk in Trentino-Alto Adige, Italy. This study identified lactic acid bacteria (LAB) developing during maturation of "Nostrano-cheeses" and evaluated their potential to produce γ-aminobutyric acid (GABA), an immunologically active compound and neurotransmitter. Cheese samples were collected on six cheese-making days, in three dairy factories located in different areas of Trentino and at different stages of cheese ripening (24 h, 15 days, and 1, 2, 3, 6, and 8 months). A total of 1,059 LAB isolates were screened using Random Amplified Polymorphic DNA-PCR (RAPD-PCR) and differentiated into 583 clusters. LAB strains from dominant clusters (n = 97) were genetically identified to species level by partial 16S rRNA gene sequencing. LAB species most frequently isolated were Lactobacillus paracasei, Streptococcus thermophilus, and Leuconostoc mesenteroides. The 97 dominant clusters were also characterized for their ability in producing GABA by high-performance liquid chromatography (HPLC). About 71% of the dominant bacteria clusters evolving during cheeses ripening were able to produce GABA. Most GABA producers were Lactobacillus paracasei but other GABA producing species included Lactococcus lactis, Lactobacillus plantarum, Lactobacillus rhamnosus, Pediococcus pentosaceus, and Streptococcus thermophilus. No Enterococcus faecalis or Sc. macedonicus isolates produced GABA. The isolate producing the highest amount of GABA (80.0±2.7 mg/kg) was a Sc. thermophilus.

  6. Identification and characterization of tetracycline resistance in Lactococcus lactis isolated from Polish raw milk and fermented artisanal products.

    Science.gov (United States)

    Zycka-Krzesinska, Joanna; Boguslawska, Joanna; Aleksandrzak-Piekarczyk, Tamara; Jopek, Jakub; Bardowski, Jacek K

    2015-10-15

    To assess the occurrence of antibiotic-resistant Lactic Acid Bacteria (LAB) in Polish raw milk and fermented artisanal products, a collection comprising 500 isolates from these products was screened. Among these isolates, six strains (IBB28, IBB160, IBB161, IBB224, IBB477 and IBB487) resistant to tetracycline were identified. The strains showing atypical tetracycline resistance were classified as Lactococcus lactis: three of them were identified as L. lactis subsp. cremoris (IBB224, IBB477 and IBB487) and the other three (IBB28, IBB160, IBB161) were identified as L. lactis subsp. lactis. The mechanism involving Ribosomal Protection Proteins (RPP) was identified as responsible for tetracycline resistance. Three of the tested strains (IBB28, IBB160 and IBB224) had genes encoding the TetS protein, whereas the remaining three (IBB161, IBB477 and IBB487) expressed TetM. The results also demonstrated that the genes encoding these proteins were located on genetic mobile elements. The tet(S) gene was found to be located on plasmids, whereas tet(M) was found within the Tn916 transposon. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Microbial diversity in raw milk and traditional fermented dairy products (Hurood cheese and Jueke) from Inner Mongolia, China.

    Science.gov (United States)

    Gao, M L; Hou, H M; Teng, X X; Zhu, Y L; Hao, H S; Zhang, G L

    2017-03-08

    Hurood cheese (HC) and Jueke (Jk) are 2 traditional fermented dairy products produced from raw milk (RM) in the Inner Mongolia region of China. They have a long history of production and consumption. The microbial compositions of RM, HC, and Jk vary greatly, and are influenced by their geographical origins and unique processing methods. In this study, 2 batches of RM, HC, and Jk samples were collected (April and August 2015) from the Zhenglan Banner, a region located in the southern part of Inner Mongolian belonging to the Xilingol league prefecture. The bacterial and fungal diversities of the samples were determined by 16S rRNA and 18S rRNA gene sequence analysis, respectively. A total of 112 bacterial and 30 fungal sequences were identified, with Firmicutes and Ascomycota being the predominant phyla for bacteria and fungi, respectively. Lactococcus and Lactobacillus were identified as the main bacterial genera, whereas Kluyveromyces was the predominant fungus identified in the 3 dairy products. Different bacterial and fungal compositions were observed in RM, HC, and Jk samples collected at different times. These results suggested that time of production may be an important factor influencing the microbial diversity present in RM, HC, and Jk.

  8. Streptococcus tangierensis sp. nov. and Streptococcus cameli sp. nov., two novel Streptococcus species isolated from raw camel milk in Morocco.

    Science.gov (United States)

    Kadri, Zaina; Vandamme, Peter; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; Elfahime, El Mostafa; Farricha, Omar El; Swings, Jean; Amar, Mohamed

    2015-02-01

    Biochemical and molecular genetic studies were performed on two unidentified Gram-stain positive, catalase and oxidase negative, non-hemolytic Streptococcus-like organisms recovered from raw camel milk in Morocco. Phenotypic characterization and comparative 16S rRNA gene sequencing demonstrated that the two strains were highly different from each other and that they did not correspond to any recognized species of the genus Streptococcus. Phylogenetic analysis based on 16S rRNA gene sequences showed the unidentified organisms each formed a hitherto unknown sub-line within the genus Streptococcus, displaying a close affinity with Streptococcus moroccensis, Streptococcus minor and Streptococcus ovis. DNA G+C content determination, MALDI-TOF mass spectrometry and biochemical tests demonstrated the bacterial isolates represent two novel species. Based on the phenotypic distinctiveness of the new bacteria and molecular genetic evidence, it is proposed to classify the two strains as Streptococcus tangierensis sp. nov., with CCMM B832(T) (=LMG 27683(T)) as the type strain, and Streptococcus cameli sp. nov., with CCMM B834(T) (=LMG 27685(T)) as the type strain.

  9. The Use of Multiplex PCR to Determine the Prevalence of Enterotoxigenic Staphylococcus aureus Isolated from Raw Milk, Feta Cheese, and Hand Swabs.

    Science.gov (United States)

    Zeinhom, Mohamed M A; Abdel-Latef, Gihan K; Jordan, Kieran

    2015-12-01

    Staphylococcus aureus (S. aureus) can cause mastitis in cattle and, therefore, can be present in milk. This study was undertaken to determine the prevalence of coagulase positive S. aureus and its enterotoxin genes sea, seb, and sec in isolates recovered from raw milk, feta cheese, and human hand swabs of milk and cheese handlers in Beni-Suef province, Egypt. A total of 100 samples of raw milk and 50 samples of pasteurized-milk feta cheese were collected. In addition, 50 hand swabs from milk handlers and 25 hand swabs from cheese handlers were examined for the presence of coagulase positive S. aureus. The isolates were characterized by multiplex PCR for detection of sea, seb, and sec genes, and for resistance to 5 classes of commonly used antibiotics. Twelve (12/100), 12 (6/50), and 17% (13/75) of milk, cheese, and hand swab samples, respectively, were positive for coagulase positive S. aureus. One isolate was obtained from each positive sample (31 isolates), and none contained genes for SEA or SEC production. Twenty-five percent, 33%, and 31%, respectively, of the isolates contained the genes for SEB, resulting in 3%, 4%, and 5% of samples being positive for toxin producing coagulase positive S. aureus, respectively. At least one isolate was resistant to each of the antibiotics tested. Despite the low potential for SEB production shown, preventative measures, such as maintenance of the cold-chain and good hygienic practices should be implemented to further reduce the potential risk to public health from SEB, and to reduce the spread of antimicrobial resistance. © 2015 Institute of Food Technologists®

  10. Multiple-Strain Approach and Probabilistic Modeling of Consumer Habits in Quantitative Microbial Risk Assessment: A Quantitative Assessment of Exposure to Staphylococcal Enterotoxin A in Raw Milk.

    Science.gov (United States)

    Crotta, Matteo; Rizzi, Rita; Varisco, Giorgio; Daminelli, Paolo; Cunico, Elena Cosciani; Luini, Mario; Graber, Hans Ulrich; Paterlini, Franco; Guitian, Javier

    2016-03-01

    Quantitative microbial risk assessment (QMRA) models are extensively applied to inform management of a broad range of food safety risks. Inevitably, QMRA modeling involves an element of simplification of the biological process of interest. Two features that are frequently simplified or disregarded are the pathogenicity of multiple strains of a single pathogen and consumer behavior at the household level. In this study, we developed a QMRA model with a multiple-strain approach and a consumer phase module (CPM) based on uncertainty distributions fitted from field data. We modeled exposure to staphylococcal enterotoxin A in raw milk in Lombardy; a specific enterotoxin production module was thus included. The model is adaptable and could be used to assess the risk related to other pathogens in raw milk as well as other staphylococcal enterotoxins. The multiplestrain approach, implemented as a multinomial process, allowed the inclusion of variability and uncertainty with regard to pathogenicity at the bacterial level. Data from 301 questionnaires submitted to raw milk consumers were used to obtain uncertainty distributions for the CPM. The distributions were modeled to be easily updatable with further data or evidence. The sources of uncertainty due to the multiple-strain approach and the CPM were identified, and their impact on the output was assessed by comparing specific scenarios to the baseline. When the distributions reflecting the uncertainty in consumer behavior were fixed to the 95th percentile, the risk of exposure increased up to 160 times. This reflects the importance of taking into consideration the diversity of consumers' habits at the household level and the impact that the lack of knowledge about variables in the CPM can have on the final QMRA estimates. The multiple-strain approach lends itself to use in other food matrices besides raw milk and allows the model to better capture the complexity of the real world and to be capable of geographical

  11. Microbial Quality of and Biochemical Changes in Fresh Soft, Acid-Curd Xinotyri Cheese Made from Raw or Pasteurized Goat’s Milk

    OpenAIRE

    Eleni C. Pappa; Thomas G. Bontinis; Maria Tasioula-Margari; John Samelis

    2017-01-01

    The microbiological quality of and changes in the main physicochemical parameters, together with the evolution of proteolysis, lipolysis and volatile profiles of soft Xinotyri, a traditional Greek acid-curd cheese (pH≈4.4, moisture 65 %, salt 1 %) made from raw (RMC) or pasteurized (PMC) goat’s milk without starters, were evaluated during aerobic storage at 4 °C for 60 days. No statistically significant differences between the total nitrogen (TN) and nitrogen fraction (% of TN) contents, the ...

  12. Prevalence and Antimicrobial Susceptibility Pattern of E. coli O157:H7 Isolated from Traditionally Marketed Raw Cow Milk in and around Asosa Town, Western Ethiopia.

    Science.gov (United States)

    Disassa, Nigatu; Sibhat, Berhanu; Mengistu, Shimelis; Muktar, Yimer; Belina, Dinaol

    2017-01-01

    A cross-sectional study was conducted from October 2014 to July 2015 to determine the prevalence and populations of E. coli as well as the prevalence and antimicrobial susceptibility of E. coli O157:H7 isolated from raw milk. Biochemical and serological tests methods were used to confirm E. coli and E. coli O157:H7 and isolates were subjected to antimicrobial susceptibility test using the agar disc diffusion method. Out of 380 raw milk samples examined, 129 (33.9%) and 11 (2.9%) were contaminated with E. coli and E. coli O157:H7, respectively. The highest prevalence was recorded in samples obtained from vendors (39.1%, 4.978 ± 0.180 log 10 /ml) compared with samples from farmers (28.1%, 3.93 ± 0.01 log 10 /ml) with significant differences ( P = 0.02). The frequency of contamination was higher in the samples collected from milk that was stored and transported in plastic containers (39.4%) than in the containers made of stainless steel (23.0%) ( P = 0.002). The antimicrobial susceptibility profile showed that E. coli O157:H7 were resistant to tetracycline (81.8%), streptomycin (81.8%), and kanamycin (63.6%). Milk samples were produced and handled under poor hygienic conditions, stored, and transported in inappropriate containers and under temperature abuse conditions leading to high health risk to the consumers. Additional studies would be needed to establish association between the occurrences of E. coli O157:H7 in raw milk and all the risk factors involved in and around Asosa town.

  13. Short communication: Sensory profile of raw goat milk cheeses made with artisan kid rennet pastes from commercial-weight animals: alternative to farmhouse goat cheeses.

    Science.gov (United States)

    Fresno, M; Álvarez, S; Díaz, E; Virto, M; de Renobales, M

    2014-10-01

    The loss of traditional kid rennet pastes in the Canary Islands (Spain), as in many other regions, is most likely due to the custom of using abomasa from very young animals killed below desirable commercial weight. In addition, the reasonable price of commercial rennets (CR) has resulted in the loss of typical sensory characteristics for most farmhouse raw goat milk cheeses, placing them at a disadvantage when local and international markets are full of different cheeses, often with aggressive marketing strategies. This paper analyzes the sensory characteristics of raw goat milk cheeses made with rennet pastes prepared from commercial kid abomasa in 2 ways: dried while full of ingested milk [full, commercial, artisan kid rennet (FCKR)], or dried after being emptied of ingested milk and refilled with raw goat milk [empty, commercial, artisan kid rennet (ECKR)]. This latter practice allows the use of empty abomasa, or abomasa with grass, soil, and so on. Sensory profiles of cheeses made with FCKR and ECKR rennets were compared with those made with CR by an expert panel (n=7). The FCKR and ECKR cheeses had similar sensory profiles. Although scores for FCKR cheeses were somewhat higher than for ECKR cheeses, they were in the range found for traditional cheeses made with rennet prepared with abomasa from very young animals. The sensory profile of CR cheeses was very different. Almost 90% of consumer panelists (n=90) preferred cheeses made with the experimental rennet pastes. These results demonstrate the possibility to prepare artisan rennet pastes from commercial-weight kids in an easy way for farmhouse cheese makers using local resources that would otherwise be destroyed in abattoirs. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Effect of cattle management practices on raw milk quality on farms operating in a two-stage dairy chain.

    Science.gov (United States)

    Sraïri, M T; Benhouda, H; Kuper, M; Le Gal, P Y

    2009-02-01

    In many developing countries, milk production varies greatly according to farm size, cattle breed, and milking practices. However, production systems often are dominated by smallholder farms. Therefore, relatively small volumes of milk are delivered daily from numerous farms to intermediate cooperatives which supply industrial units. This paper argues that in such two-stage dairy chains, milk quality could be improved by focusing on farming practices rather than on the testing of individual deliveries. Indeed, it is difficult to analyze their quality due to technical, economic, and logistic limitations. The objective of this study is to link on-farm practices with milk chemical quality parameters (fat and protein) and hygienic quality criteria (Aerobic Plate Count, APC and Coliforms). Cattle management practices were monitored monthly over one year on 23 farms located on an irrigation scheme in Morocco. 276 milk samples were analyzed. The monthly variability of milk quality parameters was then characterized. Results show that average cow milk chemical parameters vary within a normal range. They remain primarily linked to the genetic type of cows, the lactation stage, and the conversion of feed concentrates' net energy into milk. Overall milk hygienic quality was poor (APC and Coliforms counts were 100 fold international norms), due essentially to a lack of hygiene and inadequate milking conditions (hands, udder, and teat washing, type of bucket used, dirtiness of cows...). It is suggested that a close monitoring of herd management practices may allow the indirect control of milk quality parameters, thereby avoiding costly analyses of numerous smallholder milk deliveries.

  15. Effects of raw milk and starter feed on intake and body composition of Holstein × Gyr male calves up to 64 days of age.

    Science.gov (United States)

    Silva, A L; Marcondes, M I; Detmann, E; Machado, F S; Valadares Filho, S C; Trece, A S; Dijkstra, J

    2015-04-01

    The objective was to evaluate the effect of supplying different levels of raw milk, alone or in combination, with access to a starter feed, on the intake, digestibility, daily gain, N balance, and body composition of Holstein × Gyr crossbred suckling calves until 64 d of age. Thirty-nine male calves aged 4 d with an average initial live weight of 36 ± 1.0 kg were used. Five calves were defined as a reference group and slaughtered at 4 d of age to estimate the initial body composition of the animals. The other calves were distributed according to a completely randomized design in a 3 × 2 factorial arrangement consisting of 3 levels of milk (2, 4, or 8 L/d) and 2 levels of starter feed (presence or absence in diet). At 15 and 45 d of age, 4 animals from each treatment were subjected to digestibility trials with total collection of feces and urine and sampling of feeds. At 64 d of age, all animals were slaughtered and their body tissues were sampled for analyses. Total dry matter and nutrient intake increased linearly and starter intake decreased linearly in response to the supply of increasing amounts of milk. The digestibility coefficient of organic matter was not affected by the inclusion of starter feed and increased linearly as milk supply was elevated. Daily gain was greater at increased milk supply levels and also greater when starter was supplied, without any interaction between milk supply level and the presence or absence of starter. Fecal N excretion and N retention were higher in the animals fed starter feed. Fecal N excretion was not affected by milk levels, whereas N retention was affected. Body protein and ash contents decreased linearly according to increased milk allowance. In contrast, fat body content increased linearly according to milk supply. The presence of starter feed in the diet was responsible for the increased body fat content, but had no effect on protein or ash content. In conclusion, weight gain and N retention in calves up to 64 d of

  16. Lipolysis and proteolysis profiles of fresh artisanal goat cheese made with raw milk with 3 different fat contents.

    Science.gov (United States)

    Sánchez-Macías, D; Morales-Delanuez, A; Moreno-Indias, I; Hernández-Castellano, L E; Mendoza-Grimón, V; Castro, N; Argüello, A

    2011-12-01

    The objective of this study was to describe the proteolysis and lipolysis profiles in goat cheese made in the Canary Islands (Spain) using raw milk with 3 different fat contents (0.5, 1.5, and 5%) and ripened for 1, 7, 14, and 28 d. β-Casein was the most abundant protein in all cheeses and at all ripening times. Quantitative analysis showed a general decrease in caseins as ripening progressed, and degradation rates were higher for α(S1)-casein than for β-casein and α(S2)-casein. Furthermore, the degradation rate during the experimental time decreased with lower fat contents. The α(S2)-casein and α(S1)-casein levels that remained in full-fat and reduced-fat cheeses were less than those in low-fat cheese. In contrast, β-casein also showed degradation along with ripening, but differences in degradation among the 3 cheese types were not significant at 28 d. The degradation products increased with the ripening time in all cheeses, but they were higher in full-fat cheese than in reduced-fat and low-fat cheeses. The free fatty acid concentration per 100g of cheese was higher in full-fat cheese than in reduced- and low-fat cheese; however, when the results were expressed as milligrams of free fatty acids per gram of fat in cheese, then lipolysis occurred more rapidly in low-fat cheese than in reduced- and full-fat cheeses. These results may explain the atypical texture and off-flavors found in low-fat goat cheeses, likely the main causes of non-acceptance. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Paediatric HUS Cases Related to the Consumption of Raw Milk Sold by Vending Machines in Italy: Quantitative Risk Assessment Based on Escherichia coli O157 Official Controls over 7 years.

    Science.gov (United States)

    Giacometti, F; Bonilauri, P; Piva, S; Scavia, G; Amatiste, S; Bianchi, D M; Losio, M N; Bilei, S; Cascone, G; Comin, D; Daminelli, P; Decastelli, L; Merialdi, G; Mioni, R; Peli, A; Petruzzelli, A; Tonucci, F; Liuzzo, G; Serraino, A

    2017-11-01

    A quantitative risk assessment (RA) was developed to estimate haemolytic-uremic syndrome (HUS) cases in paediatric population associated with the consumption of raw milk sold in vending machines in Italy. The historical national evolution of raw milk consumption phenomenon since 2008, when consumer interest started to grow, and after 7 years of marketing adjustment, is outlined. Exposure assessment was based on the official Shiga toxin-producing Escherichia coli O157:H7 (STEC) microbiological records of raw milk samples from vending machines monitored by the regional Veterinary Authorities from 2008 to 2014, microbial growth during storage, consumption frequency of raw milk, serving size, consumption preference and age of consumers. The differential risk considered milk handled under regulation conditions (4°C throughout all phases) and the worst time-temperature field handling conditions detected. In case of boiling milk before consumption, we assumed that the risk of HUS is fixed at zero. The model estimates clearly show that the public health significance of HUS cases due to raw milk STEC contamination depends on the current variability surrounding the risk profile of the food and the consumer behaviour has more impact than milk storage scenario. The estimated HUS cases predicted by our model are roughly in line with the effective STEC O157-associated HUS cases notified in Italy only when the proportion of consumers not boiling milk before consumption is assumed to be 1%. Raw milk consumption remains a source of E. coli O157:H7 for humans, but its overall relevance is likely to have subsided and significant caution should be exerted for temporal, geographical and consumers behaviour analysis. Health education programmes and regulatory actions are required to educate people, primarily children, on other STEC sources. © 2016 Blackwell Verlag GmbH.

  18. Destruction of Mycobacterium paratuberculosis, Salmonella spp., and Mycoplasma spp. in raw milk by a commercial on-farm high-temperature, short-time pasteurizer.

    Science.gov (United States)

    Stabel, J R; Hurd, S; Calvente, L; Rosenbusch, R F

    2004-07-01

    The 2002 NAHM's Dairy Survey indicated that 87.2% of dairy farms in the United States feed waste milk to their neonatal calves. Although cost-effective, this practice can lead to increased calf morbidity and mortality due to ingestion of pathogenic agents. In an effort to reduce the risk of infection, dairy producers are implementing on-farm pasteurization of the waste milk as a control procedure before feeding the milk to calves. In the present study, the efficacy of a commercial high-temperature, short-time (HTST) on-farm pasteurizer unit to destroy Mycobacterium paratuberculosis, Salmonella enterica spp., and Mycoplasma spp. in raw milk was evaluated. Replicate experiments were run for 3 isolates of M. paratuberculosis, 3 serovars of Salmonella (derby, dublin, typhimurium); and 4 species of Mycoplasma (bovis, californicum, canadense, serogroup 7) at 2 different levels of experimental inoculation. In addition, HTST pasteurization experiments were performed on colostrum experimentally inoculated with M. paratuberculosis. After culture of the pasteurized milk samples, no viable M. paratuberculosis, Salmonella, or Mycoplasma were recovered, regardless of species, strain, or isolate. Pasteurization of colostrum was also effective in the destruction of M. paratuberculosis but resulted in an average 25% reduction in colostral immunoglobulin. These results suggest that HTST pasteurization is effective in generating a safer product to feed to young calves.

  19. Species-Level Discrimination of Psychrotrophic Pathogenic and Spoilage Gram-Negative Raw Milk Isolates Using a Combined MALDI-TOF MS Proteomics-Bioinformatics-based Approach.

    Science.gov (United States)

    Vithanage, Nuwan R; Bhongir, Jeevana; Jadhav, Snehal R; Ranadheera, Chaminda S; Palombo, Enzo A; Yeager, Thomas R; Datta, Nivedita

    2017-06-02

    Identification of psychrotrophic pathogenic and spoilage Gram-negative bacteria using rapid and reliable techniques is important in commercial milk processing, as these bacteria can produce heat-resistant proteases and act as postprocessing contaminants in pasteurized milk. Matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) is a proven technology for identification of bacteria in food, however, may require optimization for identification of pathogenic and spoilage bacteria in milk and dairy products. The current study evaluated the effects of various culture conditions and sample preparation methods on assigning of raw milk isolates to the species level by MALDI-TOF MS. The results indicated that culture media, incubation conditions (temperature and time), and sample preparation significantly affected the identification rates of bacteria to the species level. Nevertheless, the development of spectral libraries of isolates grown on different media using a web tool for hierarchical clustering of peptide mass spectra (SPECLUST) followed by a ribosomal protein based bioinformatics approach significantly enhanced the assigning of bacteria, with at least one unique candidate biomarker peak identified for each species. Phyloproteomic relationships based on spectral profiles were compared to phylogenetic analysis using 16S rRNA gene sequences and demonstrated similar clustering patterns with significant discriminatory power. Thus, with appropriate optimization, MALDI-TOF MS is a valuable tool for species-level discrimination of pathogenic and milk spoilage bacteria.

