Tick-borne Encephalitis Associated with Consumption of Raw Goat Milk, Slovenia, 2012

Science.gov (United States)

Hudopisk, Neda; Korva, Miša; Janet, Evgen; Simetinger, Marjana; Grgič-Vitek, Marta; Gubenšek, Jakob; Natek, Vladimir; Kraigher, Alenka; Strle, Franc

2013-01-01

Tick-borne encephalitis (TBE) developed in 3 persons in Slovenia who drank raw milk; a fourth person, who had been vaccinated against TBE, remained healthy. TBE virus RNA was detected in serum and milk of the source goat. Persons in TBE-endemic areas should be encouraged to drink only boiled/pasteurized milk and to be vaccinated. PMID:23697658

Effects of home-made boiling of bovine raw milk on its microbiological quality

Directory of Open Access Journals (Sweden)

Giampaolo Colavita

2012-10-01

Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.

Comparison of the in vitro digestion of raw pasture milk and commercial HTST and UHT pasteurized milk

Science.gov (United States)

Consumption of raw milk from pasture-fed cows, typically purchased at local farms, is steadily increasing in the US because many consumers believe that high-temperature short-time (HTST) or ultrahigh temperature (UHT) pasteurization affects the digestibility of milk proteins and thus the bioavailabi...

"Don't Have A Cow, Man!": Recognizing Herd Share Agreements for Raw Milk.

Science.gov (United States)

Mayer, Timothy J

2015-01-01

Dissatisfaction with the industrial model of food production has caused many consumers to seek out food produced on local, family-scale farms that use U.S. Department of Agriculture certified organic or other sustainable practices to grow their food and raise their livestock. While almost all of the types of food that are available at the grocery store can also be found at the local farmers market, one food that is difficult to find in many states is raw milk—that is, milk that has not undergone pasteurization (heat treatment). This difficulty lies in the fact that most states prohibit the direct retail sale of raw milk to the final consumer because public health officials and state legislators fear that raw milk may contain bacteria harmful to human health such as E. coli, Campylobacter, and Listeria. However, some consumers reject these warnings and instead believe that raw milk possesses both nutritional and medicinal qualities. Indeed, an ever-increasing body of scientific research published in peer-reviewed journals supports the claim that raw milk consumption can mitigate or prevent some allergies and infections, especially in young children. In order for consumers to obtain raw milk in states where its sale is prohibited, some consumers have entered into arrangements with farmers known as “herd sharing,” through which the consumer effectively becomes an owner of the herd of cows or goats. For the price of the share and a monthly boarding fee, the shareholder can receive a weekly distribution of the herd’s primary dividend, namely the raw milk. Several states expressly permit this practice while most are silent and still a few prohibit it outright. The three courts in the United States that have ruled on herd share agreements have split, with two courts rejecting the agreements as a circumvention of the state’s prohibition on the sale of raw milk, and the other court assuming the agreement’s validity in light of the state’s failure to adequately

Food safety in raw milk production: risk factors associated to bacterial DNA contamination.

Science.gov (United States)

Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos

2014-06-01

While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

Effect of raw milk on lactose intolerance: a randomized controlled pilot study.

Science.gov (United States)

Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D

2014-01-01

This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.

Survey to determine why people drink raw milk.

Science.gov (United States)

Mullin, Gerard E; Belkoff, Stephen M

2014-11-01

Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study

Science.gov (United States)

Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.

2014-01-01

PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309

Influence of raw milk quality on fluid milk shelf life.

Science.gov (United States)

Barbano, D M; Ma, Y; Santos, M V

2006-03-01

Pasteurized fluid milk shelf life is influenced by raw milk quality. The microbial count and somatic cell count (SCC) determine the load of heat-resistant enzymes in milk. Generally, high levels of psychrotrophic bacteria in raw milk are required to contribute sufficient quantities of heat-stable proteases and lipases to cause breakdown of protein and fat after pasteurization. Sanitation, refrigeration, and the addition of CO2 to milk are used to control both total and psychrotrophic bacteria count. It is not uncommon for total bacterial counts of raw milk to be milk processors have not focused much attention on milk SCC. Increased SCC is correlated with increased amounts of heat-stable protease (plasmin) and lipase (lipoprotein lipase) in milk. When starting with raw milk that has a low bacterial count, and in the absence of microbial growth in pasteurized milk, enzymes associated with high SCC will cause protein and fat degradation during refrigerated storage, and produce off-flavors. As the ability to kill, remove, or control microbial growth in pasteurized refrigerated milk continues to improve, the original milk SCC will be the factor limiting the time of refrigerated storage before development of an off-flavor in milk. Most healthy cows in a dairy herd have a milk SCC 200,000 cell/mL are usually due to the contribution of high SCC milk from a small number of cows in the herd. Technology to identify these cows and keep their milk out of the bulk tank could substantially increase the value of the remaining milk for use in fluid milk processing. To achieve a 60- to 90-d shelf life of refrigerated fluid milk, fluid processors and dairy farmers need to work together to structure economic incentives that allow farmers to produce milk with the SCC needed for extended refrigerated shelf life.

Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines

Directory of Open Access Journals (Sweden)

Gheorghe Şteţca

2014-11-01

Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain. 

Field handling conditions of raw milk sold in vending machines: experimental evaluation of the behaviour of Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni

Directory of Open Access Journals (Sweden)

Renato G. Zanoni

2012-01-01

Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.

Risky consumption habits and safety of fluid milk available in retail sales outlets in Viçosa, Minas Gerais State, Brazil.

Science.gov (United States)

Pieri, Fabio Alessandro; Colombo, Monique; Merhi, Carolina Milner; Juliati, Vinícius Augusto; Ferreira, Marcello Sebe; Nero, Marcelo Antônio; Nero, Luis Augusto

2014-06-01

This study aimed to assess raw milk consumption habits in the urban population of Viçosa, Minas Gerais, Brazil, and the microbiological safety and quality of the fluid milk available in retail sales outlets in the same region. A simplified questionnaire regarding raw milk consumption was applied to the persons responsible for food acquisition in 411 residences. The regular consumption of raw milk was observed by 18.5% of the interviewers, and lack of knowledge of possible risks related to this food product. Microbiological safety and quality were assessed for raw (n=69), pasteurized (n=80), and ultra-high-temperature (UHT)-treated milk (n=80) by analyzing the counts of mesophilic aerobes, coliforms, and Escherichia coli, and detection of Listeria monocytogenes and Salmonella spp.; raw milk samples were also subjected to enumeration of coagulase-positive Staphylococcus. Concerning raw milk, 59.4% of the samples were considered as produced in inadequate hygienic conditions, 5.8% of the samples presented counts of coagulase-positive Staphylococcus lower than 100 colony-forming units (CFU)/mL, and no samples presented with positive results for L. monocytogenes or Salmonella spp. All pasteurized and UHT milk samples presented with low counts of mesophilic aerobes and coliforms, while L. monocytogenes and Salmonella spp. were absent. The data demonstrated that raw milk was consumed by the population studied. Despite the absence of potential hazards, raw milk was of poor hygienic quality, in contrast with the processed fluid milk available in retail sales outlets that was safe and of good hygienic quality, highlighting the suitability of pasteurized and UHT milk for human consumption.

Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield?

Science.gov (United States)

Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin

2016-12-01

This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the

Consumption of unprocessed cow's milk protects infants from common respiratory infections

NARCIS (Netherlands)

Loss, G.; Depner, M.; Ulfman, L.H.; Neerven, van R.J.J.; Hose, A.J.; Genuneit, J.

2015-01-01

Background: Breast-feeding is protective against respiratory infections in early life. Given the co-evolutionary adaptations of humans and cattle, bovine milk might exert similar anti-infective effects in human infants. Objective: To study effects of consumption of raw and processed cow's milk on

Risk assessment of listeriosis linked to the consumption of two soft cheeses made from raw milk: Camembert of Normandy and Brie of Meaux.

Science.gov (United States)

Sanaa, Moez; Coroller, Louis; Cerf, Olivier

2004-04-01

This article reports a quantitative risk assessment of human listeriosis linked to the consumption of soft cheeses made from raw milk. Risk assessment was based on data purposefully acquired inclusively over the period 2000-2001 for two French cheeses, namely: Camembert of Normandy and Brie of Meaux. Estimated Listeria monocytogenes concentration in raw milk was on average 0.8 and 0.3 cells/L, respectively, in Normandy and Brie regions. A Monte Carlo simulation was used to account for the time-temperature history of the milk and cheeses from farm to table. It was assumed that cell progeny did not spread within the solid cheese matrix (as they would be free to do in liquid broth). Interaction between pH and temperature was accounted for in the growth model. The simulated proportion of servings with no L. monocytogenes cell was 88% for Brie and 82% for Camembert. The 99th percentile of L. monocytogenes cell numbers in servings of 27 g of cheese was 131 for Brie and 77 for Camembert at the time of consumption, corresponding respectively to three and five cells of L. monocytogenes per gram. The expected number of severe listeriosis cases would be Camembert of Normandy, respectively.

Is Leptospira able to survive in raw milk? Study on the inactivation at different storage times and temperatures.

Science.gov (United States)

Fratini, Filippo; Turchi, Barbara; Ferrone, Martina; Galiero, Alessia; Nuvoloni, Roberta; Torracca, Beatrice; Cerri, Domenico

2016-09-01

The consumption of raw milk is currently increasing due to several beneficial aspects, such as nutritional qualities, taste, and health benefits. However, some authors highlight the potential risk associated with raw milk consumption. In Italy, while the absence of some pathogen microorganisms is set by the regional regulation DGR 381/2007, for other microorganisms, such as Leptospira, no recommendations are provided. Leptospira is not ascribed among classical milk pathogens; however, it can potentially be present in raw milk. The aim of this study was to evaluate the survival in raw milk of six serovars of Leptospira after storage at different temperatures (4 °C ± 2 °C, 20 °C ± 2 °C, and 30 °C ± 2 °C) for different incubation times (20 min, 45 min, 1 h, and 1 h and 30 min), in order to determine the potential risk for consumers. Moreover, the immediate effect of bovine, goat, and donkey raw milk on tested Leptospira serovars was visually evaluated. After incubation, all samples were subcultured in EMJH and incubated aerobically at 30 °C for 3 months. All inoculated media were weekly examined by dark-field microscope in order to assess Leptospira survival. Extemporary observation of strains' behavior in milk allowed to detect an almost immediate motility loss, and no leptospires were detected by microscopic observations carried out weekly during the trial period. According to our results, it could be possible to exclude raw milk as a source of Leptospira infection for consumers.

Prevalence, seasonality, and growth of enterococci in raw and pasteurized milk in Victoria, Australia.

Science.gov (United States)

McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M

2015-12-01

This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively

Hygienic quality of raw milk with regard to legislation

Directory of Open Access Journals (Sweden)

Slavko Kirin

2001-01-01

Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.

Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

DEFF Research Database (Denmark)

Scullion, R.; Harrington, C.S.; Madden, R.H.

2006-01-01

A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

Raw milk from vending machines: Effects of boiling, microwave treatment, and refrigeration on microbiological quality.

Science.gov (United States)

Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena

2014-01-01

In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Modeling to control spores in raw milk

NARCIS (Netherlands)

Vissers, M.

2007-01-01

A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

Impact of Freezing Time on Dornic Acidity in Three Types of Milk: Raw Donor Milk, Mother's Own Milk, and Pasteurized Donor Milk.

Science.gov (United States)

Vázquez-Román, Sara; Escuder-Vieco, Diana; García-Lara, Nadia Raquel; Alonso-Díaz, Clara; Lora, David; Martín-Pelegrina, María Dolores; Pallás-Alonso, Carmen Rosa

2016-03-01

Although under certain circumstances it is necessary to express milk, there are not many recommendations about the ideal storage conditions for human milk. The objectives of this study were to analyze the effects on Dornic acidity of frozen storage at -20 °C in three types of milk: raw donor milk, mother's own raw milk, and pasteurized donor milk. Forty-three samples of raw donor milk, 40 samples of pasteurized donor milk, and 16 samples of mother's own milk were analyzed. Dornic acidity was measured at time 0, before freezing. The remaining aliquots were frozen and analyzed after 1, 2, 3, and 4 weeks and after 2 and 3 months. In raw donor milk, the median acidity at the start was 3 °D (interquartile range [IQR] 2-3 °D); after 3 months, it was 5 °D (IQR 3-7 °D), with a significant increase in acidity after the second week. In mother's own milk, the mean acidity at the start was 3 °D (IQR 2-4 °D) and 7 °D (IQR 4-8 °D) at 3 months. The increase was significant after the third week. In pasteurized donor milk, the mean acidity was 3 °D (IQR 2-3 °D) at the start and 2 °D (IQR 2-3 °D) at the end. When comparing the three types of milk, there were significant differences from the first week between the two types of raw milk and the pasteurized milk (p raw milks (p = 0.77). Dornic acidity in unpasteurized milk significantly increases with the duration of freezing, probably due to the action of lipases, which is lost with pasteurization. It would be advisable to reduce the length of freezing time for unpasteurized milk.

Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk.

Science.gov (United States)

Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J

2011-03-01

Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Raw Cow’s Milk Prevents the Development of Airway Inflammation in a Murine House Dust Mite-Induced Asthma Model

Directory of Open Access Journals (Sweden)

Suzanne Abbring

2017-08-01

Full Text Available Epidemiological studies show an inverse relation between raw cow’s milk consumption and the development of asthma. This protective effect seems to be abolished by milk processing. However, evidence for a causal relationship is lacking, and direct comparisons between raw and processed milk are hardly studied. Therefore, this study investigated the preventive capacity of raw and heated raw milk on the development of house dust mite (HDM-induced allergic asthma in mice. Six- to seven-week-old male BALB/c mice were intranasally (i.n. sensitized with 1 µg HDM or PBS on day 0, followed by an i.n. challenge with 10 µg HDM or PBS on days 7–11. In addition, mice were fed 0.5 mL raw cow’s milk, heated raw cow’s milk, or PBS three times a week throughout the study, starting 1 day before sensitization. On day 14, airway hyperresponsiveness (AHR in response to increasing doses of methacholine was measured to assess lung function. Bronchoalveolar lavage fluid (BALF and lungs were furthermore collected to study the extent of airway inflammation. Raw milk prevented both HDM-induced AHR and pulmonary eosinophilic inflammation, whereas heated raw milk did not. Both milk types suppressed the Th2-polarizing chemokine CCL17 in lung homogenates and reduced lung Th2 and Th17 cell frequency. IL-4 and IL-13 production after ex vivo restimulation of lung T cells with HDM was also reduced by both milk types. However, local IL-5 and IL-13 concentrations were only suppressed by raw milk. These findings support the asthma-protective capacity of raw cow’s milk and show the importance of reduced local type 2 cytokine levels. Heated raw milk did not show an asthma-protective effect, which indicates the involvement of heat-sensitive components. Besides causal evidence, this study provides the basis for further mechanistic studies.

Incorporation of Listeria monocytogenes strains in raw milk biofilms.

Science.gov (United States)

Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

2013-02-01

Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

Raw cow’s milk relatively inhibits quorum sensing activity of Cromobacterium violaceum in comparison to raw she-camel’s milk

Directory of Open Access Journals (Sweden)

A.A. Moawad

2011-10-01

Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.

Protein carbonylation sites in bovine raw milk and processed milk products.

Science.gov (United States)

Milkovska-Stamenova, Sanja; Mnatsakanyan, Ruzanna; Hoffmann, Ralf

2017-08-15

During thermal treatment of milk, proteins are oxidized, which may reduce the nutritional value of milk, abolish protein functions supporting human health, especially important for newborns, and yield potentially harmful products. The side chains of several amino acids can be oxidized to reactive carbonyls, which are often used to monitor oxidative stress in organisms. Here we mapped protein carbonylation sites in raw milk and different brands of pasteurized, ultra high temperature (UHT) treated milk, and infant formulas (IFs) after digesting the precipitated proteins with trypsin. Reactive carbonyls were derivatized with O-(biotinylcarbazoylmethyl)hydroxylamine to enrich the modified peptides by avidin-biotin affinity chromatography and analyze them by nanoRP-UPLC-ESI-MS. Overall, 53 unique carbonylated peptides (37 carbonylation sites, 15 proteins) were identified. Most carbonyls were derived from dicarbonyls (mainly glyoxal). The number of carbonylation sites increased with the harsher processing from raw milk (4) to pasteurized (16) and UHT milk (16) and to IF (24). Copyright © 2017 Elsevier Ltd. All rights reserved.

Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

Directory of Open Access Journals (Sweden)

Ehsan Shamloo

2015-01-01

Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

Monitoring of psychrotrophic microorganisms in raw milk

Directory of Open Access Journals (Sweden)

Radka Burdychová

2008-01-01

Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.

The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea.

Science.gov (United States)

Park, Y K; Koo, H C; Kim, S H; Hwang, S Y; Jung, W K; Kim, J M; Shin, S; Kim, R T; Park, Y H

2007-12-01

Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (-0.0149), lactose (-0.8910), and MUN (-0.0096), and those of MUN on milk fat (-0.3125), protein (-0.8012), and SCCt (-0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (-0.0172), protein (-0.2693), and lactose (-0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.

119-132 Microbiological Quality of Raw Cow Milk across the Milk ...

African Journals Online (AJOL)

t

equipment of producers in rural areas of Babile district; from the equipment of .... pastoral areas is supplied to urban centers through informal milk marketing channels ... raw milk across the milk supply chain to ensure safety and suitability ... Materials and Methods. 2.1. ... Ethiopia at 9°36′ N latitude and 41°52′ E longitude.

Q fever through consumption of unpasteurised milk and milk products - a risk profile and exposure assessment.

Science.gov (United States)

Gale, P; Kelly, L; Mearns, R; Duggan, J; Snary, E L

2015-05-01

Q fever is a zoonotic disease caused by the bacterium Coxiella burnetii which is endemic in cattle, sheep and goats in much of the world, including the United Kingdom (UK). There is some epidemiological evidence that a small proportion of cases in the developed world may arise from consumption of unpasteurised milk with less evidence for milk products such as cheese. Long maturation at low pH may give some inactivation in hard cheese, and viable C. burnetii are rarely detected in unpasteurised cheese compared to unpasteurised milk. Simulations presented here predict that the probability of exposure per person to one or more C. burnetii through the daily cumulative consumption of raw milk in the UK is 0·4203. For those positive exposures, the average level of exposure predicted is high at 1266 guinea pig intraperitoneal infectious dose 50% units (GP_IP_ID50 ) per person per day. However, in the absence of human dose-response data, the case is made that the GP_IP_ID50 unit represents a very low risk through the oral route. The available evidence suggests that the risks from C. burnetii through consumption of unpasteurised milk and milk products (including cheese) are not negligible but they are lower in comparison to transmission via inhalation of aerosols from parturient products and livestock contact. © 2015 The Society for Applied Microbiology.

Brucella contamination in raw milk by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Mohammad Khalili

2016-10-01

Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

Effects of storage on the major constituents of raw milk

Directory of Open Access Journals (Sweden)

Peter Zajác

2015-10-01

Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an

The hygienic quality of raw reindeer milk

Directory of Open Access Journals (Sweden)

Joanna Kurki

2004-04-01

Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten

Strontium-90 and cesium-137 in raw milk

International Nuclear Information System (INIS)

1979-01-01

Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)

Factors affecting consumers' preferences for and purchasing decisions regarding pasteurized and raw milk specialty cheeses.

Science.gov (United States)

Colonna, A; Durham, C; Meunier-Goddik, L

2011-10-01

Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Effect of leaving milk trucks empty and idle for 6 h between raw milk loads.

Science.gov (United States)

Kuhn, Eva; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy G

2018-02-01

The US Pasteurized Milk Ordinance (PMO) allows milk tanker trucks to be used repeatedly for 24 h before mandatory clean-in-place cleaning, but no specifications are given for the length of time a tanker can be empty between loads. We defined a worst-case hauling scenario as a hauling vessel left empty and dirty (idle) for extended periods between loads, especially in warm weather. Initial studies were conducted using 5-gallon milk cans (pilot-scale) as a proof-of-concept and to demonstrate that extended idle time intervals could contribute to compromised raw milk quality. Based on pilot-scale results, a commercial hauling study was conducted through partnership with a Pacific Northwest dairy co-op to verify that extended idle times of 6 h between loads have minimal influence on the microbiological populations and enzyme activity in subsequent loads of milk. Milk cans were used to haul raw milk (load 1), emptied, incubated at 30°C for 3, 6, 10, and 20 h, and refilled with commercially pasteurized whole milk (load 2) to measure cross-contamination. For the commercial-scale study, a single tanker was filled with milk from a farm known to have poorer quality milk (farm A, load 1), emptied, and refilled immediately (0 h) or after a delay (6 h) with milk from a farm known to have superior quality milk (farm B, load 2). In both experiments, milk samples were obtained from each farm's bulk tank and from the milk can or tanker before unloading. Each sample was microbiologically assessed for standard plate count (SPC), lactic acid bacteria (LAB), and coliform counts. Selected isolates were assessed for lipolytic and proteolytic activity using spirit blue agar and skim milk agar, respectively. The pilot-scale experiment effectively demonstrated that extended periods of idle (>3 h) of soiled hauling vessels can significantly affect the microbiological quality of raw milk in subsequent loads; however, extended idle times of 6 h or less would not measurably compromise milk

Allergic reactions to raw, pasteurized, and homogenized/pasteurized cow milk

DEFF Research Database (Denmark)

Høst, A; Samuelsson, E G

1988-01-01

Five children aged 12-40 months with IgE-mediated adverse reactions to cow milk (immediate onset clinical pattern of cow milk allergy) were orally challenged double-blind in random order with three different milk preparations processed from the same batch of milk 1) raw untreated cow milk, 2......) pasteurized cow milk, 3) homogenized and pasteurized cow milk, and 4) Nutramigen (a commercial hypoallergenic infant formula based on hydrolysed casein) as placebo. Skin prick tests with the same preparations were also performed. On oral challenge the three different processed milk types provoked significant...... and similar allergic reactions in each child, and no adverse reactions followed the challenge with placebo (Nutramigen). Skin prick test with the same milk products were positive in all children and comparable to the results with an extract of purified raw cow milk protein (Soluprick), whereas Nutramigen did...

Microbes from raw milk for fermented dairy products

NARCIS (Netherlands)

Wouters, J.T.M.; Ayad, E.H.E.; Hugenholtz, J.; Smit, G.

2002-01-01

Milk has a high nutritive value, not only For the new-born mammal and for the human consumer, but also for microbes. Raw milk kept at roam temperature will be liable to microbial spoilage. After some days, the milk will spontaneously become sour. This is generally due to the activity of lactic acid

XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK

Directory of Open Access Journals (Sweden)

Agnieszka Greń

2012-12-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1.  Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246

Determining the source of Bacillus cereus and Bacillus licheniformis isolated from raw milk, pasteurized milk and yoghurt.