  20. Lead Concentrations in Raw Cow and Goat Milk Collected in Rural Areas of Croatia from 2010 to 2014.

    Science.gov (United States)

    Bilandžić, Nina; Sedak, Marija; Čalopek, Bruno; Luburić, Đurđica Božić; Solomun Kolanović, Božica; Varenina, Ivana; Đokić, Maja; Kmetič, Ivana; Murati, Teuta

    2016-05-01

    A total of 249 cow and 33 goat milk samples were collected in rural areas of Croatia during the period 2010-2014. Lead concentrations in milk samples were analyzed by graphite furnace-atomic absorption spectroscopy. Mean Pb concentrations in milk ranged from (μg/kg): cow 10.8-12.2; goat 9.33-60.0. The highest Pb level of 131 μg/kg in cow milk was measured during 2014. There were no significant differences in Pb levels between cow and goat milk and also in goat milk among the analysed years. However, significant differences were found in cow milk among years. The highest Pb was determined in 2011 (157 μg/kg in goat milk). The calculated estimated weekly intakes of Pb concentrations for cow and goat milk contribute only 1.37 % and 1.84 % to the provisional tolerable weekly intake. Therefore, the consumption of milk from both species should not pose a consumer health risk.

  1. A predictive model to evaluate the impact of the cooling profile on growth of psychrotrophic bacteria in raw milk from conventional and robotic milking.

    Science.gov (United States)

    Christiansson, Anders

    2017-08-01

    This Research Communication explores the usefulness of predictive modelling to explain bacterial behaviour during cooling. A simple dynamic lag phase model was developed and validated. The model takes into account the effect of the cooling profile on the lag phase and growth in bulk tank milk. The time before the start of cooling was the most critical and should not exceed 1 h. The cooling rate between 30 and approximately 10 °C was the second most critical period. Cooling from 30 to 10 °C within 2 h ensured minimal growth of psychrotrophic bacteria in the milk. The cooling rate between 10 and 4 °C (the slowest phase of cooling) was of surprisingly little importance. Given a normal cooling profile to 10 °C, several hours of prolonged cooling time made practically no difference in psychrotrophic counts. This behaviour can be explained by the time/temperature dependence of the work needed by the bacteria to complete the lag phase at low temperature. For milk quality advisors, it is important to know that slow cooling below 10 °C does not result in high total counts of bacteria. In practice, slow cooling is occasionally found at farms with robotic milking. However, when comparing psychrotrophic growth in bulk milk tanks designed for robotic milking or conventional milking, the model predicted less growth for robotic milking for identical cooling profiles. It is proposed that due to the different rates of milk entering the tank, fewer bacteria will exit the lag phase during robotic milking and they will be more diluted than in conventional milking systems. At present, there is no international standard that specifies the cooling profile in robotic systems. The information on the insignificant effect of the cooling rate below 10 °C may be useful in the development of a standard.

  2. Risk assessment of listeriosis linked to the consumption of two soft cheeses made from raw milk: Camembert of Normandy and Brie of Meaux.

    Science.gov (United States)

    Sanaa, Moez; Coroller, Louis; Cerf, Olivier

    2004-04-01

    This article reports a quantitative risk assessment of human listeriosis linked to the consumption of soft cheeses made from raw milk. Risk assessment was based on data purposefully acquired inclusively over the period 2000-2001 for two French cheeses, namely: Camembert of Normandy and Brie of Meaux. Estimated Listeria monocytogenes concentration in raw milk was on average 0.8 and 0.3 cells/L, respectively, in Normandy and Brie regions. A Monte Carlo simulation was used to account for the time-temperature history of the milk and cheeses from farm to table. It was assumed that cell progeny did not spread within the solid cheese matrix (as they would be free to do in liquid broth). Interaction between pH and temperature was accounted for in the growth model. The simulated proportion of servings with no L. monocytogenes cell was 88% for Brie and 82% for Camembert. The 99th percentile of L. monocytogenes cell numbers in servings of 27 g of cheese was 131 for Brie and 77 for Camembert at the time of consumption, corresponding respectively to three and five cells of L. monocytogenes per gram. The expected number of severe listeriosis cases would be Camembert of Normandy, respectively.

  3. Direct Quantitative Detection and Identification of Lactococcal Bacteriophages from Milk and Whey by Real-Time PCR: Application for the Detection of Lactococcal Bacteriophages in Goat's Raw Milk Whey in France

    Directory of Open Access Journals (Sweden)

    Mai Huong Ly-Chatain

    2011-01-01

    Full Text Available The presence of Lactococcus bacteriophages in milk can partly or completely inhibit milk fermentation. To prevent the problems associated with the bacteriophages, the real-time PCR was developed in this study for direct detection from whey and milk of three main groups of Lactococcus bacteriophages, c2, 936, and P335. The optimization of DNA extraction protocol from complex matrices such as whey and milk was optimized allowed the amplification of PCR without any matrix and nontarget contaminant interference. The real-time PCR program was specific and with the detection limit of 102 PFU/mL. The curve slopes were −3.49, −3.69, and −3.45 with the amplification efficiency estimated at 94%, 94%, and 98% and the correlation coefficient (2 of 0.999, 0.999, and 0.998 for c2, 936 and P335 group, respectively. This method was then used to detect the bacteriophages in whey and goat's raw milk coming from three farms located in the Rhône-Alpes region (France.

  4. Screening of Probiotic Activities of Lactobacilli Strains Isolated from Traditional Tibetan Qula, A Raw Yak Milk Cheese

    Directory of Open Access Journals (Sweden)

    Bei Zhang

    2016-10-01

    Full Text Available In this study, 69 lactobacilli isolated from Tibetan Qula, a raw yak milk cheese, were screened for their potential use as probiotics. The isolates were tested in terms of: Their ability to survive at pH 2.0, pH 3.0, and in the presence of 0.3% bile salts; tolerance of simulated gastric and intestinal juices; antimicrobial activity; sensitivity against 11 specific antibiotics; and their cell surface hydrophobicity. The results show that out of the 69 strains, 29 strains (42% had survival rates above 90% after 2 h of incubation at pH values of 2.0 or 3.0. Of these 29 strains, 21 strains showed a tolerance for 0.3% bile salt. Incubation of these 21 isolates in simulated gastrointestinal fluid for 3 h revealed survival rates above 90%; the survival rate for 20 of these isolates remained above 90% after 4 h of incubation in simulated intestinal fluid. The viable counts of bacteria after incubation in simulated gastric fluid for 3 h and simulated intestinal fluid for 4 h were both significantly different compared with the counts at 0 h (p<0.001. Further screening performed on the above 20 isolates indicated that all 20 lactobacilli strains exhibited inhibitory activity against Micrococcus luteus ATCC 4698, Bacillus subtilis ATCC 6633, Listeria monocytogenes ATCC 19115, and Salmonella enterica ATCC 43971. Moreover, all of the strains were resistant to vancomycin and streptomycin. Of the 20 strains, three were resistant to all 11 elected antibiotics (ciprofloxacin, erythromycin, tetracycline, penicillin G, ampicillin, streptomycin, polymyxin B, vancomycin, chloramphenicol, rifampicin, and gentamicin in this study, and five were sensitive to more than half of the antibiotics. Additionally, the cell surface hydrophobicity of seven of the 20 lactobacilli strains was above 70%, including strains Lactobacillus casei 1,133 (92%, Lactobacillus plantarum 1086-1 (82%, Lactobacillus casei 1089 (81%, Lactobacillus casei 1138 (79%, Lactobacillus buchneri 1059 (78

  5. Screening of Probiotic Activities of Lactobacilli Strains Isolated from Traditional Tibetan Qula, A Raw Yak Milk Cheese.

    Science.gov (United States)

    Zhang, Bei; Wang, Yanping; Tan, Zhongfang; Li, Zongwei; Jiao, Zhen; Huang, Qunce

    2016-10-01

    In this study, 69 lactobacilli isolated from Tibetan Qula, a raw yak milk cheese, were screened for their potential use as probiotics. The isolates were tested in terms of: Their ability to survive at pH 2.0, pH 3.0, and in the presence of 0.3% bile salts; tolerance of simulated gastric and intestinal juices; antimicrobial activity; sensitivity against 11 specific antibiotics; and their cell surface hydrophobicity. The results show that out of the 69 strains, 29 strains (42%) had survival rates above 90% after 2 h of incubation at pH values of 2.0 or 3.0. Of these 29 strains, 21 strains showed a tolerance for 0.3% bile salt. Incubation of these 21 isolates in simulated gastrointestinal fluid for 3 h revealed survival rates above 90%; the survival rate for 20 of these isolates remained above 90% after 4 h of incubation in simulated intestinal fluid. The viable counts of bacteria after incubation in simulated gastric fluid for 3 h and simulated intestinal fluid for 4 h were both significantly different compared with the counts at 0 h (pstrains exhibited inhibitory activity against Micrococcus luteus ATCC 4698, Bacillus subtilis ATCC 6633, Listeria monocytogenes ATCC 19115, and Salmonella enterica ATCC 43971. Moreover, all of the strains were resistant to vancomycin and streptomycin. Of the 20 strains, three were resistant to all 11 elected antibiotics (ciprofloxacin, erythromycin, tetracycline, penicillin G, ampicillin, streptomycin, polymyxin B, vancomycin, chloramphenicol, rifampicin, and gentamicin) in this study, and five were sensitive to more than half of the antibiotics. Additionally, the cell surface hydrophobicity of seven of the 20 lactobacilli strains was above 70%, including strains Lactobacillus casei 1,133 (92%), Lactobacillus plantarum 1086-1 (82%), Lactobacillus casei 1089 (81%), Lactobacillus casei 1138 (79%), Lactobacillus buchneri 1059 (78%), Lactobacillus plantarum1141 (75%), and Lactobacillus plantarum 1197 (71%). Together, these results suggest

  6. Building global models for fat and total protein content in raw milk based on historical spectroscopic data in the visible and short-wave near infrared range.

    Science.gov (United States)

    Melenteva, Anastasiia; Galyanin, Vladislav; Savenkova, Elena; Bogomolov, Andrey

    2016-07-15

    A large set of fresh cow milk samples collected from many suppliers over a large geographical area in Russia during a year has been analyzed by optical spectroscopy in the range 400-1100 nm in accordance with previously developed scatter-based technique. The global (i.e. resistant to seasonal, genetic, regional and other variations of the milk composition) models for fat and total protein content, which were built using partial least-squares (PLS) regression, exhibit satisfactory prediction performances enabling their practical application in the dairy. The root mean-square errors of prediction (RMSEP) were 0.09 and 0.10 for fat and total protein content, respectively. The issues of raw milk analysis and multivariate modelling based on the historical spectroscopic data have been considered and approaches to the creation of global models and their transfer between the instruments have been proposed. Availability of global models should significantly facilitate the dissemination of optical spectroscopic methods for the laboratory and in-line quantitative milk analysis. Copyright © 2016. Published by Elsevier Ltd.

  7. Direct determination of Pb in raw milk by graphite furnace atomic absorption spectrometry (GF AAS) with electrothermal atomization sampling from slurries.

    Science.gov (United States)

    de Oliveira, Tatiane Milão; Augusto Peres, Jayme; Lurdes Felsner, Maria; Cristiane Justi, Karin

    2017-08-15

    Milk is an important food in the human diet due to its physico-chemical composition; therefore, it is necessary to monitor contamination by toxic metals such as Pb. Milk sample slurries were prepared using Triton X-100 and nitric acid for direct analysis of Pb using graphite furnace atomic absorption spectrometry - GF AAS. After dilution of the slurries, 10.00µl were directly introduced into the pyrolytic graphite tube without use of a chemical modifier, which acts as an advantage considering this type of matrix. The limits of detection and quantification were 0.64 and 2.14µgl -1 , respectively. The figures of merit studied showed that the proposed methodology without pretreatment of the raw milk sample and using external standard calibration is suitable. The methodology was applied in milk samples from the Guarapuava region, in Paraná State (Brazil) and Pb concentrations ranged from 2.12 to 37.36µgl -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Potential and limitation of mid-infrared attenuated total reflectance spectroscopy for real time analysis of raw milk in milking lines.

    Science.gov (United States)

    Linker, Raphael; Etzion, Yael

    2009-02-01

    Real-time information about milk composition would be very useful for managing the milking process. Mid-infrared spectroscopy, which relies on fundamental modes of molecular vibrations, is routinely used for off-line analysis of milk and the purpose of the present study was to investigate the potential of attenuated total reflectance mid-infrared spectroscopy for real-time analysis of milk in milking lines. The study was conducted with 189 samples from over 70 cows that were collected during an 18 months period. Principal component analysis, wavelets and neural networks were used to develop various models for predicting protein and fat concentration. Although reasonable protein models were obtained for some seasonal sub-datasets (determination errors protein), the models lacked robustness and it was not possible to develop a model suitable for all the data. Determination of fat concentration proved even more problematic and the determination errors remained unacceptably large regardless of the sub-dataset analyzed or of the spectral intervals used. These poor results can be explained by the limited penetration depth of the mid-infrared radiation that causes the spectra to be very sensitive to the presence of fat globules or fat biofilms in the boundary layer that forms at the interface between the milk and the crystal that serves both as radiation waveguide and sensing element. Since manipulations such as homogenisation are not permissible for in-line analysis, these results show that the potential of mid-infrared attenuated total reflectance spectroscopy for in-line milk analysis is indeed quite limited.

  9. Prevalence of antibiotic resistant Staphylococcus aureus from raw milk samples collected from the local vendors in the region of Tirupathi, India

    Directory of Open Access Journals (Sweden)

    Sudhanthirakodi Sudhanthiramani

    2015-04-01

    Full Text Available Aim: The study was carried out with the aim to identify the suitability of the milk for consumer use with special reference to Staphylococcus aureus from milk samples collected from various local vendors and determine the antibiotic susceptibility pattern of those positive isolates. Materials and Methods: A total of 110 milk samples were collected from the local milk vendors in and around Tirupathi region of India. All the samples were enriched with buffered peptone water in 9:1 ratio and the then inoculated on baird parker agar medium with added 2% egg yolk tellurite emulsion as selective medium for S.aureus and confirmed with mannitol salt agar, Gram’s staining and biochemical tests. The typical cultural characters with coagulase-positive samples were taken as positive samples the positive samples were tested for antibiotic susceptibility with 10 different antibiotics by employing disc diffusion method. Results: Prevalence of coagulase-positive S. aureus was 39.09% (43/110 from the milk samples. The antibiotic susceptibility test of positive isolates showed high resistant toward penicillin G 37/43 (86.04% and ampicillin 32/43 (74.42%, and also showed resistant to methicillin 6/43 (13.95%, cephalothin 6/43 (13.95%, tetracycline 6/43 (13.95%, ciprofloxacin 4/43 (9.30%, enrofloxacin 3/43 (6.97%, cefoxitin 2/43 (4.65%, gentamicin 2/43 (4.65%, and co-trimoxazole 2/43 (4.65%. Many individual isolates showed resistant against two or more antibiotics in our study. Conclusion: The above study results show that the milk samples collected from local vendor having S. aureus, which can induce disease condition as well as antibiotic resistant to the humans particularly young children and old age peoples by means of consumption of raw milk and its products. This is the public health issue, which needs to be solved by educating the local vendors regarding health problems related to unhygienic milk supply and make the awareness among the consumers about this

  10. Effect of pasture versus indoor feeding systems on raw milk composition and quality over an entire lactation.

    Science.gov (United States)

    O'Callaghan, Tom F; Hennessy, Deirdre; McAuliffe, Stephen; Kilcawley, Kieran N; O'Donovan, Michael; Dillon, Pat; Ross, R Paul; Stanton, Catherine

    2016-12-01

    The aim of this study was to investigate the effects of different feeding systems on milk quality and composition. Fifty-four multiparous and primiparous Friesian lactating cows were divided into 3 groups (n=18) to study the effects of 3 feeding systems over a full lactation. Group 1 was housed indoors and offered a total mixed ration diet (TMR), group 2 was maintained outdoors on a perennial ryegrass pasture (referred to as grass), and group 3 was also grazed outdoors on a perennial ryegrass/white clover pasture (referred to as clover). Bulk milk samples were collected from each group at morning and afternoon milkings once weekly from March 11 to October 28 in 2015. Milk from pasture-fed cows (grass and clover) had significantly higher concentrations of fat, protein, true protein, and casein. The pasture feeding systems induced significantly higher concentrations of saturated fatty acids C11:0, C13:0, C15:0, C17:0, C23:0, and unsaturated fatty acids C18:2n-6 trans, C18:3n-3, C20:1, and C20:4n-6 and a greater than 2-fold increase in the conjugated linoleic acid C18:2 cis-9,trans-11 content of milk compared with that of the TMR feeding system. The TMR feeding system resulted in milks with increased concentrations of C16:0, C18:2n-6 cis, C18:3n-6 cis, C22:0 C22:1n-9, and C18:2 cis-10,trans-12. Principal component analysis of average fatty acid profiles showed clear separation of milks from the grazed pasture-based diets to that of a TMR system throughout lactation, offering further insight into the ability to verify pasture-derived milk by fatty acid profiling. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Diversity of thermophilic bacteria in raw, pasteurized and selectively-cultured milk, as assessed by culturing, PCR-DGGE and pyrosequencing.

    Science.gov (United States)

    Delgado, Susana; Rachid, Caio T C C; Fernández, Elena; Rychlik, Tomasz; Alegría, Angel; Peixoto, Raquel S; Mayo, Baltasar

    2013-10-01

    Thermophilic lactic acid bacteria (LAB) species, such as Streptococcus thermophilus, Lactobacillus delbrueckii and Lactobacillus helveticus, enjoy worldwide economic importance as dairy starters. To assess the diversity of thermophilic bacteria in milk, milk samples were enriched in thermophilic organisms through a stepwise procedure which included pasteurization of milk at 63 °C for 30 min (PM samples) and pasteurization followed by incubation at 42 °C for 24 h (IPM samples). The microbial composition of these samples was analyzed by culture-dependent (at 42 °C) and culture-independent (PCR-DGGE and pyrosequencing of 16S rRNA gene amplicons) microbial techniques. The results were then compared to those obtained for their corresponding starting raw milk counterparts (RM samples). Twenty different species were scored by culturing among 352 isolates purified from the counting plates and identified by molecular methods. Mesophilic LAB species (Lactococcus lactis, Lactococcus garvieae) were dominant (87% of the isolates) among the RM samples. However, S. thermophilus and Lb. delbrueckii were found to be the dominant recoverable organisms in both PM and IPM samples. The DGGE profiles of RM and PM samples were found to be very similar; the most prominent bands belonging to Lactococcus, Leuconostoc and Streptococcus species. In contrast, just three DGGE bands were obtained for IPM samples, two of which were assigned to S. thermophilus. The pyrosequencing results scored 95 operational taxonomic units (OTUs) at 3% sequence divergence in an RM sample, while only 13 were encountered in two IPM samples. This technique identified Leuconostoc citreum as the dominant microorganism in the RM sample, while S. thermophilus constituted more than 98% of the reads in the IPM samples. The procedure followed in this study allowed to estimate the bacterial diversity in milk and afford a suitable strategy for the isolation of new thermophilic LAB strains, among which adequate

  12. Ripening of Sudanese Braided (Muddaffara Cheese Manufactured from Raw or Pasteurized Milk: Effect of Heat Treatment and Salt Concentration on the Physicochemical Properties

    Directory of Open Access Journals (Sweden)

    Mohamed O. E. Altahir

    2014-01-01

    Full Text Available The objective of the study was to investigate the interactive effect of heat treatment (raw or pasteurized milk, ripening in salted whey (SW and storage period for up to 3 months on the physicochemical properties of Sudanese braided cheese (SBC. Braided cheeses were manufactured from raw (BCRM and pasteurized (BCPM milk and ripened in SW (0%, 5%, and 10% salt for up to 90 days. All the treatments significantly (P≤0.05 affected the physicochemical characteristics of SBC. The total solid, protein, and fat contents of BCRM or BCPM decreased (P≤0.05, whereas their TA, SN, and salt contents increased significantly (P≤0.05 as storage period and the salt level of the whey were elevated. Both FRI and SRI of BCRM and BCPM increased with the increase in storage period and the salt level of the whey. For SN, FRI, SRI, pH, and moisture contents the magnitude of the change was more pronounced in BCRM than in BCPM, while for protein, fat, salt, and TS contents, the opposite was true; that is, the magnitude of the change was more pronounced in BCPM than in BCRM. Further studies are required to standardize muddaffara cheese manufacturing procedure particularly in rural areas.

  13. Ripening of Sudanese Braided (Muddaffara) Cheese Manufactured from Raw or Pasteurized Milk: Effect of Heat Treatment and Salt Concentration on the Physicochemical Properties.

    Science.gov (United States)

    Altahir, Mohamed O E; Elgasim, Elgasim A; Mohamed Ahmed, Isam A

    2014-01-01

    The objective of the study was to investigate the interactive effect of heat treatment (raw or pasteurized milk), ripening in salted whey (SW) and storage period for up to 3 months on the physicochemical properties of Sudanese braided cheese (SBC). Braided cheeses were manufactured from raw (BCRM) and pasteurized (BCPM) milk and ripened in SW (0%, 5%, and 10% salt) for up to 90 days. All the treatments significantly (P ≤ 0.05) affected the physicochemical characteristics of SBC. The total solid, protein, and fat contents of BCRM or BCPM decreased (P ≤ 0.05), whereas their TA, SN, and salt contents increased significantly (P ≤ 0.05) as storage period and the salt level of the whey were elevated. Both FRI and SRI of BCRM and BCPM increased with the increase in storage period and the salt level of the whey. For SN, FRI, SRI, pH, and moisture contents the magnitude of the change was more pronounced in BCRM than in BCPM, while for protein, fat, salt, and TS contents, the opposite was true; that is, the magnitude of the change was more pronounced in BCPM than in BCRM. Further studies are required to standardize muddaffara cheese manufacturing procedure particularly in rural areas.

  14. Validation of a liquid chromatography-electrospray ionization tandem mass spectrometric method to determine six polyether ionophores in raw, UHT, pasteurized and powdered milk.

    Science.gov (United States)

    Pereira, Mararlene Ulberg; Spisso, Bernardete Ferraz; Jacob, Silvana do Couto; Monteiro, Mychelle Alves; Ferreira, Rosana Gomes; Carlos, Betânia de Souza; da Nóbrega, Armi Wanderley

    2016-04-01

    This study aimed to validate a method developed for the determination of six antibiotics from the polyether ionophore class (lasalocid, maduramicin, monensin, narasin, salinomycin and semduramicin) at residue levels in raw, UHT, pasteurized and powdered milk using QuEChERS extraction and high performance liquid chromatography coupled to tandem mass spectrometry (HPLC-MS/MS). The validation was conducted under an in-house laboratory protocol that is primarily based on 2002/657/EC Decision, but takes in account the variability of matrix sources. Overall recoveries between 93% and 113% with relative standard deviations up to 16% were obtained under intermediate precision conditions. CCα calculated values did not exceed 20% the Maximum Residue Limit for monensin and 25% the Maximum Levels for all other substances. The method showed to be simple, fast and suitable for verifying the compliance of raw and processed milk samples regarding the limits recommended by Codex Alimentarius and those adopted in European Community for polyether ionophores. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Risco à saúde representado pelo consumo de leite cru comercializado clandestinamente Health risk due to the consumption of raw milk commercialized without due authorization

    Directory of Open Access Journals (Sweden)

    Kathia Brienza Badini

    1996-12-01

    Full Text Available Foram submetidas às contagens de microrganismos mesófilos, Staphylococccus coagulase positiva, e às determinações do número mais provável (NMP de coliformes totais e de coliformes fecais, 60 amostras de leite cru comercializado clandestinamente nos Municípios de Botucatu e de São Manuel, Estado de São Paulo, Brasil. Os resultados obtidos evidenciaram a ocorrência de 41 (68,3% e 50 (83,3% amostras com contagens de microrganismos mesófilos e de coliformes totais, respectivamente, acima dos limites máximos estabelecidos pelo Ministério da Saúde para o leite pasteurizado tipo C. Evidenciaram, ainda, a presença de 30 (50,0% e 11 (18,3% amostras contaminadas por cepas de Staphylococcus coagulase positiva e por coliformes fecais, respectivamente. Apenas 5 (8,3% amostras mostraram-se dentro dos referidos padrões legais.Sixty raw milk samples commercialized without due authorization in the counties of Botucatu and S. Manuel, State of S. Paulo (Brazil, were submitted to mesophilic microorganism and coagulase-positive Staphylococcus and most probable number of total coliform and fecal coliform counts. Forty-one (68.3% and 50 (83.3% of the samples were found, respectively to contain mesophilic microorganisms and total coliforms above the maximum limits established by the Health Ministry for type C pasteurized milk. Thirty (50.0% and 11 (18.3% of the samples were found, respectively, to the contaminated by coagulase-positive Staphylococcus and fecal coliforms. Only 5 (8.3% samples were found to comply with the required legal standards. The results showed the unsatisfactory hygienic and sanitary conditions of the raw milk and suggest the existence of great risk to the health of the consumers, especially when the product is taken without being boiled.

  16. Microbial Quality of and Biochemical Changes in Fresh Soft, Acid-Curd Xinotyri Cheese Made from Raw or Pasteurized Goat's Milk.

    Science.gov (United States)

    Pappa, Eleni C; Bontinis, Thomas G; Tasioula-Margari, Maria; Samelis, John

    2017-12-01

    The microbiological quality of and changes in the main physicochemical parameters, together with the evolution of proteolysis, lipolysis and volatile profiles of soft Xinotyri, a traditional Greek acid-curd cheese (pH≈4.4, moisture 65%, salt 1%) made from raw (RMC) or pasteurized (PMC) goat's milk without starters, were evaluated during aerobic storage at 4 o C for 60 days. No statistically significant differences between the total nitrogen (TN) and nitrogen fraction (% of TN) contents, the degradation of intact α s - or β-caseins, total free amino acid (FAA) contents, and the ratio of hydrophilic and hydrophobic peptides in the water-soluble fraction of RMC and PMC were found. Threonine, alanine and lysine were the principal FAAs. Oleic, palmitic, capric and caprylic acids, and ethyl hexonate, ethyl octanoate, ethyl decanoate, ethanol, 3-methyl butanol, phenyl ethyl alcohol and acetone were the most abundant free fatty acids and volatile compounds, respectively. Cheese lipolysis evolved slowly at 4 o C, and milk pasteurization had no significant effect on it. Mesophilic lactic acid bacteria (LAB) were predominant in fresh cheese samples. PMC samples had significantly lower levels of enterococci and enterobacteria than RMC samples, while yeasts grew at similar levels during storage at 4 o C. All cheese samples (25 g) were free of Salmonella and Listeria monocytogenes . Coagulase-
-positive staphylococci exceeded the 5-log safety threshold in fresh RMC samples, whereas they were suppressed (pasteurization of raw goat milk's and utilization of commercially defined or natural mesophilic LAB starters are recommended for standardizing the biochemical, microbial and safety qualities of fresh soft Xinotyri cheese.

  17. Plasmids of Raw Milk Cheese Isolate Lactococcus lactis subsp. lactis Biovar diacetylactis DPC3901 Suggest a Plant-Based Origin for the Strain ▿ †

    Science.gov (United States)

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F.; Ross, R. Paul

    2011-01-01

    The four-plasmid complement of the raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 was sequenced, and some genetic features were functionally analyzed. The complete sequences of pVF18 (18,977 bp), pVF21 (21,739 bp), pVF22 (22,166 bp), and pVF50 (53,876 bp) were obtained. Each plasmid contained genes not previously described for Lactococcus, in addition to genes associated with plant-derived lactococcal strains. Most of the novel genes were found on pVF18 and encoded functions typical of bacteria associated with plants, such as activities of plant cell wall modification (orf11 and orf25). In addition, a predicted high-affinity regulated system for the uptake of cobalt was identified (orf19 to orf21 [orf19-21]), which has a single database homolog on a plant-derived Leuconostoc plasmid and whose functionality was demonstrated following curing of pVF18. pVF21 and pVF22 encode additional metal transporters, which, along with orf19-21 of pVF18, could enhance host ability to uptake growth-limiting amounts of biologically essential ions within the soil. In addition, vast regions from pVF50 and pVF21 share significant homology with the plant-derived lactococcal plasmid pGdh442, which is indicative of extensive horizontal gene transfer and recombination between these plasmids and suggests a common plant niche for their hosts. Phenotypes associated with these regions include glutamate dehydrogenase activity and Na+ and K+ transport. The presence of numerous plant-associated markers in L. lactis DPC3901 suggests a plant origin for the raw milk cheese isolate and provides for the first time the genetic basis to support the concept of the plant-milk transition for Lactococcus strains. PMID:21803914

  18. The rapid determination of fat and protein content in fresh raw milk using the laser light scattering technology

    Science.gov (United States)

    Xin, Qi; Zhi Ling, Hou; Jian Long, Tian; Zhu, Yu

    2006-08-01

    The aim was to develop a simple and rapid method for determination of fat and protein content in milk. Based on the laser light scattering theory, the ratio of the scattered light (at 90±0.05° scattering angles) intensity to the transmitted light intensity, which is called scattered-transmitted-ratio method, is adopted as the optical parameter representing the milk fat content and the protein content. In this way, the influence of the fluctuation of the power of the light source is eliminated and the accuracy of determination is improved accordingly. The system we use is real-time and can satisfy the challenging requirements of dairy farming. Results of this study indicate the feasibility of using this technology for fresh milk fat and protein analysis. The fat contents and protein contents of 50 milk samples determined by this method were consistent with the values obtained by the reference methods based on Rose-Gottlieb method and Kjeldahl determination of N method. In this paper, the operating principle of the instrument is introduced and the influence of the environmental conditions, such as the homogenization pressure and homogenization temperature, etc. on the result of the test is analyzed. Through data analysis, the concrete schemes for testing the fat using the curve fitting and testing the protein using the surface fitting technique are determined. Finally, the difference from the reference values of the test is discussed.

  19. Qualidade do leite cru ovino armazenado sob refrigeração | Quality of ovine raw milk stored under refrigeration

    Directory of Open Access Journals (Sweden)

    Félix Roman Munieweg

    2017-02-01

    Full Text Available A industrialização de lácteos ovinos é recente no Brasil e a produção é concentrada em regiões de serra, como a Gaúcha. O leite ovino possui alto conteúdo de sólidos comparado ao bovino, com maior rendimento na produção de queijo. A produção deste leite sofre variações sazonais e poderia ser estocado até obter uma quantidade suficiente para processamento. O objetivo deste trabalho foi avaliar parâmetros microbiológicos e físico-químicos no leite proveniente de seis produtores sob armazenamento refrigerado. O leite foi analisado durante sete dias, incluindo contagem padrão em placas (CPP, psicrotróficos, coliformes totais e termotolerantes, Staphylococcus sp. e Staphylococcus aureus, acidez titulável, pH, atividade de água e proteína. Os resultados demonstraram altas contagens microbianas e CPP acima dos limites estabelecidos pela legislação para a maioria das amostras. Contagens de psicrotróficos, coliformes totais e fecais foram elevadas durante este período. A acidez titulável aumentou ao longo dos dias e o conteúdo de proteína diminuiu. As amostras do produtor B apresentaram menores contagens microbianas dentre todas testadas. A estocagem a frio torna-se uma alternativa, a curto prazo, quando há diminuição na produção de leite ovino para beneficiamento a derivados. No entanto, o período de armazenamento refrigerado não deve ultrapassar dois dias, devido à deterioração. ==================================================== The dairy sheep industry is recent in Brazil and the production is concentrated in mountainous regions, such as Serra Gaúcha. Ovine milk has a higher solids content compared to bovine milk, thus with higher yield in cheese production. Sheep milk production undergoes seasonal variations and it could be stored until a sufficient quantity is available for processing. The objective of this study was to evaluate microbiological and physicochemical parameters in ovine milk from six

  20. Existing drug resistance among Staphylococcus spp. from raw milk samples in Khon Kaen province, Northeastern Thailand by direct quadriplex PCR

    Directory of Open Access Journals (Sweden)

    Buppachat Trakarnchan

    2017-10-01

    Full Text Available To describe the proportion of methicillin resistant Staphylococcus aureus, and mupirocin resistant among the isolates from milk, three hundred and eighty-one samples were collected in Khon Kaen province, Thailand, during January to March, 2014. Quadriplex PCR was a method of choice. The occurrence of S. aureus and other Staphylococcus spp. were 21.26 and 34.12%, respectively. Among the 81 S. aureus isolates, 82.72 (67/81, 11.11 (9/81, and 6.17% (5/81 were S. aureus, S. aureus carrying mecA, and S. aureus harboring mupA genes, respectively. These two mutant genes may possibly be transferred to other bacteria in milk. Therefore, good hygienic practices and strict control may limit the spread.

  1. Speciation of native cations and added radionuclides in raw bovine milk. I. membraneless dialysis in aqueous biphasic systems

    International Nuclear Information System (INIS)

    Macasek, F.; Gerhart, P.; Malovikova, A.; Celkova, A.

    1996-01-01

    Partition of native sodium, potassium, magnesium, calcium and radioisotopes of cesium, strontium and europium was investigated in the aqueous liquid-liquid systems formed after agitation of fresh pasteurized skim bovine milk with 4% w/w water solution of pectin of various degree of esterification (60-93%). The partition of the ions in the 'membraneless dialysis' was described by Donnan equilibria and ion-exchange in the macro-and microheterogenous systems and, within uncertainty of results, does not depend on the degree of esterification. Strong negative non-ideality of Sr and Eu in milk phase is attributed to binding with proteins, casein particles in particular, and complexation with low molecular ligands. Separation factor α = D(Sr)/D(Ca) is 0.70 ±0.06, in favor of strontium concentration in pectin phase. While>96% of cesium is diffusible to pectin phase, only 43-56% (depending on physico-chemical model of dialysis) of strontium behaves in that way, and in original milk phase the percent of strontium cationic from may be as low as 13%. (author). 24 refs., 8 figs., 4 tabs

  2. Determination of benzimidazole residues and their metabolites in raw milk using high performance liquid chromatography-diode array detection

    Directory of Open Access Journals (Sweden)

    Marija Denžić Lugomer

    2017-01-01

    Full Text Available A new analytical method using high performance liquid chromatography-diode array detector (HPLC-DAD was developed for the analysis of 18 benzimidazoles and their metabolites in milk. Samples were extracted with acetonitrile and n-hexane and purified by polymer cation exchange (PCX solid phase extraction cartridges. LC separation was performed on Xbridge C18 with gradient elution using acetonitrile and ammonium acetate buffer. The DAD detection was set at 298, 312, 254 and 290 nm. The method was validated according to the criteria of Commission Decision 2002/657/EC. The following validation parameters were set: accuracy (expressed as recovery 31.7-137.6 %, limit of decision (CCα 6.0-120.6 μg kg-1, detection capability (CCβ 6.1-120.8 μg kg-1, limit of detection (LOD 1-4 μg kg-1, limit of quantification (LOQ 4-18 μg kg-1, precision as CV 7.0-22.5 %, withinlaboratory reproducibility expressed as CV 8.8-30.6 %. Finally, the developed method was applied to the analysis of collected milk samples. A total of 50 milk samples was analysed for benzimidazole residues. All obtained concentrations for all compounds were below the LOQ values.

  3. Impact of thistle rennet from Carlina acanthifolia All. subsp. acanthifolia on bacterial diversity and dynamics of a specialty Italian raw ewes' milk cheese.

    Science.gov (United States)

    Cardinali, Federica; Osimani, Andrea; Taccari, Manuela; Milanović, Vesna; Garofalo, Cristiana; Clementi, Francesca; Polverigiani, Serena; Zitti, Silvia; Raffaelli, Nadia; Mozzon, Massimo; Foligni, Roberta; Franciosi, Elena; Tuohy, Kieran; Aquilanti, Lucia

    2017-08-16

    Caciofiore della Sibilla is an Italian specialty soft cheese manufactured with Sopravissana raw ewes' milk and thistle rennet prepared with young fresh leaves and stems of Carlina acanthifolia All. subsp. acanthifolia, according to an ancient tradition deeply rooted in the territory of origin (mountainous hinterland of the Marche region, Central Italy). In this study, the impact of thistle rennet on the bacterial dynamics and diversity of Caciofiore della Sibilla cheese was investigated by applying a polyphasic approach based on culture and DNA-based techniques (Illumina sequencing and PCR-DGGE). A control cheese manufactured with the same batch of ewes' raw milk and commercial animal rennet was analyzed in parallel. Overall, a large number of bacterial taxa were identified, including spoilage, environmental and pro-technological bacteria, primarily ascribed to Lactobacillales. Thistle rennet was observed clearly to affect the early bacterial dynamics of Caciofiore della Sibilla cheese with Lactobacillus alimentarius/paralimentarius and Lactobacillus plantarum/paraplantarum/pentosus being detected in the phyllosphere of C. acanthifolia All., thistle rennet and curd obtained with thistle rennet. Other bacterial taxa, hypothetically originating from the vegetable coagulant (Enterococcus faecium, Lactobacillus brevis, Lactobacillus delbrueckii, Leuconostoc mesenteroides/pseudomesenteroides), were exclusively found in Caciofiore della Sibilla cheese by PCR-DGGE. At the end of the maturation period, Illumina sequencing demonstrated that both cheeses were dominated by Lactobacillales; however curd and cheese produced with thistle rennet were co-dominated by Lactobacillus and Leuconostoc, whereas Lactoccous prevailed in curd and cheese produced with commercial animal rennet followed by Lactobacillus. Differences in the bacterial composition between the two cheeses at the end of their maturation period were confirmed by PCR-DGGE analysis. Copyright © 2017 Elsevier B

  4. Microbial Quality of and Biochemical Changes in Fresh Soft, Acid-Curd Xinotyri Cheese Made from Raw or Pasteurized Goat’s Milk

    Directory of Open Access Journals (Sweden)

    Eleni C. Pappa

    2017-01-01

    Full Text Available The microbiological quality of and changes in the main physicochemical parameters, together with the evolution of proteolysis, lipolysis and volatile profiles of soft Xinotyri, a traditional Greek acid-curd cheese (pH≈4.4, moisture 65 %, salt 1 % made from raw (RMC or pasteurized (PMC goat’s milk without starters, were evaluated during aerobic storage at 4 °C for 60 days. No statistically significant differences between the total nitrogen (TN and nitrogen fraction (% of TN contents, the degradation of intact αs- or β-caseins, total free amino acid (FAA contents, and the ratio of hydrophilic and hydrophobic peptides in the water-soluble fraction of RMC and PMC were found. Threonine, alanine and lysine were the principal FAAs. Oleic, palmitic, capric and caprylic acids, and ethyl hexonate, ethyl octanoate, ethyl decanoate, ethanol, 3-methyl butanol, phenyl ethyl alcohol and acetone were the most abundant free fatty acids and volatile compounds, respectively. Cheese lipolysis evolved slowly at 4 °C, and milk pasteurization had no significant effect on it. Mesophilic lactic acid bacteria (LAB were predominant in fresh cheese samples. PMC samples had significantly lower levels of enterococci and enterobacteria than RMC samples, while yeasts grew at similar levels during storage at 4 °C. All cheese samples (25 g were free of Salmonella and Listeria monocytogenes. Coagulase-positive staphylococci exceeded the 5-log safety threshold in fresh RMC samples, whereas they were suppressed (<100 CFU/g in all PMC samples. Consequently, pasteurization of raw goat milk’s and utilization of commercially defined or natural mesophilic LAB starters are recommended for standardizing the biochemical, microbial and safety qualities of fresh soft Xinotyri cheese.

  5. Growth and enterotoxin production of Staphylococcus aureus during the manufacture and ripening of Camembert-type cheeses from raw goats' milk.

    Science.gov (United States)

    Meyrand, A; Boutrand-Loei, S; Ray-Gueniot, S; Mazuy, C; Gaspard, C E; Jaubert, G; Perrin, G; Lapeyre, C; Vernozy-Rozand, C

    1998-09-01

    Tests were carried out to determine the effect of manufacturing procedures for a Camembert-type cheese from raw goats' milk on the growth and survival of Staphylococcus aureus organisms added to milk at the start of the process, and to study the possible presence of staphylococcal enterotoxin A in these cheeses. The initial staphylococcal counts were, respectively, 2, 3, 4, 5 and 6 log cfu ml-1. Cheese was prepared following the industrial specifications and ripened for 41 d. Detection of enterotoxins was done by the Vidas SET test and by an indirect double-sandwich ELISA technique using antienterotoxin monoclonal antibodies. Generally, numbers of microbes increased at a similar rate during manufacture in all cheeses until salting. During the ripening period, the aerobic plate count population and Staph. aureus levels remained stable and high. There was an approximately 1 log reduction of Staph. aureus in cheeses made with an initial inoculum of Staph. aureus greater than 10(3) cfu ml-1 at the end of the ripening period (41 d) compared with the count at 22 h. The level of staphylococcal enterotoxin A recovered varied from 1 to 3.2 ng g-1 of cheese made with an initial population of 10(3)-10(6) cfu ml-1. No trace of enterotoxin A was detected in cheeses made with the lowest Staph. aureus inoculum used in this study.

  6. Diversity and dynamic of lactic acid bacteria strains during aging of a long ripened hard cheese produced from raw milk and undefined natural starter.

    Science.gov (United States)

    Pogačić, Tomislav; Mancini, Andrea; Santarelli, Marcela; Bottari, Benedetta; Lazzi, Camilla; Neviani, Erasmo; Gatti, Monica

    2013-12-01

    The aim of this study was to explore diversity and dynamic of indigenous LAB strains associated with a long ripened hard cheese produced from raw milk and undefined natural starter such as PDO Grana Padano cheese. Samples of milk, curd, natural whey culture and cheeses (2nd, 6th, 9th and 13th months of ripening) were collected from 6 cheese factories in northern Italy. DNA was extracted from each sample and from 194 LAB isolates. tRNA(Ala)-23S rDNA-RFLP was applied to identify isolates. Strain diversity was assessed by (GTG)5 rep-PCR and RAPD(P1)-PCR. Finally, culture-independent LH-PCR (V1-V2 16S-rDNA), was considered to explore structure and dynamic of the microbiota. Grana Padano LAB were represented mainly by Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus helveticus and Pediococcus acidilactici, while the structure and dynamic of microbiota at different localities was specific. The strength of this work is to have focused the study on isolates coming from more than one cheese factories rather than a high number of isolates from one unique production. We provided a valuable insight into inter and intraspecies diversity of typical LAB strains during ripening of traditional PDO Grana Padano, contributing to the understanding of specific microbial ecosystem of this cheese. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. 60-day aging requirement does not ensure safety of surface-mold-ripened soft cheeses manufactured from raw or pasteurized milk when Listeria monocytogenes is introduced as a postprocessing contaminant.

    Science.gov (United States)

    D'Amico, Dennis J; Druart, Marc J; Donnelly, Catherine W

    2008-08-01

    Because of renewed interest in specialty cheeses, artisan and farmstead producers are manufacturing surface-mold-ripened soft cheeses from raw milk, using the 60-day holding standard (21 CFR 133.182) to achieve safety. This study compared the growth potential of Listeria monocytogenes on cheeses manufactured from raw or pasteurized milk and held for > 60 days at 4 degrees C. Final cheeses were within federal standards of identity for soft ripened cheese, with low moisture targets to facilitate the holding period. Wheels were surface inoculated with a five-strain cocktail of L. monocytogenes at approximately 0.2 CFU/ cm2 (low level) or 2 CFU/cm2 (high level), ripened, wrapped, and held at 4 degrees C. Listeria populations began to increase by day 28 for all treatments after initial population declines. From the low initial inoculation level, populations in raw and pasteurized milk cheese reached maximums of 2.96 +/- 2.79 and 2.33 +/- 2.10 log CFU/g, respectively, after 60 days of holding. Similar growth was observed in cheese inoculated at high levels, where populations reached 4.55 +/- 4.33 and 5.29 +/- 5.11 log CFU/g for raw and pasteurized milk cheeses, respectively. No significant differences (P milk types. Independent of the milk type, cheeses held for 60 days supported growth from very low initial levels of L. monocytogenes introduced as a postprocess contaminant. The safety of cheeses of this type must be achieved through control strategies other than aging, and thus revision of current federal regulations is warranted.

  8. Anti-inflammatory properties of fermented soy milk with Lactococcus lactis subsp. lactis S-SU2 in murine macrophage RAW264.7 cells and DSS-induced IBD model mice.