Science.gov (United States)

Banykó, J; Vyletelová, M

2009-03-01

Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.

Effect of Modified Pre-Milking Sanitizing Approaches on Raw Milk Quality Obtained from the Dairy Farmers of Tawau Area, Sabah

Directory of Open Access Journals (Sweden)

Sim Kheng Yuen

2016-01-01

Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.

COMPARISON BETWEEN SOME PHYSICAL - CHEMICAL CHARACTERISTICS OF CACAO MILK AND RAW MILK

OpenAIRE

Florin Roman

2009-01-01

The paper presents a comparison between some physical - chemical characteristics of the cacao milk and of the raw milk. For this comparison we made the following determinations for both types of milk: the determination of the dry substance using the drying oven with a 102 °C temperature, the determination of the proteic substance by titration with sodium hydroxide ( NaOH ) N/10, the milk pasteurization control by the starch and potassium iodide test and the pH determination using the indicato...

Hydrolytic potential of a psychrotrophic Pseudomonas isolated from refrigerated raw milk

Directory of Open Access Journals (Sweden)

Ana Paula F. Corrêa

2011-12-01

Full Text Available The production of extracellular hydrolases by a psychrotrophic bacterium isolated from refrigerated raw milk, and identified as a Pseudomonas sp. belonging to the Pseudomonas jenssenii group, was studied. This bacterium produced proteolytic and lipolytic enzymes in all media investigated (skim milk, cheese whey, casein broth, and tryptone soy broth. High levels of α-glucosidase were produced in skim milk broth. Hydrolytic enzymes detected in skim milk broth are of particular concern, indicating that these enzymes could be produced by Pseudomonas sp. during the cold storage of raw milk, contributing to the spoilage problem in milk and dairy products.

Seasonal variation in the Dutch bovine raw milk composition

NARCIS (Netherlands)

Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.

2009-01-01

In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main

Determination of heavy metals concentration in raw sheep milk from mercury polluted area

Directory of Open Access Journals (Sweden)

Radovan Stanovič

2016-01-01

Full Text Available The paper focuses on determining the content of monitored contaminants (Cd, Cu, Hg, Pb and Zn in 53 samples of raw sheep milk collected in 2013 and 2014 on the sites Poráč and Matejovce nad Hornádom (middle Spiš. The area is characterized by historical mining and metalworking activity (mining and processing of polymetallic ores rich in Hg, Cd and Pb. Currently, the area is one of the most mercury contaminated areas in Central Europe. All statistical analyses were carried out using the statistical software Statistica 10.0 (Statsoft, USA. Descriptive data analysis included minimum value, maximum value, arithmetic mean and standard deviation. The results of the studied contaminant content show that the limit value for cadmium (10 μg.kg-1 was exceeded in 25 samples. In the case of lead, the limit value of 20 μg.kg-1 was exceeded in 16 cases. The limit value for copper (0.4 mg.kg-1 was exceeded in one case. The limit value for zinc is not defined by a legislative standard. The risk level of the studied contaminants in the samples of raw sheep milk decreases as follows: Cd > Pb > Hg > Cu > Zn. It can be concluded that frequent and long-term consumption of the raw sheep milk originating from the studied sites poses a health risk. The content of the contaminants in the milk and their eventual transition into dairy products should be monitored over a longer term in more detail. Normal 0 21 false false false CS JA X-NONE

Seasonal variation in the Dutch bovine raw milk composition.

Science.gov (United States)

Heck, J M L; van Valenberg, H J F; Dijkstra, J; van Hooijdonk, A C M

2009-10-01

In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main components and milk fatty acid composition. Milk lactose concentration was rather constant throughout the season. Milk true protein content was somewhat more responsive to season, with the lowest content in June (3.21 g/100 g) and the highest content in December (3.38 g/100 g). Milk fat concentration increased from a minimum of 4.10 g/100 g in June to a maximum of 4.57 g/100 g in January. The largest (up to 2-fold) seasonal changes in the fatty acid composition were found for trans fatty acids, including conjugated linoleic acid. Milk protein composition was rather constant throughout the season. Milk unsaturation indices, which were used as an indication of desaturase activity, were lowest in spring and highest in autumn. Compared with a previous investigation of Dutch dairy milk in 1992, the fatty acid composition of Dutch raw milk has changed considerably, in particular with a higher content of saturated fatty acids in 2005 milk.

Improved growth of preterm infants receiving mother's own raw milk compared with pasteurized donor milk.

Science.gov (United States)

Montjaux-Régis, N; Cristini, C; Arnaud, C; Glorieux, I; Vanpee, M; Casper, C

2011-12-01

To determine whether growth, feeding tolerance and infectious events of preterm infants is related to the proportion of intake of mother's own raw milk (maternal milk) versus pooled pasteurized banked breast milk (donor milk). This is a prospective observational study of 55 premature infants born less than 32 weeks of gestational age admitted to the neonatal intensive care unit at the Children's Hospital of Toulouse during two 6-month periods from 2003 to 2005. Enrolled infants were exclusively on enteral feeds with maternal milk ± donor milk. Mean gestational age was 28.6 weeks (SD 1.5) and mean birth weight 1105 grams (SD 282). During the time of exclusively breast milk feeds, weight gain (g/kg/day) was correlated to the proportion of maternal milk consumed (p = 0.0048, r = 0.4). Necrotizing enterocolitis was inversely correlated to the amount of maternal milk. The amount of maternal milk did not impact on infectious events. Mother's own raw milk improves weight gain compared with donor milk in preterm infants. Lactation strategies should be sought that helps mothers to increase their milk production. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

Prevalence, characterization, and antimicrobial resistance of Yersinia species and Yersinia enterocolitica isolated from raw milk in farm bulk tanks.

Science.gov (United States)

Jamali, Hossein; Paydar, Mohammadjavad; Radmehr, Behrad; Ismail, Salmah

2015-02-01

The aims of this study were to investigate the prevalence and to characterize and determine the antibiotic resistance of Yersinia spp. isolates from raw milk. From September 2008 to August 2010, 446 raw milk samples were obtained from farm bulk milk tanks in Varamin, Iran. Yersinia spp. were detected in 29 (6.5%) samples, out of which 23 (79.3%), 5 (17.2%), and 1 (3.4%) were isolated from cow, sheep, and goat raw milk, respectively. The most common species isolated was Yersinia enterocolitica (65.5%), followed by Yersinia frederiksenii (31%), and Yersinia kristensenii (3.4%). Of the 19 Y. enterocolitica isolates, 14 (73.7%) were grouped into bioserotype 1A/O:9, 4 (21.1%) belonged to bioserotype 1B:O8, 1 (5.3%) belonged to bioserotype 4/O:3, and 1 isolate (biotype 1A) was not typable. All the isolates of biotypes 1B and 4harbored both the ystA and ail genes. However, all the isolates of biotype 1A were only positive for the ystB gene. The tested Yersinia spp. showed the highest percentages of resistance to tetracycline (48.3%), followed by ciprofloxacin and cephalothin (each 17.2%), ampicillin (13.8%), streptomycin (6.9%), and amoxicillin and nalidixic acid (each 3.4%). All of the tested isolates demonstrated significant sensitivity to gentamicin and chloramphenicol. Recovery of potentially pathogenic Y. enterocolitica from raw milk indicates high risks of yersiniosis associated with consumption of raw milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Molecular characterization of Aspergillus fumigatus isolated from raw cow milk in Argentina: Molecular typing of A. fumigatus from raw cow milk.

Science.gov (United States)

Pena, Gabriela A; Alonso, Verónica; Manini, Marina Velasco; Pellegrino, M; Cavaglieri, Lilia R

2018-06-20

Aspergillus fumigatus, the major etiological agent of human and animal aspergillosis, is a gliotoxinogenic species into section Fumigati commonly found in contaminated animal environments. In dairy herds, exposed areas of lactating cows, as mammalian glandule, can be easily contaminated by them. This study was aimed to identify A. fumigatus sensu lato strains (identified based on morphology) isolated from raw cow milk at species level, by morphological and molecular techniques, and to estimate their genetic variability. Forty-five A. fumigatus strains showed similar RAPD profiles (generated with PELF and URP1F primers) to each other and to A. fumigatus sensu stricto reference strains; also, they were almost identical to clinical human and feed-borne A. fumigatus strains included in the assay, since their similarity coefficient ranged from 0.7 to 1.00. Therefore, all strains were characterized as belonging to A. fumigatus sensu stricto species. This result was supported by sequencing the benA gene of selected strains and by maximum parsimony analysis. In addition, RAPD fingerprinting demonstrated intra-specific genetic variability into the A. fumigatus sensu stricto cluster. The results found in this study strengthen the fact that A. fumigatus sensu stricto is the predominant species in the Aspergillus section Fumigati found in animal environments such as dairy herd environments, while other species such as A. novofumigatus, A. fumigatiaffinis, A. udagawae and A. lentulus may be rarely isolated. Since no differences between animal and human strains were observed they can become pathogenic also for farm handlers'. Moreover, the presence of A. fumigatus sensu stricto in raw cow milk is probably a very important risk factor since milk and its by-products are generally indented for human consumption, then gliotoxin could be transferred to them. Copyright © 2018. Published by Elsevier B.V.

Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China

Directory of Open Access Journals (Sweden)

Li Aijun

2016-01-01

Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.

Cow's milk and immune function in the respiratory tract

OpenAIRE

Perdijk, Olaf; Splunter, van, Marloes; Savelkoul, Huub F.J.; Brugman, Sylvia; Neerven, van, Joost

2018-01-01

During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these f...

Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.

Science.gov (United States)

Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T

2016-04-01

The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.

Behavior of Arcobacter butzleri and Arcobacter cryaerophilus in ultrahigh-temperature, pasteurized, and raw cow's milk under different temperature conditions.

Science.gov (United States)

Giacometti, Federica; Serraino, Andrea; Pasquali, Frederique; De Cesare, Alessandra; Bonerba, Elisabetta; Rosmini, Roberto

2014-01-01

The growth and survival of Arcobacter butzleri and Arcobacter cryaerophilus in milk were investigated at different storage temperatures. Three strains of each Arcobacter species were inoculated into ultrahigh-temperature (UHT), pasteurized, and raw cow's milk and stored at 4, 10, and 20°C for 6 days. The survival of Arcobacter spp. during storage was evaluated by a culture method. Results clearly showed that A. butzleri and A. cryaerophilus remained viable in milk when stored at 4°C and 10°C for a period of 6 days. When UHT and pasteurized milk were stored at 20°C, the A. butzleri count increased, with a longer lag-phase in pasteurized milk, whereas the A. cryaerophilus count increased in the first 48 h and then rapidly decreased to below the detection limit on the sixth storage day. When raw milk was stored at 20°C, the A. butzleri and A. cryaerophilus counts decreased from the first day of storage and no viable bacteria were recovered on the last day of storage. Generally, A. butzleri displayed a significantly better growth and survival capacity than A. cryaerophilus in milk. The present study is the first to assess the survival and/or growth of A. butzleri and A. cryaerophilus in milk. The evidence suggests that in case of primary contamination of milk or secondary contamination due to postprocessing contamination, milk can act as a potential source of Arcobacter infection in humans and could have public health implications, especially for raw milk consumption.

Proteolysis during ripening of Manchego cheese made from raw or pasteurized ewes' milk. Seasonal variation.

Science.gov (United States)

Gaya, Pilar; Sánchez, Carmen; Nuñez, Manuel; Fernández-García, Estrella

2005-08-01

Changes in nitrogen compounds during ripening of 40 batches of Manchego cheese made from raw milk (24 batches) or pasteurized milk (16 batches) at five different dairies throughout the year were investigated. After ripening for six months, degradation of p-kappa- and beta-caseins was more intense in raw milk cheese and degradation of alpha(s2)-casein in pasteurized milk cheese. Milk pasteurization had no significant effect on breakdown of alpha(s1)-casein. Hydrophobic peptide content did not differ between raw and pasteurized milk cheese, whereas hydrophilic peptide content was higher in raw milk cheese. There were no significant differences between seasons for residual caseins, but hydrophobic peptides were at a higher level in cheese made in autumn and winter and hydrophilic peptides in cheese made in winter and spring. Raw milk cheese had a higher content of total free amino acids and of most individual free amino acids than pasteurized milk cheese. The relative percentages of the individual free amino acids were significantly different for raw milk and pasteurized milk cheeses. The relative percentages of Lys and lie increased, while those of Val, Leu and Phe decreased during ripening. There were also seasonal variations within the relative percentages of free amino acids. In raw milk cheeses, Asp and Cys were relatively more abundant in those made in autumn, Glu and Arg in cheeses made in winter, and Lys and Ile in cheeses made in spring and summer. Biogenic amines were detected only in raw milk cheese, with the highest levels of histamine, tryptamine and tyramine in cheeses made in spring, winter and spring, respectively.

Prevalence of the pathogen microorganisms in raw cow milk

Directory of Open Access Journals (Sweden)

Angelovski Ljupco

2009-11-01

Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

Short communication: The effect of raw milk cooling on sensory perception and shelf life of high-temperature, short-time (HTST)-pasteurized skim milk.

Science.gov (United States)

Lee, A P; Barbano, D M; Drake, M A

2016-12-01

The cooling rate of raw milk may influence sensory properties and pasteurized shelf life. Under the Pasteurized Milk Ordinance for grade A milk, raw milk may be cooled instantaneously by on-farm heat exchangers but is also acceptable if "cooled to 10°C or less within four (4) hours of the commencement of the first milking." The objective of this study was to determine the effect of raw milk cooling on consumer perception and shelf life. Raw milk (18-21°C) was obtained and transported within 1h of milking to North Carolina State University (Raleigh). The batch of raw milk was split in 2 portions, and a plate heat exchanger was used to quickly cool one portion to <6°C within 1min. The second portion was stored in a jacketed bulk tank and slowly cooled over 4h to <10°C. Milk from 3 consecutive milkings was collected every 12h, with subsequent milkings added to the previous collections. The bulk milk was kept below 10°C while adding milk for the slow cool milk treatment. After 72h, each whole milk was separated; the skim milk was pasteurized at 73 or 78°C for 20 s, homogenized, and held at 4°C. Difference tests (n=75) and consumer acceptance tests (n=100) were conducted to determine if consumers could detect differences among milks. Descriptive analysis and microbial testing for aerobic, psychrotrophic, and psychrotolerant spore counts were conducted through shelf life. The entire experiment was repeated in triplicate. Raw milks averaged 3.3 logcfu/mL by aerobic plate count, <25cfu/mL coliforms, somatic cell count of 300,000 cells/mL, and 3.15±0.07% protein. Psychrotolerant spores were not found in the raw milk. Consumers could not detect differences between cooling treatments of the same pasteurization temperature or between different temperatures of the same cooling treatment. Milks reached sensory failure 49±4d on average after processing, and aerobic counts were between 5 to 7 logcfu/mL. Cooling treatment had no effect on shelf life. These results suggest

CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK

Directory of Open Access Journals (Sweden)

Lukáčová Anetta

2012-10-01

Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.

Research And Practice: Quantification Of Raw And Heat-Treated Cow Milk in Sheep Milk, Cheese And Bryndza By ELISA Method

Directory of Open Access Journals (Sweden)

Lucia Zeleňáková

2016-01-01

Full Text Available The aim of this study was to test the reliability of commercial ELISA tests (RC-bovino within raw and heat treated cow milk detection in sheep milk and cheese in order to obtain a high-quality, reliable and economically beneficial method suitable for routine application in practice. These tests were subsequently used for quantification of cow milk in commercial "Bryndza". Raw sheep milk, cow milk and heat-treated cow milk (pasteurisation at 72 °C for 15 sec or at 85 °C for 3 sec were mixed in precisely defined proportions (0 - 100% cow milk in sheep milk. The milk mixtures were sampled to detect adulteration and subsequently cheese was made. By ELISA tests was possible to determine these amounts of raw cow milk in sheep milk: 0.5% (0.2%, 5 % (4.81%, 50% (42.08% and 75% (56.52%. The pasteurized samples in different combinations gave lower optical density responses than those prepared from raw milk (by approximately 60%. In context with the above mentioned, the relationship between the real and detected amount of cow milk (% in different production stages (milk, cheese using a regression analysis was examined. However, a lower reliability of the detection was indicated by R2 values, which ranged from 0.4058 (cheese to 0.5175 (milk. In practice this means that although individual percentage (% of cow milk in the sample can be detected, but in the unknown sample it can not be clearly confirm whether the cow milk was raw or heat-treated. In this context, the results can be inaccurate and may not correspond to the real situation. Within monitoring phase of this research, 9 samples of bryndza were analysed with the results of detected cow milk ranged from 11.56% to 14.3%. The obtained results confirm that the appropriate selection of ELISA tests can become an important factor in the setting of analytical capabilities for the detection of milk and cheese adulteration.

Short communication: Microbial quality of raw milk following commercial long-distance hauling.

Science.gov (United States)

Darchuk, Emily M; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy

2015-12-01

Hauling is a critical part of the commercial milk supply chain, yet very few studies have aimed to understand its effect on raw milk quality. This study focused on the effect of extended-duration tanker use during hauling on raw milk quality at a commercial facility. Standard tanker use [cleaned-in-place (CIP) once per 24h] served as a control and an incremental between-load water rinse with sanitizer treatment (RS) was evaluated to mitigate any effect from extended duration hauling. During this study, 1 commercial truck with 2 trailers was monitored for 10d. The truck collected milk at a large dairy farm, transported the milk to a manufacturing facility, and then returned to the same farm for a second load. Each round-trip journey took between 10 and 12h, allowing for 2 loads per 24-h use period. Following the second delivery, the truck was cleaned by CIP treatment starting a new treatment day. Producer samples were collected from the raw milk bulk tank on the farm before loading milk into the tanker. The same milk was sampled directly out of the tanker truck before unloading at the manufacturer. Effect on individual bacteria count, thermophilic spore count, and preliminary incubation count was quantified through common industry tests. Surface sponge swabs were also used to monitor tanker sanitation and the efficacy of cleaning treatments. Results did not identify a negative effect on raw milk quality due to extended duration hauling. Whereas the addition of RS did not provide any measurable quality benefits for the microbial milk quality, swab results demonstrated that the RS treatment was able to reduce surface bacteria in the tanker, although not to the same level as the full CIP treatment. Based on this study, current CIP practices for long distance milk hauling appear to be effective in mitigating any measurable effect on raw milk quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source

Directory of Open Access Journals (Sweden)

T Moshtaghi Maleki

2015-11-01

Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.

Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

OpenAIRE

Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.

2012-01-01

Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...

Milk consumption and lactose intolerance in adults.

Science.gov (United States)

Qiao, Rong; Huang, ChengYu; Du, HuiZhang; Zeng, Guo; Li, Ling; Ye, Sheng

2011-10-01

To investigate relations between milk consumption and lactose intolerance (LI) in adults and to explore the effect of milk consumption on lactase activity. Total of 182 subjects aged 20-70 years were recruited and interviewed by questionnaires, and their accumulative cow's milk intake (AMI) was calculated. LI was evaluated by hydrogen breath test (HBT). A negative correlation was found between AMI and severity of observed LI symptom (r=-0.2884; P<0.05). Binary logistic regression analysis showed a negative correlation between LI and duration and frequency of milk consumption (OR, 0.317 and 0.465, respectively; both P<0.05) and a positive correlation between LI and amount of milk consumed per sitting (OR, 6.337; P<0.05). LI is related to various milk consumption behaviors. Most Chinese adults with LI may tolerate moderate milk consumption <160 mL. Copyright © 2011 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

Haptoglobin and serum amyloid A in bulk tank milk in relation to raw milk quality.

Science.gov (United States)

Akerstedt, Maria; Waller, Karin Persson; Sternesjö, Ase

2009-11-01

The aim of the present study was to evaluate relationships between the presence of the two major bovine acute phase proteins haptoglobin (Hp) and serum amyloid A (SAA) and raw milk quality parameters in bulk tank milk samples. Hp and SAA have been suggested as specific markers of mastitis but recently also as markers for raw milk quality. Since mastitis has detrimental effects on milk quality, it is important to investigate whether the presence of Hp or SAA indicates such changes in the composition and properties of the milk. Bulk tank milk samples (n=91) were analysed for Hp, SAA, total protein, casein, whey protein, proteolysis, fat, lactose, somatic cell count and coagulating properties. Samples with detectable levels of Hp had lower casein content, casein number and lactose content, but higher proteolysis than samples without Hp. Samples with detectable levels of SAA had lower casein number and lactose content, but higher whey protein content than samples without SAA. The presence of acute phase proteins in bulk tank milk is suggested as an indicator for unfavourable changes in the milk composition, e.g. protein quality, due to udder health disturbances, with economical implications for the dairy industry.

Real-time PCR detection of Paenibacillus spp. in raw milk to predict shelf life performance of pasteurized fluid milk products.

Science.gov (United States)

Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J

2012-08-01

Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.

Proteolysis produced within biofilms of bacterial isolates from raw milk tankers.

Science.gov (United States)

Teh, Koon Hoong; Flint, Steve; Palmer, Jon; Andrewes, Paul; Bremer, Phil; Lindsay, Denise

2012-06-15

In this study, six bacterial isolates that produced thermo-resistant enzymes isolated from the internal surfaces of raw milk tankers were evaluated for their ability to produce proteolysis within either single culture biofilms or co-culture biofilms. Biofilms were formed in an in vitro model system that simulated the upper internal surface of a raw milk tanker during a typical summer's day of milk collection in New Zealand. The bacterial isolates were further evaluated for their ability to form biofilms at 25, 30 and 37°C. Mutual and competitive effects were observed in some of the co-culture biofilms, with all isolates being able to form biofilms in either single culture or co-culture at the three temperatures. The proteolysis was also evaluated in both biofilms and corresponding planktonic cultures. The proteolysis per cell decreased as the temperature of incubation (20-37°C) increased. Furthermore, mutualistic interactions in terms of proteolysis were observed when cultures were grown as co-culture biofilms. This is the first study to show that proteolytic enzymes can be produced in biofilms on the internal surfaces of raw milk tankers. This has important implications for the cleaning and the temperature control of raw milk transport tankers. Copyright © 2012 Elsevier B.V. All rights reserved.

Essential elements, cadmium, and lead in raw and pasteurized cow and goat milk

Energy Technology Data Exchange (ETDEWEB)

Lopez, A.; Collins, W.F.; Williams, H.L.