    Science.gov (United States)

    Kawahara, Miho; Nemoto, Maki; Nakata, Toru; Kondo, Saya; Takahashi, Hajime; Kimura, Bon; Kuda, Takashi

    2015-06-01

    Six lactic acid bacteria strains (four Lactobacillus plantarum strains and one each of Lactococcus lactis subsp. lactis and Pediococcus pentosaceus) have been isolated and shown to possess anti-oxidant activity. In this study, we determined their acid, bile, salt resistance, and adhesion activity on human enterocyte-like HT-29-Luc and Caco-2 cells. An isolate Lc. lactis S-SU2 showed highest bile resistance and adhesion activity compared to type strains. S-SU2 could ferment both 10% skimmed milk and soy milk while the type strain could not ferment soy milk. Soy milk fermented with S-SU2 showed an increased nitric oxide (NO) secretion in the mouse macrophage RAW264.7 cells without bacterial lipopolysaccharide (LPS). Furthermore, the inhibitory effects of the fermented soy milk on Escherichia coli O111 LPS-induced NO secretion were higher than those of fresh soy milk. Inflammatory bowel disease (IBD) was induced in mice fed either 5% (w/v) dextran sodium sulfate (DSS) in drinking water or 50% soy milk in drinking water. Shortening of colon length, breaking of epithelial cells, lowering liver and thymus weights, and enlargement of spleen are some of the characteristics observed in the IBD, which were prevented by the use of soy milk fermented with Lc. lactis S-SU2. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  10. Quality of raw milk produced in agreste region of Pernambuco, Brazil / Qualidade do leite cru produzido na região do agreste de Pernambuco, Brasil

    Directory of Open Access Journals (Sweden)

    Márcia de Aguiar Ferreira Barros

    2010-04-01

    Full Text Available The poor quality of raw milk is the main problem in dairy industries, once it can directly interfere in the productivity and quality of dairy products. The Pernambuco is not different. located between the Zona da Mata and the Sertão regions, is responsible for a daily milk production of 980,000 liters, and presented an increase of 23% in the last two years. This study aimed the evaluation of the microbiological and physical-chemical quality of raw milk produced in the Agreste region of Pernambuco. Raw milk samples were collected from 53 dairy farms located at the following cities: Saloá, Águas Belas, São Bento do Una and Bom Conselho. For microbiological analysis, all samples were plated for mesophilic aerobes, total coliforms, Escherichia coli and DNase positive staphylococci in specific Petrifilm™ (3M Microbiology, St. Paul, USA. Listeria monocytogenes and Salmonella spp. were detected using VIDAS system (bioMérieux SA, Marcy l'Etoile, France. Organophosphorade and carbamates were detected by thin layer chromatography. Fat, protein, and lactose contents, total and non-fat solids, and density were obtained by ultrasound method using am automatic milk analyzer (Boecolac-60, Boeco, Hamburg, Germany. In addition, the raw milk samples were evaluated to cryoscopic, California Mastitis Test (CMT, peroxidase, Dornic acidity and Ring-test to brucellosis status of herds. In microbiological analysis, all samples presented high counts of the researched indicators microorganisms. The average of mesophilic aerobes was 1.68 X 107 with 83% of samples over 106. Listeria monocytogenes and Salmonella spp were not found, 47% of the samples were positive for organophosphates and/or carbamates, 67.9% of the samples were positive for CMT and 26.4% for ring test. Thus, only 2 (3.77% samples were accordance with the established parameters of Instrução Normativa 51.,P.A qualidade do leite é um dos maiores problemas da cadeia do leite no Brasil, interferindo

  11. Microbiological quality of raw milk and factors that influence its quality Qualidade microbiológica de leite cru refrigerado e fatores associados

    Directory of Open Access Journals (Sweden)

    Liliane Borsatti

    2009-03-01

    Full Text Available In order to investigate the microbiological conditions of raw milk and some factors that influence its quality, 31 dairy farms of municipality of Marechal Cândido Rondon were evaluated. Analyses of aerobic mesophilic microorganisms, coliforms at 35ºC, thermotolerant coliforms and fungi and yeasts were accomplished. The following issues were evaluated: type of milking management, cleaning of utensils, separation of animals in batches during milking, teat washing and use of pre and post dipping disinfectant solution. The results showed that 25.8% (for aerobic mesophilic and 19.35% (for coliforms at 35°C of the analyzed samples had their counting above the actual legislation standard and 58.06% of the samples were contaminated with thermotolerant coliforms. It was verified that 64.51% of samples had fungi and yeasts counting above 100 UFC/mL. There were failures at hygiene and cleaning procedures in all dairy farms. Severe regulatory policies must be adopted for this kind of product aiming a food safety warranty to the customer.Para avaliação das condições microbiológicas do leite cru e estudo de alguns dos fatores que influenciam sua qualidade, foram analisadas 31 propriedades leiteiras do município de Marechal Cândido Rondon. Realizaram-se análises de microrganismos aeróbios mesófilos, coliformes a 35ºC, coliformes termotolerantes e de bolores e leveduras. Foram analisados tipo de ordenha, lavagem dos utensílios, separação dos animais no momento da ordenha por lotes, lavagem dos tetos e uso de soluções desinfetantes para pré e pós-dipping. Entre as amostras analisadas, 25,8% (para aeróbios mesófilos e 19,35% (para coliformes a 35ºC apresentaram contagens acima do padrão vigente pela legislação e 58,06% possuíam coliformes termotolerantes. Verificou-se que 64,51% das amostras apresentaram contagem de bolores e leveduras acima de 100 UFC/mL. Em todas as propriedades havia falhas nos procedimentos de higiene e limpeza

  12. Do different standard plate counting (IDF/ISSO or AOAC) methods interfere in the conversion of individual bacteria counts to colony forming units in raw milk?

    Science.gov (United States)

    Cassoli, L D; Lima, W J F; Esguerra, J C; Da Silva, J; Machado, P F; Mourão, G B

    2016-10-01

    This study aimed to establish the correlation between individual bacterial count (IBC) obtained by flow cytometry and the number of colony forming units (CFU) determined by standard plate count (SPC) in raw milk using two different reference methodologies: the methodology of the International Dairy Federation (IDF) - International Organization for Standardization (ISO) 4833, incubation for 72 h at 30°C and the methodology of the Association of Official Analytical Chemists (AOAC), incubation for 48 h at 35°C. For this, 100 bovine milk samples (80 ml) from different farms were collected in a sterile bottle and maintained refrigerated at 4°C and were delivered to the laboratory. In the laboratory, the samples were divided into two vials of 40 ml each. Then, half of the vials were forwarded for the SPC analysis, and the other half were analysed using the equipment BactoScan FC. The analyses by flow cytometry and SPC were performed at the same time (maximum deviation of +/- 1 h). To transform the data from IBC ml(-1) to CFU ml(-1) (IDF or AOAC methodology), a standard linear regression equation was used, as recommended by IDF/ISO-196. The difference between the reference methodologies affects the equation that transforms IBC into CFU and therefore the accuracy of the results. The results estimated by the equation using the ISO 4833 methodology were on average 0·18 log units higher than the results estimated using the equation using the AOAC methodology. After the comparison of the methodologies, it was concluded that there is an impact of the reference methodologies on the conversion of the results from IBC to CFU. Depending on the methodology adopted by each laboratory or country, there may not be equivalence in the results. Hence, the laboratories specialized in milk quality analysis that have changed their methodology for analysis, passing from the MAPA (AOAC) methodology to the IDF standard, need to develop new conversion equations to make their

  13. Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

    Science.gov (United States)

    Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

    2014-09-01

    The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

  14. Biodiversity and γ-Aminobutyric Acid Production by Lactic Acid Bacteria Isolated from Traditional Alpine Raw Cow’s Milk Cheeses

    Directory of Open Access Journals (Sweden)

    Elena Franciosi

    2015-01-01

    Full Text Available “Nostrano-cheeses” are traditional alpine cheeses made from raw cow’s milk in Trentino-Alto Adige, Italy. This study identified lactic acid bacteria (LAB developing during maturation of “Nostrano-cheeses” and evaluated their potential to produce γ-aminobutyric acid (GABA, an immunologically active compound and neurotransmitter. Cheese samples were collected on six cheese-making days, in three dairy factories located in different areas of Trentino and at different stages of cheese ripening (24 h, 15 days, and 1, 2, 3, 6, and 8 months. A total of 1,059 LAB isolates were screened using Random Amplified Polymorphic DNA-PCR (RAPD-PCR and differentiated into 583 clusters. LAB strains from dominant clusters (n=97 were genetically identified to species level by partial 16S rRNA gene sequencing. LAB species most frequently isolated were Lactobacillus paracasei, Streptococcus thermophilus, and Leuconostoc mesenteroides. The 97 dominant clusters were also characterized for their ability in producing GABA by high-performance liquid chromatography (HPLC. About 71% of the dominant bacteria clusters evolving during cheeses ripening were able to produce GABA. Most GABA producers were Lactobacillus paracasei but other GABA producing species included Lactococcus lactis, Lactobacillus plantarum, Lactobacillus rhamnosus, Pediococcus pentosaceus, and Streptococcus thermophilus. No Enterococcus faecalis or Sc. macedonicus isolates produced GABA. The isolate producing the highest amount of GABA (80.0±2.7 mg/kg was a Sc. thermophilus.

  15. Influence of vegetable coagulant and ripening time on the lipolytic and sensory profile of cheeses made with raw goat milk from Canary breeds.

    Science.gov (United States)

    Rincón, Arturo A; Pino, Verónica; Fresno, María R; Jiménez-Abizanda, Ana I; Álvarez, Sergio; Ayala, Juan H; Afonso, Ana M

    2017-04-01

    Free fatty acids and sensory profiles were obtained for cheeses made with raw goat milk and vegetable coagulant, derived from the cardoon flower ( Cynara cardunculus), at different ripening times (7 and 20 days). A solid-liquid phase extraction method followed by solid-phase extraction and gas chromatography was used. Profiles were also obtained with cheeses made with commercial coagulant, traditional kid rennet paste, and mixture coagulant (vegetable coagulant-kid rennet). The use of vegetable coagulant and vegetable coagulant-kid rennet is common in traditional Protected Designation of Origin cheeses such as " Queso Flor de Guía" and " Queso Media Flor de Guía" (Spain). Contents of short-chain free fatty acids (7.5-22.5 mmol·kg -1 ), medium-chain free fatty acids (0.4-3.7 mmol·kg -1 ), and long-chain free fatty acids (0.2-2.1 mmol·kg -1 ) varied depending on the coagulant type and the ripening time. Vegetable coagulant cheeses present odour intensity and flavour intensity much higher than commercial coagulant cheeses in the sensory analysis for cheeses obtained with seven days of ripening, but the values decrease when increasing the ripening time. Multivariate analysis allowed us to differentiate cheese samples according to the ripening time when using lipolytic profile and according to the coagulant type using the sensory profile.

  16. A Novel Potentiometric Sensor Based on 1,2-Bis(N’-benzoylthioureido)benzene and Reduced Graphene Oxide for Determination of Lead (II) Cation in Raw Milk

    International Nuclear Information System (INIS)

    Abraham, Abigail Asha; Rezayi, Majid; Manan, Ninie S.A.; Narimani, Leila; Rosli, Ahmad Nazmi Bin; Alias, Yatimah

    2015-01-01

    We have developed a highly sensitive and selective potentiometric PVC-membrane sensor for lead (II) cation. A glassy carbon electrode (GCE) was modified with synthesized 1,2-Bis(N’-benzoylthioureido) benzene (BBTB) as an ionophore and reduced graphene oxide (RGO), and this material was characterized by scanning electron microscopy. The sensor shows sensitive and highly selective response to Pb(II) ion with a linear range from 6.31 × 10 −8 to 3.98 × 10 −2 M, Nernstian slope of 30.37 ± 0.62 mV per decade and a detection limit of 2.51 × 10 −8 M. The proposed sensor could be used in a pH range of 4.0–8.0. Selectivity coefficients were determined for known common cations by applying the match potential method (MPM). The sensor was successfully applied to monitor Pb(II) in raw milk and in potentiometric titration of Pb 2+ ions. The structure of BBTB ligand and its complexation with some common cations were investigated by using quantum mechanical DFT calculations. Lead (II) cation showed prominent affinity to the BBTB carrier

  17. A Comparative Study Between the Antibacterial Effect of Nisin and Nisin-Loaded Chitosan/Alginate Nanoparticles on the Growth of Staphylococcus aureus in Raw and Pasteurized Milk Samples.

    Science.gov (United States)

    Zohri, Maryam; Alavidjeh, Mohammad Shafiee; Haririan, Ismaeil; Ardestani, Mehdi Shafiee; Ebrahimi, Seyed Esmaeil Sadat; Sani, Hadi Tarighati; Sadjadi, Seyed Kazem

    2010-12-01

    The aim of this study was to evaluate the antibacterial effect of nisin-loaded chitosan/alginate nanoparticles as a novel antibacterial delivery vehicle. The nisin-loaded nanoparticles were prepared using colloidal dispersion of the chitosan/alginate polymers in the presence of nisin. After the preparation of the nisin-loaded nanoparticles, their physicochemical properties such as size, shape, and zeta potential of the formulations were studied using scanning electron microscope and nanosizer instruments, consecutively. FTIR and differential scanning calorimetery studies were performed to investigate polymer-polymer or polymer-protein interactions. Next, the release kinetics and entrapment efficiency of the nisin-loaded nanoparticles were examined to assess the application potential of these formulations as a candidate vector. For measuring the antibacterial activity of the nisin-loaded nanoparticles, agar diffusion and MIC methods were employed. The samples under investigation for total microbial counts were pasteurized and raw milks each of which contained the nisin-loaded nanoparticles and inoculated Staphylococcus aureus (ATCC 19117 at 10(6) CFU/mL), pasteurized and raw milks each included free nisin and S. aureus (10(6) CFU/mL), and pasteurized and raw milks each had S. aureus (10(6) CFU/mL) in as control. Total counts of S. aureus were measured after 24 and 48 h for the pasteurized milk samples and after the time intervals of 0, 6, 10, 14, 18, and 24 h for the raw milk samples, respectively. According to the results, entrapment efficiency of nisin inside of the nanoparticles was about 90-95%. The average size of the nanoparticles was 205 nm, and the average zeta potential of them was -47 mV. In agar diffusion assay, an antibacterial activity (inhibition zone diameter, at 450 IU/mL) about 2 times higher than that of free nisin was observed for the nisin-loaded nanoparticles. MIC of the nisin-loaded nanoparticles (0.5 mg/mL) was about four times less than

  18. PREVALENCIA DE BRUCELOSIS EN LA LECHE CRUDA DE BOVINOS EXPENDIDA EN EL MUNICIPIO DE POPAYÁN CAUCA SEPTIEMBRE - DICIEMBRE 2006. PREVALENCE OF BRUCELLOSIS IN CATTLE RAW MILK SPREAD IN THE CITY OF POPAYAN CAUCA. SEPTEMBER-DECEMBER 2006

    Directory of Open Access Journals (Sweden)

    DIEGO VERGARA COLLAZOS

    2008-12-01

    Full Text Available La Brucelosis bovina es una zoonosis de declaración obligatoria y la de mayor difusión en el mundo según la Organización Mundial de la Salud OMS. Esta enfermedad ocasiona pérdidas importantes en la producción, reproducción del ganado lechero y en humanos afecta la salud, productividad y calidad de vida. El propósito de este trabajo es determinar la prevalencia de Brucelosis en la leche cruda que se expende en el Municipio de Popayán e identificar factores asociados con la presencia de brucelosis en los diferentes hatos proveedores de leche cruda. Se realizó un estudio descriptivo de corte transversal, se evaluaron 247 muestras de leche cruda comercializadas en el Municipio de Popayán a través de 11 rutas, provenientes de los municipios de Sotará, Puracé y Coconuco, principales proveedores de leche cruda al Municipio de Popayán, mediante la técnica de Ring Test para detectar anticuerpos específicos antibrucella y se aplicó una encuesta estructurada a los dueños de los hatos. La Prevalencia encontrada en este estudio fue del 15% (37/247. Los factores que se asociaron significativamente (p The Cattle Brucellosis is a highly contagious zoonosis and it is greatly released in the world according to World Health Organization (WHO. This disease causes important looses in the production, reproduction of dayri cattle. In humans it affects the health, productivity and human quality. This article aims at determining the prevalence of Brucellosis in raw milk that is expended in the city of Popayán and identificate the factors associated with the presence of Brucellosis in the different raw milk provider herds. At descriptive study of cross-cutting was carried out. There were evaluated 247 marketed samples of raw milk in the city of Popayan by 11 routes, originating from the municipalities of Sotará, Puracé and Coconuco, principal providers of raw milk in the city of Popayan. The Ring Test Technique was used for detecting specific

  19. Experimental infection of goats with tick-borne encephalitis virus and the possibilities to prevent virus transmission by raw goat milk.

    Science.gov (United States)

    Balogh, Zsuzsanna; Egyed, László; Ferenczi, Emőke; Bán, Enikő; Szomor, Katalin N; Takács, Mária; Berencsi, György

    2012-01-01

    The aim of this work was to study the tick-borne encephalitis virus (TBEV) infection of goats and the possibilities to prevent human milk-borne infections either by immunizing animals or the heat treatment of milk. An experiment was conducted with 20 milking goats. Ten goats (half of them immunized) were challenged with live TBEV and 10 were left uninfected. Clinical signs and body temperatures of the animals were recorded and milk samples were collected daily. The presence of viral RNA and infectious virions in milk were detected by RT-PCR and intracerebral inoculation of suckling mice, respectively. Milk samples containing infectious virions were subjected to various heat treatment conditions and retested afterwards to assess the effect on infectivity. The infected goats did not show any clinical signs or fever compared to uninfected ones. Infectious virions were detected for 8-19 days from the milk samples (genome for 3-18 days by PCR) of infected goats. Immunized goats did not shed the virus. After heat treatment of the milk, the inoculated mice survived. Goats shed the virus with their milk without showing any symptoms. Human milk-borne infections can be avoided both by immunizing goats and boiling/pasteurizing infected milk. Copyright © 2011 S. Karger AG, Basel.

  20. Effect of microbiological characteristics of raw milk on the quality of whole milk powder Efeito das características microbiológicas do leite cru sobre a qualidade do leite em pó integral

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Fernandes de Oliveira

    2000-06-01

    Full Text Available The relationship between microbiological characteristics of raw milk and the quality of high-heat whole powder made from it was investigated. To this end, 16 lots of milk standardized for fat and non-fat solids were used. Powder average levels of mesophiles and psychrotrophs were 7.8 x 10¹ and 4.0 x 10¹ CFU/g, respectively, and these values correlated positively (P Neste trabalho, avaliou-se a relação entre a qualidade do leite em pó integral e os principais parâmetros microbiológicos do leite empregado como matéria-prima, utilizando-se 16 lotes de leite padronizado quanto aos teores de gordura e sólidos não gordurosos. Os níveis médios de microrganismos mesófilos e psicrotróficos do produto em pó foram 7,8 x 10¹ e 4,0 x 10¹ UFC/g, respectivamente, sendo que estes valores estiveram correlacionados significativamente (P < 0,05 com as contagens de mesófilos e psicrotróficos do leite cru (níveis médios de 8,1 x 10(6 e 1,8 x 10(7 UFC/g, respectivamente. Observou-se, também, uma correlação significativa (P < 0,05 entre a contagem de psicrotróficos do leite cru e o teor de acidez titulável do produto em pó, cujos valores variaram de 0,15 a 0,19% (em ácido lático. As amostras de leite em pó produzido a partir de leite cru contendo níveis elevados de psicrotróficos apresentaram maiores índices de insolubilidade, porém, a correlação entre estes parâmetros não foi significativa. Discute-se a importância do controle das condições higiênicas do leite cru, como instrumento fundamental para garantir a qualidade do produto em pó oferecido ao consumo.

  1. Filtering reducer of flushing fluid

    Energy Technology Data Exchange (ETDEWEB)

    Secu, P; Apostu, M; Basarabescu, T; Popescu, F

    1981-02-28

    This is a patent of a filtering reducer of flushing fluid on a water base with low content of solid particles used at temperatures of roughly 200/sup 0/C. With the use of the proposed filtering reducer, there is no excessive increase in viscosity and gelatinization of the flushing fluids without restriction in the quantity of reducer needed to guarantee the required filtering. There is a possibility of recovering the polyalkylphenol vat residues obtained in the production of nonyl phenol. It is possible to reduce the time of treatment and dissolving of the product; there is no danger of plugging of the productive oil beds. The process of hydration of clay is excluded.

  2. Comparing the mannitol-egg yolk-polymyxin agar plating method with the three-tube most-probable-number method for enumeration of Bacillus cereus spores in raw and high-temperature, short-time pasteurized milk.

    Science.gov (United States)

    Harper, Nigel M; Getty, Kelly J K; Schmidt, Karen A; Nutsch, Abbey L; Linton, Richard H

    2011-03-01

    The U.S. Food and Drug Administration's Bacteriological Analytical Manual recommends two enumeration methods for Bacillus cereus: (i) standard plate count method with mannitol-egg yolk-polymyxin (MYP) agar and (ii) a most-probable-number (MPN) method with tryptic soy broth (TSB) supplemented with 0.1% polymyxin sulfate. This study compared the effectiveness of MYP and MPN methods for detecting and enumerating B. cereus in raw and high-temperature, short-time pasteurized skim (0.5%), 2%, and whole (3.5%) bovine milk stored at 4°C for 96 h. Each milk sample was inoculated with B. cereus EZ-Spores and sampled at 0, 48, and 96 h after inoculation. There were no differences (P > 0.05) in B. cereus populations among sampling times for all milk types, so data were pooled to obtain overall mean values for each treatment. The overall B. cereus population mean of pooled sampling times for the MPN method (2.59 log CFU/ml) was greater (P milk samples ranged from 2.36 to 3.46 and 2.66 to 3.58 log CFU/ml for inoculated milk treatments for the MYP plate count and MPN methods, respectively, which is below the level necessary for toxin production. The MPN method recovered more B. cereus, which makes it useful for validation research. However, the MYP plate count method for enumeration of B. cereus also had advantages, including its ease of use and faster time to results (2 versus 5 days for MPN).

  3. Differences of some indicators of raw milk properties and especially mineral composition between small ruminants as compared to cows in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2008-01-01

    Full Text Available Sheep and goat farming is returning back into the Czech Republic (CR because of positive effects of alternative milk consumption on human health. Especially the elements Ca and Mg are important for nutrition. Paper presents the comparison of mineral milk composition of goats (White short–haired–W, n = 60, sheep (Tsigai–C, n = 60 and cows (Holstein–H, n = 36; Czech Fleckvieh–B, n = 93. Cow milk results were considered as reference. The herds were kept at altitude 260 m (H, 360 m (B, and 572 m above sea level (W, C with total precipitation 449, 700 and 1200 mm per year and mean air temperatures 9.6, 7.0 and 3.7 °C. Bulk milk samples (4–8 animals in sample from the first two thirds of the lactation and the winter and summer season were investigated. Goat milk freezing point differed from other species (P < 0.001, −0.6048 for C < −0.5544 W < −0.5320 H < −0.5221 °C for B. Cow milk Ca values were comparable to former results although milk yield (MY was higher. Along lower MY the Ca was higher (1299.6 > 1172.0 mg . kg−1; P < 0.001 in B than H, similar trend was in Mg (122.0 > 107.4 mg . kg−1; P<0.001. Differences (P > 0.05 between species were in Ni and also mostly in Cu. Iodine results differed between species but not between cow breeds (P < 0.001; 462.8 H and 434.9 B > 126.0 W and 164.2 μg . l−1 C. It could be explainable by using of I disinfection at teat treatment in cows and absence of treatment in small ruminants. Macroelements were mostly highest (Ca, P, Na, Mg in sheep milk, with exception of K. Phosphorus values (950.1 H, 1016.9 B, 1042.6 W and 1596.7 mg . kg−1 C in species were linked with crude or true protein and casein values. Small ruminant milk could be good source of minerals for human nutrition, especially in the case of Ca and Mg of sheep and goat milk.

  4. Effect of lavender aromatherapy on menopause hot flushing: A crossover randomized clinical trial.

    Science.gov (United States)

    Kazemzadeh, Rafat; Nikjou, Roya; Rostamnegad, Masoumeh; Norouzi, Hosein

    2016-09-01

    Flushing is generally considered to be the primary symptom of menopause and is typically the most common complaint in menopausal women. Although flushing poses no danger to a woman's health, it decreases the quality of life. Thus, the purpose of this study was to determine the effect of lavender aromatherapy on menopause flushing. This double-blinded crossover clinical trial included 100 menopausal women 45-55 years of age who were referred to various health centers in Ardabil, Iran in 2013-2014. Samples were blocked randomly and divided into two intervention (lavender) and control (diluted milk) groups. Lavender aroma was smelled for 20 minutes twice a day, over a 12-week period. Data were collected using a demographic questionnaire, and flushing numbers were duly recorded. Data analysis was performed by SPSS version 16 (SPSS Inc., Chicago, IL, USA) using the Chi-square and t test. The results of our investigation showed that both groups had no significant difference according to demographic characteristics (p > 0.05). Additionally, the flushing number significantly decreased in the intervention group than in the control group (p aromatherapy reduced menopause flushing. Given the impact of stress on flushing and the undesirable effects of menopause symptoms on the quality of life, it would appear that this simple, noninvasive, safe, and effective method can be used by menopausal women with noticeable benefits. Copyright © 2016. Published by Elsevier Taiwan LLC.

  5. Effect of farm characteristics and practices on hygienic quality of ovine raw milk used for artisan cheese production in central Italy.

    Science.gov (United States)

    Carloni, Elisa; Petruzzelli, Annalisa; Amagliani, Giulia; Brandi, Giorgio; Caverni, Francesco; Mangili, Piermario; Tonucci, Franco

    2016-04-01

    A survey on ovine dairy farms directly transforming own-produced milk, in the Italian Marche region, was carried out to assess flock and milking practices that may influence milk hygienic-sanitary conditions. A census survey established that 24 dairy farms were located in this region. Bulk milk samples were collected throughout the milking period in each dairy farm in 2013. Analyzed variables were: (i) chemical parameters such as fat, protein and lactose content, dry matter and pH; and (ii) total bacterial (TBC) and somatic cell counts (SCC). Chemical parameter values were in agreement with published data while, geometric mean (GM) log10 SCC was 5.91 and TBC GM was 57 978 colony forming units/mL, in compliance with Eropean Union criteria. A positive correlation was found between SCC and TBC when GMs of all farm data were considered (Spearman's rho = 0.7925; P = 0.0001). Statistical analysis did not show significant correlation between SCC or TBC GM and dairy farm principal characteristics. Although SCC levels detected in the present study should suggest the need to implement mastitis control programs, Marche's dairy sheep flocks revealed a good hygienic condition level. This is an important aspect in implementing safety for end users of the final product. © 2015 Japanese Society of Animal Science.