1985-08-01

Fifteen essential elements plus cadmium and lead were determined in raw and pasteurized cow and goat milks by atomic absorption spectrophotometry. When results were compared on a wet weight basis, there were no significant differences between the raw and pasteurized milks except for cobalt, iron, and lead in goat milk. When copper in goat milk was expressed on a dry weight basis, there was a significant difference between raw and pasteurized milk. There were significantly higher amounts of cobalt, copper, iron, lead, magnesium, and phosphorus, wet weight basis, in pasteurized goat milk than in pasteurized cow milk. Significantly more nickel and sodium were in pasteurized cow milk. No difference in the content of chloride, calcium, potassium, and zinc was significant between the two milks. When dry weights of the two milks were compared, statistical differences were the same, except there was significantly more calcium and potassium in pasteurized cow milk than in pasteurized goat milk and there were no significant differences in the content of lead and phosphorus between the two milks. Percentages of the established and estimated recommended daily allowances show both cow and goat milk to be excellent sources of calcium, phosphorus, and potassium and fair sources of iron, magnesium, and sodium.

Quality control of raw cows' milk by headspace analysis

NARCIS (Netherlands)

Hettinga, K.A.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.

2008-01-01

This study investigated whether headspace analysis of volatile components can be used for monitoring the quality of raw cows¿ milk. The detection of different quality defects caused by cows¿ feed, microbiological and chemical contamination, as well as enzymatic deterioration was studied. Fresh raw

Verocytotoxin-producing Escherichia coli O26 in raw water buffalo (Bubalus bubalis) milk products in Italy.

Science.gov (United States)

Lorusso, Vanessa; Dambrosio, Angela; Quaglia, Nicoletta Cristiana; Parisi, Antonio; La Salandra, Giovanna; Lucifora, Giuseppe; Mula, Giuseppina; Virgilio, Sebastiano; Carosielli, Leonardo; Rella, Addolorata; Dario, Marco; Normanno, Giovanni

2009-08-01

Escherichia coli 026 is known as a verocytotoxin-producing E. coli (VTEC) organism that causes severe foodborne diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Although cattle are the most important reservoir of VTEC, only a few reports on the role of water buffalo (Bubalus bubalis) as a reservoir of VTEC and on the presence of these organisms in their milk are available. However, in Southern Italy, where water buffalo are intensively reared, an outbreak of hemolytic uremic syndrome due to E. coli 026 has recently been reported, in which the consumption of typical dairy products was considered to be a common risk factor. The aims of this work were to assess the prevalence of E. coli O26 in raw water buffalo milk, to characterize the virulence gene profiles of the isolates, and to evaluate their phenotypic antimicrobial resistance pattern. Of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O26, and the isolate showed the stx1+/stx2+/eae-/hlyA+ genotypic profile. The strain showed resistance against glycopeptides, macrolides, and penicillins. The presence of VTEC organisms in raw water buffalo milk could be considered to be a potential threat to consumers; however, the strict adherence to the processes used in the preparation of the most common buffalo dairy products could strongly mitigate the foodborne risk. To our knowledge, this article reports the first isolation and characterization of E. coli O26 VTEC in raw water buffalo milk.

THE DIRECT SALE OF RAW MILK: PREVALENCE OF PATHOGENS IN RAW MILK AND BOVINE FAECES COLLECTED IN FARMS WITHIN THE PROVINCE OF PESARO-URBINO

Directory of Open Access Journals (Sweden)

F. Tonucci

2009-09-01

Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.

Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

Science.gov (United States)

Eftekhari, Mohsen; Mosavari, Nader

2016-12-01

Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar

Directory of Open Access Journals (Sweden)

A.R Barami

2012-02-01

Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p

Composition of raw cow milk and artisanal yoghurt collected in ...

African Journals Online (AJOL)

The composition of milk is of most importance to the dairy industry and human health. This study was conducted to provide data on the composition of raw cow milk and artisanal yoghurt collected in Maroua (Cameroon). Milk and yoghurt samples were collected from 11 breeding sites and 12 producers in the city of Maroua, ...

Gravity separation of fat, somatic cells, and bacteria in raw and pasteurized milks.

Science.gov (United States)

Caplan, Z; Melilli, C; Barbano, D M

2013-04-01

The objective of experiment 1 was to determine if the extent of gravity separation of milk fat, bacteria, and somatic cells is influenced by the time and temperature of gravity separation or the level of contaminating bacteria present in the raw milk. The objective of experiment 2 was to determine if different temperatures of milk heat treatment affected the gravity separation of milk fat, bacteria, and somatic cells. In raw milk, fat, bacteria, and somatic cells rose to the top of columns during gravity separation. About 50 to 80% of the fat and bacteria were present in the top 8% of the milk after gravity separation of raw milk. Gravity separation for 7h at 12°C or for 22h at 4°C produced equivalent separation of fat, bacteria, and somatic cells. The completeness of gravity separation of fat was influenced by the level of bacteria in the milk before separation. Milk with a high bacterial count had less (about 50 to 55%) gravity separation of fat than milk with low bacteria count (about 80%) in 22h at 4°C. Gravity separation caused fat, bacteria, and somatic cells to rise to the top of columns for raw whole milk and high temperature, short-time pasteurized (72.6°C, 25s) whole milk. Pasteurization at ≥76.9°C for 25s prevented all 3 components from rising, possibly due to denaturation of native bovine immunoglobulins that normally associate with fat, bacteria, and somatic cells during gravity separation. Gravity separation can be used to produce reduced-fat milk with decreased bacterial and somatic cell counts, and may be a critical factor in the history of safe and unique traditional Italian hard cheeses produced from gravity-separated raw milk. A better understanding of the mechanism of this natural process could lead to the development of new nonthermal thermal technology (that does not involve heating the milk to high temperatures) to remove bacteria and spores from milk or other liquids. Copyright © 2013 American Dairy Science Association. Published by

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

[Investigation of gestagenic effect of raw drone milk in rats].

Science.gov (United States)

Seres, Adrienn; Ducza, Eszter; Gáspár, Róbert

2014-01-01

Numerous honeybee products are used in traditional medicine. The best-known honeybee products are the honey, the propolis and the royal jelly. Drone milk is a relatively little-known honeybee product. Although, drone milk is traditionally used to treat infertility and to promote vitality in both men and women in certain countries, the literature furnishes no information concerning effects of the drone milk. The oestrogenic and androgenic effects of drone milk have recently been reported in rats and the effective compounds have also been identified. The aim of this study was to determine the putative gestagenic effect of raw drone milk in rats. Maintenance of pregnancy assays revealed that drone milk was able to increase the number of surviving fetuses. This results suggested some gestagenic effects. This effect was confirmed by RT-PCR and Western blot methods in which the mRNA and protein expressions of gestagen-dependent CRLR (Calcitonin Receptor-Like Receptor) peptide were determined. To determine the efficacy of gestagenic effect of drone milk, spironolactone (weak gestagen compound) was used. The combination of drone milk and spironolactone showed more potent gestagenic effect. These results lead us to suppose that raw drone milk shows weak gestagenic effect and this effect can be increased by another weak gestagen. Further studies are required to clarify the gestagenic mechanisms of action of drone milk.

Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

OpenAIRE

Olaf Perdijk; Marloes van Splunter; Huub F. J. Savelkoul; Sylvia Brugman; R. J. Joost van Neerven; R. J. Joost van Neerven

2018-01-01

During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these f...

RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION

Directory of Open Access Journals (Sweden)

S. Gallina

2010-06-01

Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.

Importance of Decision Support Systems About Food Safety in Raw Milk Production

Directory of Open Access Journals (Sweden)

Ecem Akan

2015-12-01

Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.

Assessment of raw milk quality and stakeholders' awareness on milk-borne health risks in Arusha City and Meru District, Tanzania.

Science.gov (United States)

Ngasala, J Uma Bukuku; Nonga, Hezron Emmanuel; Mtambo, Mkumbukwa Madundo Angelo

2015-06-01

A cross-sectional study was conducted to assess the quality of raw milk and stakeholders' awareness on milk-borne health risks and factors for poor milk hygiene in Arusha City and Meru District, Tanzania between October and December 2012. A total of 105 smallholder dairy farmers, milk vendors and milk retailers were interviewed, and milk samples were collected for physical, microbial and antibiotic residue analysis using standard procedures. Questionnaire results indicated high level of awareness (94 %) that drinking raw milk can predispose consumers to milk-borne diseases; nevertheless, 65 % of respondents consumed raw milk. Physicochemical analyses showed some of the milk had sediments (20 %), bad smell (21 %) and had clotted on alcohol test (27 %). About 36 % of milk samples had pH below 6.6, and 25 % had specific gravity below 1.028 g/ml. The mean total viable count (TVC) of milk from vendors is significantly (P milk samples assessed had a higher TVC than the level recommended (2.0 × 10(5) cfu/ml) by the East African Community (EAC) standards. Up to 91 % of the milk samples had bacterial growth that included Eschericia coli (66 %), Staphylococcus aureus (33 %), Corynebacterium (11 %) and Pseudomonas (10 %). All smallholder dairy farmers were aware of drug residues, but majority (57 %) were unaware of human health effects caused by veterinary drug residues in milk. Up to 97 % of respondents reported to comply with drug withdrawal periods. This possibly led to all milk samples analysed to be negative from detectable levels of antibiotic residues. It is concluded that the level of awareness on milk quality is high, although practices associated with milking and post-harvest handling predispose milk to bacterial contamination which is a public health risk to milk consumers.

Short communication: Microbiological quality of raw cow milk and its association with herd management practices in Northern China.

Science.gov (United States)

Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q

2017-06-01

Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Encephalitozoon cuniculi in Raw Cow's Milk Remains Infectious After Pasteurization.

Science.gov (United States)

Kváč, Martin; Tomanová, Vendula; Samková, Eva; Koubová, Jana; Kotková, Michaela; Hlásková, Lenka; McEvoy, John; Sak, Bohumil

2016-02-01

This study describes the prevalence of Encephalitozoon cuniculi in raw cow's milk and evaluates the effect of different milk pasteurization treatments on E. cuniculi infectivity for severe combined immunodeficient (SCID) mice. Using a nested polymerase chain reaction approach, 1 of 50 milking cows was found to repeatedly shed E. cuniculi in its feces and milk. Under experimental conditions, E. cuniculi spores in milk remained infective for SCID mice following pasteurization treatments at 72 °C for 15 s or 85 °C for 5 s. Based on these findings, pasteurized cow's milk should be considered a potential source of E. cuniculi infection in humans.

Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

Directory of Open Access Journals (Sweden)

afshin Nazari

2007-10-01

Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

Milk production, raw milk quality and fertility of dromedary camels (Camelus Dromedarius) under intensive management.

Science.gov (United States)

Nagy, Péter; Thomas, Sonia; Markó, Orsolya; Juhász, Jutka

2013-03-01

In many arid countries, dromedaries play an important role as a milk source in rural areas. However, the milk and meat production potential of this species is not well understood and documented. A large-scale camel dairy farm was established in 2006 in the United Arab Emirates. This study summarises the most important data on milk production, raw milk quality and reproductive efficiency collected on this farm during the first three years of operation. The average daily milk production, the mean length of lactation and the mean total milk production per lactation of 174 dromedaries were 6.0 ± 0.12 kg (± SEM), 586 ± 11.0 days (± SEM) and 3314 ± 98.5 kg (± SEM), respectively. The lactation curve reached its peak during the 4th month after parturition (mean ± SEM, 8.9 ± 0.04 kg), then it declined gradually, falling to 50% of the maximum by the 16th month postpartum (mean ± SEM, 4.3 ± 0.06 kg). Milking three times a day did not increase daily milk production compared to two times milking. Mean total viable bacterial count (TVC) and mean somatic cell count (SCC, ± SEM) of bulk raw camel milk were 4,403 ± 94 CFU/cm3 and 392,602 ± 5,999 cells/cm3 for a one-year period, respectively. There was a significant difference among months (P fat, protein, lactose, total solids (TS) and solid-non-fat (SNF) concentrations of individual milk samples were 2.51 ± 0.03%, 2.60 ± 0.01%, 4.03 ± 0.03%, 9.98 ± 0.03% and 7.56 ± 0.03%, respectively. Lactation period, average daily milk production and morning vs. evening milking significantly influenced milk chemical composition. For the 470 camels in the breeding programme, end-of-season pregnancy rate and birth rate were 87.0% and 82.6%, respectively, after natural mating. We have demonstrated that sustainable milk production is possible from a traditional species, the dromedary camel, under an intensive management system.

The effect of raw milk microbial flora on the sensory characteristics of salers-type cheeses

OpenAIRE

Callon, Cecile; Berdagué, Jean-Louis; Montel, Marie-Christine

2005-01-01

The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial cou...

Viscosity and Analytical Differences between Raw Milk and UHT Milk of Czech Cows

Directory of Open Access Journals (Sweden)

Kumbár V.

2015-06-01

Full Text Available Viscosity and analytical differences in four milk samples from Czech cows were described. Three samples of UHT milk (0.5%, 1.5%, and 3.5% fat and one sample of raw milk from a Czech bio-farm were analyzed. The following analytical properties were observed: titratable acidity, fat content, dry matter content, and protein content. Titratable acidity and dry matter content decreased in dependence upon the increasing milk fat content. The protein content ranged 3.51-3.57 g per 100 g milk. The milk flow behaviour represented by density, dynamic and kinematic viscosity, as well as the dependence of the milk flow behaviour on temperature were investigated. These properties were measured using a digital densitometer and a rotary viscometer. Milk density was studied at temperatures ranging 0-60 °C and dynamic viscosity at 0-100 °C. With increasing temperature, the density and dynamic viscosity of the studied milk samples decreased. The temperature dependence of dynamic viscosity was manifested in all samples. Kinematic viscosity was calculated from experimental data. Furthermore, mathematical models using Power law and Gaussian fitting were constructed. Determination coefficients achieved high values (0.843-0.997.

Evaluation of biogenic amines and microbial counts throughout the ripening of goat cheeses from pasteurized and raw milk.

Science.gov (United States)

Novella-Rodríguez, Sonia; Veciana-Nogués, M Teresa; Roig-Sagués, Artur X; Trujillo-Mesa, Antonio J; Vidal-Carou, M Carmen

2004-05-01

The effect of the hygienic quality of milk on changes in microbial counts and biogenic amine content was evaluated during ripening of goat cheeses manufactured from pasteurized and raw milks at 1, 14, 30, 60 and 90 d. The original milk, rennet, curd and whey were also included in the study. The pH, salt content and extent of proteolysis in the cheese were also evaluated. Spermidine and spermine were the main amines in raw milk, while they were minor amines in cheeses. Other amines increased markedly during ripening, tyramine being the main amine in cheese made from raw milk and cadaverine and putrescine in those produced from pasteurized milk. Enterobacteriaceae counts decreased during ripening whereas those of lactic acid bacteria increased, especially lactobacilli and enterococci. Cheese made from raw milk showed higher microbial counts during ripening than those made from pasteurized milk, especially for Enterobacteriaceae and enterococci, counts being 2 or 3 log units higher. Raw milk cheese showed remarkably higher biogenic amines compared with pasteurized milk cheeses. Therefore, pasteurization of milk causes a decrease in final biogenic amine content of cheese as a result of the reduction of its microbial counts.

Comparative analysis of the microbial communities in raw milk produced in different regions of Korea.

Science.gov (United States)

Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung

2017-11-01

The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.

Seasonal variability of thermophilic Campylobacter spp. in raw milk sold by automatic vending machines in Lombardy Region

Directory of Open Access Journals (Sweden)

Barbara Bertasi

2016-06-01

Full Text Available In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1% in different months during the three years considered. The statistical analysis showed a significant difference (PCampylobacter spp. between warmer and cooler months (2.3 vs 0.6%. The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

Science.gov (United States)

Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

2017-07-01

Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

Theory of Reasoned Action predicts milk consumption in women.

Science.gov (United States)

Brewer, J L; Blake, A J; Rankin, S A; Douglass, L W

1999-01-01

To determine the factors influencing the consumption or avoidance of milk in women. One hundred women completed food frequency questionnaires and a milk attitudes questionnaire framed within the Theory of Reasoned Action and performed sensory evaluations of different milk samples. Differences among milk types were assessed using 2-way analysis of variance and least-significant-difference mean comparison procedures. Correlation and multiple regression analyses, and standardized partial regression coefficients, were used to determine the contribution of each component of the model in predicting behavior. Mean age of the 100 subjects was 39 years (range = 20-70 years). Milk consumption among subjects was low; 23 subjects indicated that they seldom or never drank milk. Data from the dairy frequency questionnaire showed that the primary milk for 42%, 36%, 27%, and 18% of the milk drinkers was skim, 2%, 1%, and whole, respectively (subjects could indicate more than 1 type of milk consumed). The Theory of Reasoned Action indicated that health and familiarity belief items were most associated with attitudes toward milk consumption. Skim milk had significantly lower scores for taste and texture belief items than 1%, 2%, and whole milk (P reasons other than beliefs about taste and texture or actual sensory preference. This study identifies important factors contributing to milk consumption such as beliefs, attitudes, and sensory evaluation, which can be used to develop a specific framework in which to examine other components of milk consumption behavior.

The freezing point of raw and heat treated sheep milk and its variation during lactation

Directory of Open Access Journals (Sweden)

Bohumíra Janštová

2013-01-01

Full Text Available The freezing point of milk is an important indicator of the adulteration of the milk with water, but heat treatment may also affect its value. The aim of this study was determine freezing point of raw and heat treated sheep milk and its variation during lactation. The freezing point was determined in 42 bulk tank raw sheep milk samples and 42 pasteurized milk samples collected during lactation of sheep at one ecofarm in Moravian Walachia (Valašsko in the Czech Republic. The freezing point was determined in accordance with the standard ČSN 57 0538 using a thermistor cryoscope. The average freezing point of raw milk was -0.617 ± 0.052 °C, with a range from -0.560 to -0.875 °C. The freezing point was lower in the first months of lactation and increased at the end of lactation. The freezing point correlated (r = 0.8967 with the content of total non-fat solids. The average freezing point of sheep milk pasteurized at 65 °C for 30 min was -0.614 ± 0.053 °C, with a range from -0.564 to -0.702 °C. The median of freezing point differences between raw and pasteurized milk was 0.004 °C. Our study extends data about physico-chemical properties of sheep milk and registers for the first time specific changes in the freezing point value of sheep milk by heating.

Invasive human brucellosis infection in travelers to and immigrants from the Horn of Africa related to the consumption of raw camel milk.

Science.gov (United States)

Rhodes, Heather M; Williams, David N; Hansen, Glen T

2016-01-01

Brucellosis is the commonest zoonosis worldwide and typically results from ingestion of unpasteurized goat and sheep milk and cheese. Consumption of camel milk is common in the Middle East and the Horn of Africa, but is an infrequently reported source of brucellosis. We report three immigrant patients seen in one hospital system between 2007 and 2013 with brucellosis due to the consumption of camel milk. The case patients presented after 3-14 days of symptoms following travel to countries where Brucella is endemic. All three patients were bacteremic. One patient had definite infective endocarditis, one had possible endocarditis and one patient presented with acute brucellosis. The diagnoses were made expeditiously and appropriate treatment initiated. Knowledge of travel, local customs and immigration patterns are keys to early Brucella diagnosis and optimal treatment. Previous reports implicating camel milk as the source of Brucella infection have been limited to patients living in or traveling to and from the Middle East. This report highlights the acquisition of Brucella infection in travelers to and immigrants from the Horn of Africa related to the consumption of camel milk. Copyright © 2016. Published by Elsevier Ltd.

Quality aspects of raw goat milk in Lower Southern Thailand

OpenAIRE

Siriwat Wasiksiri; Usa Chethanond; Sahutaya Pongprayoon; Somjit Srimai; Bunjob Nasae

2010-01-01

This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05) on pH and total plate count among samples from eachfarm. However...

CONTRIBUTION TO THE DEBATE ON THE MICROBIOLOGICAL QUALITY OF RAW MILK FROM VENDING MACHINES

Directory of Open Access Journals (Sweden)

Ján Šnelcer

2011-07-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE MicrosoftInternetExplorer4 Microbiological quality or raw milk from vending maschine was analyzed in this work. Despite the pathogenic bacteria may be present in raw milk, the analyses and evaluations were focused to bacterial indicators only. Refer to total bacterial counts, the criterion ≤ 100,000 cfu/ml met 12 from 15 samples (80% and all samples complied with the supplementary criterion of 5×104 cfu/ml for psychrotrophs. Numbers of coagulase-positive staphylococci ranged closely around the average value 2.9×102 cfu/ml. Average numbers of coliforms and E. coli in raw milk were found 4.34 ± 0.42 and 3.25 ± 0.83 log CFU/ml, respectively. These values significantly exceeded even the limits applicable in the past. On the basis of unchanged numbers of these bacteria in milk after 24 h at 6 °C, we assume that the high numbers of coliforms and E. coli present in milk are the result of fecal contamination and not growth. As E. coli is an indicator of faecal contamination of raw milk comprising the possible presence of Salmonella sp. Campylobacter sp. and other pathogens, microbiological survey suggested appropriate preventive measures that should be applied in terms of risk management.doi:10.5219/98

RAW MILK AT VENDING MACHINES: EVALUATION OF E. SAKAZAKII, COXIELLA BURNETII AND M. PARATUBERCULOSIS IN PIEDMONT EXPERIENCE

Directory of Open Access Journals (Sweden)

S. Gallina

2009-12-01

Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.

Impact of applying hygienic practices at farm on bacteriological quality of raw milk

Directory of Open Access Journals (Sweden)

N. Pandey

2014-09-01

Full Text Available Aim: The present study was carried out to explore the potential source of contamination and the efficacy of different washing practices towards quality milk production. Materials and Methods: Probable sources of contamination viz. stored water, potable water, milker’s hands, milking pail, udder of individual buffalo and milk cans were subjected to different types of bacterial counts before the actual experiment to start. Twenty milch buffaloes thereafter were divided randomly into four treatment groups where washing was performed in each step viz. milker hands, udder of individual buffalo, milking pail and milk cans before milking either with water (T0: stored water, T1: potable water or sanitizers (T2: 200 ppm chlorine solution, T3: 50 ppm iodophore solution for 60 days. Bacterial counts again were performed for last 5 alternate days for all the sources involved along with the microbial load of raw milk. Data obtained were subjected to standard statistical analysis. Results: It was found that for all bacterial count stored water contributed significantly higher as compared to the potable water. Among the other potential sources of contamination (log/6 cm2, standard plate count (SPC and coliform count were significantly highest for milking pail (6.73±0.02 and udder of milch buffaloes (3.77±0.12, respectively, while for Staphylococci count both milking pail (3.24±0.02 and milking can (3.22±0.04 were contributed maximally (p0.05 for most of the parameters, even for the raw milk quality. Conclusion: Study revealed that milker hands, milking pails, udder of animals, milk cans and stored water used for washing of equipment are the potential source of contamination in raw milk. These were counted as critical point which needs attention for the production of high-quality milk. Potable water was found to be better than stored water. The use of either chlorine 200 ppm and iodophor 50 ppm is highly effective in reducing the bacterial population for

Surveillance of bulk raw and commercially pasteurized cows' milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis.

Science.gov (United States)

O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat

2004-09-01

Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.

Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.

Science.gov (United States)

Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J

2008-04-01

Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.

Spoilage potential of Paenibacillussp. in Brazilian raw milk

Directory of Open Access Journals (Sweden)

José Carlos Ribeiro Júnior

2016-04-01

Full Text Available ABSTRACT: Bacterial spores are widespread in the environment and can contaminate milk. Spores are resistant to thermal conditions and your germination reduces milk shelf-life because the aerobic bacteria that are sporulated produce proteases and lipases. The aim of this study was identify Paenibacillus sp., the spoilage microbiota, arising from the germination of spores in raw milk and your spoilage potential. Twenty different milk samples were treated at 80°C/12min and plated to isolate spore-forming bacteria. These strains were picked in milk agar and tributyrin agar for verification of their potential proteolytic and lipolytic activities, respectively. Amplification and sequencing of the 16S rRNA gene of the strains for identification by similarity to the DNA sequences deposited in GenBank was performed. One hundred and thirty-seven isolates were obtained, of which 40 (29.2% showed spoilage activity for milk. Of these, three (7.5% were identified as strains of Paenibacillus sp., and all were lipolytic. Paenibacillus sp. have been identified as primarily responsible for the spoilage of pasteurized milk with a long shelf-life in other countries. To increase the shelf-life of Brazilian pasteurized milk, it is important to identify the sporulated microbes to determine their origin and to control the contamination of milk by vegetative forms such as spores.

Fatty acid profile and health lipid indices in the raw milk of ...

African Journals Online (AJOL)

qw-k

2015-02-26

Feb 26, 2015 ... in the raw milk of Simmental and Holstein-Friesian cows from an organic farm. ... as an important source of energy, high-quality protein and essential ... Nevertheless, inter-breed differences in the milk fat composition were ...

ELECTROLYTE AND MINERAL COMPOSITION OF TERM DONOR HUMAN MILK BEFORE AND AFTER PASTEURIZATION AND OF RAW MILK OF PRETERM MOTHERS.

Science.gov (United States)

Codo, Carla Regina Bianchi; Caldas, Jamil Pedro de Siqueira; Peixoto, Rafaella Regina Alves; Sanches, Vitor Lacerda; Guiraldelo, Tamara Cristina; Cadore, Solange; Marba, Sérgio Tadeu Martins

2018-02-22

To determine and compare the concentrations of electrolytes and minerals in three different types of maternal milk samples: term donor milk before pasteurization, term donor milk after pasteurization and raw milk of mothers of preterm newborns at bedside. Descriptive cross-sectional study. Concentrations of calcium (Ca), phosphorous (P), magnesium (Mg), sodium (Na) and potassium (K) were measured in random samples of three human breast milk groups. Samples were analyzed using acid mineralization assisted by microwave radiation and further analysis by inductively coupled plasma optical emission spectrometry. Concentrations were expressed in mg/L, described as mean and standard deviation. The one-way ANOVA and Tukey's post-test were applied to determine the variability between the means of each group. Significance level was set at 5%. There was a significant reduction in the content of Ca (259.4±96.8 vs. 217.0±54.9; p=0.003), P (139.1±51.7 vs. 116.8±33.3; p=0.004) and K (580.8±177.1 vs. 470.9±109.4; ppasteurization. Samples of raw milk presented higher contents of Na than the donated milk (twice). The elements P and Ca would only reach the daily intake levels recommended by the European Society of Pediatric Gastroenterology, Hepatology and Nutrition if at least 60 mL of milk could be offered every 3 hours. Mg levels were not different between the three groups. There was a significant reduction in Ca, P and K levels in samples after pasteurization. The Na value in raw milk, collected at bedside, was higher than in the samples of donor's milk before pasteurization.

Analysis of the Kanamycin in Raw Milk Using the Suspension Array

Directory of Open Access Journals (Sweden)

Yanfei Wang

2013-01-01

Full Text Available With the monoclonal antibody against kanamycin being prepared successfully, a bead-based indirect competitive fluorescent immunoassay was developed to detect kanamycin in milk. The fact that there was no significant cross-reaction with other aminoglycoside antibiotics implied that the monoclonal antibody was highly specific for kanamycin. The limit of detection (LOD and the 50% inhibition concentration (IC50 in raw milk were 3.2 ng/mL and 52.5 ng/mL, respectively. Using the method developed in this study, the kanamycin concentrations were monitored in raw milk after the intramuscular administration of kanamycin in sick cows. Compared to the conventional enzyme-linked immunosorbent assay (ELISA, the method using the suspension array system was more sensitive. The results obtained in the present study showed a good correlation with that of the ELISA.

Seasonal Variability of Thermophilic Campylobacter Spp. in Raw Milk Sold by Automatic Vending Machines in Lombardy Region.

Science.gov (United States)

Bertasi, Barbara; Losio, Marina Nadia; Daminelli, Paolo; Finazzi, Guido; Serraino, Andrea; Piva, Silvia; Giacometti, Federica; Massella, Elisa; Ostanello, Fabio

2016-06-03

In temperate climates, a seasonal trend was observed in the incidence of human campylobacteriosis cases, with peaks reported in spring and autumn in some countries, or in summer in others; a similar trend was observed in Campylobacter spp. dairy cattle faecal shedding, suggesting that cattle may play a role in the seasonal peak of human infection. The objectives of this study were to assess if a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk exists and to evaluate a possible relation between this and the increase of human campylobacteriosis incidence in summer months. The results showed a mean prevalence of 1.6% of milk samples positive for thermophilic Campylobacter spp. with a wide range (0.0-3.1%) in different months during the three years considered. The statistical analysis showed a significant difference (P<0.01) of the prevalence of positive samples for thermophilic Campylobacter spp. between warmer and cooler months (2.3 vs 0.6%). The evidence of a seasonal trend in thermophilic Campylobacter spp. contamination of raw milk sold for direct consumption, with an increase of the prevalence in warmer months, may represent one of the possible links between seasonal trend in cattle faecal shedding and seasonal trend in human campylobacteriosis.

Evaluation of the Influence of Frequency of Milk Collection and Milking Dayshift on the Microbiological Quality of Raw Milk

Directory of Open Access Journals (Sweden)

Lucía Reguillo

2018-01-01

Full Text Available The aim of this study was to analyze the influence of milk collection frequency (24 h versus 48 h and milking dayshift (morning and evening on total mesophilic aerobic bacteria (MAB and psychrotrophic bacteria (PSY counts in raw milk samples. MAB counts were determined by flow cytometry (BactoScan and PSY counts by the plate counting agar method. An univariate statistical analysis was performed to find out significant differences among the studied factors. Results obtained showed that collecting milk every 24 h was effective in reducing MAB and PSY counts by 32 and 18%, respectively, compared to 48 h milk collection. This positive impact allowed reducing up to 4°C the temperature of the heat treatment in the dairy industry, thus involving energy savings of 22%. Milking during the mornings showed a significant reduction of MAB counts in comparison to milking performed during the evenings (P<0.05. These results are highly useful for the improvement of milk quality through the optimization of collection and milking systems set at primary production.

Milk Enhancements Improve Milk Consumption and Increase Meal Participation in the NSLP: The School Milk Pilot Test

Science.gov (United States)

Rafferty, Karen; Zipay, Diane; Patey, Camellia; Meyer, Jennifer

2009-01-01

Purpose/Objectives: The objective of the School Milk Pilot Test and the Westside School Milk Pilot Study was to test the effect of a milk enhancement initiative to make milk more appealing and attractive to elementary and secondary school students and to improve milk consumption. Methods: 146 schools participated in the national School Milk Pilot…

Bacteriological quality of raw camel milk along the market value chain in Fafen zone, Ethiopian Somali regional state.

Science.gov (United States)

Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu

2016-05-26

The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

DEVELOPMENT OF MILK CONSUMPTION AND MARKETING ANALYSIS OF ITS DEMAND

Directory of Open Access Journals (Sweden)

Marta Habánová

2012-12-01

Full Text Available The strategy of most households is to eliminate the negative effects of economic changes related mainly to the economic crisis by mobilizing available resources and reducing costs, but which cloud lead to a decrease in food consumption and changes in consumption patterns. Pensions and prices are factors that shape the demand for food and other estates. Both of these factors guarantee the economic viability of nutrition. Paper analyzes the development of the of milk consumption and level of its substitution by milk products. There was quantified the elasticity of demand and  estimated own price elasticity and income elasticity. For the past 17 years, consumption of milk, except cheese, cottage cheese, sour milk products and butter, decreased. Expressed by linear regression model in recent years (since 1995 in Slovakia occurred overall reduction in the consumption of milk and dairy products by an average of 0.988 kg per capita per year. This development was mainly conditioned by the annual descent of demand for milk, as its consumption with little variation in average decreased annually by up to 1.88 kg per capita. This development is largely due to the increase of milk prices and especially the increasing supply of a wide range of quality and flavored sour milk and cheese products. Acidified milk product consumption in recent observed years increased and is expressed by the average growth factor of 0.6748 kg per capita per year. Prognosis with a five percent risk of error of estimate could increase their consumption up to 13.936 kg per capita in 2014. Consumption of cheese and curd should the increase the current trend by an average of 0.0476 kg per person and would be able to achieve the level of consumption of 11.03 kg per capita in 2014.doi:10.5219/236

Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia.

Science.gov (United States)

Garedew, Legesse; Berhanu, Ayalew; Mengesha, Desalegne; Tsegay, Getachew

2012-11-06

Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder's milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%), Pseudomonas aeruginosa (18.5%), and Klebsiella pneumoniae (16.7%), were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. This study showed the presence of diverse pathogenic gram-negative staining bacterial species in raw

Identification of gram-negative bacteria from critical control points of raw and pasteurized cow milk consumed at Gondar town and its suburbs, Ethiopia

Directory of Open Access Journals (Sweden)

Garedew Legesse

2012-11-01

Full Text Available Abstract Background Milk is highly prone to contamination and can serve as an efficient vehicle for human transmission of foodborne pathogens, especially gram-negative bacteria, as these are widely distributed in the environment. Methods This cross-sectional study of gram-negative staining bacterial contamination of milk meant for human consumption was carried out from October 2010 to May 2011 in Gondar town, Ethiopia. Milk samples were collected from critical control points, from production to consumption, that were hypothesized to be a source of potential contamination. Milk sampling points included smallholder’s milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and postpasteurization storage conditions at these specified critical control points were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. Results The results of the current study showed that conditions for contamination of raw milk at different critical points were due to less hygienic practices in pre-milking udder preparation, sub-optimal hygiene of milk handlers, and poor sanitation practices associated with milking and storage equipments. Among all critical control points considered, transportation containers at milk collection centers and at processing plants were found to be the most heavily contaminated with gram-negative staining bacterial species. Overall, 54 different bacterial species were indentified, and Escherichia coli (29.6%, Pseudomonas aeruginosa (18.5%, and Klebsiella pneumoniae (16.7%, were the most commonly identified gram-negative staining bacterial pathogens. Of particular interest was that no gram-negative staining bacteria were isolated from pasteurized milk samples with varying shelf life. Conclusion This study showed the presence of

Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

Directory of Open Access Journals (Sweden)

F Tajbakhsh

2014-05-01

Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing.

Science.gov (United States)

Li, Ling; Renye, John A; Feng, Ling; Zeng, Qingkun; Tang, Yan; Huang, Li; Ren, Daxi; Yang, Pan

2016-09-01

The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High-quality samples of raw buffalo milk were obtained from 3 dairy farms in the Guangxi province in southern China. Five liters of each milk sample were pasteurized (72°C; 15 s); and both raw and pasteurized milks were stored at refrigeration temperature (1-4°C) for various times with their microbial communities characterized using the Illumina Miseq platform (Novogene, Beijing, China). Results showed that both raw and pasteurized milks contained a diverse microbial population and that the populations changed over time during storage. In raw buffalo milk, Lactococcus and Streptococcus dominated the population within the first 24h; however, when stored for up to 72h the dominant bacteria were members of the Pseudomonas and Acinetobacter genera, totaling more than 60% of the community. In pasteurized buffalo milk, the microbial population shifted from a Lactococcus-dominated community (7d), to one containing more than 84% Paenibacillus by 21d of storage. To increase the shelf-life of buffalo milk and its products, raw milk needs to be refrigerated immediately after milking and throughout transport, and should be monitored for the presence of Paenibacillus. Results from this study suggest pasteurization should be performed within 24h of raw milk collection, when the number of psychrotrophic bacteria are low; however, as Paenibacillus spores are resistant to pasteurization, additional antimicrobial treatments may be required to extend shelf-life. The findings from this study are expected to aid in improving the quality and safety of raw and pasteurized buffalo milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Practices and values regarding milk consumption among pre-schoolers in Bangkok.

Science.gov (United States)

Yothasamut, Jomkwan; Camfield, Laura; Pfeil, Michael

2018-12-01

Thai government agencies and the business sector have been promoting milk consumption. Considering the robust and continual movements by those actors to promote milk consumption among children in Thailand at the national level, this study aims to investigate milk-consumption practices and values towards milk consumption at pre-school, family and individual levels. This cross-sectional qualitative study employs observation and interview methods, along with the Ecological System Theory as a framework. Data were collected from three kindergartens used by families of varying socio-economic status, and the homes of 18 pre-schoolers, aged 3-5 years old, attending these kindergartens, from October 2013-September 2014. Findings reveal kindergartens implemented daily routines to make children drink milk. Practices at home include (i) overfeeding of milk, (ii) preference for fortified milk and (iii) using sweetness to make children drink milk. These practices were underpinned by values that milk is good for children and good parents feed their children milk. These values, in combination with other macro-level measures such as the government's milk-promotion campaigns and the milk industry's marketing, influence the milk-drinking practices of pre-schoolers. The promotion of the benefits of milk prompted children to exceed the recommended milk consumption of 400ml per day. Balanced information on moderation in milk drinking was absent.

Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption.

Science.gov (United States)

Magistrelli, Damiano; Rosi, Fabia

2014-07-23

In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower ( p raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower ( p pasteurized milks. In skimmed UHT milk, leptin was 40% lower ( p milk. Leptin was correlated ( p milks. Results suggest that the heat treatment (pasteurization or UHT) is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

Directory of Open Access Journals (Sweden)

Pınar Şanlıbaba

2018-02-01

Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

Chemical Contaminants in Raw and Pasteurized Human Milk.

Science.gov (United States)

Hartle, Jennifer C; Cohen, Ronald S; Sakamoto, Pauline; Barr, Dana Boyd; Carmichael, Suzan L

2018-05-01

Environmental contaminants ranging from legacy chemicals like p,p'-dichlorodiphenyltrichloroethane (DDT) to emerging chemicals like phthalates are ubiquitous. Research aims/questions: This research aims to examine the presence and co-occurrence of contaminants in human milk and effects of pasteurization on human milk chemical contaminants. We analyzed human milk donated by 21 women to a milk bank for 23 chemicals, including the persistent organic pollutants (POPs) polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDT), and dichlorodiphenyldichloroethylene (DDE) isomers that are known to sequester in adipose tissue, along with the current-use and nonpersistent pesticides chlorpyrifos and permethrin, phthalates, and bisphenol A (BPA). Human milk was analyzed raw and pasteurized for these chemicals using gas chromatography-tandem mass spectrometry for the POPs and high-performance liquid chromatography-tandem mass spectrometry for non-POPs. Within the different chemical classes, PBDE47, PCB153, ppDDE, and MEHHP (phthalate metabolite) had the highest median concentrations and were observed in all samples. We also observed chlorpyrifos and BPA in all samples and permethrin in 90% of the samples tested. Only two chemicals, chlorpyrifos and permethrin, were susceptible to substantial degradation from pasteurization, a standard method for processing donated human milk. We detected 19 of 23 chemicals in all of our prepasteurized milk and 18 of 23 chemicals in all of our pasteurized milk. Pasteurization did not affect the presence of most of the chemicals. Future research should continue to explore human milk for potential chemical contamination and as a means to surveil exposures among women and children.

Bacterial contaminations of informally marketed raw milk in Ghana ...

African Journals Online (AJOL)

Background: Milk has an outstanding nutritional quality but is also an excellent medium for bacterial growth and an important source of bacterial infection when consumed without pasteurization. Objective: To estimate the bacterial health risk of milk consumption in Accra and Kumasi, the twomajor cities in Ghana. Method: A ...

High-throughput metataxonomic characterization of the raw milk microbiota identifies changes reflecting lactation stage and storage conditions.

Science.gov (United States)

Doyle, Conor J; Gleeson, David; O'Toole, Paul W; Cotter, Paul D

2017-08-16

Low temperature is used to control the growth of bacteria in milk, both pre- and post-pasteurization. As the duration of refrigerated storage extends, psychrotrophs dominate the milk microbiota, that can produce heat stable lipases which negatively impact the organoleptic qualities of milk. Here we examine the influence that refrigeration temperature (2°C, 4°C and 6°C) and storage duration (96h) have on the microbiota composition (16S profiling) of raw bulk tank milk (BTM). To reflect a proposed change to current farming practices, raw milk was blended after each milking (8 milkings) and stored for five consecutive days in each temperature-specific tank. Here 16S rRNA-based microbiota compositional analysis was performed after milk was collected on day 1 and again after the final addition of milk at day 5. In addition to assessing the impact of the duration and temperature of storage, the influence of lactation stage, i.e. mid- versus late-lactation, on the microbiota of the blended BTM was also examined. Overall, both temperature and length of storage had surprisingly little influence on the raw milk microbiota, other than an increase in proportions of Gammaproteobacteria in the blended milk samples collected after pooling on day 5, and in samples stored at 6°C. However, lactation stage had a considerable influence on microbiota composition, with milk from mid-lactation containing higher proportions of Bacteroides, Faecalibacterium, Campylobacter and Rhodanobacter, and late-lactation milk containing higher proportions of Actinobacteria. Overall, the study demonstrates that current temperature and storage duration practises impact the microbiota of raw milk, but these impacts are modest relative to the more considerable differences between mid and late-lactation milk. Copyright © 2017 Elsevier B.V. All rights reserved.

Full fat milk consumption protects against severe childhood obesity in Latinos

Directory of Open Access Journals (Sweden)

Amy L. Beck

2017-12-01

Full Text Available Consumption of non- or low-fat dairy products is recommended as a strategy to lower the risk of childhood obesity. However, recent evidence suggests that consumption of whole fat dairy products may, in fact, be protective against obesity. Our objective was to determine the association between milk fat consumption and severe obesity among three-year-old Latino children, a population with a disproportionate burden of obesity and severe obesity. 24-hour-dietary recalls were conducted to determine child intake in San Francisco based cohort recruited in 2006–7. Mother-child dyads were weighed and measured. The 24-hour recall data was analyzed to determine participants' consumption of whole milk, 2% milk, and 1% milk. The milk consumption data was used to calculate grams of milk fat consumed. The cross-sectional association between milk fat intake and severe obesity (BMI ≥ 99th percentile was determined using multivariable logistic regression. Data were available for 145 children, of whom 17% were severely obese. Severely obese children had a lower mean intake of milk fat (5.3 g vs. 8.9 g and fewer drank any milk (79% versus 95% for not severely obese children (p < 0.01. Among the potential confounders assessed, maternal BMI and maternal marital status were associated with severe obesity and were included in a multivariate model. In the multivariate model, higher milk fat consumption was associated with lower odds of severe obesity (OR 0.88 CI 0.80–0.97. Higher milk fat consumption is associated with lower odds of severe obesity among Latino preschoolers. These results call into question recommendations that promote consumption of lower fat milk. Keywords: Preschoolers, Dairy products, Latinos, Nutrition policy, Health disparities

Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

Science.gov (United States)

Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

2010-11-01

The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

Monitoring Milk Somatic Cell Counts

Directory of Open Access Journals (Sweden)

Gheorghe Şteţca

2014-11-01

Full Text Available The presence of somatic cells in milk is a widely disputed issue in milk production sector. The somatic cell counts in raw milk are a marker for the specific cow diseases such as mastitis or swollen udder. The high level of somatic cells causes physical and chemical changes to milk composition and nutritional value, and as well to milk products. Also, the mastitic milk is not proper for human consumption due to its contribution to spreading of certain diseases and food poisoning. According to these effects, EU Regulations established the maximum threshold of admitted somatic cells in raw milk to 400000 cells / mL starting with 2014. The purpose of this study was carried out in order to examine the raw milk samples provided from small farms, industrial type farms and milk processing units. There are several ways to count somatic cells in milk but the reference accepted method is the microscopic method described by the SR EN ISO 13366-1/2008. Generally samples registered values in accordance with the admissible limit. By periodical monitoring of the somatic cell count, certain technological process issues are being avoided and consumer’s health ensured.

Physico-chemical characterisation of some samples of fresh milk and milk powder

Directory of Open Access Journals (Sweden)

Soceanu Alina

2015-12-01

Full Text Available Milk consumption is important in the diet of all age groups because it provides important nutrients that are essential for humans. Children are the largest consumers of milk, thus, it’s very important that milk is free of toxic compounds that can be harmful for humans. Aim of the study was to determine the physico-chemical characteristics of some samples of milk powder for different stage of baby growing and for some samples of fresh milk: raw cow’s milk, milk trade and UHT type. The following physico-chemical properties: density, pH, acidity, the presence of acetone, enzymes, antiseptics, dry substance, the ash, total fat, saponification and peroxide index, total nitrogen and protein content were determined. Comparing the values of acidity for analyzed samples it can be concluded that the powder milk acidity value is much lower than the fresh milk. The presence of antiseptics and acetone was not identified, and amylase and peroxidase were found only in raw cow's milk. The highest protein content was found for milk powder (27.22%.