  6. Invasive human brucellosis infection in travelers to and immigrants from the Horn of Africa related to the consumption of raw camel milk.

    Science.gov (United States)

    Rhodes, Heather M; Williams, David N; Hansen, Glen T

    2016-01-01

    Brucellosis is the commonest zoonosis worldwide and typically results from ingestion of unpasteurized goat and sheep milk and cheese. Consumption of camel milk is common in the Middle East and the Horn of Africa, but is an infrequently reported source of brucellosis. We report three immigrant patients seen in one hospital system between 2007 and 2013 with brucellosis due to the consumption of camel milk. The case patients presented after 3-14 days of symptoms following travel to countries where Brucella is endemic. All three patients were bacteremic. One patient had definite infective endocarditis, one had possible endocarditis and one patient presented with acute brucellosis. The diagnoses were made expeditiously and appropriate treatment initiated. Knowledge of travel, local customs and immigration patterns are keys to early Brucella diagnosis and optimal treatment. Previous reports implicating camel milk as the source of Brucella infection have been limited to patients living in or traveling to and from the Middle East. This report highlights the acquisition of Brucella infection in travelers to and immigrants from the Horn of Africa related to the consumption of camel milk. Copyright © 2016. Published by Elsevier Ltd.

  7. A simple micro-batch ion-exchange resin extraction method coupled with reverse-phase HPLC (MBRE-HPLC) to quantify lactoferrin in raw and heat-treated bovine milk.

    Science.gov (United States)

    Pochet, Sylvie; Arnould, Céline; Debournoux, Perrine; Flament, Jocelyne; Rolet-Répécaud, Odile; Beuvier, Eric

    2018-09-01

    Lactoferrin is an iron-binding cationic glycoprotein (pI = 8.7) beneficial for mammal health, especially udder and milk preservation. A new simple two-step method of quantification was developed. Lactoferrin in 1 mL of bovine skim milk was first adsorbed onto 100 mg of macroporous sulfonated-resin at pH 6.8 by rotary stirring for 90 min at 20-25 °C. After washing the resin, lactoferrin was desorbed using 1 mL of 2 M NaCl containing phenylalanine as a dilution marker, then fully resolved and quantified by RP-HPLC at 220 nm using a wide-bore C4 silica column. This robust, inexpensive and flexible method improves selectivity (no protein interference) and sensitivity compared to previous HPLC methods. In-laboratory validation demonstrated its linearity (25 to 514 µg Lf mL -1 ), accuracy (110 to 98% recovery), and precision (<4%), which were comparable to immuno-based methods. The results for individual raw cow's milk were strongly correlated with results using an ELISA test. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Characterization of quality of raw milk and pasteurized commercialized informally in Colorado do Oeste City, RO, Brazil | Caracterização da qualidade do leite cru e pasteurizado comercializado informalmente na cidade de Colorado do Oeste, RO, Brasil

    Directory of Open Access Journals (Sweden)

    Edmar Costa Alves

    2016-05-01

    Full Text Available Milk quality can be characterized by physicochemical parameters indicating possible changes in the product properties. The poor quality of milk may affect human health and compromise the shelf life of the product. The objective of this study was to characterize the physicochemical quality of milk and to perform reductase testing of twenty four samples of raw milk and of twelve samples of pasteurized milk being informally commercialized in the city of Colorado do Oeste, RO. The density, the cryoscopic index, the fat (using the method of Gerber, the acidity (in Dornic degrees, and the defatted solids (SNG (according to official methods were evaluated accoring to the Normative Instruction 68. The results of cryoscopy and density, showed that 27% (n = 10 and 27% (n = 10 of the samples, respectively, do not comply with the IN-62 criteria. For the content of defatted solids, 19% of the samples were at odds with the legislation. The assessment of physicochemical parameters suggest that the informal trade of milk in the studied retail outlets can compromise the integrity of the product, a problem that might be solved by correcting and intensifying enforcement actions. -------------------------------------------------------------------------------------------- A qualidade do leite pode ser caracterizada pelos parâmetros físico-químicos que indicam possíveis alterações nas propriedades do produto. A baixa qualidade do leite pode afetar a saúde humana e comprometer a vida útil do produto. O objetivo desse estudo foi caracterizar a qualidade físico-química em 24 amostras de leite cru e 12 amostras de leite pasteurizado comercializados informalmente na cidade de Colorado do Oeste, RO. Foram avaliados: densidade; índice crioscópico; gordura pelo método de Gerber; acidez em graus Dornic e sólidos desengordurados, de acordo com os métodos oficiais preconizados pela Instrução Normativa no 68. Os resultados da crioscopia e da densidade, apontam

  9. Quality Analysis of Raw Cow Milk from the Cojocna Farm, UASVM Cluj Napoca in Correlation with the Feeding Technique and Mammary Gland Health Status

    Directory of Open Access Journals (Sweden)

    Eugen Claudiu Jurco

    2016-11-01

    Full Text Available Quality analysis of 576 milk samples, obtained from the eight controls was performed in 2015 at the didactics UASVM farm from Cojocna. The biological material was represented by a 107 cows of Romanian spotted breed. On this population, individual and overall, were analized more aspects: productive performances and the main milk quality indicators such as fat, protein, lactose, pH, with particular reference to somatic cell counts as the main indicator of subclinical mastitis and the content of urea as the main indicator of nutritional aspects of the dairy cows. Following the official control of milk production, it was found that the milk production was on average 14.76 kg/day with a quite high values of coefficient of variability, between 31.05% and 40.47%, depending on the controls, which indicating a strong heterogeneity of this trait. The chemical characteristics of 576 samples showed considerable variations from one control to another. The amount of total fat and protein was found to be on average of 3.92% and 3.37% respectively. Regarding the content of urea and somatic cells, in all tested milk samples, the lowest value was found in the fifth control, with an average of 8.04±0.6 mg/dl and 69.20±23.3 cell/mlx103, while the highest was in the first control 19.37±0.7 mg/dl for urea, and 263.17±31.7 cell/mlx103 for the somatic cells.

  10. Use of alternative raw materials for yoghurt production | Farinde ...

    African Journals Online (AJOL)

    Soymilk and maize steep water were used as alternative raw materials to cow milk and commercial starter, respectively, for production of yoghurt. The cow milk used was both Fresh milk and dried powdered milk (DANO). The cost of production of the yoghurt samples as well as their chemical, microbial and organoleptic ...

  11. Genomic and proteomic characterization of bacteriocin-producing Leuconostoc mesenteroides strains isolated from raw camel milk in two southwest Algerian arid zones.

    Science.gov (United States)

    Benmechernene, Zineb; Fernández-No, Inmaculada; Quintela-Baluja, Marcos; Böhme, Karola; Kihal, Mebrouk; Calo-Mata, Pilar; Barros-Velázquez, Jorge

    2014-01-01

    Information on the microbiology of camel milk is very limited. In this work, the genetic characterization and proteomic identification of 13 putative producing bacteriocin Leuconostoc strains exhibiting antilisterial activity and isolated from camel milk were performed. DNA sequencing of the 13 selected strains revealed high homology among the 16S rRNA genes for all strains. In addition, 99% homology with Leuconostoc mesenteroides was observed when these sequences were analysed by the BLAST tool against other sequences from reference strains deposited in the Genbank. Furthermore, the isolates were characterized by matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDITOF MS) which allowed for the identification of 2 mass peaks 6242 m/z and 5118 m/z that resulted to be specific to the species L. mesenteroides. Remarkably, the phyloproteomic tree provided more intraspecific information of L. mesenteroides than phylogenetic analysis. Accordingly, phyloproteomic analysis grouped L. mesenteroides strains into different subbranches, while all L. mesenteroides isolates were grouped in the same branch according to phylogenetic analysis. This study represents, to our knowledge, the first report on the use of MALDI-TOF MS on the identification of LAB isolated from camel milk.

  12. Genomic and Proteomic Characterization of Bacteriocin-Producing Leuconostoc mesenteroides Strains Isolated from Raw Camel Milk in Two Southwest Algerian Arid Zones

    Directory of Open Access Journals (Sweden)

    Zineb Benmechernene

    2014-01-01

    Full Text Available Information on the microbiology of camel milk is very limited. In this work, the genetic characterization and proteomic identification of 13 putative producing bacteriocin Leuconostoc strains exhibiting antilisterial activity and isolated from camel milk were performed. DNA sequencing of the 13 selected strains revealed high homology among the 16S rRNA genes for all strains. In addition, 99% homology with Leuconostoc mesenteroides was observed when these sequences were analysed by the BLAST tool against other sequences from reference strains deposited in the Genbank. Furthermore, the isolates were characterized by matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDITOF MS which allowed for the identification of 2 mass peaks 6242 m/z and 5118 m/z that resulted to be specific to the species L. mesenteroides. Remarkably, the phyloproteomic tree provided more intraspecific information of L. mesenteroides than phylogenetic analysis. Accordingly, phyloproteomic analysis grouped L. mesenteroides strains into different subbranches, while all L. mesenteroides isolates were grouped in the same branch according to phylogenetic analysis. This study represents, to our knowledge, the first report on the use of MALDI-TOF MS on the identification of LAB isolated from camel milk.

  13. Automatic Flushing Unit With Cleanliness Monitor

    Science.gov (United States)

    Hildebrandt, N. E.

    1982-01-01

    Liquid-level probe kept clean, therefore at peak accuracy, by unit that flushes probe with solvent, monitors effluent for contamination, and determines probe is particle-free. Approach may be adaptable to industrial cleaning such as flushing filters and pipes, and ensuring that manufactured parts have been adequately cleaned.

  14. SOME FACTORS RELATED WITH MICROBIOLOGICAL QUALITY OF RAW MILK OBTAINED IN FARMS AROUND GOIÂNIA (GO ESTUDO DE ALGUNS FATORES RELACIONADOS COM A QUALIDADE MICROBIOLÓGICA DO LEITE CRU OBTIDO NA FONTE DE PRODUÇÃO

    Directory of Open Access Journals (Sweden)

    José Carlos Seraphin

    2007-09-01

    Full Text Available

    The aim of this work is the evaluation of some factors that contribute to the microbiological and hygienic quality of raw milk, obtained at production level, placing emphasis to verify some important variables performance in raw production, like: spoil or free tail, pen floor types, strainers type utilized, etc, in relation to a group of present microorganisms; the counting of viable mesophilic aerobes, thermodurics and the most probable number of total coliform and the lactofiltration test.

    O presente trabalho objetivou estudar alguns fatores relacionados com a qualidade microbiológica e higiênica do leite cru obtido na fonte da produção, tendo a preocupação de verificar o desempenho de algumas variáveis importantes na produção do leite “in natura” tais como: cauda solta ou presa, tipo de piso dos currais, tipo de coador empregado etc., em relação a grupos microbianos presentes como a contagem de microorganismos termodúricos, número mais provável de coliformes totais e da prova da lactofiltração.

  15. Mediterranean milk and milk products.

    Science.gov (United States)

    Hinrichs, Jörg

    2004-03-01

    Milk and dairy products are part of a healthy Mediterranean diet which, besides cow's milk, also consists of sheep's, goat's and buffalo's milk--alone or as a mixture---as raw material. The fat and protein composition of the milk of the various animal species differs only slightly, but in every case it has a high priority in human nutrition. The milk proteins are characterized by a high content of essential amino acids. Beyond that macromolecules,which have various biological functions, are available or may be formed by proteolysis in milk. Taking this into consideration, the technology of different well-known Italian and German cheese types is presented and the differences as well as correspondences regarding nutrition are discussed. Especially Ricotta and Mascarpone are discussed in detail. Ricotta represents a special feature as this cheese is traditionally made of whey and cream. Thus the highly valuable whey proteins which contain a higher amount of the amino acids lysine, methionine and cysteic acid in comparison to casein and, additionally, to soy protein, are made usable for human nutrition. Finally, it is pointed out on the basis of individual examples that technologies to enrich whey proteins in cheese are already available and in use. Thus, the flavor of low fat cheese is improved and the nutritional value is increased.

  16. Distribution of animal drugs among curd, whey, and milk protein fractions in spiked skim milk and whey

    Science.gov (United States)

    It is important to understand the partitioning of drugs in processed milk and milk products, when drugs are present in raw milk, in order to estimate the potential consumer exposure. Radioisotopically labelled erythromycin, ivermectin, ketoprofen, oxytetracycline, penicillin G, sulfadimethoxine, and...

  17. 7 CFR 58.936 - Milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Milk. 58.936 Section 58.936 Agriculture Regulations of... Official Identification § 58.936 Milk. To process and package evaporated and condensed milk of ultra... Shield the raw incoming milk shall meet the requirements as outlined in §§ 58.132 through 58.136. Unless...

  18. Molecular Characterization of Shiga Toxin-Producing Escherichia coli Isolated from Ruminant and Donkey Raw Milk Samples and Traditional Dairy Products in Iran

    Directory of Open Access Journals (Sweden)

    Hassan Momtaz

    2012-01-01

    Full Text Available The aims of the current study were to detect the virulence factors and antibiotic resistance of Shiga toxin-producing E. coli, in animal milk and dairy products in Iran. After E. coli dentification with culture method, PCR assay were developed for detection of pathogenic genes, serotypes and antibiotic resistance genes of E. coli. Results showed that out of 719 samples, 102 (14.18% were confirmed to be positive for E. coli and out of 102 positive samples, 17.64% were O26 and 13.72% were O157 and 1.96% were O91 and 1.96% were O145 serotypes. Totally, the prevalence of stx1 and papA genes were the highest while the prevalence of sfaS and fyuA were the lowest in the positive samples. PCR results showed that tetA, tetB were the highest (64.70% and aac(3-IV were the lowest (27.45% antibiotic resistant genes in E. coli positive samples. Our study indicated that the isolated E. coli trains in these regions had a highest antibiotic resistance to tetracycline (58.82% and the lowest to nitrofurantoin (3.92%. tetA gene and E. coli O157 serotype had highest and aac(3-IV gene, and E. coli O145 serotype had a lowest frequency rates of antibiotics resistance genes, in the region.

  19. Identification of Lactobacillus delbrueckii and Streptococcus thermophilus Strains Present in Artisanal Raw Cow Milk Cheese Using Real-time PCR and Classic Plate Count Methods.

    Science.gov (United States)

    Stachelska, Milena A

    2017-12-04

    The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.

  20. Residuos de insecticidas organoclorados presentes en leche cruda comercializada en el departamento de Córdoba, Colombia Organochlorine insecticide residues present in raw milk sold in the Department Córdoba, Colombia

    Directory of Open Access Journals (Sweden)

    2012-01-01

    Full Text Available En el estudio se determinaron residuos de plaguicidas organoclorados en leche cruda proveniente de hatos lecheros del departamento de Córdoba, Colombia. Durante el procedimiento de extracción se utilizó una columna de tierra de diatomeas y como sistema eluyente una mezcla de n-hexano-acetonaacetato de etilo (4:2:1, seguida de metanol al 5% en hexano. Para la determinación se usó un cromatógrafo de gases Perkin Elmer, Autosystem XL con detector captura de electrones, en modo de inyección ‘splitless', una columna capilar Rtx-5 30 m, 0.25 mm di y 0.25 µm de espesor de película. El porcentaje de recuperación para los plaguicidas determinados se encontró entre 88.5 y 96%, los límites de detección se definieron entre 0.01 y 0.04 ng/g con desviaciones estándar In this investigation organochlorine pesticide residues in raw milk from Dairy herds in the Cordoba department were determined. During the extraction procedure using a column of diatomaceous earth as eluting system a mixture of n-hexane-acetone-ethyl acetate (4:2:1, followed by 5% methanol in hexane. For the determination we used a gas Chromatograph Perkin Elmer, Autosystem XL with electron capture detector, split less injection mode, a capillary column Rtx-5 30m, 0.25 mm id and 0.25 um film thickness. The recovery rate for certain pesticides were between 88.5 and 96%, the detection limits were defined between 0.01 and 0.04 ng/g, relative standard deviations less than 6%. In the 63 samples tested p, p'-DDT, a-HCH, d-HCH, aldrin, dieldrin, endrin, heptachlor, heptachlor epoxide and g-chlordane were determined, establishing concentrations between 27.1 and 469.6 ng/g. The frequencies of occurrence ranged between 1.6 and 65.1% for heptachlor and p, p'-DDT, respectively. The older population that lives in the sub-regions: Middle Sinú, San Jorge and Savannas were exposed to high health risk associated with the concentration a-HCH, aldrin and dieldrin in raw milk.

  1. Flush Mounting Of Thin-Film Sensors

    Science.gov (United States)

    Moore, Thomas C., Sr.

    1992-01-01

    Technique developed for mounting thin-film sensors flush with surfaces like aerodynamic surfaces of aircraft, which often have compound curvatures. Sensor mounted in recess by use of vacuum pad and materials selected for specific application. Technique involves use of materials tailored to thermal properties of substrate in which sensor mounted. Together with customized materials, enables flush mounting of thin-film sensors in most situations in which recesses for sensors provided. Useful in both aircraft and automotive industries.

  2. Final flush of the shielded cells melter

    International Nuclear Information System (INIS)

    Marshall, K.M.; Fellinger, T.L.; Harbour, J.R.

    1997-01-01

    A flush of the Savannah River Technology Center (SRTC) Shielded Cells melter was performed after the completion of a campaign to vitrify loaded crystalline silicotitanate (CST) ion exchange medium. The purpose of the flush was to lower levels of radioisotopes accumulated during the campaign and to lower the level of titanium dioxide present in the glass. This in turn would ready the melter for future campaigns involving the Defense Waste Processing Facility (DWPF)

  3. Validation of the charm 3 SL3 beta-lactam test for screening raw milk in compliance with the U.S. pasteurized milk ordinance. Performance Tested Method 071002.

    Science.gov (United States)

    Salter, Robert S; Douglas, David; McRobbie, Lindsey; Quintana, Julio; Legg, David; Schwartz, Janine; Conaway, David; McPhee, Carla; Saul, Steven; Markovsky, Robert

    2011-01-01

    The Charm 3 SL3 beta-Lactam Test is a 3 min receptor-based lateral-flow Rapid One-Step Assay (ROSA) that detects the six beta-lactam drugs of concern approved for dairy cattle in the United States. The method is a biochemical formulation change of the SL3 beta-Lactam Test evaluated and approved in 2007. The Charm 3 SL3 was evaluated under the AOAC Research Institute Performance Tested Method (PTM) program following the protocol of the U.S. Food and Drug Administration, Center for Veterinary Medicine. The method was approved as PTM 071002 on May 8, 2009. The following drugs were detected in three combined lots: penicillin G at 3.8 ppb, ampicillin at 8.0 ppb, amoxicillin at 8.4 ppb, cephapirin at 20.0 ppb, ceftiofur (total metabolites) at 79 ppb, and cloxacillin at 8.6 ppb > or = 90% of the time with 95% confidence. These detection levels are lower than, but within 75% of, the U.S. Safe Level/Tolerances. Lot-to-lot repeatability was typically within 20% of these determined levels. The test kit was found to be suitable for testing thawed frozen samples. It was also found to respond with equal or better sensitivity to samples that contained incurred analytes, i.e., both the microbiologically active parent drug and its active metabolites. There were no interferences from somatic cells at 1.1 million/mL, bacterial cells at 300 000 CFU/mL, or 32 other non-beta-lactam drugs at 100 ppb. Ruggedness experiments indicated that the test procedure is robust. These results meet the fit-for-purpose approval criteria for inclusion in the National Conference for Interstate Milk Shipments milk testing program.

  4. Impact of processing on the digestibility of milk

    Science.gov (United States)

    Processing of milk by homogenization and pasteurization causes changes in the milk proteins and fats, but there is little information about whether these changes affect milk digestibility. In this study, whole and skim milk samples were processed and compared to raw milk after all samples had underg...

  5. Variation in retinol and carotenoid content of milk and milk products in the Netherlands

    NARCIS (Netherlands)

    Hulshof, P.J.M.; Roekel-Jansen, van G.C.; Bovenkamp, van de P.; West, C.E.

    2006-01-01

    Retinol and carotenoids were measured in Dutch milk and dairy products using a validated approach based on complete extraction of fat, followed by mild saponification and analysis by high-performance liquid chromatography. Raw milk, full fat milk, semi-skimmed milk and butter contain about 10 ¿g

  6. 33 CFR 162.20 - Flushing Bay near La Guardia Airport, Flushing, N.Y.; restricted area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Flushing Bay near La Guardia Airport, Flushing, N.Y.; restricted area. 162.20 Section 162.20 Navigation and Navigable Waters COAST... NAVIGATION REGULATIONS § 162.20 Flushing Bay near La Guardia Airport, Flushing, N.Y.; restricted area. (a...

  7. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  8. Qualidade do leite cru comercializado informalmente no município de Itaqui-RS | Quality of raw milk informally sold in the city of Itaqui, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Henrique Almeida Molina

    2015-11-01

    Full Text Available O objetivo deste trabalho foi avaliar a qualidade do leite cru comercializado informalmente no município de Itaqui-RS. Foram coletadas 21 amostras de leite de diferentes produtores, as quais foram identificadas e investigadas quanto à presença de substâncias fraudulentas (cloro e hipocloritos, peróxido de hidrogênio, formol, neutralizantes de acidez, amido, urina e sacarose, análises físico-químicas (densidade, gordura, extrato seco total (EST, extrato seco desengordurado (ESD, proteínas e acidez titulável, microbiológicas, resíduos de antibióticos e contagem de células somáticas (CCS. Os resultados obtidos indicaram a presença de neutralizantes de acidez somente na amostra do produtor 8, e apenas as amostras 7 e 15 estavam com valores de densidade em desacordo com a legislação. Para o conteúdo de gordura, 33,3% das amostras não atenderam aos requisitos da Instrução Normativa nº 62/2011, assim como 57,1%, 61,9% e 61,9% das amostras avaliadas quanto à CCS, ao ESD e à acidez, respectivamente. Considerando a contagem total de micro-organismos, 61,9% das amostras de leite apresentaram contagem superior ao estabelecido pela legislação. Além disso, constatou-se que 23,8% continham resíduos de antibióticos. Portanto, observou-se que todo o leite comercializado apresentou pelo menos um dos parâmetros de qualidade fora dos padrões da legislação brasileira. =============================================== The objective of this work was to evaluate the quality of informally commercialized raw milk in the city of Itaqui, RS. Various producers provided a total of 21 samples of milk, which were then identified and investigated for fraudulent compounds (chlorine, hypochlorites, hydrogen peroxide, formaldehyde, acid neutralizers, starch, urine, and sucrose, physical-chemical analysis [density, fat content, total dry extract, solids-non-fat, protein content, and titratable acidity], microbiological analysis, antibiotic residues

  9. Monitoring Milk Somatic Cell Counts

    Directory of Open Access Journals (Sweden)

    Gheorghe Şteţca

    2014-11-01

    Full Text Available The presence of somatic cells in milk is a widely disputed issue in milk production sector. The somatic cell counts in raw milk are a marker for the specific cow diseases such as mastitis or swollen udder. The high level of somatic cells causes physical and chemical changes to milk composition and nutritional value, and as well to milk products. Also, the mastitic milk is not proper for human consumption due to its contribution to spreading of certain diseases and food poisoning. According to these effects, EU Regulations established the maximum threshold of admitted somatic cells in raw milk to 400000 cells / mL starting with 2014. The purpose of this study was carried out in order to examine the raw milk samples provided from small farms, industrial type farms and milk processing units. There are several ways to count somatic cells in milk but the reference accepted method is the microscopic method described by the SR EN ISO 13366-1/2008. Generally samples registered values in accordance with the admissible limit. By periodical monitoring of the somatic cell count, certain technological process issues are being avoided and consumer’s health ensured.