Microbiological quality of raw donkey milk from Campania Region

Directory of Open Access Journals (Sweden)

Nicola Costanzo

2012-07-01

Full Text Available Microbiological quality of raw milk from eight healthy donkeys reared in Campania Region was investigated. A total of 152 samples were analyzed in order to evaluate the milk safety status trough monitoring mesophilic total bacterial count (TBC at 32°C and 20°C, psychrophilic TBC at 5°C, Enterobacteriaceae, Salmonella spp., Listeria monocytogenes, Staphylococcus aureus and somatic cell count (SCC. The ranges for mesophilic bacteria at 32°C, 20°C and psychrophilic bacteria at 5°C were, respectively, 2.80-4.00 Log CFU/mL, 2.84-3.92 Log CFU/mL and 1.27-2.12 Log CFU/mL. Enterobacteriaceae showed a load ranging between 0.68-1.93 Log CFU/mL. No pathogenic bacteria were isolated. Estimated SCC values were always under 50,000 cells/mL. Additionally quantitative changes of bacterial population in raw bulk milk during eight storing days at 8°C and 3°C, were evaluated. Firstly, fresh bulk milk was contaminated by bacteria with a mean TBC at 32°C and 20°C of 2.71 Log CFU/mL and 2.64 Log CFU/mL, respectively, whereas TBC at 5°C and Enterobacteriaceae were not detected. After eight days of storage at 8°C, TBC at 32°C, 20°C and Enterobacteriaceae increased by three Log and TBC at 5°C by five Log. On the other side, after eight days of storage at 3°C no gradual Log increase was detected. Our results showed that donkey milk could be a good healthy ingredient for feeding where good hygienic procedures are applied and storage is kept at temperature lower than 3°C.

MICROBIOLOGICAL CHARACTERISTICS OF MILK FROM DONKEYS FARMED IN CAMPANIA REGION: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

E. Sarno

2012-08-01

Full Text Available Interest in donkey’s milk destined to human consumption is increasing owing to its complex composition and unique functional properties. The microbiological profile of donkeys’ raw milk was investigated. Individual donkey milk samples were collected from 8 asses after mechanical milking and filtration in a farm of Campania region. A total of 133 samples were analyzed. Total plate count bacteria and Enterobacteriaceae were enumerated. Other microbiological characteristics were monitored as established by legislation in force on the sale of raw milk. Results showed a low contamination level of the raw milk in accordance with other authors. No correlations were evidenced between milk contamination and lactation stage.

Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran

Directory of Open Access Journals (Sweden)

Mafakheri, Sh.

2010-07-01

Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.

GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS

Directory of Open Access Journals (Sweden)

Shanmuga Priya Seshadhri

2014-12-01

Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.

QUALITY AND SAFETY OF RAW COW’S MILK IN SLOVAKIA IN 2011

Directory of Open Access Journals (Sweden)

Jozef Čurlej

2012-04-01

Full Text Available The quality and safety of raw cow’s milk is very important for dairy companies and consumers of milk products. Due to the methods of production, it is impossible to completely eliminate contamination of milk with microorganisms, therefore the microbial content of milk is a major feature in determining its quality. Other important factors to consider include somatic cells count, veterinary drug residues, milk composition and freezing point. Somatic cells represent the udder health and can be used for monitoring of subclinical mastitis. A high level of somatic cells can increase proteolysis in milk which affects technological processes. Veterinary drugs administered to cows may lead to residues in the milk which are harmful to humans. The content of fat, protein and solids-non-fat are the main indicators used by dairies for technological purposes. In this article we discuss the quality and safety of raw cow’s milk in Slovakia during 2011. We found that 73.53% of samples tested for somatic cell count, and 84.54% of samples tested for total bacterial count, met the European Union legislation limits. We found the largest decrease in fat and protein content was during the summer period and the largest increase was in the winter period. We found that 92.14 %, 98.7% and 91.38% of samples met the limit presented in STN 570529:1999 for fat content, protein content and freezing point respectively. The percentage of drug positive samples was 0.087%.doi:10.5219/189

Raw bovine milk improves gut responses to feeding relative to infant formula in preterm piglets

DEFF Research Database (Denmark)

Li, Yanqi; Jensen, Mikkel Lykke; Chatterton, Dereck Edward Winston

2014-01-01

For preterm neonates, the quality of the first milk is crucial for intestinal maturation and resistance to necrotizing enterocolitis (NEC). Among other factors, milk quality is determined by the stage of lactation and processing. We hypothesized that unprocessed mature bovine milk (BM, raw bovine...

Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil

Directory of Open Access Journals (Sweden)

Helena Fagundes

2010-06-01

Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.

Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

Directory of Open Access Journals (Sweden)

William van Caenegem

2017-04-01

cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw milk cheese consumer market. This article compares the Australian system with the French raw milk cheese regulation and production system, and argues that its approach in encouraging and supporting small farmhouse artisanal traditional raw milk cheese is beneficial to both producer and consumer, and has not resulted in any significant health risks. The Australian approach amounts to a missed opportunity to encourage the emergence of a value-added industry with local and export potential, and is at odds with important movements in food policy, such as recognition of the value of localism and terroir.

Aflatoxin M1 levels in raw milk, pasteurised milk and infant formula

Directory of Open Access Journals (Sweden)

Sharaf S. Omar

2016-06-01

Full Text Available The incidence of contamination of aflatoxin M1 (AFM1 in milk samples collected from the Jordanian market was investigated by using the competitive enzyme linked immunosorbent assay (ELISA technique. A total of 175 samples were collected during 2014-2015. All tested samples were contaminated with various levels of AFM1 ranging from 9.71 to 288.68 ng/kg. The concentration of AFM1 in 66% of fresh milk samples was higher than the maximum tolerance limit accepted by the European Union (50 ng/kg and 23% higher than the maximum tolerance limit accepted by the US (500 ng/kg. Percentages of contaminated raw cow, sheep, goat and camel milk exceeding the European tolerance limit were 60, 85, 75 and 0%, respectively. Of AFM1 contaminated pasteurised cow milk samples, 12% exceeded the European tolerance limit with a range of contamination between 14.60 and 216.78 ng/kg. For infant formula samples, the average concentration of AFM1 was 120.26 ng/kg (range from 16.55 to 288.68 ng/kg, the concentration of AFM1 in 85% of infant formula samples was higher than the maximum tolerance limit accepted by the European Union and the US (25 ng/kg.

Assessment of the application of an automated electronic milk analyzer for the enumeration of total bacteria in raw goat milk.

Science.gov (United States)

Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A

2011-07-01

Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d

Effect of medicinal plants, Heavy metals and antibiotics against pathogenic bacteria isolated from raw, Boiled and pasteurized milk.

Science.gov (United States)

Ali, Nazish Mazhar; Sarwar, Khadija; Mazhar, Syed Abdullah; Liaqat, Iram; Andleeb, Saiqa; Mazhar, Bushra; Kalim, Bushra

2017-11-01

Present study has been undertaken to isolate and identify the bacterial flora in raw, boiled and pasteurized milk. Agar disc diffusion method was used to determine their sensitivity using medicinal plants, antibiotics and heavy metals. Methylene blue reduction test was used to test the quality of milk samples. Total 10 pathogenic strains were isolated, five strains were isolated from raw milk, three from boiled milk and 2 two from pasteurized milk. To determine optimum conditions for growth, these pathogenic microorganisms were incubated at various temperatures and pH. Gram's staining and biochemical tests revealed that these pathogenic bacteria include Lactobacillus sp., E. coli, Salmonella sp., Pseudomonas sp., Streptococcus sp. and Staphylococcus. Ribotyping revealed S2 as Pseudomonas fluorescens, S5 as Lactococcus lactis and S9 as Lactobacillus acidophilus. Prevalence of pathogenic organisms provided the evidence that contamination of milk arises during milking, transportation and storage of milk. Raw milk is more contaminated than other two types of milk because it contains highest percentage of pathogenic organisms and pasteurized milk was found to be of best quality among three types. So it is recommended to drink milk after proper boiling or pasteurization. Proper pasteurization and hygienic packing of milk is essential to minimize contamination in milk which can save human beings from many milk borne diseases. Our study suggests that antimicrobial use in animal husbandry should be minimized to reduce the hazard of antibiotic resistance. Plant extracts are better alternative against pathogenic bacteria in milk.

Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

Science.gov (United States)

Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

2018-01-01

During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

Quality of raw cow milk in Republic of Macedonia determined through the testing of somatic cell count and total viable count

Directory of Open Access Journals (Sweden)

Angelovski Ljupco

2008-11-01

Full Text Available Somatic cells count and total viable count are criteria used to estimate the compliance of raw cow milk with the Book of rules for demands for safety and hygiene and procedures for official controls of milk and milk products, Official Gazette of RM 157/2007. According to the given demands, raw milk operators are obliged to conduct all procedures and to guarantee that milk is in compliance with the criteria laid down in Book of rules. At the same time, Republic of Macedonia have to fulfill EU criteria laid down in Directive 92/46 (Council directive 92/46/EEC laying down the health rules for the production and placing on the market of raw milk, heat-treated milk and milkbased products for quality of raw milk as part of implementation of community legislation and milk production. The independent laboratory for milk quality control at FVM-Skopje, in frame of its activities in the period February- August 2008 has conducted a study for obtaining preliminary results for the situation with raw milk quality produced in R. of Macedonia for somatic cells counts and total viable count. In the study we analyzed 2065 samples for TVC and 1625 samples for SCC of raw milk samples produced in different parts of the country. From the tested samples only 41,8% fulfill criteria for SCC and 41,45% criteria for TVC lay down in Book of rules for 2008. Assessment of the results in light of Council Directive it is obvious that only 42,7% of the samples for SCC and 10,7% for TVC fulfill the criteria of Council Directive having in mind different requirements vs. Book of rules.

Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco.

Science.gov (United States)

Bendahou, Abdrezzak; Lebbadi, Mariam; Ennanei, Latifa; Essadqui, Fatima Z; Abid, Mohammed

2008-06-01

To investigate the incidence and antibiotic resistance of staphylococcal strains isolated from milk and milk products and to trace the ecological origin of the Staphylococcus aureus isolated. Eighty-one samples of raw milk, lben (whey) and jben (cheese) were analyzed for the presence of staphylococcal strains. Isolates were identified by Gram stains, tests for coagulase, the API staph system and the WalkAway 40/96, which also determines the antimicrobial susceptibility profiles. The S. aureus strains were biotyped, and variable regions of the coagulase gene were amplified using the polymerase chain reaction. The identification results showed a predominance of coagulase-negative staphylococci (54 %). Coagulase-positive staphylococci that were identified were divided into 3 groups comprising S. aureus (40%), Staphylococcus intermedius (2 %) and Staphylococcus hyicus (4%). Among the S. aureus that was isolated, biotype C was the predominant biotype. Among 40 coagulase gene PCR-amplification products, 37 produced a single band, while 3 isolates produced two bands. The antimicrobial susceptibility-profile of the staphylococcal strains revealed a high incidence of S. aureus to penicillin G. In addition, Staphylococcus lentus presented considerable resistance to the oxacillin, erythromycin and lincomycin. The presence of staphylococci in raw milk, lben and jben in areas of northern Morocco poses a health hazard, so it is necessary for the public health inspectors to properly examine the conditions during production, storage and commercialization of all products made with unpasteurized milk.

Radiometric determination of the bacteriological quality of raw milk

International Nuclear Information System (INIS)

Cogan, T.M.; O'Connor, F.

1977-01-01

The usefulness of 14 CO 2 production from (U- 14 C) glucose, (U- 14 C) glutamate and ( 14 C) formate as an index of raw milk quality was investigated. Development work showed that the volume of milk sample influenced the detection of radioactivity. The regression coefficient between Log 10 of the inital bacterial count and the detection time (the time to reach 2000 cpm) in the presence of 0.13 μCi (U- 14 C) glucose/ml was -0.55 (n=119 samples) and the relationship was y=-0.11x+-0.46. The addition of 0.5 μCi (U- 14 C) glutamate and 0.5 μCi of ( 14 C) formate decreased the detection times but did not result in greater predictability. Further study is required before the method could be used to determine the bacteriological quality of milk

Effect of Technological Treatments on Human-Like Leptin Level in Bovine Milk for Human Consumption

Directory of Open Access Journals (Sweden)

Damiano Magistrelli

2014-07-01

Full Text Available In this experiment, raw milk and commercially available full-cream UHT milk, semi-skimmed UHT milk, skimmed UHT milk, full-cream pasteurized milk, semi-skimmed pasteurized milk and infant formulas for babies between 6 and 12 months of age were analyzed by RIA, with a method using an antibody directed against human leptin and human leptin as reference standard. Raw milk and full-cream UHT milk did not differ for human-like leptin. Leptin content of full-cream pasteurized milk was not different to that of full-cream UHT milk, but it was 14% lower (p < 0.05 than that observed in raw milk. Human-like leptin level of semi-skimmed UHT milk was not different to that of semi-skimmed pasteurized milk, but it was 30% lower (p < 0.0001 than those of full-cream UHT and full-cream pasteurized milks. In skimmed UHT milk, leptin was 40% lower (p < 0.0001 than in full-cream UHT milk. Leptin was correlated (p < 0.001 with lipid content. Leptin level of infant formulas was not different to that of skimmed milks. Results suggest that the heat treatment (pasteurization or UHT is not a modifier of human-like leptin content of edible commercial bovine milks, whereas the skimming process significantly reduces milk leptin level.

Detection and identification of Staphylococcus aureus in raw milk by ...

African Journals Online (AJOL)

STORAGESEVER

2010-04-12

Apr 12, 2010 ... detection and identification of S. aureus in raw milk demonstrated high sensitivity and specificity. Key words: Microarray .... sterile after screening for S. aureus contamination according to the procedure described by Wang ... methods, the microarray method is high throughput, specific, and sensitive and also ...

Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

OpenAIRE

William van Caenegem; Madeline Elizabeth Taylor

2017-01-01

Australia’s regulatory framework has resulted in the standardisation of cheese production based on pasteurisation. Up until early 2015, regulations effectively prohibited raw milk cheese-making in Australia and thus stifled artisanal on-farm production. Although the introduction of Food Standards Australia New Zealand Standard 4.2.4 has allowed the production of certain hard, low-moisture raw milk cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw mil...

[Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

Science.gov (United States)

Jallut, O

1989-06-13

Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

Effect of raw sunflower seeds on goat milk production in different farming systems

Directory of Open Access Journals (Sweden)

L. Rapetti

2010-04-01

Full Text Available Aim of this study was to test the effect of raw sunflower seeds on goat milk production. Two farms with different farming systems (intensive and semi-intensive participated to the trial. In each farm about 60 mid-lactation Alpine goats were divided in two groups during spring-summer time. A diet containing 5-6% of sunflower seeds on DM basis was compared with a control diet in a change-over design. In the semi-intensive farm milk yield of goats fed sunflower was 3.46 kg/d compared to 3.58 kg/d of goats fed control diet, whereas in the intensive farm milk yield was 4.60 kg/d vs 4.66 kg/d. Fat content increased significantly from 2.99% to 3.23% only in the intensive farm. The research in the intensive farm investigated also milk and cheese fatty acids composition. Medium and short chain fatty acids (C8-C16 content dropped and long chain fatty acids content increased when sunflower was added. In conclusion raw sunflower seed inclusion in dairy goat diets can be useful, in order to limit the inversion of fat and protein percentages in milk.

The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy

Directory of Open Access Journals (Sweden)

Ehsan Sadeghi

2013-03-01

Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.

Proteolytic and lipolytic microbiota of refrigerated raw milk from northeast and southern regions of Brazil

Directory of Open Access Journals (Sweden)

Jose Carlos Ribeiro Junior

2015-12-01

Full Text Available The shelf life of milk and milk derivatives is directly related to the microbiological quality of refrigerated raw milk. Spoilage microorganisms with proteolytic and/or lipolytic properties are primarily responsible for the decrease in the quality of milk, which is reflected in the shelf life of pasteurized milk and all derivatives. The aim of this study was to determine the spoilage microbial load of refrigerated raw milk from the northeast and southern regions of Brazil, which have different climatic and technological conditions of production. We evaluated 46 samples of milk from the state of Paraná in the southern region, and 10 samples of milk from the state of Maranhão in the northeast region, totaling 56 samples collected from November 2013 to November 2014. The producers of Paraná were divided into large (20 or small (26 according to the average daily production. All producers of Maranhão were considered small (<500L/day. The proteolytic and lipolytic microorganism counts were conducted in milk agar and tributyrin agar, respectively. Milk from the large producers of Paraná had average counts of 1.4 × 104 CFU/mL for proteolytic microorganisms and 1.2 × 103 CFU/mL for lipolytics microorganisms, significantly (p <0.05 lower than the small producers in the same state, and the producers of Maranhão. Producers of Maranhao had counts of 1.1 × 105 CFU/mL for proteolytic microorganisms and 2 × 105 CFU/mL for lipolytic microorganisms, with the proteolytic count significantly lower than that of small Paraná producers. The amount of proteolytic and lipolytic spoilage microorganisms in milk is influenced by the adaptation of the microorganisms to cold, promoted by the cooling of milk, which is practiced less frequently in the country’s northeastern region. The amount of spoilage microorganisms is also affected by the implementation of milking hygiene practices, which reduce contamination. Such practices are more frequently and efficiently

Assessment of Raw Cow Milk Quality in Smallholder Dairy Farms in Pemba Island Zanzibar, Tanzania

Directory of Open Access Journals (Sweden)

S. H. Gwandu

2018-01-01

Full Text Available Milk quality depends on the physicochemical characteristics, hygienic standards, and nutritional quality; however, animal husbandry practices, unhygienic harvesting and processing, may affect its quality. A cross-sectional study was conducted between August 2010 and July 2011 to assess the hygiene of cow milk production environment, raw cow milk physicochemical characteristics, and microbial quality and estimate the prevalence of antimicrobial residues using standard methods in Pemba Island. A total of 98 raw cow milk samples from selected smallholder dairy farms were analyzed, and the judgement on the quality used the East African Standards. Generally, the milk production chain was done under the unhygienic condition, and dirty plastic containers were used for collection and storage of milk under room temperature. Some milk samples had abnormal colour (2.1%, abnormal smell (7.1%, and pH below normal (35.7%, clotted on alcohol test (9.2%, and had the specific gravity below normal (13.3%. All the milk samples had mineral contents within the recommended range. Milk samples with butterfat below normal were 29.6%, while 14.3% had total solids below recommended values. The mean total viable count (TVC of milk container surfaces was 9.7±10.5 log CFU/100 cm2, while total coliform count (TCC was 7.8±8.5 log CFU/100 cm2. Up to 55.1% of milk had TVC beyond the recommended levels. The milk mean TVC was 11.02±11.6 log CFU/ml and TCC was 6.7±7.3 log CFU/ml. Up to 26.5% of milk samples had the TCC beyond levels. Results on physicochemical characteristics and nutritional analysis show that the raw cow milk in Pemba Island is of inferior quality. Microbiological results of this study imply heavy contaminations of milk. Antimicrobial residues were detected in 83% of the samples and most of them were from Wete District. Unhygienic milk production chain accelerates microbial contaminations, and antimicrobial residues in milk are a big

Microelements and heavy metals in raw cow milk from various regions in Serbia

Directory of Open Access Journals (Sweden)

Živkov-Baloš Milica

2013-01-01

Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084

Effect of processing intensity on immunologically active bovine milk serum proteins

NARCIS (Netherlands)

Brick, Tabea; Ege, Markus; Boeren, Sjef; Böck, Andreas; Mutius, Von Erika; Vervoort, Jacques; Hettinga, Kasper

2017-01-01

Consumption of raw cow’s milk instead of industrially processed milk has been reported to protect children from developing asthma, allergies, and respiratory infections. Several heat-sensitive milk serum proteins have been implied in this effect though unbiased assessment of milk proteins in general

Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing

Science.gov (United States)

The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...

[On-site evaluation of raw milk qualities by portable Vis/NIR transmittance technique].

Science.gov (United States)

Wang, Jia-Hua; Zhang, Xiao-Wei; Wang, Jun; Han, Dong-Hai

2014-10-01

To ensure the material safety of dairy products, visible (Vis)/near infrared (NIR) spectroscopy combined with che- mometrics methods was used to develop models for fat, protein, dry matter (DM) and lactose on-site evaluation. A total of 88 raw milk samples were collected from individual livestocks in different years. The spectral of raw milk were measured by a porta- ble Vis/NIR spectrometer with diffused transmittance accessory. To remove the scatter effect and baseline drift, the diffused transmittance spectra were preprocessed by 2nd order derivative with Savitsky-Golay (polynomial order 2, data point 25). Changeable size moving window partial least squares (CSMWPLS) and genetic algorithms partial least squares (GAPLS) meth- ods were suggested to select informative regions for PLS calibration. The PLS and multiple linear regression (MLR) methods were used to develop models for predicting quality index of raw milk. The prediction performance of CSMWPLS models were similar to GAPLS models for fat, protein, DM and lactose evaluation, the root mean standard errors of prediction (RMSEP) were 0.115 6/0.103 3, 0.096 2/0.113 7, 0.201 3/0.123 7 and 0.077 4/0.066 8, and the relative standard deviations of prediction (RPD) were 8.99/10.06, 3.53/2.99, 5.76/9.38 and 1.81/2.10, respectively. Meanwhile, the MLR models were also cal- ibrated with 8, 10, 9 and 7 variables for fat, protein, DM and lactose, respectively. The prediction performance of MLR models was better than or close to PLS models. The MLR models to predict fat, protein, DM and lactose yielded the RMSEP of 0.107 0, 0.093 0, 0.136 0 and 0.065 8, and the RPD of 9.72, 3.66, 8.53 and 2.13, respectively. The results demonstrated the usefulness of Vis/NIR spectra combined with multivariate calibration methods as an objective and rapid method for the quality evaluation of complicated raw milks. And the results obtained also highlight the potential of portable Vis/NIR instruments for on-site assessing quality indexes of

Quality of raw milk from a farm with automatic milking system in the Czech Republic

Directory of Open Access Journals (Sweden)

Bohumíra Janštová

2011-01-01

Full Text Available The aim of this study was to assess the quality of raw cow’s milk from an automatic milking system. Samples of milk (48 were analyzed chemically and microbiologically and the somatic cell count, freezing point and inhibitor residues were determined. For comparison purposes, milk analysis data from two farms using conventional machine milking and 2008 milk analysis report data for the Czech Republic were used. All physical and chemical characteristics of the study samples were within the established limits. The average content (% of chemical indicators was following: fat 3.79 ± 0.18, protein 3.46 ± 0.06, casein 2.67 ± 0.09, lactose 4.82 ± 0.04 and NFS 8.96 ± 0.11. The values for freezing point and somatic cells count were 221 ± 46.103·ml-1 and -0.521 ± 0.003 °C respectively. No inhibitor residue was detected in any of the samples. Microbiological values were lower than the limits: the total microbial count (2.3·104 CFU·ml-1, psychrotrophic count (6.3·103 CFU·ml-1, coliform count (2.4·101 CFU·ml-1, Escherichia coli count (3.2·101 CFU·ml-1, enterococci count (8.5·101 CFU·ml-1 and Staphylococcus aureus count (1.1·101 CFU·ml-1. The study provides a comprehensive view on the quality of milk produced by robotic milking. The automatic milking system seems to be excellent in terms of milking and milk hygiene.

Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.

Science.gov (United States)

Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D

2011-06-01

Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

Evaluation of raw milk quality in three subregions of the department of Sucre, Colombia

Directory of Open Access Journals (Sweden)

Alberto Romero P

2018-03-01

Full Text Available The objective was to evaluate the physicochemical, microbiological quality, somatic cell count and presence of inhibitors in raw milks in the department of Sucre. 150 samples of raw milk from six storage centers or processing plants from three subregions of the department of Sucre (Sabanas, San Jorge and Gulf of Morrosquillo were taken using a descriptive cross-sectional study. 25 samples in each collection center that correspond to 25 producers from the different subregions of the department were taken. Microbiological and physiochemical parameters and udder health were determined of a total of 50 samples for each subregion. The data obtained were analyzed according to accepted standards in Colombia. For the most part of the physicochemical parameters, were within the accepted values established in decree 616 of 2006 and decree 1880of 2011(protein ≥2.9%, fat ≥3.0%, density (15oC ≥1.030, TS ≥11.30, SNF ≥8.30. The count of colony forming units (CFU/mL in the different subregions was greater than 600,000 CFU/mL. The somatic cell count (SCC/mL was greater than 500,000 SCC/mL. In 8% of the sampled milks showed presence of inhibitors. Overall, the raw milk had good physicochemical quality but, the microbiological quality and health of the udder were poor, which requires immediate implementation of programs in order to obtain high quality hygienic milk.

Perception of Sheep and Goat Milk Consumption among Rural ...

African Journals Online (AJOL)

A total of 120 respondents were purposively selected to study the perception of sheep and goat milk consumption among rural dwellers in South-Western Nigeria. The study showed that most of the respondents (72.5%) are not aware of the consumption of such milk and as such only few (10, 8%) claimed that they have ...

Microbiological quality and antibiotic residues in informally marketed raw cow milk within the coastal savannah zone of Ghana.

Science.gov (United States)

Addo, K K; Mensah, G I; Aning, K G; Nartey, N; Nipah, G K; Bonsu, C; Akyeh, M L; Smits, H L

2011-02-01

To investigate the microbiological quality and the presence of antibiotic residues in raw cow milk and in some indigenous milk products produced and marketed by the informal sector in the coastal savannah zone of Ghana. Milk samples were aseptically collected from 224 kraals and samples of 26 indigenous milk products were purchased from processors and retailers. Total plate counts, total coliform counts and the presence of Escherichia coli and E. coli O157:H7 were determined in all 250 samples. Milk samples were also tested for antibiotic residues. Total plate counts exceeded 10⁵ CFU/ml in 45.2% of the samples while coliforms exceeded 10³ CFU/ml in 66.0% and E. coli was detected in 11.2%. E. coli was present in raw cow milk but not in the indigenous products and all E. coli isolates were negative for E. coli O157:H7. Antibiotic residues were detected in 3.1% of the raw cow milk samples. Bulk milk contains unacceptable levels of hygiene indicators and antibiotic residues and is a potential source of milk-borne infections. The detection of E. coli and antibiotic residues raises public health concerns about the safety of fresh unpasteurized cow milk in the coastal savannah zone of Ghana and calls for improved farm hygiene, the need for milk pasteurization and the sensible use of antibiotics in the milk industry. © 2010 Blackwell Publishing Ltd.

Invited review: Microbial evolution in raw-milk, long-ripened cheeses produced using undefined natural whey starters.

Science.gov (United States)

Gatti, Monica; Bottari, Benedetta; Lazzi, Camilla; Neviani, Erasmo; Mucchetti, Germano

2014-02-01

The robustness of the starter culture during cheese fermentation is enhanced by the presence of a rich consortium of microbes. Natural starters are consortia of microbes undoubtedly richer than selected starters. Among natural starters, natural whey starters (NWS) are the most common cultures currently used to produce different varieties of cheeses. Undefined NWS are typically used for Italian cooked, long-ripened, extra-hard, raw milk cheeses, such as Parmigiano Reggiano and Grana Padano. Together with raw milk microbiota, NWS are responsible for most cheese characteristics. The microbial ecology of these 2 cheese varieties is based on a complex interaction among starter lactic acid bacteria (SLAB) and nonstarter lactic acid bacteria (NSLAB), which are characterized by their different abilities to grow in a changing substrate. This review aims to summarize the latest findings on Parmigiano Reggiano and Grana Padano to better understand the dynamics of SLAB, which mainly arise from NWS, and NSLAB, which mainly arise from raw milk, and their possible role in determining the characteristics of these cheeses. The review is presented in 4 main sections. The first summarizes the main microbiological and chemical properties of the ripened cheese as determined by cheese-making process variables, as these variables may affect microbial growth. The second describes the microbiota of raw milk as affected by specific milk treatments, from milking to the filling of the cheese milk vat. The third describes the microbiota of NWS, and the fourth reviews the knowledge available on microbial dynamics from curd to ripened cheese. As the dynamics and functionality of complex undefined NWS is one of the most important areas of focus in current food microbiology research, this review may serve as a good starting point for implementing future studies on microbial diversity and functionality of undefined cheese starter cultures. Copyright © 2014 American Dairy Science Association

Traceability of Plant Diet Contents in Raw Cow Milk Samples

Science.gov (United States)

Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

2009-01-01

The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

Impact of replacing regular chocolate milk with the reduced-sugar option on milk consumption in elementary schools in Saskatoon, Canada.

Science.gov (United States)

Henry, Carol; Whiting, Susan J; Finch, Sarah L; Zello, Gordon A; Vatanparast, Hassan

2016-05-01

Excess sugar consumption in children has led to the removal of chocolate milk from some schools. Lower-sugar formulations, if accepted, would provide the benefits of milk consumption. In a cross-over trial, milk consumption was measured in 8 schools over 6 weeks in 2 phases: phase 1 provided standard 1% chocolate milk and plain 2% milk choices for the first 3 weeks, and phase 2 provided reduced-sugar 1% chocolate milk and plain 2% milk for the next 3 weeks. Milk selection and milk wasted were measured by sex and grade (1-8). Children chose chocolate milk more often than white milk in both phases (phase 1, 8.93% ± 0.75% vs. 0.87% ± 0.11% (p chocolate milk in phase 2 (p chocolate milk over plain milk even when a reduced-sugar formula was offered; however, switching to reduced-sugar chocolate milk led to a decrease in the number of students choosing milk. Longer-duration studies are required to determine if students would purchase reduced-sugar chocolate milk at the same rate as they would purchase regular chocolate milk.

EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2015. Scientific Opinion on the public health risks related to the consumption of raw drinking milk

DEFF Research Database (Denmark)

Hald, Tine

Raw drinking milk (RDM) has a diverse microbial flora which can include pathogens transmissible to humans. The main microbiological hazards associated with RDM from cows, sheep and goats, horses and donkeys and camels were identified using a decision tree approach. This considered evidence of milk...... can arise from animals with systemic infection as well as from localised infections such as mastitis. Extrinsic contamination can arise from faecal contamination and from the wider farm environment. It was not possible to rank control options as no single step could be identified which would...

Quality aspects of raw goat milk in Lower Southern Thailand

Directory of Open Access Journals (Sweden)

Siriwat Wasiksiri

2010-05-01

Full Text Available This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05 on pH and total plate count among samples from eachfarm. However, acidity, specific gravity, milk fat, solid not fat, and total solid varied between farms depending on feed supplyand management. Means of total bacteria count and Coliform count of most samples were in TACF standard quality (log3.720 cfu/ml and log 1.892 cfu/ml, respectively, except four samples had higher Coliform contamination. Additionally,a higher proportion (22.7 % of samples with antibiotic residue was found.

Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

Science.gov (United States)

Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

2011-06-01

The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

Replacement of raw soybean with roasted soybean increased milk production in Holstein cows

Directory of Open Access Journals (Sweden)

Gilson Sebastião Dias Júnior

Full Text Available ABSTRACT: The aim of this study was to evaluate the effect of total replacement of raw whole soybean (RAW for roastedwhole soybean (ROS on the production performance of Holstein cows. Two experiments were carried out usinga simple reversal design where RAW has been completely replaced by ROS. In experiment 1, 22 cows (175±60 days in milkwere used, and the dietary inclusion level of RAW or ROS was 3.7% of dry matter (DM. In experiment 2, 16 cows (130±50 days in milkwere used, and thedietary inclusion level of RAW or ROS was 11% of DM. In both experiments, ROS increased milk production by 1.1kgday-1 without changing fat and protein production. Dry matter intake or milk urea nitrogenwere not affected by dietary soy source. In experiment 2, plasma glucose concentration was decreased, and allantoin/creatinine ratio in urine tended to decreasein ROS. Experiment 2 also evaluated the nutrient digestibility and ruminal degradation kinetics of crude protein in two soybean sources. Roasting had no effect on the digestibility of DM, organic matter, and neutral detergent fiber. Roasted whole soybean hadgreater fraction B and lower protein degradation rate than did RAW; this showed that heat treatment was effective in increasing therumen undegradable amino acid flowto the animal, which suggesteda potential mechanism of action for improved performance observed in ROS.

Milk consumption does not lead to mucus production or occurrence of asthma.

Science.gov (United States)

Wüthrich, Brunello; Schmid, Alexandra; Walther, Barbara; Sieber, Robert

2005-12-01

There is a belief among some members of the public that the consumption of milk and dairy products increases the production of mucus in the respiratory system. Therefore, some who believe in this effect renounce drinking milk. According to Australian studies, subjects perceived some parameters of mucus production to change after consumption of milk and soy-based beverages, but these effects were not specific to cows' milk because the soy-based milk drink with similar sensory characteristics produced the same changes. In individuals inoculated with the common cold virus, milk intake was not associated with increased nasal secretions, symptoms of cough, nose symptoms or congestion. Nevertheless, individuals who believe in the mucus and milk theory report more respiratory symptoms after drinking milk. In some types of alternative medicine, people with bronchial asthma, a chronic inflammatory disease of the lower respiratory tract, are advised not to eat so-called mucus-forming foods, especially all kinds of dairy products. According to different investigations the consumption of milk does not seem to exacerbate the symptoms of asthma and a relationship between milk consumption and the occurrence of asthma cannot be established. However, there are a few cases documented in which people with a cow's milk allergy presented with asthma-like symptoms.

Evaluation of Brucella contamination in raw milk in Kerman dairy farms by PCR

Directory of Open Access Journals (Sweden)

Mohammad Khalili

2016-10-01

Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. In endemic developing countries, dairy products produced from untreated milk are a potential threat to public health. The aim of this study was to detect brucellae in milk from dairy cattle farms in Kerman (Iran. Methods: Forthy and eight Bulk Tank Milk (BTM  were collected from 48 dairy cattle farm including 4200 cow. All milk samples were examined by PCR to detect Brucella-specific DNA. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp from 48 BTM samples in this area.. Conclusions: The detection of Brucella DNA in milk for human consumption, especially the highly pathogenic species B. melitensis, is of obvious concern. The shedding of Brucella spp. in milk poses an increasing threat to consumers in Iran. Consumption of dairy products produced from non-pasteurized milk by individual farmers operating under poor hygienic conditions represents an unacceptable risk to public health.

Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011.

Science.gov (United States)

Vahedi, M; Nasrolahei, M; Sharif, M; Mirabi, A M

2013-06-01

The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes by culture methods and biochemical tests. Data analysis was performed by SPSS software using Chi2 test and described in percentage. In the raw milk, contamination with E. coli, coliforms and Staphylococcus aureus was observed in 42 (42%), 36 (36%) and 22 (22%) of samples respectively, and the same for the pasteurized milk samples was 9 (9%), 2 (2%) and 2 (2%), respectively. Listeria monocytogenes was not detected in any sample. Presence of E. coli in the milk could be due to contamination with waste water and fecal materials. Considering the contamination of raw and pasteurized milk with E. coli and coliforms, sanitary practice during collecting and transporting, particularly in the summer season is recommended.

Preference for goat meat and milk products consumption in Bauchi ...

African Journals Online (AJOL)

Very few people were involved in the consumption of goat milk and milk products, with the highest percentage coming from respondents who consume goat milk only on certain occasions. In general, the study indicated that goat meat is well cherished, while milk from goats is unpopular in the state. Since goat milk is known ...

Analysis of electric energy consumption of automatic milking systems in different configurations and operative conditions.

Science.gov (United States)

Calcante, Aldo; Tangorra, Francesco M; Oberti, Roberto

2016-05-01

Automatic milking systems (AMS) have been a revolutionary innovation in dairy cow farming. Currently, more than 10,000 dairy cow farms worldwide use AMS to milk their cows. Electric consumption is one of the most relevant and uncontrollable operational cost of AMS, ranging between 35 and 40% of their total annual operational costs. The aim of the present study was to measure and analyze the electric energy consumption of 4 AMS with different configurations: single box, central unit featuring a central vacuum system for 1 cow unit and for 2 cow units. The electrical consumption (daily consumption, daily consumption per cow milked, consumption per milking, and consumption per 100L of milk) of each AMS (milking unit + air compressor) was measured using 2 energy analyzers. The measurement period lasted 24h with a sampling frequency of 0.2Hz. The daily total energy consumption (milking unit + air compressor) ranged between 45.4 and 81.3 kWh; the consumption per cow milked ranged between 0.59 and 0.99 kWh; the consumption per milking ranged between 0.21 and 0.33 kWh; and the consumption per 100L of milk ranged between 1.80 to 2.44 kWh according to the different configurations and operational contexts considered. Results showed that AMS electric consumption was mainly conditioned by farm management rather than machine characteristics/architectures. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Total tract nutrient digestion and milk fatty acid profile of dairy cows fed diets containing different levels of whole raw soya beans.

Science.gov (United States)

Venturelli, B C; de Freitas Júnior, J E; Takiya, C S; de Araújo, A P C; Santos, M C B; Calomeni, G D; Gardinal, R; Vendramini, T H A; Rennó, F P

2015-12-01

Whole oilseeds such as soya beans have been utilized in dairy rations to supply additional fat and protein. However, antinutritional components contained in soya beans, such as trypsin inhibitors and haemagglutinins (lectins) may alter digestibility of nutrients and consequently affect animal performance. The objective of the present experiment was to quantify the effect of different levels of whole raw soya beans in diets of dairy cows on nutrient intake, total tract digestion, nutrient balances and milk yield and composition. Sixteen mid to late-lactation cows (228 ± 20 days in milk; mean ± SD) were used in four replicated 4 × 4 Latin square design experiment with 21-d periods. Cows were assigned to each square according to milk yield and DIM. The animals were randomly allocated to treatments: control (without soya beans addition; CO), WS9, WS18 and WS27, with addition of 9%, 18% and 27% of whole raw soya bean in diet on a dry matter (DM) basis respectively. All diets contained identical forage and concentrate components and consisted of maize silage and concentrate based on ground corn and soya beans at a ratio of 60:40. There were no differences in OM, CP, NDF and NEL intakes (kg/day and MJ/day) among the treatments (p > 0.05). However, DM and NFC intakes were negatively affected (p = 0.04 and p raw soya beans for EE (p raw soya beans. However, the nutritive characteristics of excreted grains were not altered. Milk (kg), milk lactose (kg) and protein (kg) yield decreased linearly (p milk fat content (%) increased linearly (p raw soya beans inclusion. Increasing addition of whole raw soya beans affected milk fatty acid profile with a linear decrease of cis-9-trans 11CLA and total saturated FA; and linear increase of total unsaturated and C18:3 FA. Energy balance was positively affected (p = 0.03) by whole raw soya beans as well as efficiency of NEL milk/DE intake (p = 0.02). Nitrogen balance and microbial protein synthesis were not affected by whole raw soya

Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

Directory of Open Access Journals (Sweden)

Olaf Perdijk

2018-02-01

Full Text Available During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow’s milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow’s milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow’s milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow’s milk components in the gut must recirculate into the blood and home to the (upper and lower respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present

Chosen biotic factors influencing raw cow milk freezing point

Directory of Open Access Journals (Sweden)

Oto Hanuš

2011-01-01

Full Text Available The milk freezing point depression (FPD is important physical property. FPD is influenced by milk composition especially by components with osmotic pressure activity and by other physiological factors. There is possible to indicate a foreign (extraneous water addition into milk by FPD. This is necessary to have a good estimated legislative FPD discrimination limit (FPD–L for purpose of milk quality control. This paper was aimed at obtaining information to improve such estimation. Impacts factors as season variations, estimated state of dairy cow nutrition and some milk components and properties on milk FPD and their relations to FPD were quantified (n 11 540 – 72 607 bulk raw cow milk samples. The highest FPD was in Spring (−0.52097 ± 0.004877 °C, the lowest in Autumn (−0.52516 ± 0.005725 °C; P < 0.001. Correlation between FPD and lactose was 0.35 (P < 0.001. 12% and 5.4% of FPD variability is explainable by lactose and casein variability. Relationship between FPD and urea (U was 0.26 (P < 0.001 in March. The worst FPD was in group with presupposed (according to milk urea and protein combination nitrogen matter (NM and energy (E insufficiency (−0.51855 ± 0.007288 °C. The best FPD was in group with presupposed NM and E surplus in feeding ration (−0.52536 ± 0.004785 °C; P < 0.001. The FPD was worse in suspicion on E deficiency (on the basis of fat/crude protein ratio as compared to presumption for balanced E nourishment of dairy herds (−0.52105 ± 0.006436 °C > −0.52244 ± 0.005367 °C; P < 0.001. Results can improve the estimation of objective FPD–L.

Direct evidence of milk consumption from ancient human dental calculus.

Science.gov (United States)

Warinner, C; Hendy, J; Speller, C; Cappellini, E; Fischer, R; Trachsel, C; Arneborg, J; Lynnerup, N; Craig, O E; Swallow, D M; Fotakis, A; Christensen, R J; Olsen, J V; Liebert, A; Montalva, N; Fiddyment, S; Charlton, S; Mackie, M; Canci, A; Bouwman, A; Rühli, F; Gilbert, M T P; Collins, M J

2014-11-27

Milk is a major food of global economic importance, and its consumption is regarded as a classic example of gene-culture evolution. Humans have exploited animal milk as a food resource for at least 8500 years, but the origins, spread, and scale of dairying remain poorly understood. Indirect lines of evidence, such as lipid isotopic ratios of pottery residues, faunal mortality profiles, and lactase persistence allele frequencies, provide a partial picture of this process; however, in order to understand how, where, and when humans consumed milk products, it is necessary to link evidence of consumption directly to individuals and their dairy livestock. Here we report the first direct evidence of milk consumption, the whey protein β-lactoglobulin (BLG), preserved in human dental calculus from the Bronze Age (ca. 3000 BCE) to the present day. Using protein tandem mass spectrometry, we demonstrate that BLG is a species-specific biomarker of dairy consumption, and we identify individuals consuming cattle, sheep, and goat milk products in the archaeological record. We then apply this method to human dental calculus from Greenland's medieval Norse colonies, and report a decline of this biomarker leading up to the abandonment of the Norse Greenland colonies in the 15(th) century CE.

[Severe nutritional deficiencies in young infants with inappropriate plant milk consumption].

Science.gov (United States)

Le Louer, B; Lemale, J; Garcette, K; Orzechowski, C; Chalvon, A; Girardet, J-P; Tounian, P

2014-05-01

Over the past few years, we have observed increasing consumption of inappropriate plant milks as an alternative to infant milk formula. Some families believe that foods labeled as natural are the most healthy and an appropriate nutritional choice. However, their composition does not respect European recommendations. They are always hypocaloric and protein, vitamin, and mineral concentrations are inadequate. The aim of this study was to report severe nutritional complications after inappropriate plant milk consumption. Between 2008 and 2011, we studied severe nutritional deficiencies caused by consumption of plant milks bought in health food stores or online shops. Infants were identified in our centers and examined through medical history, physical examination, and laboratory testing. Nine cases of infants aged from 4 to 14 months were observed. In all cases, these milks were used as an alternative to milk formulas for supposed cow's milk allergy. At diagnosis, four patients were aged 6 months or less. They had received plant milk exclusively for 1-3 months. The beverages consumed were rice, soya, almond and sweet chestnut milks. In three cases, infants presented severe protein-calorie malnutrition with substantial hypoalbuminemia (slow down the progress of this social trend. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011

OpenAIRE

VAHEDI, M.; NASROLAHEI, M.; SHARIF, M.; MIRABI, A.M.

2013-01-01

Summary Introduction. The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. Methods. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and List...

Milk Consumption in the Milk Bars of the City of N’Djamena in Chad

Directory of Open Access Journals (Sweden)

M. O. Koussou

2007-01-01

Full Text Available Out-of-home milk consumption has been increasing for the past ten years in N’Djamena, capital of Chad, through small shops called milk bars. In order to understand the reasons for this new dynamic, 180 consumers chosen at random in 36 of these places were interviewed by means of a transversal survey conducted in March-April 2007. The surveyed consumers were on average 31 years old, unmarried for the majority (54%, originated from the Sahara-Sahelian region (84% and worked in the informal sector (half of them. More than one third (37% bought milk “to take away” and the rest consumed it in the bars, mostly in the evening (79%. The dairy products consisted in sweetened fresh milk (halib and cultured whole milk (rayeb often consumed with bread. Average consumed quantities per client were 11.5 L/month for fresh milk and 19.5 L/month for rayeb. Quantities varied according to the season and the origin of the client. A consumption peak occurred during the hot dry season when production was at its lowest level. However, the price of these two products was stable at 1000 FCFA/L throughout the year, because of the existence of supply contracts with the milk bars. The farm origin of fresh or fermented whole milk greatly influenced the consumers’ choice. Suggestions are made to improve milk supply during the hot season so as to meet the increasing demand.

Selected abiotic factors that influence raw cow milk freezing point depression

Directory of Open Access Journals (Sweden)

Oto Hanuš

2012-01-01

Full Text Available Freezing point depression (FPD is an important property of milk that is influenced primarily by milk components connected to osmotic pressure. Under certain conditions it is possible to detect the addition of water to milk. It is necessary to have the right FPD limit in legislation for milk quality control. The aim of this study was to improve the estimation procedure of this limit. Apart from factors related to dairy cow nutrition, cattle breed and milk yield, it is important to take into account CO2 (6%, water steam evaporation and pasteurization under technological conditions. Bulk milk samples (1, 30, 6, 6, 10, 1 according to experiment from Holstein and Czech Fleckvieh breed (1:1 were used in the experiments and technologically treated. The effects of water addition (water saturated and unsaturated by CO2, carbon dioxide evaporation and pasteurization (80 °C for 22 min were quantified. Pasteurization aggravation of FPD was -0.00394 ± 0.00171 ºC (P P < 0.001 depending on practice. Increase in FPD is recorded after milking during technological procedures of milk storage, mixing, pumping, transport shaking and warming. During FPD shift, the acuteness of FPD data sets increases. This fact should be considered in the process of deriving standard raw cow milk FPD limits. Similar experimental analysis of milk FPD technological shifts has not been performed in this way until now.