  10. Seasonal and Milking-to-Milking Variations in Cow Milk Fat, Protein and Somatic Cell Counts

    Directory of Open Access Journals (Sweden)

    Elena Raluca PAVEL

    2011-05-01

    Full Text Available The first objective of this study was to examine milking-to-milking variations in milk fat, protein and SCC (somatic cell count. The second objective of this study was to examine variations of milk components (fat, protein and SCC over a period of six months (April-September 2010 at Agricultural Research Development Station Simnic. A total of 128 milk samples (64 morning milking and 64 evening milking ones from milk bulk tank commingled from 904 Holstein cows, were collected and analyzed for fat, protein and SCC. Data suggested that milking period effects milk fat, making the fat percentage lower in the morning compared with the evening milking period, effect which was not similar in protein content. Seasonal differences in milk fat and protein were also investigated. The season of year had influenced SCC, fat and protein: SCC increased, while fat and protein decreased. The period of the day when milking took place and the season influenced fat, protein and SCC, but the composition of milk, as well as its hygienic quality, fell within the aplicabile standards for raw milk.

  11. Seasonal and Milking-to-Milking Variations in Cow Milk Fat, Protein and Somatic Cell Counts

    Directory of Open Access Journals (Sweden)

    Elena Raluca PAVEL

    2011-05-01

    Full Text Available The first objective of this study was to examine milking-to-milking variations in milk fat, protein and SCC (somatic cell count. The second objective of this study was to examine variations of milk components (fat, protein and SCC over a period of six months (April-September 2010 at Agricultural Research Development Station Simnic. A total of 128 milk samples (64 morning milking and 64 evening milking ones from milk bulk tank commingled from 90�4 Holstein cows, were collected and analyzed for fat, protein and SCC. Data suggested that milking period effects milk fat, making the fat percentage lower in the morning compared with the evening milking period, effect which was not similar in protein content. Seasonal differences in milk fat and protein were also investigated. The season of year had influenced SCC, fat and protein: SCC increased, while fat and protein decreased. The period of the day when milking took place and the season influenced fat, protein and SCC, but the composition of milk, as well as its hygienic quality, fell within the aplicabile standards for raw milk.

  12. ANALYSIS OF MILK QUALITY AND ITS IMPORTANCE FOR MILK PROCESSORS

    Directory of Open Access Journals (Sweden)

    AGATHA POPESCU

    2009-05-01

    Full Text Available The paper aimed to present some aspects regarding milk quality and its importance for milk processors , taking into account a study case at FLAV O’RICH DAIRY INC,USA. The study analyses how milk quality is checked from the bulk milk to final product according to the Milk Quality Program in force. The main aspects concerning raw milk selection criteria such as : antibiotic test, temperature, bacteria, organoleptic properties , acidity, somatic cell count , but also main milk components such as water, butterfat , total solids, protein, lactose , solids non fats , minerals, acids have been approached . Also a comparison for 7 butterfat producers for East Fluid Group has been done . Milk processing assures the destruction of human pathogens , the maintenance of product quality without significant loss of flavor, appearance, physical and nutritive properties and the selection of organisms which may produce unsatisfactory products.

  13. Characterization of a Wild, Novel Nisin A-Producing Lactococcus Strain with an L. lactis subsp. cremoris Genotype and an L. lactis subsp. lactis Phenotype, Isolated from Greek Raw Milk

    Science.gov (United States)

    Parapouli, Maria; Delbès-Paus, Céline; Kakouri, Athanasia; Koukkou, Anna-Irini; Montel, Marie-Christine

    2013-01-01

    Several molecular taxonomic studies have revealed that many natural (wild) Lactococcus lactis strains of dairy origin which are phenotypically representative of the L. lactis subspecies lactis cluster genotypically within subspecies cremoris and vice versa. Recently, we isolated two wild nisin-producing (Nis+) L. lactis strains, M78 and M104, of the lactis phenotype from Greek raw milk (J. Samelis, A. Lianou, A. Kakouri, C. Delbès, I. Rogelj, B. B. Matijašic, and M. C. Montel, J. Food Prot. 72:783–790, 2009); strain M78 possess a novel nisin A sequence (GenBank accession number HM219853). In this study, the actual subspecies identity of M78 and M104 isolates was elucidated, using 16S rRNA and acmA (encoding lactococcal N-acetylmuramidase) gene and histidine biosynthesis operon polymorphisms and 16S rRNA and ldh (encoding lactate dehydrogenase) gene phylogenies. Except the acmA gene analysis, molecular tools revealed that isolates M78 and M104 clustered with strains of the cremoris genotype, including the LMG 6897T strain, while they were distant from strains of the lactis genotype, including the LMG 6890T strain. The two wild isolates had identical repetitive sequence-based PCR (rep-PCR), randomly amplified polymorphic DNA (RAPD), plasmid, and whole-cell protein profiles and shared high 16S rRNA (99.9%) and ldh (100%) gene sequence homologies. In contrast, they exhibited identical sugar fermentation and enzymatic patterns which were similar to those of the subspecies lactis LMG 6890T strain. To our knowledge, this is the first complete identification report on a wild L. lactis subsp. cremoris genotype of the lactis phenotype which is capable of nisin A production and, thus, has strong potential for use as a novel dairy starter and/or protective culture. PMID:23542625

  14. Remediation of Contaminated Soils by Solvent Flushing

    NARCIS (Netherlands)

    Augustijn, Dionysius C.M.; Jessup, Ron E.; Rao, P. Suresh C.; Wood, A. Lynn

    1994-01-01

    Solvent flushing is a potential technique for remediating a waste disposal/spill site contaminated with organic chemicals. This technique involves the injection of a solvent mixture (e.g., water plus alcohols) that enhances contaminant solubility, reduces the retardation factor, and increases the

  15. Flushing characteristics of Mahim river estuary (Bombay)

    Digital Repository Service at National Institute of Oceanography (India)

    Sabnis, M.M; Zingde, M

    to the influence of wastewater. Flushing time of 19 tidal cycles was estimated by applying modified tidal prism method. After a large number of tidal cycles the estuary would retain 9.3x10 super(4) m super(3) of wastewater which was over 15% of the spring high tide...

  16. Data quality objectives for PUREX deactivation flushing

    International Nuclear Information System (INIS)

    Bhatia, R.K.

    1995-01-01

    This Data Quality Objection (DQO) defines the sampling and analysis requirements necessary to support the deactivation of the Plutonium-Uranium Extraction (PUREX) facility vessels that are regulated by WAC 173-303. Specifically, sampling and analysis requirements are identified for the flushing operations that are a major element of PUREX deactivation

  17. 7 CFR 58.932 - Milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Milk. 58.932 Section 58.932 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections....932 Milk. The raw milk shall meet the requirements as outlined in §§ 58.132 through 58.138. Unless...

  18. 7 CFR 58.232 - Milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Milk. 58.232 Section 58.232 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections....232 Milk. Raw milk shall meet the requirements as outlined in §§ 58.132 through 58.138 and, unless...

  19. 7 CFR 58.518 - Milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Milk. 58.518 Section 58.518 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections....518 Milk. The selection of raw milk for cottage cheese shall be in accordance with §§ 58.132 through...

  20. A hazard of the Intraflo continuous flush system.

    Science.gov (United States)

    Schwartz, A J; Stoner, B B; Jobes, D R

    1977-01-01

    Patency of pressure sensing systems can be provided by the Intraflow Continuous Flush System (Sorenson Research Company, Salt Lake City, UT 84115). This device allows continuous flow of flush solution through a regulatory valve while preventing transmission of the high pressure of the flush solution. The case presented describes the recognition of a false elevation of a monitored pressure secondary to the malfunction of the Intraflo regulatory valve. Elimination of the flush solution high pressure during monitoring prevents inappropriate data collection.

  1. 46 CFR 194.20-11 - Flushing systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Flushing systems. 194.20-11 Section 194.20-11 Shipping... Flushing systems. (a) Provision shall be made for flushing away chemical spills. (b) If a drainage system is installed, it shall be separate from any other drainage system. ...

  2. Application of osmometry in quality analysis of milk

    OpenAIRE

    Musara, Colin; Pote, William

    2013-01-01

    The aim of this study was to evaluate osmometry as a tool in quality analysis of milk. The osmolality of raw milk, sterilized milk, skimmed UHT (ultra-high temperature-treated) milk, pasteurized milk, standardized UHT milk and fermented milk (Lactococcus lactis culture) was determined by freezing point osmometry. The relationship between osmolality and pH of fermented milk was further investigated during spontaneous fermentation of UHT milk at 37 °C for 48 h. Average osmolality values (mean ±...

  3. Milk Allergy

    Science.gov (United States)

    ... contain blood Abdominal cramps Runny nose Watery eyes Colic, in babies Milk allergy or milk intolerance? A ... fat milk, skim milk, buttermilk Butter Yogurt Ice cream, gelato Cheese and anything that contains cheese Half- ...

  4. Economics of Local Cow Milk Products Marketing in Kwara State ...

    African Journals Online (AJOL)

    Economics of Local Cow Milk Products Marketing in Kwara State, Nigeria. ... The marketing chain for the commodity is simple and crude. It starts from the raw cow milk processors ... EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL ...

  5. Post-LOCA core flushing system

    International Nuclear Information System (INIS)

    Boyajian, J.D.; Weinberger, P.A.

    1980-01-01

    A system is disclosed for flushing the core of a nuclear reactor after a loss-of-coolant accident. A pump causes flow of liquid-phase fluid from the containment-vessel sump. This flow is used to provide the motivating force for an eductor that causes suction at the hot log of the reactor. The eductor suction can draw gas-phase coolant out of the hot leg. As a result, it can reduce pressure which may be preventing the flow of liquid-phase coolant out of the hot leg. By causing liquid-phase flow through the reactor, the system ensures that particles and boric acid are flushed out of the core. The system thereby eliminates the build-up of particles and the concentrations of boric acid in the core that could result if the coolant were to leave the pressure vessel exclusively in the gas phase. 9 claims

  6. Ethamsylate in the treatment of climacteric flushing.

    Science.gov (United States)

    Harrison, R F

    1981-03-01

    Ethamsylate, a non-hormonal agent acting at the capillary level, was compared with a placebo in a double-blind trial of 12 wk duration in 20 post-menopausal patients with hot flushes. Both ethamsylate and placebo patients showed fluctuations in the frequency of flushes during the trial, but there was a significant downward trend in the ethamsylate group. Capillary strength was measured but was not found to be low or to alter during the trial except in 1 patient in the placebo group. No side-effects attributable to trial medication were reported. Other symptoms recorded during the trial were probably climacteric and occurred more frequently during placebo treatment than during treatment with ethamsylate.

  7. Cow's milk and immune function in the respiratory tract

    OpenAIRE

    Perdijk, Olaf; Splunter, van, Marloes; Savelkoul, Huub F.J.; Brugman, Sylvia; Neerven, van, Joost

    2018-01-01

    During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these f...

  8. Estuarine turbidity, flushing, salinity, and circulation

    Science.gov (United States)

    Pritchard, D. W.

    1972-01-01

    The effects of estuarine turbidity, flushing, salinity, and circulation on the ecology of the Chesapeake Bay are discussed. The sources of fresh water, the variations in salinity, and the circulation patterns created by temperature and salinity changes are analyzed. The application of remote sensors for long term observation of water temperatures is described. The sources of sediment and the biological effects resulting from increased sediments and siltation are identified.

  9. USE OF SILVER IONS IN PASTEURIZED MILK PRODUCTION

    OpenAIRE

    A. Mamaev; K. Leshukov; S. Stepanova

    2012-01-01

    The means of pasteurized milk shelf life prolongation by electro-chemical diffusion of silver ions has been introduced. Three samples of pasteurized milk were test subjects. In the course of study the following data have been examined: organoleptic, physicochemical, microbiological parameters of check samples and pilot samples of raw and pasteurized milk. Its shelf life has been determined. It has been determined that the test results of raw and pasteurized milk samples processed by various c...

  10. Avaliação da qualidade do leite cru comercializado informalmente em feiras livres no município de Santa Maria-RS / Quality assessment of raw milk informally commercialized in street markets in the city of Santa Maria-RS

    Directory of Open Access Journals (Sweden)

    Márcia Liliane Rippel Silveira

    2014-05-01

    Full Text Available O objetivo deste trabalho foi avaliar a qualidade do leite cru comercializado informalmente em feiras livres no município de Santa Maria, RS. Amostras de leite cru foram adquiridas diretamente dos feirantes em feiras livres e a avaliação da qualidade do leite foi realizada por meio de análises físico-químicas e microbiológicas. Dez amostras de leite cru informal foram analisadas, mas apenas duas não apresentaram alterações em relação à acidez titulável. Dessas duas amostras, os parâmetros de densidade e gordura apresentaram resultado satisfatório, ao contrário do índice crioscópico, teor de proteína e extrato seco desengordurado, que apresentaram valores em desacordo com os padrões estabelecidos. Em relação às análises microbiológicas, 30% das amostras apresentaram contagem de micro-organismos mesófilos superior a 6,0x105 UFC/mL e a presença de coliformes termotolerantes foi confirmada em todas as amostras de leite cru, porém nenhuma apresentava contaminação por Salmonella sp. Considerando que este produto é comercializado de forma clandestina, os resultados obtidos evidenciam a precariedade higiênica do leite comercializado nas feiras livres. O consumo do leite cru sem qualquer tipo de controle higiênico-sanitário expõe a saúde do consumidor a riscos. ------------------------------------------------------------------------ The objective of this paper was to evaluate the quality of raw milk informally commercialized in street markets in the city of Santa Maria, RS. Samples of raw milk were purchased directly from merchants in street markets and the milk quality evaluation was performed through physical-chemical and microbiological analysis. Ten samples of informal raw milk were analyzed, but only two showed no variation from the titrable acidity. In these two samples, the parameters of density and fat showed satisfactory results, in opposition to the cryoscopic index, protein and fat dry extract that

  11. [HTLV and "donating" milk].

    Science.gov (United States)

    Rigourd, V; Meyer, V; Kieffer, F; Aubry, S; Magny, J-F

    2011-08-01

    In France, the screening for human T-cell leukemia/ lymphoma virus type 1 and 2 (HTLV-1 and HTLV-2) during the donation of human milk has been carried out from 1992 with the application of the circular DGS 24 November 1992. The screening for antibodies against these viruses is regulated and done systematically during every donation of milk. Breast feeding being the main mode of transmission of the HTLV-1, the last ministerial decree of 25 August 2010 has made the screening test compulsory for the anonymous donation and for the personalized donation (of a mother for her own child) from all women including those affected by the infection. The milk delivered by milk banks is pasteurized (62.5 °C for 30 minutes) before freezing at -18 °C, which inactivates the pathogens. This double means of prevention of the transmission of the HTLV-1 paradoxically seems disproportionate in the absence of any precautionary measure in the case of direct breast-feeding and the use of mother's raw milk. Indeed, in most neonatal intensive care units in maternity hospitals, unpasteurized milk is administered to the neonates without any systematic preliminary testing of the serological HTLV-1 status of the mother. An increased sensitization of the community of the obstetricians, midwives and neonatologists by the Association of the Milk Banks of France (ADLF) and the Société de pathologie exotique could address the issue of screening for HTLV-1 in "donated" milk and breast-feeding.

  12. Establishment and application of milk fingerprint by gel filtration chromatography.

    Science.gov (United States)

    Gao, P; Li, J; Li, Z; Hao, J; Zan, L

    2016-12-01

    Raw milk adulteration frequently occurs in undeveloped countries. It not only reduces the nutritional value of milk, but it is also harmful to consumers. In this paper, we focused on investigating an efficient method for the quality control of raw milk protein. A gel filtration chromatography (GFC) fingerprint method combined with chemometrics was developed for fingerprint analysis of raw milk. To optimize the GFC conditions, milk fat was removed by centrifugation, and GFC analysis was performed on a Superdex 75 10/300GL column (Just Scientific, Shanghai, China) with 0.2 M NaH 2 PO 4 -Na 2 HPO 4 buffer (pH 7.0) as the mobile phase. The flow rate was 0.5mL/min, and the detection wavelength was set at 280 nm. Ten batches of 120 raw milk samples were analyzed to establish the GFC fingerprint under optimal conditions. Six major peaks common to the chromatogram of each raw milk sample were selected for fingerprint analysis, and the characteristic peaks were used to establish a standard chromatographic fingerprint. Principal component analysis was then applied to classify GFC information of adulterated milk and raw milk, allowing adulterated samples to be effectively screened out from the raw milk in principal component analysis scores plot. The fingerprint method demonstrates promising features in detecting milk protein adulteration. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. EFFECT OF TIME AND TEMPERATURE OF REFRIGERATION IN THE DEVELOPMENT OF PSYCHROTROPHIC MICRORGANISMS IN COOLED RAW MILK COLLECTED IN THE MACROREGION OF GOIÂNIA – GO EFEITO DO TEMPO E DA TEMPERATURA DE REFRIGERAÇÃO NO DESENVOLVIMENTO DE MICRORGANISMOS PSICROTRÓFICOS EM LEITE CRU REFRIGERADO COLETADO NA MACRORREGIÃO DE GOIÂNIA – GO

    Directory of Open Access Journals (Sweden)

    Antônio Nonato de Oliveira

    2009-12-01

    Full Text Available

    The objective of the research were evaluated the effect of storage time and of refrigeration temperature under the counting of psychrotrophics microrganisms and proteolytics psychrotrophics in refrigerated raw milk samples. In the period of August the September of 2005 34 refrigerated raw milk samples were collected of refrigeration tanks, being 29 individuals and five collectives. Milk was proceeding from bovine flocks. For the collection of the samples followed a route determined for the industry located in the macroregion of Goiânia – GO, Brazil. For the microbiological evaluation was carried the standard plate count method of psychrotrophics microrganisms and proteolytics psychrotrophics. For the determination and quantification of the glycomacropeptide (GMP were adopted methodology proposal in Brazil (1991. The counting of psychrotrophics microrganisms and proteolytics psychrotrophics increased with the storage time of refrigerated bovine milk. Were observed the inadequate tanks were observed e presence of GMP for the High Performance Liquid Chromatography (HPLC was not evidenced.

    KEY WORDS: Proteolysis, Pseudomonas spp, raw milk.
    O objetivo da pesquisa foi avaliar o efeito do tempo de estocagem e da temperatura de refrigeração sob a contagem de microrganismos psicrotróficos e psicrotróficos proteolíticos em amostras de leite cru refrigerado. No período de agosto a setembro de 2005 coletaram-se 34 amostras de leite cru refrigerado de tanques de expansão, sendo 29 individuais e cinco coletivos. Para a coleta das amostras seguiu-se uma rota determinada pela indústria localizada na macrorregião de Goiânia, GO. Para a avaliação microbiológica, foi realizada a contagem-padrão em placas de microrganismos psicrotróficos e psicrotróficos proteolíticos. Para a determinação e quantificação do caseinomacropeptídeo (CMP, adotou-se a metodologia proposta em BRASIL (1991. A contagem de

  14. MICROBIOLOGICAL CHARACTERISTICS OF MILK FROM DONKEYS FARMED IN CAMPANIA REGION: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    E. Sarno

    2012-08-01

    Full Text Available Interest in donkey’s milk destined to human consumption is increasing owing to its complex composition and unique functional properties. The microbiological profile of donkeys’ raw milk was investigated. Individual donkey milk samples were collected from 8 asses after mechanical milking and filtration in a farm of Campania region. A total of 133 samples were analyzed. Total plate count bacteria and Enterobacteriaceae were enumerated. Other microbiological characteristics were monitored as established by legislation in force on the sale of raw milk. Results showed a low contamination level of the raw milk in accordance with other authors. No correlations were evidenced between milk contamination and lactation stage.

  15. New possibilities of developing formulas for flushing drilling fluids

    Energy Technology Data Exchange (ETDEWEB)

    Beregi, I; Dobozy, G; Szornyi, I

    1982-01-01

    The problem of preventing cave-in of the walls of boreholes can be effectively and economically solved only with a broad assortment of flushing fluids (FF) of the corresponding quality. In order to search for inexpensive and simple methods of preparing and formulas of FF which have good stabilizing properties, the authors conducted laboratory studies. It is indicated that this goal can be reached by three methods: 1) improvement in the properties by traditional (based on gypsum and lime) FF by additives (for example, chloride, acetate and potassium dihydrophosphate); 2) production of FF of the limestone type based on new theoretical concepts regarding the mechanism of their effect, and 3) by using as the FF ammonium-containing chemical compounds (for example, diammonium hydrophosphate). The studied FF were tested under field conditions and yielded positive results. It was established that different specific conditions of the wells make it necessary to systematically study clays and marls in the drilling zone in order to select the most effective and economical for the given conditions of FF. This will permit the maximum use of local raw material and selection of the simplest method of preparing FF.

  16. Tests Of Array Of Flush Pressure Sensors

    Science.gov (United States)

    Larson, Larry J.; Moes, Timothy R.; Siemers, Paul M., III

    1992-01-01

    Report describes tests of array of pressure sensors connected to small orifices flush with surface of 1/7-scale model of F-14 airplane in wind tunnel. Part of effort to determine whether pressure parameters consisting of various sums, differences, and ratios of measured pressures used to compute accurately free-stream values of stagnation pressure, static pressure, angle of attack, angle of sideslip, and mach number. Such arrays of sensors and associated processing circuitry integrated into advanced aircraft as parts of flight-monitoring and -controlling systems.

  17. 7 CFR 58.332 - Segregation of raw material.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Segregation of raw material. 58.332 Section 58.332... Specifications for Dairy Plants Approved for USDA Inspection and Grading Service 1 Operations and Operating Procedures § 58.332 Segregation of raw material. The milk and cream received at the dairy plant shall meet...

  18. PRESENCE OF ENTEROCOCCI IN COW MILK AND THEIR ANTIBIOTIC RESISTANCE

    Directory of Open Access Journals (Sweden)

    Miroslav Kročko

    2010-05-01

    Full Text Available Enterococci represent an important part of contaminate microflora in raw milk and dairy products. They constitute significant part of nosocomial pathogens with a remarkable capacity of expressing resistance to several antimicrobial  agents. We aimed to assess occurrence and antibiotic resistance of enterococci in the raw milk samples and pasteurized milk samples. In this study total bacterial count, psychrotrophic count and count of enterococci were determine in raw milk cistern samples, storage tank milk samples and milk samples after pasteurization. A collection of 46 enterococcal isolates were identified and screened for their antibiotic resistance. Isolates of E. faecalis were dominant in raw milk samples (56.5 %. Sensitive to teicoplanine (30 mcg/disk were 97.9 % of enterococcal isolates and 15.2 % isolates were resistant to vankomycin (30 mcg/disk.  

  19. Physicochemical and Microbiological Properties of Yogurt-cheese Manufactured with Ultrafiltrated Cow's Milk and Soy Milk Blends

    OpenAIRE

    Lee, Na-Kyoung; Mok, Bo Ram; Jeewanthi, Renda Kankanamge Chaturika; Yoon, Yoh Chang; Paik, Hyun-Dong

    2015-01-01

    The objective of this study was to develop yogurt-cheese using cow?s milk, ultrafiltrated cow?s milk, and soy milk. The addition of soy milk and ultrafiltrated milk increased the amount of protein in the yogurt-cheese. Yogurt-cheeses were made using cheese base using 10% and 20% soy milk with raw and ultrafiltrated cow?s milk, and stored at 4? during 2 wk. The yield of yogurt-cheeses made with added soy milk was decreased and the cutting point was delayed compared to yogurt-cheese made withou...