Draft Genome Sequence of Bacillus sp. FMQ74, a Dairy-contaminating Isolate from Raw Milk

DEFF Research Database (Denmark)

Okshevsky, Mira Ursula; Regina, Viduthalai R.; Marshall, Ian

2017-01-01

Representatives of the genus Bacillus are common milk contaminants that cause spoilage and flavor alterations of dairy products. Bacillus sp. FMQ74 was isolated from raw milk on a Danish dairy farm. To elucidate the genomic basis of this strain’s survival in the dairy industry, a high-quality draft...

Milk modulates campylobacter invasion into caco-2 intestinal epithelial cells

NARCIS (Netherlands)

Louwen, R.; Neerven, van R.J.J.

2015-01-01

Raw milk is a recognized source of Campylobacter outbreaks, but pasteurization is an effective way to eliminate the causative agent of Campylobacteriosis. Whereas breastfeeding is protective against infectious diseases, consumption of formula milk is thought to be not. However, in relation to

Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Dressed Beef Carcasses and Raw Milk in Tanzania.

Science.gov (United States)

Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh

2016-01-01

Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.

Iodine in raw and pasteurized milk of dairy cows fed different amounts of potassium iodide.

Science.gov (United States)

Norouzian, M A

2011-02-01

Relation between iodine (I) intake by lactating Holstein cows and iodine concentrations in raw and pasteurized milk were investigated. Four treatment groups with eight cows assigned to each treatment were fed a basal diet containing 0.534 mg I/kg alone or supplemented with potassium iodide at 2.5, 5 or 7.5 mg/kg in 7-week period. Iodine concentrations in raw milk increased with each increase in dietary I from 162.2 ng/ml for basal diet to 534.5, 559.8 and 607.5 ng/ml when 2.5, 5 and 7.5 mg/kg was fed as potassium iodide (P HTST) pasteurization process reduced I concentration. The mean iodine content found in the milk prior to heating processing was 466.0 ± 205.0 ng/ml, whereas for the processed milk this level was 349.5 ± 172.8 ng/ml. It was concluded that iodine supplementation above of NRC recommendation (0.5 mg/kg diet DM) resulted in significant increases in iodine concentrations in milk, although the effect of heating in HTST pasteurization process on iodine concentration was not negligible.

Cow's milk and immune function in the respiratory tract

NARCIS (Netherlands)

Perdijk, Olaf; Splunter, van Marloes; Savelkoul, Huub F.J.; Brugman, Sylvia; Neerven, van Joost

2018-01-01

During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw

Milk consumption and mucus production in children with asthma

OpenAIRE

Thiara, Gurkaran; Goldman, Ran D.

2012-01-01

Question Many parents of children with asthma are becoming increasingly reluctant to add milk to their children’s diet because they believe it will worsen their children’s asthma owing to increased mucus secretion. Recognizing the importance of milk as part of a healthy diet in supporting growth and calcium consumption, is it advisable to restrict milk in the diet?

Towards a decision support system for control of multiple food safety hazards in raw milk production

NARCIS (Netherlands)

Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.

2013-01-01

Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw

Visible and near-infrared spectroscopic analysis of raw milk for cow health monitoring: reflectance or transmittance?

Science.gov (United States)

Aernouts, B; Polshin, E; Lammertyn, J; Saeys, W

2011-11-01

The composition of produced milk has great value for the dairy farmer. It determines the economic value of the milk and provides valuable information about the metabolism of the corresponding cow. Therefore, online measurement of milk components during milking 2 or more times per day would provide knowledge about the current health and nutritional status of each cow individually. This information provides a solid basis for optimizing cow management. The potential of visible and near-infrared (Vis/NIR) spectroscopy for predicting the fat, crude protein, lactose, and urea content of raw milk online during milking was, therefore, investigated in this study. Two measurement modes (reflectance and transmittance) and different wavelength ranges for Vis/NIR spectroscopy were evaluated and their ability to measure the milk composition online was compared. The Vis/NIR reflectance measurements allowed for very accurate monitoring of the fat and crude protein content in raw milk (R(2)>0.95), but resulted in poor lactose predictions (R(2)milk samples gave accurate fat and crude protein predictions (R(2)>0.90) and useful lactose predictions (R(2)=0.88). Neither Vis/NIR reflectance nor transmittance spectroscopy lead to an acceptable prediction of the milk urea content. Transmittance spectroscopy can thus be used to predict the 3 major milk components, but with lower accuracy for fat and crude protein than the reflectance mode. Moreover, the small sample thickness (1mm) required for NIR transmittance measurement considerably complicates its online use. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The effects of milk and colostrum on allergy and infection: mechanisms and implications

NARCIS (Netherlands)

Neerven, van R.J.J.

2014-01-01

Children that grow up on farms have fewer allergies than children growing up in city environments. This protection against the development of allergy is associated with the consumption of raw farm milk. Heated farm milk does not have this effect, indicating that (non-denatured) milk proteins are

Maternal milk consumption, fetal growth, and the risks of neonatal complications: The Generation R Study

NARCIS (Netherlands)

D.H.M. Heppe (Denise); R.M. van Dam (Rob); S.P. Willemsen (Sten); H. den Breeijen (Hanneke); H. Raat (Hein); A. Hofman (Albert); E.A.P. Steegers (Eric); V.W.V. Jaddoe (Vincent)

2011-01-01

textabstractBackground: Maternal cow-milk consumption may increase birth weight. Previous studies did not assess the association of maternal milk consumption with trimester-specific fetal growth. Objective: The objective was to assess associations of first-trimester maternal milk consumption with

A Study on the Occurrence of Aflatoxin M1 in Raw and Pasteurized Milk Produced in Rafsanjan, Iran

Directory of Open Access Journals (Sweden)

FaAkrami Mohajeri Akrami Mohajeri

2015-12-01

Full Text Available Introduction: Aflatoxins, known as causative factors of hepatic and extra-hepatic carcinogenesis within humans, are extremely teratogenic, mutagenic, toxic, and carcinogenic compounds. Materials & Methods: This study was undertaken to determine the occurrence of aflatoxin M1 (AFM1 in 40 raw milk and 47 pasteurized milk samples collected during spring and winter. In order to analyze the samples, the Enzyme-linked Immunosorbent Assay (ELISA procedure was used. The statistical methods used in this study were based on normal confidence intervals and analysis of variance (ANOVA. Results: Aflatoxin M1 was detected in 97.5% of the raw milk ranging from 6.52 to 68.17 ng/l and 95.7% of the pasteurized milk, ranging from 0.8 to 58.13 ng/l. Toxin levels in 10% of the raw milk and 2.1% of the pasteurized milk samples exceeded the Iranian national standard limit i.e. 50 ng/l.  Due to seasonal variations, mean concentration of AFM1 in the samples collected in winter was significantly (P < 0.03 higher than those collected in the summer. Conclusion: Large amount of AFM1 in milk samples might be a potential hazard for the public health. Reducing the levels of AFB1 in animal feedstuffs can be regarded as the initial step to control the transfer of AFM1 to humans.

Consumption of nonfat milk results in a less atherogenic lipoprotein profile: a pilot study.

Science.gov (United States)

Hidaka, Hiroya; Takiwaki, Masaki; Yamashita, Mine; Kawasaki, Kenji; Sugano, Mitsutoshi; Honda, Takayuki

2012-01-01

An increase in plasma low-density lipoprotein (LDL) is a well-known risk factor in the development of atherosclerosis. Dairy consumption may lower the risk of atherosclerosis; however, studies on the effects of milk on cardiovascular risk factors are still scarce. We were interested in investigating whether the intake of milk improves the atherogenic lipoprotein profile. We investigated the effects of consuming whole or nonfat milk on plasma lipoprotein composition in healthy Japanese subjects as a pilot study. Normolipidemic subjects consumed 500 ml of whole milk (whole milk group; n=7) or nonfat milk (nonfat milk group; n=7) every day for 2 weeks. The consumption of nonfat milk resulted in a lowering of plasma triglyceride (TG) and phospholipid levels and TG level in high-density lipoprotein (HDL) and increased the plasma apolipoprotein (apo) C-III level. In addition, the TG/cholesterol ratios in HDL and LDL were significantly decreased, and LDL particles became larger. In contrast, the only changes observed following whole milk consumption were increases in the plasma levels of apoC-III and apoE. These findings suggest that consumption of nonfat milk, but not whole milk, may result in a less atherogenic lipoprotein profile, and that the constituents of nonfat milk may improve lipid metabolism.

Contribution of hydrogen peroxide to the inhibition of Staphylococcus aureus by Lactococcus garvieae in interaction with raw milk microbial community

OpenAIRE

Delbes, Céline; Dorchies, Géraud; Chaabna, Zineddine; Callon, Cecile; Montel, Marie-Christine

2010-01-01

The response of Staphylococcus aureus growth inhibition by Lactococcus garvieae to catalase and milk lactoperoxidase, and its efficiency in raw milk cheese were evaluated. S. aureus and L. garvieae were co-cultivated in broth buffered at pH 6.8, and in raw, pasteurized and microfiltered milk, in presence and absence of catalase. Although H(2)O(2) production by L garvieae was detected only in agitated broth, the inhibition of S. aureus by L garvieae was reduced by catalase both in stati...

The effect of raw milk microbial flora on the sensory characteristics of Salers-type cheeses.

Science.gov (United States)

Callon, C; Berdagué, J L; Dufour, E; Montel, M C

2005-11-01

The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial counts (on selective media), biochemical tests, and volatile and sensory component analyses at different times of ripening. Adding different microbial communities to specimens of the same (biochemically identical) pasteurized milk lead to different sensory characteristics of the cheeses. Cheeses with fresh cream, hazelnut, and caramel attributes were opposed to those with fermented cream, chemical, and garlic flavors. The aromatic compounds identified (esters, acids, alcohols, and aldehydes) in these cheeses were quite similar. Nevertheless, one milk was distinguished by a higher content of acetoin, and lower 2-butanone and 3-methylpentanone concentrations. Over the production period of 1 mo, the different cheeses were characterized by the same balance of the microbial population assessed by microbial counts on different media. This was associated with the stability of some sensory attributes describing these cheeses. Nevertheless, there was no linear correlation between microbial flora data and sensory characteristics as measured in this study.

Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk in the northwestern region of Paraná, Brazil

Directory of Open Access Journals (Sweden)

Sônia Aparecida Sgarioni

2014-06-01

Full Text Available Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA and Mycolic acids analysis. Thirteen (25% raw and 2 (4% pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum. M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

Occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk in the northwestern region of Paraná, Brazil.

Science.gov (United States)

Sgarioni, Sônia Aparecida; Hirata, Rosario Dominguez Crespo; Hirata, Mario Hiroyuki; Leite, Clarice Queico Fujimura; de Prince, Karina Andrade; de Andrade Leite, Sergio Roberto; Filho, Dirceu Vedovello; Siqueira, Vera Lucia Dias; Caleffi-Ferracioli, Katiany Rizzieri; Cardoso, Rosilene Fressatti

2014-01-01

Milk is widely consumed in Brazil and can be the vehicle of agent transmission. In this study, was evaluated the occurrence of Mycobacterium bovis and non-tuberculous mycobacteria (NTM) in raw and pasteurized milk consumed in the northwestern region of Paraná, Brazil. Fifty-two milk samples (20 pasteurized and 32 raw) from dairy farms near the municipality of Maringa, Parana State, Brazil were collected. Milk samples were decontaminated using 5% oxalic acid method and cultured on Lowenstein-Jensen and Stonebrink media at 35 °C and 30 °C, with and without 5-10% CO2. Mycobacteria isolates were identified by morphological features, PCR-Restriction Fragment Length Polymorphism Analysis (PCR-PRA) and Mycolic acids analysis. Thirteen (25%) raw and 2 (4%) pasteurized milk samples were positive for acid fast bacilli growth. Nine different species of NTM were isolated (M. nonchromogenicum, M. peregrinum, M. smegmatis, M. neoaurum, M. fortuitum, M. chelonae, M. flavescens, M. kansasii and M. scrofulaceum). M. bovis was not detected. Raw and pasteurized milk may be considered one source for NTM human infection. The paper reinforces the need for intensification of measures in order to avoid the milk contamination and consequently prevent diseases in the south of Brazil.

Proteolysis, lipolysis, volatile compounds and sensory characteristics of Hispánico cheeses made using frozen curd from raw and pasteurized ewe milk.

Science.gov (United States)

Alonso, Rocío; Picon, Antonia; Gaya, Pilar; Nuñez, Manuel

2013-02-01

Hispánico cheese, manufactured from a mixture of cow and ewe milk, is representative of cheese varieties made using milk from more than one animal species in Mediterranean countries. The shortage of ewe milk production in autumn hinders the uniformity of Hispánico cheese composition throughout the year. To surmount this inconvenience of ewe milk seasonality, curds made in spring from raw and pasteurized ewe milk were stored frozen and used four months later for the manufacture of Hispánico cheese. Experimental cheeses were made by mixing fresh curd from pasteurized cow milk with thawed curd from raw or pasteurized ewe milk, and control cheese from a mixture of pasteurized cow and ewe milk in the same proportion. Characteristics of experimental and control cheeses throughout a 60-d ripening period were investigated. On the one hand, the experimental cheese containing frozen curd from raw ewe milk showed the highest counts of staphylococci, Gram-negative bacteria and coliforms, the highest levels of aminopeptidase and esterase activity, and the highest concentrations of free amino acids, free fatty acids, alcohols and esters. On the other, the experimental cheese containing frozen curd from pasteurized ewe milk had concentrations of free amino acids, free fatty acids and volatile compounds similar to those of control cheese, with the only exception being a higher level of ketones. Flavour intensity reached the highest scores in the experimental cheese containing frozen curd from raw ewe milk, followed by the experimental cheese containing frozen curd from pasteurized ewe milk. Flavour quality scores of both experimental cheeses were similar, and lower than those of control cheese.

A new comprehensive index for discriminating adulteration in bovine raw milk.

Science.gov (United States)

Liu, Jing; Ren, Jing; Liu, Zhen-Min; Guo, Ben-Heng

2015-04-01

This paper proposes a new comprehensive index, called Q, which can effectively discriminate artificial adulterated milk from unadulterated milk. Both normal and adulterated samples of bovine raw milk were analysed by Fourier transform infrared spectroscopic instrument to measure the traditional indices of quality, including fat (FAT), protein (PRO), lactose (LAC), total solids (TS), non-fat solid (NFS), freezing point (FP) and somatic cell counts (SCC). From these traditional indices, this paper elaborates a method to build the index Q. First, correlated analysis and principle component analysis were used to select parameter pairs TS-FAT and FP-LAC as predominant variables. Second, linear-regression analysis and residual analysis are applied to determine the index Q and its discriminating ranges. The verification and two-blind trial results suggested that index Q could accurately detect milk adulteration with maltodextrin and water (as low as 1.0% of adulteration proportions), and with other nine kinds of synthetic adulterants (as low as 0.5% of adulteration proportions). Copyright © 2014 Elsevier Ltd. All rights reserved.

[Determination of fat, protein and DM in raw milk by portable short-wave near infrared spectrometer].

Science.gov (United States)

Li, Xiao-yun; Wang, Jia-hua; Huang, Ya-wei; Han, Dong-hai

2011-03-01

Near infrared diffuse reflectance spectroscopy calibrations of fat, protein and DM in raw milk were studied with partial least-squares (PLS) regression using portable short-wave near infrared spectrometer. The results indicated that good calibrations of fat and DM were found, the correlation coefficients were all 0.98, the RMSEC were 0.187 and 0.217, RMSEP were 0.187 and 0.296, the RPDs were 5.02 and 3.20 respectively; the calibration of protein needed to be improved but can be used for practice, the correlation coefficient was 0.95, RMSEC was 0.105, RMSEP was 0.120, and RPD was 2.60. Furthermore, the measuring accuracy was improved by analyzing the correction relation of fat and DM in raw milk This study will probably provide a new on-site method for nondestructive and rapid measurement of milk.

Determination of lactose in raw milks by means of the combined He-Ne laser optothermal window

NARCIS (Netherlands)

Bakos, P.; Doka, O.; Ajtony, Z.; Bicanic, D.; Szucs, D.

2002-01-01

The concept of OW (with 632.8 nm He–Ne laser), combined with colorimetry based on a reaction of anthrone-sulphuric acid, was proposed as a new tool for determination of lactose in raw milk. Data obtained from various milk samples by OW colorimetry were compared to those acquired from the MilkoScan

The inhibitory effect of sodium thiocyanate and sodium percarbonate ratios on microorganism growth in raw milk samples as an effective treatment to extend milk quality during storage

Directory of Open Access Journals (Sweden)

Supreena Srisaikham

2017-02-01

Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.

Effect of seasonal variation on the composition and properties of raw milk destined for processing in the UK.

Science.gov (United States)

Chen, Biye; Lewis, Michael J; Grandison, Alistair S

2014-09-01

The composition and physical properties of raw milk from a commercial herd were studied over a 1 year period in order to understand how best to utilise milk for processing throughout the year. Protein and fat levels demonstrated seasonal trends, while minerals and many physical properties displayed considerable variations, which were apparently unrelated to season. However, rennet clotting time, ethanol stability and foaming ability were subject to seasonal variation. Many significant interrelationships in physico-chemical properties were found. It is clear that the milk supply may be more suited to the manufacture of different products at different times of the year or even on a day to day basis. Subsequent studies will report on variation in production and quality of products manufactured from the same milk samples described in the current study and will thus highlight potential advantages of seasonal processing of raw milk. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular screening of bovine raw milk for the presence of Shiga toxin-producing Escherichia coli (STEC on dairy farms

Directory of Open Access Journals (Sweden)

Tatiane Vendramin

2014-09-01

Full Text Available Milkborne transmission of Shiga toxin- producing Escherichia coli (STEC has raised considerable concern due to recent outbreaks worldwide and poses a threat to public health. The aim of this study was to develop a sensitive and specific multiplex PCR assay to detect the presence of STEC in bovine raw milk. To identify E. coli (ATCC 25922 contamination, the gene uspA was used, and PCR sensitivity and specificity were accessed by testing diluted samples ranging from 2 to 2.0 × 10(6 CFU/mL. To detect STEC, the stx1 and stx2 genes were selected as targets. After reaction standardization, the multiplex assay was tested in raw milk collected from 101 cows on dairy farms. PCR assay for E. coli detection had a specificity of 100% and sensitivity of 79% (P<0.0001, with a lower detection limit of 2 CFU/mL. Multiplex PCR assay had 100% sensitivity for E. coli positive raw milk samples, and 31.1% were contaminated with STEC, 28.3% of stx2, and 1.9% of stx1. The multiplex PCR assay described in the present study can be employed to identify and screen E. coli harboring stx1 and stx2 genes in raw milk on dairy farms and in industries.

Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province

Directory of Open Access Journals (Sweden)

B. A. Abbas

2012-01-01

Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.

OXA-48 and CTX-M-15 extended-spectrum beta-lactamases in raw milk in Lebanon: epidemic spread of dominant Klebsiella pneumoniae clones.

Science.gov (United States)

Diab, Mohamad; Hamze, Monzer; Bonnet, Richard; Saras, Estelle; Madec, Jean-Yves; Haenni, Marisa

2017-11-01

Raw milk has recently been reported as a source of extended-spectrum beta-lactamase (ESBL) and carbapenemase genes. We thus investigated the prevalence of ESBL- and carbapenemase-producing Enterobacteriaceae in raw milk in Lebanon in order to assess the risk of transfer of these bacteria to humans. A high prevalence (30.2 %) of CTX-M-15-producing K. pneumoniae was detected in raw bovine milk. Three main K. pneumoniae clones were identified by PFGE and MLST typing. Southern blot experiments revealed that one of these clones carried the blaCTX-M-15 gene chromosomally. Moreover, one OXA-48-producing K. pneumoniae ST530 and seven CTX-M-15-producing Escherichia coli sharing the same ST were also detected. These findings highlight the spread of dominant CTX-M-15-producing K. pneumoniae clones and OXA-48-producing isolates in the food chain. Milk, which is mostly consumed raw in Lebanon, may be a source of human exposure to ESBLs and carbapenemases.

Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

Science.gov (United States)

Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

2014-01-01

In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

Assess the prevalence rate of Campylobacter genus and Campylobacter jejuni species in raw milk collected from the Amol City by Multiplex- Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Ali Dabiri

2016-03-01

Full Text Available Background & Objective: Campylobacter can be transmitted through the raw milk. The purpose of this study was to determine the prevalence of Campylobacter genus and Campylobacter jejuni (C. jejuni species in raw milk samples. Materials & Methods: In this study, 72 samples of raw milk were collected of the platforms milk in the Amol city in summer. Phenotypic identification of Campylobacter genus and C. jejuni species using microbiology laboratory methods and molecular identification of this bacterium using Multiplex- Polymerase Chain Reaction (M-PCR were performed. The data was calculated using the SPSS 16.0 software and the Fisher's exact test (p < 0.05. Results: Among the 72 samples, 13.88% of samples were contaminated with C. jejuni and 2.77% were contaminated with Campylobacter genus. The highest prevalence rate for this bacterium was in July (20.83% and the lowest prevalence rate was in September (12.5%. The significant difference between the prevalence of the Campylobacter genus and C. jejuni species in raw milk samples in various months of summer was not observed (p = 0.07. Conclusion: This study showed the raw milk contamination with Campylobacter, and thereby the sanitation in the dairy food production places and the use of fast and accurate method to identify this bacterium is important.