  20. Flush mounting of thin film sensors

    Science.gov (United States)

    Moore, Thomas C., Sr. (Inventor)

    1992-01-01

    Flush mounting of a sensor on a surface is provided by first forming a recessed area on the surface. Next, an adhesive bonding mixture is introduced into the recessed area. The adhesive bonding mixture is chosen to provide thermal expansion matching with the surface surrounding the recessed area. A strip of high performance polymeric tape is provided, with the sensor attached to the underside thereof, and the tape is positioned over the recessed area so that it acts as a carrier of the sensor. A shim having flexibility so that it will conform to the surface surrounding the recessed area is placed over the tape, and a vacuum pad is placed over the shim. The area above the surface is then evacuated while holding the sensor flush with the surface during curing of the adhesive bonding mixture. After such curing, the pad, shim, and tape are removed from the sensor, electrical connections for the sensor are provided, after which the remaining space in the recessed area is filled with a polymeric foam.

  1. Pricing and Policy Problems in the Northeast Fluid Milk Industry

    OpenAIRE

    Cotterill, Ronald

    2006-01-01

    This article documents the need for reform of milk pricing in the Northeast. The New York price gouging law can be recast as a fair share law. This new milk policy "kills two birds with one stone." It corrects regional inequities in raw milk pricing by reforming the pricing of milk at retail by limiting and redistributing excessive retail margins to farmers and consumers. The fair share policy relieves allocative price inefficiency, improves the performance of the federal milk market order po...

  2. Milk Allergy

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Milk Allergy KidsHealth / For Teens / Milk Allergy What's in this ... to find out. What Happens With a Milk Allergy? Food allergies involve the body's immune system, which ...

  3. Effect of hypothermic pulmonary artery flushing on capillary filtration coefficient.

    Science.gov (United States)

    Andrade, R S; Wangensteen, O D; Jo, J K; Tsai, M Y; Bolman, R M

    2000-07-27

    We previously demonstrated that surfactant dilution and inhibition occur immediately after pulmonary artery flushing with hypothermic modified Euro-Collins solution. Consequently, we speculated that increased capillary permeability contributed to these surfactant changes. To test this hypothesis, we evaluated the effects of hypothermic pulmonary artery flushing on the pulmonary capillary filtration coefficient (Kfc), and additionally performed a biochemical analysis of surfactant. We used a murine isolated, perfused lung model to measure the pulmonary capillary filtration coefficient and hemodynamic parameters, to determine the wet to dry weight ratio, and to evaluate surfactant by biochemical analysis of lung lavage fluid. We defined three study groups. In group I (controls), we harvested lungs without hypothermic pulmonary artery flushing, and measured Kfc immediately. In group II (in situ flush), we harvested lungs after hypothermic pulmonary artery flushing with modified Euro-Collins solution, and then measured Kfc. Experiments in groups I and II were designed to evaluate persistent changes in Kfc after pulmonary artery flushing. In group III (ex vivo flush), we flushed lungs ex vivo to evaluate transient changes in Kfc during hypothermic pulmonary artery flushing. Groups I and II did not differ significantly in capillary filtration coefficient and hemodynamics. Group II showed significant alterations on biochemical surfactant analysis and a significant increase in wet-to-dry weight ratio, when compared with group I. In group III, we observed a significant transient increase in capillary filtration coefficient during pulmonary artery flushing. Hypothermic pulmonary artery flushing transiently increases the capillary filtration coefficient, leads to an increase in the wet to dry weight ratio, and induces biochemical surfactant changes. These findings could be explained by the effects of hypothermic modified Euro-Collins solution on pulmonary capillary

  4. The changes of proteins fractions shares in milk and fermented milk drinks.

    Science.gov (United States)

    Bonczar, Genowefa; Walczycka, Maria; Duda, Iwona

    2016-01-01

    The aim of this research was to observe the changes which take place in the electrophoretic picture of milk proteins after pasteurisation and inoculation with different starter cultures (both traditional and probiotic). After incubation, the yoghurt, kefir, acidified milk, fermented Bifidobacterium bifidum drink and Lactobacillus acidophillus drink were chilled for 14 days to observe the changes which occurred. The research materials were raw and pasteurised milk, as well as fermented milk- based drinks. The raw milk used for research came from Polish Holstein-Fresian black and white cows. The milk was sampled 3 times and divided into 5 parts, each of which was pasteurised at 95°C for 10 min and then cooled for inoculation: yoghurt to 45°C, kefir and acidified milk to 22°C and drinks with Bifidobacterium bifidum and Lactobacillus acidophillus to 38°C. Milk was inoculated with lyophilised, direct vat starter cultures, in an amount equal to 2% of the working starter. For the production of fermented drinks, the subsequent starters were applied: "YC-180" Christian Hansen for yoghurt, "D" Biolacta-Texel-Rhodia for kefir, CH-N--11 Christian Hansen for acidified milk, starter by Christian Hansen for the probiotic Bifidobacterium bifidum milk, starter by Biolacta-Texel-Rhodia for the probiotic Lactobacillus acidophillus milk. The analyses were conducted in raw, pasteurised and freshly fermented milk as well as in milk drinks stored for 14 days. The total solid content was estimated by the drying method; the fat content by the Gerber method; the lactose content by the Bertrand method; the protein content by the Kjeldahl method with Buchi apparatus; the density of milk was measured with lactodensimeter; acidity with a pH-meter; and potential acidity by Soxhlet-Henkl method (AOAC, 1990). The electrophoretic separation of proteins in raw and pasteurised milk, as well as in freshly produced milk drinks and those stored for 14 days, was performed with SDS-PAGE (on

  5. 46 CFR 194.15-11 - Flushing systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Flushing systems. 194.15-11 Section 194.15-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS HANDLING, USE... § 194.15-11 Flushing systems. (a) Working spaces in which chemical stores are used shall be equipped...

  6. 30 CFR 57.7807 - Flushing the combustion chamber.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Flushing the combustion chamber. 57.7807... and Rotary Jet Piercing Rotary Jet Piercing-Surface Only § 57.7807 Flushing the combustion chamber. The combustion chamber of a jet drill stem which has been sitting unoperated in a drill hole shall be...

  7. 30 CFR 56.7807 - Flushing the combustion chamber.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Flushing the combustion chamber. 56.7807 Section 56.7807 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND... Rotary Jet Piercing Rotary Jet Piercing § 56.7807 Flushing the combustion chamber. The combustion chamber...

  8. 21 CFR 870.1210 - Continuous flush catheter.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Continuous flush catheter. 870.1210 Section 870.1210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... that permits continuous intravascular flushing at a slow infusion rate for the purpose of eliminating...

  9. Hot flushes | van Schoor | South African Family Practice

    African Journals Online (AJOL)

    Vasomotor symptoms, such as hot flushes and night sweats, are considered to be the cardinal symptoms of menopause, and are experienced by most women. The physiology of hot flushes is not fully understood, and is likely to reflect the interplay between multiple central and peripheral physiological systems. Reproductive ...

  10. 7 CFR 58.439 - Cheese from unpasteurized milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Cheese from unpasteurized milk. 58.439 Section 58.439... Procedures § 58.439 Cheese from unpasteurized milk. If the cheese is labeled as “heat treated”, “unpasteurized,” “raw milk”, or “for manufacturing” the milk may be raw or heated at temperatures below...

  11. Fate of ivermectin residues in ewes' milk and derived products

    NARCIS (Netherlands)

    Cerkvenik, V.; Perko, B.; Rogelj, I.; Doganoc, D.Z.; Skubic, V.; Beek, W.M.J.; Keukens, H.J.

    2004-01-01

    The fate of ivermectin (IVM) residues was studied throughout the processing of daily bulk milk from 30 ewes (taken up to 33 d following subcutaneous administration of 0·2 mg IVM/kg b.w.) in the following milk products: yoghurt made from raw and pasteurized milk; cheese after pressing; 30- and 60-day

  12. Microbiological examination of milk in Tarakeswar, India with special ...

    African Journals Online (AJOL)

    A study was carried out to assess the milk quality in Tarakeswar, India with special reference to coliforms. By standard plate count (SPC) method, out of ten raw milk samples, the microbial colonies were found to be high in six samples and the colony content was low in rest four samples. In pasteurized milk samples, the ...

  13. Staphylococcal milk poisoning in calves | Ngatia | Kenya Veterinarian

    African Journals Online (AJOL)

    Twenty out of 89 dairy calves fed on unsold raw milk returned from the fresh milk market, became sick within one hour after consuming the milk. The main clinical signs observed were sudden collapse, bloating, tetany, and diarrhea, seven of the sick calves died and two were submitted for necropsy. Postmortem findings ...

  14. Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption.

    Science.gov (United States)

    Magistrelli, Damiano; Rosi, Fabia

    2014-07-23

    In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower ( p raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower ( p pasteurized milks. In skimmed UHT milk, leptin was 40% lower ( p milk. Leptin was correlated ( p milks. Results suggest that the heat treatment (pasteurization or UHT) is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

  15. Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption

    Directory of Open Access Journals (Sweden)

    Damiano Magistrelli

    2014-07-01

    Full Text Available In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower (p < 0.05 than that observed in raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower (p < 0.0001 than those of full-cream UHT and full-cream pasteurized milks. In skimmed UHT milk, leptin was 40% lower (p < 0.0001 than in full-cream UHT milk. Leptin was correlated (p < 0.001 with lipid content. Leptin level of infant formulas was not different to that of skimmed milks. Results suggest that the heat treatment (pasteurization or UHT is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

  16. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  17. Occurrence and antimicrobial resistance of Staphylococcus aureus in bulk tank milk and milk filters

    Directory of Open Access Journals (Sweden)

    Kateřina Bogdanovičová

    2014-02-01

    Full Text Available This work is focused on the monitoring of Staphylococcus aureus prevalence in raw milk and milk filters, its antibiotic resistance and detection of methicillin resistant Staphylococcus aureus (MRSA. Samples of raw cow´s milk and milk filters were collected in the period from 2012 till 2014, from 50 dairy farms in the Czech Republic. The total of 261 samples (164 samples of raw milk and 97 milk filters were cultivated on Baird-Parker agar. Both the typical and atypical colonies were examined by plasmacoagulase test and PCR method was used for detection of species specific fragment SA442 and mecA gene. Standard disk diffusion method was used to determinate resistance to antimicrobial agents. The bacterium Staphylococcus aureus was detected on 25 farms (50%. The antimicrobial resistance showed differences between the farms. Total of 58 samples were positive for Staphylococcus aureus, of which were 37 (14.2% isolated from raw milk samples and 21 (8.1% from milk filters. From these samples we isolated 62 Staphylococcus aureus strains, 41 isolates bacteria S. aureus from raw milk (66.1% and 21 isolates S. aureus from milk filters (33.9%. The presence of antibiotic resistance in Staphylococcus aureus isolates was low, most of them were resistant to amoxicilin. According to the results obtained by the PCR method for the methicillin - resistant S. aureus (MRSA, the mecA gene was present in 6 strains (9.7%, 4 isolates obtained from milk samples (6.5% and 2 isolates from milk filters (3.2%.  These isolates can be considered as a possible source of resistance genes, which can be spread through the food chain. Nowadays, a globally unfavourable increasing trend of prevalence of methicillin resistant staphylococci strains especially Staphylococcus aureus is being observed worldwide. The improper hygiene and poor farm management practices contributed to the presence of S. aureus in the milk. This may have contributed to the high level of S. aureus isolated

  18. Effect of processing intensity on immunologically active bovine milk serum proteins

    NARCIS (Netherlands)

    Brick, Tabea; Ege, Markus; Boeren, Sjef; Böck, Andreas; Mutius, Von Erika; Vervoort, Jacques; Hettinga, Kasper

    2017-01-01

    Consumption of raw cow’s milk instead of industrially processed milk has been reported to protect children from developing asthma, allergies, and respiratory infections. Several heat-sensitive milk serum proteins have been implied in this effect though unbiased assessment of milk proteins in general

  19. Impact of pasteurization on the antibacterial properties of human milk.

    Science.gov (United States)

    Van Gysel, Marjan; Cossey, Veerle; Fieuws, Steffen; Schuermans, Annette

    2012-08-01

    Growing evidence favours the use of human milk for the feeding of preterm newborns based on its many beneficial effects. Despite the many benefits, human milk has been associated as a possible vehicle of transmission for a number of infections. Although pasteurization of human milk can diminish the risk of neonatal infection, it also significantly reduces the concentrations of immunological components in human milk due to thermal damage. In order to evaluate the impact of pasteurization on the antibacterial properties of human milk, we aimed to compare the capacity of raw and pasteurized human milk to inhibit bacterial proliferation. Therefore, a single milk sample was collected from ten healthy lactating mothers. Each sample was divided into two aliquots; one aliquot was pasteurized, while the other was kept raw. Both aliquots were inoculated either with Escherichia coli or Staphylococcus aureus and incubated at 37 °C during 8 h. Viable colony counts from the inoculated samples were performed at regular time points to compare the bacterial growth in both forms of breast milk. Relative to the tryptic soy broth control sample, both raw and pasteurized milk samples exhibited an inhibitory effect on the growth of E. coli and S. aureus. Compared with the raw portion, growth inhibition was significantly lower in the pasteurized milk at every time point beyond T0 (after 2, 4 and 8 h of incubation) (p = 0.0003 for E. coli and p pasteurization adversely affects the antibacterial properties of human milk.

  20. Effect of gamma irradiation on the properties of various kinds of milk fat. II. Fatty acids composition of milk fat

    International Nuclear Information System (INIS)

    Girgis, E.S.; Rady, A.H.; Kamal, T.H.; Shehata, T.E.; Ibrahim, M.K.

    1986-01-01

    Fresh cow's, buffalo's and goat's milk fat were subjected to ascendent doses of 8-rays of 250, 500 and 750 K.rad as compared to raw milk samples (control). The methyl esters of fats separated from these samples were analyzed using gas liquid chromatographic technique. Total saturated fatty acids (T.S.F.A.) were 70.46%, 67.44% and 72.85%, while total unsaturated fatty acid (T.U.F.A.) were 29.51%, 32.54% and 27.15% for cow's buffalo's and goat's raw milk fats, respectively. Water insoluble volatile fatty acids (W.I.V.F.A.) were much higher in goat's raw milk fat (23.24%) than in cows (6.34%) and buffaloes (5.25%) ones. Palmitic acid represents the predominant saturated fatty acid, while oleic acid represents the major unsaturated fatty acids in the three kinds of milk fat. Linoleic acid was present only in buffalo's and goat's raw milk fat. The exposure of buffalo's and goat's milk to 8-rays doses increased TSFA and decreased TUFA of their fats. Meanwhile the same doses induced a minor change in both TSFA and TUFA of cow's milk one. Also, 8-irradiation increased the relative percentage of Palmitic acid in the three types of milk fat, while linoleic acid decreased in buffalo's and goat's milk fat. Besides, W.I.V.F.A. showed a gradual decrease, when the three types of milk were exposed to ascendent doses of 8-rays

  1. Effects of light and copper ions on volatile aldehydes of milk and milk fractions

    Energy Technology Data Exchange (ETDEWEB)

    Jeno, W.; Bassette, R.; Crang, R.E.

    1988-09-01

    Raw, laboratory-pasteurized and plant-pasteurized homogenized milks were exposed to copper ions (5 ppm), to sunlight or fluorescent light and the effects determined on the composition of volatile aldehydes. The greatest change due to copper treatment was an increase in n-hexanal; acetaldehyde showed the least response in each of the sources of milk. The responses were similar from all three sources of milk with laboratory-pasteurized milk samples showing the greatest responses for each aldehyde analyzed. Similar milk samples exposed to sunlight also showed an increase in volatile aldehydes from all milk sources but with the greatest response being acetaldehyde and n-pentanal components. The milk fraction most susceptible to changes in the presence of light was neutralized whey, whereas resuspended cream was most susceptible to copper exposure. Overall, dialyzed whey appeared to be influenced more than other milk fractions by both light and copper ions.

  2. Flushing Enhancement with Vibration and Pulsed Current in Electrochemical Machining

    Directory of Open Access Journals (Sweden)

    Zhujian Feng

    2017-12-01

    Full Text Available This research aims to understand flushing of by-products in electrochemical machining (ECM by modeling and experimentally verifying mechanism of particle transport in inter-electrode gap under low frequency vibration. A series of hole were drilled on steel plates to evaluate the effect of vibration on material removal rate and hole quality. Infinite focus optical technique was used to capture and analyze the three-dimensional images of ECM'ed features. Experimental results showed that maximum machining depth and minimum taper angle can be achieved when vibrating the workpiece at 40 Hz and 10 µm amplitude. Simulation results showed that the highest average flushing speed of 0.4 m/s was obtained at this vibration frequency and amplitude. Machining depth and material removal rate has a positive correlation with the average flushing speed. Sharper ECM’ed profile is obtained since the taper angle is favorably reduced at high average flushing speed.

  3. Flushing wells during drilling in rocks with negative temperature

    Energy Technology Data Exchange (ETDEWEB)

    Badalov, S S

    1982-01-01

    Results are examined of experimental studies of cavern formation in loose sands cemented by ice. The new data obtained make it possible to have a substantiated plan for the indicators of the flushing fluid and its chemical treatment. Results are presented of studies of argillaceous solutions chemically treated and untreated, as well as water and diesel fuel. Comparison of the findings with the technological indicators of the argillaceous solutions indicated that with an increase in viscosity of the solution and its content of clay powder, the rates of ice destruction diminish. It was established that with a rise in viscosity, there is also an intensification of the ice destruction rate, if the rise in viscosity is accompanied by increase in water-output of the flushing fluid. It is namely the water-output of the flushing fluid which is one of the universal indicators for the suitability of the flushing fluid for drilling under the examined conditions.

  4. Effects of Ohmic Heating on Microbial Counts and Denaturatiuon of Proteins in Milk

    OpenAIRE

    SUN, Huixian; KAWAMURA, Shuso; HIMOTO, Jun-ichi; ITOH, Kazuhiko; WADA, Tatsuhiko; KIMURA, Toshinori

    2008-01-01

    The aim of this study was to compare the inactivation effects of ohmic heating (internal heating by electric current) and conventional heating (external heating by hot water) on viable aerobes and Streptococcus thermophilus 2646 in milk under identical temperature history conditions. The effects of the two treatments on quality of milk were also compared by assessing degrees of protein denaturation in raw and sterilized milk (raw milk being sterilized by ohmic heating or conventional heating)...

  5. Citrus flush shoot ontogeny modulates biotic potential of Diaphorina citri.

    Science.gov (United States)

    Cifuentes-Arenas, Juan Camilo; de Goes, António; de Miranda, Marcelo Pedreira; Beattie, George Andrew Charles; Lopes, Silvio Aparecido

    2018-01-01

    The biology and behaviour of the psyllid Diaphorina citri Kuwayama (Hemiptera: Sternorrhyncha: Liviidae), the major insect vector of bacteria associated with huanglongbing, have been extensively studied with respect to host preferences, thermal requirements, and responses to visual and chemical volatile stimuli. However, development of the psyllid in relation to the ontogeny of immature citrus flush growth has not been clearly defined or illustrated. Such information is important for determining the timing and frequency of measures used to minimize populations of the psyllid in orchards and spread of HLB. Our objective was to study how flush ontogeny influences the biotic potential of the psyllid. We divided citrus flush growth into six stages within four developmental phases: emergence (V1), development (V2 and V3), maturation (V4 and V5), and dormancy (V6). Diaphorina citri oviposition and nymph development were assessed on all flush stages in a temperature controlled room, and in a screen-house in which ambient temperatures varied. Our results show that biotic potential of Diaphorina citri is not a matter of the size or the age of the flushes (days after budbreak), but the developmental stage within its ontogeny. Females laid eggs on flush V1 to V5 only, with the time needed to commence oviposition increasing with the increasing in flush age. Stages V1, V2 and V3 were most suitable for oviposition, nymph survival and development, and adult emergence, which showed evidence of protandry. Flush shoots at emerging and developmental phases should be the focus of any chemical or biological control strategy to reduce the biotic potential of D. citri, to protect citrus tree from Liberibacter infection and to minimize HLB dissemination.

  6. Milk Iodine Content in Slovakia

    Directory of Open Access Journals (Sweden)

    I. Paulíková

    2008-01-01

    Full Text Available The aim of this work was to map actual iodine status and its seasonal differences in raw milk of dairy cows, sheep, and goats in various regions of Slovakia. Iodine concentrations were determined in 457 samples of raw milk from dairy cows, 78 samples of sheep, and 16 samples of goat milk collected in various regions of Slovakia from 2002 to 2007. Among all the 457 samples of bovine milk, iodine content below 50 μg l-1 was recorded in 114 samples (24.94%; 294 samples (64.33% ranged between 50 and 200 μg l-1; 19 samples (4.16% from 200 to 500 μg l-1; 17 samples (3.72% between 500 and 1 000 μg l-1, and 13 samples (2.85% showed iodine concentrations over 1 000 μg l-1. regional concentrations showed the highest values in the Western, then Middle and Eastern Slovakia, and the lowest values in Northern Slovakia (p p -1 in 49 sheep (62.8% and in 6 goats below 60 μg l-1 (37.5%, which are indicative of iodine deficiency. When comparing seasonal differences, sheep and goat milk had higher iodine content during the winter feeding period, however, in dairy cows we recorded the opposite ratio. Except for goat milk (p < 0.01 the seasonal differences were not significant.

  7. Double-Shell Tank (DST) Diluent and Flush Subsystem Specification

    International Nuclear Information System (INIS)

    GRAVES, C.E.

    2000-01-01

    The Double-Shell Tank (DST) Diluent and Flush Subsystem is intended to support Waste Feed Delivery. The DST Diluent and Flush Subsystem specification describes the relationship of this system with the DST System, describes the functions that must be performed by the system, and establishes the performance requirements to be applied to the design of the system. It also provides references for the requisite codes and standards. The DST Diluent and Flush Subsystem will treat the waste for a more favorable waste transfer. This will be accomplished by diluting the waste, dissolving the soluble portion of the waste, and flushing waste residuals from the transfer line. The Diluent and Flush Subsystem will consist of the following: The Diluent and Flush Station(s) where chemicals will be off-loaded, temporarily stored, mixed as necessary, heated, and metered to the delivery system; and A piping delivery system to deliver the chemicals to the appropriate valve or pump pit Associated support structures. This specification is intended to be the basis for new projects/installations. This specification is not intended to retroactively affect previously established project design criteria without specific direction by the program

  8. FEASIBILITY STUDY OF SEDIMENT FLUSHING FROM MOSUL RESERVOIR, IRAQ

    Directory of Open Access Journals (Sweden)

    Thair Mahmood Al-Taiee

    2015-02-01

    Full Text Available The Feasibility of sediment flushing  from Mosul reservoir located northern iraq was conducted. Many up to date world criteria and indices for checking the efficiency of sediment flushing from reservoir which have been got through analyzing large amount of  data from many flushed reservoirs  in the world which were depended tested and applied in the present case study (Mosul Reservoir. These criteria and indices depend mainly on the hydrological , hydraulic and  topographical properties of the reservoirs in-addition to the operation plan of the reservoirs. They gave a good indication for checking the efficiency of the sediment flushing  process in the reservoirs. It was concluded that approximately the main criteria for the successful flushing sediment was  verified  in  Mosul  reservoir  such as  Sediment Balance Ratio   (SBR and the Long Term Capacity Ratio (LTCR,the shape factor  of reservoir (W/L and the hydraulic condition such as the percentage of (Qf/Qin and (Vf/Vin. This gave an indication that the processes of flushing sediment in Mosul reservoir is probably feasible and may be applied  in the future to maintain the water storage in the reservoir.

  9. The effect of milk processing on the microstructure of the milk fat globule and rennet induced gel observed using confocal laser scanning microscopy.

    Science.gov (United States)

    Ong, L; Dagastine, R R; Kentish, S E; Gras, S L

    2010-04-01

    Confocal laser scanning microscopy (CLSM) was successfully used to observe the effect of milk processing on the size and the morphology of the milk fat globule in raw milk, raw ultrafiltered milk, and standardized and pasteurized milk prepared for cheese manufacture (cheese-milk) and commercial pasteurized and homogenized milk. Fat globule size distributions for the milk preparations were analyzed using both image analysis and light scattering and both measurements produced similar data trends. Changes to the native milk fat globule membrane (MFGM) were tracked using a MFGM specific fluorescent stain that allowed MFGM proteins and adsorbed proteins to be differentiated on the fat globule surface. Sodium dodecyl sulfate polyacrylamide gel electrophoresis confirmed the identity of native MFGM proteins isolated from the surface of fat globules within raw, UF retentate, and cheese-milk preparations, whereas only casein was detected on the surface of fat globules in homogenized milk. The microstructure, porosity, and gel strength of the rennet induced gel made from raw milk and cheese-milk was also found to be comparable and significantly different to that made from homogenized milk. Our results highlight the potential use of CLSM as a tool to observe the structural details of the fat globule and associated membrane close to its native environment.

  10. Cow's milk quality and energy value during different lactation stages.

    Science.gov (United States)

    Salamończyk, Ewa

    2013-01-01

    The quality of dairy products, raw milk in particular, depends on many factors. Low bacterial and somatic cell counts are basic determinants of the appropriate raw milk quality. The objective of the work was to assess the effect of selected factors, that is, the age of cows and their daily milk performance, on cytological quality (somatic cell count) and energy value of milk produced at individual stages of lactation. Somatic cell count and energy value of cow's milk were assessed. A total of 229 792 milk samples were examined. Data for analysis were taken from milk records of 350 dairy herds. It was demonstrated that, of all the lactations studied, the fi rst lactation (from calving to the 100th day of lactation) was characterised by the highest daily milk performance (25.1 kg) and the lowest somatic cell count (356 thous./1 ml), fat, protein and dry matter contents (4.06, 2.96 and 12.41%, respectively) and milk calorific value (732 kcal/kg). The highest energy value was recorded in cow's milk produced towards the end of lactation, that is from day 300 till the end of lactation (842 kcal/kg). High milk calorific value in late lactation and high fat and protein contents were accompanied by low raw milk quality.

  11. Physico-chemical characterisation of some samples of fresh milk and milk powder

    Directory of Open Access Journals (Sweden)

    Soceanu Alina

    2015-12-01

    Full Text Available Milk consumption is important in the diet of all age groups because it provides important nutrients that are essential for humans. Children are the largest consumers of milk, thus, it’s very important that milk is free of toxic compounds that can be harmful for humans. Aim of the study was to determine the physico-chemical characteristics of some samples of milk powder for different stage of baby growing and for some samples of fresh milk: raw cow’s milk, milk trade and UHT type. The following physico-chemical properties: density, pH, acidity, the presence of acetone, enzymes, antiseptics, dry substance, the ash, total fat, saponification and peroxide index, total nitrogen and protein content were determined. Comparing the values of acidity for analyzed samples it can be concluded that the powder milk acidity value is much lower than the fresh milk. The presence of antiseptics and acetone was not identified, and amylase and peroxidase were found only in raw cow's milk. The highest protein content was found for milk powder (27.22%.

  12. Detection of non-milk fat in milk fat by gas chromatography and linear discriminant analysis.

    Science.gov (United States)

    Gutiérrez, R; Vega, S; Díaz, G; Sánchez, J; Coronado, M; Ramírez, A; Pérez, J; González, M; Schettino, B

    2009-05-01

    Gas chromatography was utilized to determine triacylglycerol profiles in milk and non-milk fat. The values of triacylglycerol were subjected to linear discriminant analysis to detect and quantify non-milk fat in milk fat. Two groups of milk fat were analyzed: A) raw milk fat from the central region of Mexico (n = 216) and B) ultrapasteurized milk fat from 3 industries (n = 36), as well as pork lard (n = 2), bovine tallow (n = 2), fish oil (n = 2), peanut (n = 2), corn (n = 2), olive (n = 2), and soy (n = 2). The samples of raw milk fat were adulterated with non-milk fats in proportions of 0, 5, 10, 15, and 20% to form 5 groups. The first function obtained from the linear discriminant analysis allowed the correct classification of 94.4% of the samples with levels <10% of adulteration. The triacylglycerol values of the ultrapasteurized milk fats were evaluated with the discriminant function, demonstrating that one industry added non-milk fat to its product in 80% of the samples analyzed.

  13. USE OF SILVER IONS IN PASTEURIZED MILK PRODUCTION

    Directory of Open Access Journals (Sweden)

    A. Mamaev

    2012-10-01

    Full Text Available The means of pasteurized milk shelf life prolongation by electro-chemical diffusion of silver ions has been introduced. Three samples of pasteurized milk were test subjects. In the course of study the following data have been examined: organoleptic, physicochemical, microbiological parameters of check samples and pilot samples of raw and pasteurized milk. Its shelf life has been determined. It has been determined that the test results of raw and pasteurized milk samples processed by various concentration of silver ions showed minor difference in organoleptic, physic-chemical, microbiological parameters and shelf life span. In this connection it appears reasonable to use the smallest concentration of silver ions - 50 micrograms per liter for milk shelf life prolongation as it is considered the least harmful for person's organism. Infusion of silver ions in the concentration of 50 micrograms per liter allows to prolong raw and pasteurized milk shelf life by two days.

  14. ICE CREAM WITH A COMBINED COMPOSITION OF RAW MATERIALS

    Directory of Open Access Journals (Sweden)

    O. E. Khodyreva

    2013-01-01

    Full Text Available Dairy products are the product of daily demand. Nowadays actively assimilate new types of raw materials, tech-nology, formulation. One of the propagation methods of enriching dairy products is a combination of milk and vegetable raw materials. The possibility of making a concentrated paste of Jerusalem artichoke in dairy products was investigated. The ice cream sundae "Vanilla" was chosen as the object of research.

  15. Milk removal

    OpenAIRE

    Ferneborg, Sabine

    2016-01-01

    Milk from dairy cows is a staple dietary component for humans all over the world. Regardless of whether milk is consumed in its purest, unaltered form or as high-end products such as fine cheese or ice cream, it needs to be of high quality when taken from the cow, produced at a low price and produced in a system that consider aspects such as animal health, animal welfare and sustainability. This thesis investigated the role of milk removal and the importance of residual milk on milk yield...

  16. Identification of lactose ureide, a urea derivative of lactose, in milk and milk products.

    Science.gov (United States)

    Suyama, K; Sasaki, A; Oritani, T; Hosono, A

    2011-12-01

    With the widespread consumption of milk, the complete characterization of the constituents of milk and milk products is important in terms of functionality and safety. In this study, a novel nonreducing carbohydrate was separated from powdered skim milk and was identified using electron spray ionization-mass spectrometry (m/z 385.1[M + H(+)]), ¹H, ¹³C, ¹H¹H-correlation spectroscopy, and heteronuclear single quantum-nuclear magnetic resonance spectra. The carbohydrate was identified as a lactose derivative of urea, N-carbamoyl-o-β-D-galactopyranosyl-(1-4)-D-glucopyranosylamine (lactose ureide, LU). For the HPLC analysis of LU in milk and milk products, benzoylated LU, hepta-o-benzoyl lactose ureide (melting point 137-139°C; m/z 1,113 [M + H⁺]; wavelength of maximum absorption, λ(max), 229 nm; molar extinction coefficient, ε, 8.1037 × 10⁷), was used as a standard. The crude nonreducing carbohydrate fraction from raw milk, thermally processed milk, and milk products such as powdered milks were directly benzoylated and subjected to HPLC analysis using an octadecylsilyl column to determine the quantity of LU. The content of LU in 10% solutions of powdered skim milk and powdered infant formula (5.0±1.1 and 4.9±1.5 mg/L, respectively) were almost 3-fold higher than that of UHT milk (1.6±0.5 mg/L) and higher than that of low-temperature, long-time-processed (pasteurized at 65°C for 30 min) milk (1.2±0.3 mg/L) and the fresh raw milk sample (0.3±0.1 mg/L). A time-course of the LU content in raw milk during heating at 110°C revealed that LU increased with time. From these results, it is likely that LU is formed by the Maillard-type reaction between the lactose and urea in milk and milk products. Because the concentration of LU in milk increased with the degree of processing heat treatment, it could serve as an indicator of the thermal deterioration of milk. Although it is known that the human intestine is unable to digest LU, the gastrointestinal bacteria

  17. Variable-Volume Flushing (V-VF) device for water conservation in toilets

    Science.gov (United States)

    Jasper, Louis J., Jr.

    1993-01-01

    Thirty five percent of residential indoor water used is flushed down the toilet. Five out of six flushes are for liquid waste only, which requires only a fraction of the water needed for solid waste. Designers of current low-flush toilets (3.5-gal. flush) and ultra-low-flush toilets (1.5-gal. flush) did not consider the vastly reduced amount of water needed to flush liquid waste versus solid waste. Consequently, these toilets are less practical than desired and can be improved upon for water conservation. This paper describes a variable-volume flushing (V-VF) device that is more reliable than the currently used flushing devices (it will not leak), is simple, more economical, and more water conserving (allowing one to choose the amount of water to use for flushing solid and liquid waste).

  18. Cow's milk and goat's milk.

    Science.gov (United States)

    Turck, Dominique

    2013-01-01

    Cow's milk is increasingly suggested to play a role in the development of chronic degenerative, non-communicable disorders whereas goat's milk is advocated as having several health benefits. Cow's milk is a rich and cheap source of protein and calcium, and a valuable food for bone health. Despite their high content in saturated fats, consumption of full-fat dairy products does not seem to cause significant changes in cardiovascular disease risk variables. Early introduction of cow's milk is a strong negative determinant of iron status. Unmodified cow's milk does not meet nutritional requirements of infants although it is acceptable to add small volumes of cow's milk to complementary foods. Cow's milk protein allergy has a prevalence ranging from 2 to 7%, and the age of recovery is usually around 2-3 years. The evidence linking cow's milk intake to a later risk of type 1 diabetes or chronic degenerative, non-communicable disorders (obesity, metabolic syndrome, type 2 diabetes, hypertension) is not convincing. Milk probably protects against colorectal cancer, diets high in calcium are a probable cause of prostate cancer, and there is limited evidence suggesting that high consumption of milk and dairy products increases the risk for prostate cancer. There is no evidence to support the use of a cow's milk-free diet as a primary treatment for individuals with autistic spectrum disorders. Unmodified goat's milk is not suitable for infants because of the high protein and minerals content and of a low folate content. Goat's milk has no clear nutritional advantage over cow's milk and is not less allergenic. The European Food Safety Authority recently stated that proteins from goat's milk can be suitable as a protein source for infant and follow-on formula, provided the final product complies with the compositional criteria laid down in Directive 2006/141/EC. Copyright © 2013 S. Karger AG, Basel.

  19. Camel milk and milk products

    Directory of Open Access Journals (Sweden)

    Andreja Brezovečki

    2015-05-01

    Full Text Available Camel milk and camel milk products have always been highly esteemed playing even today an important role in the diet of the population in the rural areas of Africa, Asia and the Middle East, with scarce agricultural areas, high temperatures and small amount of precipitation. In aggravated environmental circumstances, camels may produce more milk than any other species, while their demand for food is very modest. A camel produces between 1000 and 2000 L of milk during the lactation period of 8 to 18 months, while the daily production of milk is between 3 and 10 L. The goal of the overview is to present the chemical composition of camel milk, and products made from camel milk. On average camel milk contains 81.4-87 % water, 10.4 % dry matter, 1.2-6.4 % milk fat, 2.15-4.90 % protein, 1.63-2.76 % casein, 0.65-0.80 % whey protein, 2.90-5.80 % lactose and 0.60-0.90 % ash. Variations in the contents of camel milk may be attributed to several factors such as analytical methods, geographical area, nutrition conditions, breed, lactation stage, age and number of calvings. Camel milk is becoming an increasingly interesting product in the world, not only for its good nutritive properties, but also for its interesting and tasteful products.

  20. Proteolysis of milk fat globule membrane proteins during in vitro gastric digestion of milk.

    Science.gov (United States)

    Ye, A; Cui, J; Singh, H

    2011-06-01

    The influence of gastric proteolysis on the physicochemical characteristics of milk fat globules and the proteins of the milk fat globule membrane (MFGM) in raw milk and cream was examined in vitro in simulated gastric fluid (SGF) containing various pepsin concentrations at pH 1.6 for up to 2h. Apparent flocculation of the milk fat globules occurred in raw milk samples incubated in SGF containing pepsin, but no coalescence was observed in either raw milk samples or cream samples. The changes in the particle size of the fat globules as a result of the flocculation were dependent on the pepsin concentration. Correspondingly, the physical characteristics of the fat globules and the composition of the MFGM proteins in raw milk changed during incubation in SGF containing pepsin. The major MFGM proteins were hydrolyzed at different rates by the pepsin in the SGF; butyrophilin was more resistant than xanthine oxidase, PAS 6, or PAS 7. Peptides with various molecular weights, which altered with the time of incubation and the pepsin concentration, were present at the surfaces of the fat globules. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. A 100-Year Review: The production of fluid (market) milk.

    Science.gov (United States)

    Barbano, David M

    2017-12-01

    During the first 100 years of the Journal of Dairy Science, dairy foods and dairy production dairy scientists have partnered to publish new data and research results that have fostered the development of new knowledge. This knowledge has been the underpinning of both the commercial development of the fluid milk processing industry and regulations and marketing policies for the benefit of dairy farmers, processors, and consumers. During the first 50 years, most of the focus was on producing and delivering high-quality raw milk to factories and improving the shelf life of pasteurized fluid milk. During the second 50 years, raw milk quality was further improved through the use of milk quality payment incentives. Due to changing demographics and lifestyle, whole fluid milk consumption declined and processing technologies were developed to increase the range of fluid milk products (skim and low-fat milks, flavored milks, lactose-reduced milk, long-shelf-life milks, and milks with higher protein and calcium contents) offered to the consumer. In addition, technology to produce specialty high-protein sports beverages was developed, which expanded the milk-based beverage offerings to the consumer. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Investigation on pyrolysis of some organic raw materials

    Directory of Open Access Journals (Sweden)

    Purevsuren B

    2017-02-01

    Full Text Available We have been working on pyrolysis of some organic raw materials including different rank coals, oil shale, wood waste, animal bone, cedar shell, polypropylene waste, milk casein and characterization of obtained hard residue, tar and pyrolytic water and gas after pyrolysis. The technical characteristics of these organic raw materials have been determined and the thermal stability characteristics such as thermal stability indices (T5% and T25% determined by using thermogravimetric analysis. The pyrolysis experiments were performed at different heating temperatures and the yields of hard residue, tar, pyrolysis water and gaseous products were determined and discussed. The main technical characteristics of hard residue of organic raw materials after pyrolysis have been determined and the adsorption ability of pyrolysis hard residue and its activated carbon of organic raw materials also determined. The pyrolysis tars of organic raw materials were distilled in air condition and determined the yields of obtained light, middle and heavy fractions and bitumen like residue with different boiling temperature. This is the first time to investigate the curing ability of pyrolysis tars of organic raw materials for epoxy resin and the results of these experiments showed that only tar of milk casein has the highest (95.0%, tar of animal bone has certain (18.70% and tars of all other organic raw materials have no curing ability for epoxy resin.

  3. Recuento de bacterias totales en leche cruda de tambos que caracterizan la zona noroeste de Santa Fe y sur de Santiago del Estero Total bacterial count in raw milk of dairy farms that characterize the northwest zone of Santa Fe and south of Santiago del Estero

    Directory of Open Access Journals (Sweden)

    G.R. Revelli

    2004-09-01

    Full Text Available Un total de 6.998 muestras de leche cruda de pool de tanque, correspondientes a 55 establecimientos lecheros asociados a la Cooperativa Tambera Nueva Alpina Ltda., fueron recolectadas entre los años 1993 y 2002. Se realizó el Recuento de Microorganismos Aerobios Mesófilos Totales, obteniéndose como resultado un valor medio de 1,2 x 105± 2,4 x 105UFC/ml que caracteriza la zona. El año de finalización de la experiencia, se observó un 97% de los tambos evaluados con promedios £ 1,0 x 105UFC/ml. Solamente un 3% sobrepasa este límite, no encontrándose establecimientos con niveles superiores a 1,5 x 105UFC/ml. Al relacionar este indicador con parámetros composicionales, las correlaciones más significativas resultaron para: Recuento de Bacterias Totales vs Acidez (r = 0,292; P A total of 6.998 raw milk samples of bulk tank, belonging to 55 dairy farms associated to the Cooperativa Tambera Nueva Alpina Ltda., were collected between the years 1993 and 2002. The Total Mesophilic Aerobic Microorganisms Count was analyzed, obtaining a medium value of 1.2 x 105± 2.4 x 105CFU/ml that characterizes the zone. The final year of experience, observed a 97% of dairy farms evaluated with averages £ 1,0 x 105CFU/ml. Only a 3% it surpasses this limit, not being found establishments with levels over 1.5 x 105CFU/ml. Relating this indicators with compositionals parameters, the most significant correlation resulted for: Total Bacterial Count vs Acidity (r = 0.292; P < 0.001 and Total Bacterial Count vs Freezing Point (r = 0.157; P < 0.001. The microbiological quality in raw milk of dairy farms belonging to the northwest zone of Santa Fe and south of Santiago del Estero showed a significant improvement during this time.

  4. Effect of gamma irradiation on the unsaponifiable matter components of cows, buffaloes and goats milk fat

    International Nuclear Information System (INIS)

    Rady, A.H.

    1986-01-01

    Fresh cow's, buffalo's and goat's milk were treated with gamma-irradiation from a cobalt-60 source at safe doses (250, 500 and 750 krad) in addition to raw milk of the same types. Results indicate that total hydrocarbon was much lower in unsaponifiable matter (unsap. m) of goat's raw milk fat than that of cow's and buffalo's. Unsap. m of cow's milk fat consisted of ten hydrocarbon compounds, while it consisted of eight hydrocarbon compounds in both buffaloes and goats ones. Moreover, the unsap. m of goat's milk had the highest total sterols followed by buffalo's and cow's, respectively. Cholesterol represents the predominant sterol compound of the unsap. m in all kinds of raw milk fat. The application of ascendent doses of gamma irradiation increased total hydrocarbons and decreased total sterols (particularly cholesterol compounds) of unsap. m of both buffalo's and goat's milk fats, while the reverse trend occurred with cow's milk fat

  5. FACTORS INCREASING THE COMPETITIVENESS OF MILK PRODUCTION IN THE KRASNODAR REGION

    OpenAIRE

    Kremyanskaya E. V.

    2016-01-01

    The study justifies the need for improving the competitiveness of milk production in the commodity market, identifies the key indicators of improving the competitiveness of milk, which include the quality and level of costs. A direct dependence of the efficiency of realization of milk and incentives of operators of machine milking (milkers) on the quality of the raw milk produced is defined by means of the method of statistical groupings. A correlation and regression analysis of the quality o...

  6. Characteristics of the first human milk bank in Taiwan.

    Science.gov (United States)

    Chang, Fang-Yuan; Cheng, Shao-Wen; Wu, Tsung-Zu; Fang, Li-Jung

    2013-02-01

    The benefits of feeding human milk to infants, even in prematurity, have been well documented. Well-organized donor milk processing has made the milk bank a good source of nutrition for premature or sick infants if their own mother's milk is not sufficient or suitable. The Taipei City Hospital Milk Bank was established in 2005 and is the first nonprofit human milk bank to operate in Taiwan. The milk bank has adopted standards of practice laid down by the Human Milk Banking Association of North America and United Kingdom Association for Milk Banking. The clinical characteristics of the eligible milk donors, the recipients, and the donor milk were reviewed retrospectively. In the past 6 years, 816 eligible donors donated a total or 13,900 L (mean 17.03 L/donor) of breast milk. The mean age of these donors was 31.3 years, and 79.7% of them had college education. Most had term delivery (91.2%), with mean birth weight of their babies being 3120 g; 68.9% of the donors were primiparas. A total of 551 infants had received bank milk, with these indications: prematurity (65.4%), malabsorption (7.6%), feeding intolerance (7.2%), maternal illness (5.1%) and post-surgery (4.6%). The pass rate of raw donor milk was around 72.1%. The most common reasons to discard raw milk were Gram-negative rods contamination (72.8%) and ≥10 colony-forming units/mL of coagulase-negative Staphylococcus (62.3%). Only 0.63% of donor milk post pasteurization showed bacterial growth. Proper management and operation of a human milk bank can support breastfeeding, and provide a safe alternative to artificial formula for feeding preterm or ill infants in Taiwan. Sustainability of the milk bank needs more propagation and financial support by health authorities. Copyright © 2012. Published by Elsevier B.V.

  7. Refrigerated raw milk quality of a processing plant in the north of Parana after the implementation of changes imposed by NI 62 of 2011Qualidade do leite cru refrigerado de uma planta de processamento, no norte do Paraná, após a implementação das mudanças impostas pela NI 62 de 2011

    Directory of Open Access Journals (Sweden)

    Elsa Helena Walter de Santana

    2012-02-01

    Full Text Available This study aimed to compare the microbiological and physicochemical quality of raw milk from individual and collective tanks, identify the psychrotrophic microbiota of refrigerated raw milk and verify compliance with current legislation. The enumeration of proteolytic and lipolytic psychrotrophs, as well as, populations of mesophilic aerobes, total coliforms, E. coli and enterobacteria was carried out. The psychrotrophic microbiota was characterized by morpho-tinctorial tests. Determination of fat content, protein, lactose, total solids, titratable acidity, cryoscopic index and somatic cells count (SCC were also conducted. The average counts of mesophilic aerobes did not met the minimum quality requirements; however, the average results of SCC and the physicochemical parameters were in accordance with Brazilian legislation. The psychrotrophs counts were on average 90% of the total count of mesophilic aerobes, with psychrotrophic population of less than 6 log CFU/ml. A high percentage of proteolytic and lipolytic psychrotrophs in relation to psychrotrophs total counts was found. Considering the two weeks testing, there was a significant difference (P> 0.05 between milk samples from collective and individual tanks only for total coliforms and for protein and lactose contents. Although the predominant psychrotrophic microbiota was Gram negative bacilli, but Gram positive bacteria were also found. Thus, the population of mesophilic aerobes in disagreement with the legislation and the high counts of psychrotrophic and Gram negative population in milk are indicative that yet, there are problems in the sanitary-hygienic production, storage and transportation of refrigerated raw milk produced in the region studied. Therefore, there is a gap between the practices recommended by legislation and the actions really found in the Brazilian milk production chain.Este estudo teve como objetivo comparar a qualidade microbiológica e físico-química de leite cru

  8. Modulation of magmatic processes by CO2 flushing

    Science.gov (United States)

    Caricchi, Luca; Sheldrake, Tom E.; Blundy, Jon

    2018-06-01

    Magmatic systems are the engines driving volcanic eruptions and the source of fluids responsible for the formation of porphyry-type ore deposits. Sudden variations of pressure, temperature and volume in magmatic systems can produce unrest, which may culminate in a volcanic eruption and/or the abrupt release of ore-forming fluids. Such variations of the conditions within magmatic systems are commonly ascribed to the injection of new magma from depth. However, as magmas fractionating at depth or rising to the upper crust release CO2-rich flui