Association between Milk Consumption and Metabolic Syndrome among Korean Adults: Results from the Health Examinees Study

Directory of Open Access Journals (Sweden)

Sangah Shin

2017-10-01

Full Text Available It has been suggested that a greater dairy consumption, particularly of milk, may have contributed in lowering the prevalence of metabolic syndrome (MetS. A cross-sectional analysis was conducted to examine the association between milk consumption and MetS, and its components among Korean adults aged 40–69. A total of 130,420 subjects (43,682 men and 86,738 women from the Health Examinees Study were selected for the final analysis. Milk consumption was estimated using a validated 106-item food frequency questionnaire. MetS was defined using the National Cholesterol Education Program, Adult Treatment Panel III (NCEP III. Logistic regression analyses were performed to calculate the odds ratios (ORs and 95% confidence intervals (CIs between milk consumption and MetS after adjusting for potential confounders. In this study, the average milk consumption was 77.9 g/day, with the overall prevalence of MetS being 26.1% (29.1% in men and 24.6% in women. We found that the prevalence of the MetS was significantly lower in subjects with higher milk consumption (p < 0.0001. Adjusted OR for MetS was significantly lower in the highest milk consumption category (≥1 serving/day among men; ≥2 serving/day among women than those in the lowest milk consumption category (OR: 0.92 95%CI: 0.86–0.99, p trend = 0.0160 in men; OR: 0.68, 95%CI: 0.60–0.76, p trend < 0.0001 in women. Overall, higher milk consumption was inversely associated with the MetS components: elevated waist circumference, elevated triglyceride, and reduced high-density lipoprotein cholesterol (HDL-C (all p trend < 0.05. This study concludes that higher milk consumption is associated with the lower odds of MetS in Korean adults.

Detection and genotyping of Toxoplasma gondii DNA in the blood and milk of naturally infected donkeys (Equus asinus).

Science.gov (United States)

Mancianti, Francesca; Nardoni, Simona; Papini, Roberto; Mugnaini, Linda; Martini, Mina; Altomonte, Iolanda; Salari, Federica; D'Ascenzi, Carlo; Dubey, Jitender P

2014-04-03

Toxoplasma gondii is a worldwide zoonotic protozoan. Consumption of raw milk from infected animals is considered a risk factor for acquiring toxoplasmosis in humans. Recently, donkey milk has been indicated for therapeutic and nutritional purposes and T. gondii infection is common in donkeys. The purpose of the present paper was to detect the presence of parasite DNA in milk of T. gondii positive donkeys. Antibodies to T. gondii were found in 11 out of 44 healthy lactating donkeys by IFAT. T. gondii DNA was detected by PCR in blood of 6 and milk of 3 seropositive jennies. Results of limited RFLP-PCR genotyping indicated the presence of T. gondii genotype II or III, commonly found in Europe. The occurrence of T. gondii DNA in milk suggests that the consumption of raw milk from seropositive donkeys could be a potential source of human infection.

Milk consumption during teenage years and risk of hip fractures in older adults.

Science.gov (United States)

Feskanich, Diane; Bischoff-Ferrari, Heike A; Frazier, A Lindsay; Willett, Walter C

2014-01-01

Milk consumption during adolescence is recommended to promote peak bone mass and thereby reduce fracture risk in later life. However, its role in hip fracture prevention is not established and high consumption may adversely influence risk by increasing height. To determine whether milk consumption during teenage years influences risk of hip fracture in older adults and to investigate the role of attained height in this association. Prospective cohort study over 22 years of follow-up in more than 96,000 white postmenopausal women from the Nurses' Health Study and men aged 50 years and older from the Health Professionals Follow-up Study in the United States. Frequency of consumption of milk and other foods during ages 13 to 18 years and attained height were reported at baseline. Current diet, weight, smoking, physical activity, medication use, and other risk factors for hip fractures were reported on biennial questionnaires. Cox proportional hazards models were used to calculate relative risks (RRs) of first incidence of hip fracture from low-trauma events per glass (8 fl oz or 240 mL) of milk consumed per day during teenage years. During follow-up, 1226 hip fractures were identified in women and 490 in men. After controlling for known risk factors and current milk consumption, each additional glass of milk per day during teenage years was associated with a significant 9% higher risk of hip fracture in men (RR = 1.09; 95% CI, 1.01-1.17). The association was attenuated when height was added to the model (RR = 1.06; 95% CI, 0.98-1.14). Teenage milk consumption was not associated with hip fractures in women (RR = 1.00 per glass per day; 95% CI, 0.95-1.05). Greater milk consumption during teenage years was not associated with a lower risk of hip fracture in older adults. The positive association observed in men was partially mediated through attained height.

Short communication: Postpasteurization hold temperatures of 4 or 6°C, but not raw milk holding of 24 or 72 hours, affect bacterial outgrowth in pasteurized fluid milk.

Science.gov (United States)

Andrus, Alexis D; Campbell, Brynne; Boor, Kathryn J; Wiedmann, Martin; Martin, Nicole H

2015-11-01

As fluid milk processors continue to reduce microbial spoilage in fluid milk through improved control of postpasteurization contamination and psychrotolerant sporeformer outgrowth, it is necessary to identify strategies to further improve the quality and extend the shelf life of fluid milk products that are high-temperature, short-time pasteurized. Solutions that optimize product quality, and are economically feasible, are of particular interest to the dairy industry. To this end, this study examined the effects of raw milk holding time and temperature of pasteurized milk storage over shelf life on bacterial growth. In 3 independent replicates, raw milk was stored for 24 and 72 h before pasteurization at 76°C for 25s and then incubated at 3 different storage conditions: (1) 4°C for 21d; (2) 4°C for the first 48 h, then 6°C for the duration of the 21-d shelf life; or (3) 6°C for 21d. Total bacteria counts were assessed initially and on d 7, 14, and 21. No substantial difference in bacterial growth over shelf life was observed between samples processed from raw milk held for 24 versus 72 h. A significantly lower bacterial load was seen at d 21 after pasteurization in samples held at 4°C, versus 4°C for the first 48 h followed by 6°C for the duration of the 21-d shelf life and samples held at 6°C for 21d. This work demonstrates the importance of maintaining control of the fluid milk cold chain throughout postpasteurization, transportation, and retail storage on fluid milk microbial quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

RESEARCH ON THE TRENDS IN MILK PRODUCTION AND CONSUMPTION IN ROMANIA

Directory of Open Access Journals (Sweden)

Agatha POPESCU

2015-04-01

Full Text Available The purpose of the paper was to analyze the main trends in the milk and dairy products market in Romania in the period 2007-2012 and to set up the forecast for the 2013-2015 horizon, based on the empirical data provided by the National Institute of Statistics and Eurostat and using the fixed basis index, average change method, and comparison method. Milk production for consumption reached 210 thou tons in 2012 registering a descending trend. Despite that milk production decreased in the period 2007-2012, the production diversification applied by dairies supported the growth of dairy products output as follows: by 13.54 % for milk, by 3.45 % for sour cream, and by 13 % for butter. The forecast for the year 2015 provides that the production of dairy products will account for: 223,936.6 tons milk for consumption, 48,709.4 tons sour cream, 166,674.2 tons acidulated milk, 9,937.6 tons butter and 66,584.4 tons cheese. The development of milk processing imposes the improvement of production technologies, products quality, efficiency and competitiveness. Due to the unbalanced demand/offer ratio, after the elimination of milk quota, the Romanian milk and dairy products market will be invaded by foreign products.

Determination of the concentrations of lead in raw milk in the Valley of Toluca

International Nuclear Information System (INIS)

Rosas Vilchis, E.

1991-01-01

The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)

Raw material consumption of the European Union--concept, calculation method, and results.

Science.gov (United States)

Schoer, Karl; Weinzettel, Jan; Kovanda, Jan; Giegrich, Jürgen; Lauwigi, Christoph

2012-08-21

This article presents the concept, calculation method, and first results of the "Raw Material Consumption" (RMC) economy-wide material flow indicator for the European Union (EU). The RMC measures the final domestic consumption of products in terms of raw material equivalents (RME), i.e. raw materials used in the complete production chain of consumed products. We employed the hybrid input-output life cycle assessment method to calculate RMC. We first developed a highly disaggregated environmentally extended mixed unit input output table and then applied life cycle inventory data for imported products without appropriate representation of production within the domestic economy. Lastly, we treated capital formation as intermediate consumption. Our results show that services, often considered as a solution for dematerialization, account for a significant part of EU raw material consumption, which emphasizes the need to focus on the full production chains and dematerialization of services. Comparison of the EU's RMC with its domestic extraction shows that the EU is nearly self-sufficient in biomass and nonmetallic minerals but extremely dependent on direct and indirect imports of fossil energy carriers and metal ores. This implies an export of environmental burden related to extraction and primary processing of these materials to the rest of the world. Our results demonstrate that internalizing capital formation has significant influence on the calculated RMC.

Analysis of the Storage Methods for Raw Human Milk from Mothers with Infants Admitted to a Neonatal Intensive Care Unit, According to Brazilian Regulations.

Science.gov (United States)

Grazziotin, Maria Celestina Bonzanini; Grazziotin, Ana Laura; Vidal, Newton Medeiros; Freire, Marcia Helena de Souza; da Silva, Regina Paula Guimarães Vieira Cavalcante

2016-08-01

Milk safety is an important concern in neonatal units and human milk banks. Therefore, evidence-based recommendations regarding raw milk handling and storage are needed to safely promote supplying hospitalized infants with their mother's own milk. To evaluate raw human milk storage methods according to Brazilian milk management regulations by investigating the effects of refrigeration (5°C) for 12 hours and freezing (-20°C) for 15 days on the acidity and energy content in a large number of raw milk samples. Expressed milk samples from 100 distinct donors were collected in glass bottles. Each sample was separated into 3 equal portions that were analyzed at room temperature and after either 12 hours of refrigeration or 15 days of freezing. Milk acidity and energy content were determined by Dornic titration and creamatocrit technique, respectively. All samples showed Dornic acidity values within the established acceptable limit (≤ 8°D), as required by Brazilian regulations. In addition, energy content did not significantly differ among fresh, refrigerated and frozen milk samples (median of ~50 kcal/100 mL for each). Most samples tested (> 80%) were considered top quality milk (milk energy content was preserved after storage. We conclude that the storage methods required by Brazilian regulations are suitable to ensure milk safety and energy content of stored milk when supplied to neonates. © The Author(s) 2016.

Total bacterial count and somatic cell count in refrigerated raw milk stored in communal tanks

Directory of Open Access Journals (Sweden)

Edmar da Costa Alves

2014-09-01

Full Text Available The current industry demand for dairy products with extended shelf life has resulted in new challenges for milk quality maintenance. The processing of milk with high bacterial counts compromises the quality and performance of industrial products. The study aimed to evaluate the total bacteria counts (TBC and somatic cell count (SCC in 768 samples of refrigerated raw milk, from 32 communal tanks. Samples were collected in the first quarter of 2010, 2011, 2012 and 2013 and analyzed by the Laboratory of Milk Quality - LQL. Results showed that 62.5%, 37.5%, 15.6% and 27.1% of the means for TBC in 2010, 2011, 2012 and 2013, respectively, were above the values established by legislation. However, we observed a significant reduction in the levels of total bacterial count (TBC in the studied periods. For somatic cell count, 100% of the means indicated values below 600.000 cells/mL, complying with the actual Brazilian legislation. The values found for the somatic cell count suggests the adoption of effective measures for the sanitary control of the herd. However, the results must be considered with caution as it highlights the need for quality improvements of the raw material until it achieves reliable results effectively.

Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.

Science.gov (United States)

Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran

2007-11-15

During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.

Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

Directory of Open Access Journals (Sweden)

Carla Duarte

2016-04-01

Full Text Available Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

Effect of Processing Intensity on Immunologically Active Bovine Milk Serum Proteins.

Science.gov (United States)

Brick, Tabea; Ege, Markus; Boeren, Sjef; Böck, Andreas; von Mutius, Erika; Vervoort, Jacques; Hettinga, Kasper

2017-08-31

Consumption of raw cow's milk instead of industrially processed milk has been reported to protect children from developing asthma, allergies, and respiratory infections. Several heat-sensitive milk serum proteins have been implied in this effect though unbiased assessment of milk proteins in general is missing. The aim of this study was to compare the native milk serum proteome between raw cow's milk and various industrially applied processing methods, i.e., homogenization, fat separation, pasteurization, ultra-heat treatment (UHT), treatment for extended shelf-life (ESL), and conventional boiling. Each processing method was applied to the same three pools of raw milk. Levels of detectable proteins were quantified by liquid chromatography/tandem mass spectrometry following filter aided sample preparation. In total, 364 milk serum proteins were identified. The 140 proteins detectable in 66% of all samples were entered in a hierarchical cluster analysis. The resulting proteomics pattern separated mainly as high (boiling, UHT, ESL) versus no/low heat treatment (raw, skimmed, pasteurized). Comparing these two groups revealed 23 individual proteins significantly reduced by heating, e.g., lactoferrin (log2-fold change = -0.37, p = 0.004), lactoperoxidase (log2-fold change = -0.33, p = 0.001), and lactadherin (log2-fold change = -0.22, p = 0.020). The abundance of these heat sensitive proteins found in higher quantity in native cow's milk compared to heat treated milk, renders them potential candidates for protection from asthma, allergies, and respiratory infections.

Contribution of natural milk culture to microbiota, safety and hygiene of raw milk cheese produced in alpine malga

Directory of Open Access Journals (Sweden)

Rosaria Lucchini

2018-04-01

Full Text Available Processing of alpine milk in malga farms is carried out under conditions that can favor contamination by coliforms, coagulase-positive staphylococci, or pathogens such as Listeria monocytogenes. With the aim to improve the hygienic characteristics and safety of cheese produced in four malga farms the use of lyophilized Natural Milk Culture prepared with selected strains was tested. Two cheesemaking tests were carried out in the same day always starting from the same milk: in the first case following the malga recipe that uses either Natural Whey Culture or without the addition of a starter, in the second one using a Natural Milk Culture. Cheesemaking were carried out in four malga farms located in the west area of Trentino region within the same week. For hygienic and safety evaluation, aerobic colony count, coagulase-positive staphylococci, Escherichia coli, staphylococcal toxins, Listeria monocytogenes , and Salmonella spp, pH and aw were determined in raw milk from evening and morning milking, curd in vat, curd after extraction and two months-ripened cheese. Pathogens or toxins, high values of coagulase- positive staphylococci and E. coli were not found in cheese samples. However, in the curd coagulase-positive staphylococci reached values almost of 5 Log CFU/g in the two malga without starter cultures. The use of Natural Milk Culture reduced E. coli counts. In addition, DNA was extracted from cheese samples and from Natural Milk Culture and the composition of the microbial community determined by Next Generation Sequencing method. The determination of cheese microbial communities demonstrated that the use of Natural Milk Culture exerted different effects in the different malga, in any case preserving bacterial biodiversity.

Direct evidence of milk consumption from ancient human dental calculus

DEFF Research Database (Denmark)

Warinner, C.; Hendy, J.; Speller, C.

2014-01-01

directly to individuals and their dairy livestock. Here we report the first direct evidence of milk consumption, the whey protein β-lactoglobulin (BLG), preserved in human dental calculus from the Bronze Age (ca. 3000 BCE) to the present day. Using protein tandem mass spectrometry, we demonstrate that BLG...... is a species-specific biomarker of dairy consumption, and we identify individuals consuming cattle, sheep, and goat milk products in the archaeological record. We then apply this method to human dental calculus from Greenland's medieval Norse colonies, and report a decline of this biomarker leading up...

Habit Formation in Natural Cheese Consumption An Approach Based on Dynamic Demand Analysis

OpenAIRE

WAKABAYASHI, Katsufumi

2010-01-01

In expectation of growing cheese consumption, natural cheese production is being increased to reduce surplus milk and create high added value in raw milk. Other studies found positive trends in cheese consumption. However, those studies neither clarified recent trends, nor distinguished natural cheese from processed cheese. The purpose of this paper is to discuss the structure of natural cheese consumption, focusing on habit formation. We test structural changes in cheese demand using dynamic...

Rapid detection of Streptococcus uberis in raw milk by loop-mediated isothermal amplification

NARCIS (Netherlands)

Cornelissen, J.B.W.J.; Greeff, De A.; Heuvelink, A.E.; Swarts, M.; Smith, H.E.; Wal, Van der F.J.

2016-01-01

A loop-mediated isothermal amplification (LAMP) method to detect Streptococcus uberis in raw milk was developed and evaluated. Three genes (sodA, pauA, cpn60) were assessed for their suitability as targets in LAMP. The analytical sensitivity was 120, 120, and 12 fg per assay for the sodA, pauA,

Shelf life of donkey milk subjected to different treatment and storage conditions.

Science.gov (United States)

Giacometti, Federica; Bardasi, Lia; Merialdi, Giuseppe; Morbarigazzi, Michele; Federici, Simone; Piva, Silvia; Serraino, Andrea

2016-06-01

The aim of this study was to investigate the effects of different treatment conditions on microbiological indicators of donkey milk hygiene and their evolution during shelf life at 4 and 12°C from 3 to 30d, simulating a farm-scale pasteurization and packing system. Four treatment conditions were tested: no treatment (raw milk), pasteurization (65°C × 30 min), high-pressure processing (HPP), and pasteurization plus HPP. The microbiological quality of the raw donkey milk investigated was not optimal; our results highlight the importance of raw milk management with the need for animal hygiene management and good dairy farming practices on donkey farms to improve handling procedures. The raw milk treated with HPP alone showed visible alterations with flocks, making the milk unfit for sale. The microbiological risk posed by consumption of raw donkey milk was significantly reduced by heat treatment but farm-scale packing systems cannot guarantee an extended shelf life. In contrast, the pasteurization plus HPP treatment was the most effective method to maintain microbiological milk quality. Microflora growth had little effect on pH in donkey milk: pH values were significantly different only between raw milk and pasteurized and pasteurized plus HPP milk stored at 12°C for 3d. Alkaline phosphatase activity and furosine could be used as indicators of proper pasteurization and thermal processing in donkey milk. Moreover, the presence and growth of Bacillus cereus in the case of thermal abuse hamper the wide-scale marketing of donkey milk due to the potential consequences for sensitive consumers and therefore further tests with time/temperature/high-pressure protocols associated with B. cereus are needed. Finally, our study shows that an HPP treatment of pasteurized milk after packing extends the shelf life of donkey milk and assures its microbial criteria up to 30d if properly stored at 4°C until opening; therefore, combined heat treatment and storage strategies are

Surveillance of Bulk Raw and Commercially Pasteurized Cows' Milk from Approved Irish Liquid-Milk Pasteurization Plants To Determine the Incidence of Mycobacterium paratuberculosis

OpenAIRE

O'Reilly, Ciara E.; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R.; Donaghy, John; Rowe, Michael; O'Mahony, Pat

2004-01-01

Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of ...

Sanitary Quality of Raw Milk within the Commodity Subsector in Mbarara District and Kampala City in Uganda

Directory of Open Access Journals (Sweden)

N. Grillet

2005-04-01

Full Text Available The sanitary quality of raw milk is an important issue in Uganda for social, economical and health reasons. The present study carried out on the informal raw milk subsector of Uganda highlighted two main issues: (i poor hygiene conditions from the production location all the way to the consumer; (ii lack of an efficient preservation system to limit bacteria development during transportation to Kampala. The bacteria population reached very high levels close to 2 x 106 colony forming units per milliliter on the farm milk of Mbarara District in the southwestern region of the country, and these levels increased 150-fold during transportation to Kampala. The sector also includes rudimentary pasteurization units, where the overheated milk comes out bacteria-free. However, conservation over several days of the overheated milk makes this process potentially more dangerous than beneficial. Thus, the need for all the players of the sector to implement a strategy to improve milk quality can be two ways: (i by changing common practices to ensure better hygiene conditions; (ii by improving milk preserving through new methods such as cooling, small-scale pasteurization, or the use of the lactoperoxidase system. This study can help develop a technical and scientific basis to generate quality improvement actions in Uganda. But, whatever the strategy adopted by decision makers, it can only be implemented if all the stakeholders of the sector are involved.

Detection of Salmonella spp., Candida albicans, Aspergillus spp., and Antimicrobial Residues in Raw and Processed Cow Milk from Selected Smallholder Farms of Zimbabwe

Directory of Open Access Journals (Sweden)

Tryness Anastazia Mhone

2012-01-01

Full Text Available A cross-sectional study was conducted to detect the presence of Salmonella spp., Candida albicans, Aspergillus spp., and antimicrobial residues in raw milk (n=120 and processed cow milk (n=20 from smallholder dairy farms from three sites in Zimbabwe. Culture and isolation of Salmonella spp., C. albicans, and Aspergillus spp. were performed using selective media, while antimicrobial residues were detected by a dye reduction test. No Salmonella, but C. albicans (17.5%; 21/120, Aspergillus spp. (0.8%; 1/120, and antimicrobial residues (2.5%; 3/120 were detected from raw milk. C. albicans was isolated from all three sites, while Aspergillus spp. and antimicrobial residues were detected from sites 1 and 3, respectively. From processed milk, only C. albicans (5% was isolated while Aspergillus spp. and antimicrobial residues were not detected. These results suggested low prevalence of Salmonella spp. and Aspergillus spp. and a relatively high prevalence of C. albicans in raw milk from the smallholder farms. The potential public health risks of C. albicans and the detected antimicrobial residues need to be considered. Thus, educating farmers on improving milking hygiene and storage of milk and establishing programmes for monitoring antimicrobial residues may help to improve the safety of milk from smallholder farms.

Validation and application of FTIR spectroscopy in raw milk analysis

Directory of Open Access Journals (Sweden)

Kučević Denis S.

2017-01-01

Full Text Available The aim of this study was to investigate whether FTIR spectroscopy is an accurate and valid technique for the assessment of quality parameters in raw cow's milk: fat, protein, lactose, and total solids. The assessment was based on calibration series and comparison with reference material. Furthermore, it takes into account the results obtained in the inter-laboratory comparisons (proficiency testing. The calibration samples were purchased from the accredited regional reference laboratories. The validation parameters included linearity, accuracy, repeatability, reproducibility, and robustness. The linearity ratio was 0.95%. The biases calculated for the fat, protein, lactose and dry matter were -0.33, 0.31, -0.25, and 0.06 respectively. The F value from the F-test was used to determine the significant differences between two independent sets of the results. The obtained results were as follows: 1.469 for fat, 1.634 for protein, 1.192 for lactose, and 0.528 for dry matter. The intra-laboratory reproducibility calculated as the Horwitz Ratios for all parameters were within the criterion limits (0.5 to 0.8. The data obtained for carry-over were 0.27% for fat, 0.52% for protein, 0.47% for lactose, and 0.47% for dry matter. Based on the obtained results it can be concluded that the FTIR spectroscopy is a reliable instrumental technique for the determination of fat, protein, lactose and total solids in raw cow's milk.

Raw Garlic Consumption and Lung Cancer in a Chinese Population.

Science.gov (United States)

Myneni, Ajay A; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Swanson, Mya K; Li, Jiawei; Su, Jia; Giovino, Gary A; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina

2016-04-01

Evidence of anticancer properties of garlic for different cancer sites has been reported previously in in vitro and in vivo experimental studies but there is limited epidemiologic evidence on the association between garlic and lung cancer. We examined the association between raw garlic consumption and lung cancer in a case-control study conducted between 2005 and 2007 in Taiyuan, China. Epidemiologic data was collected by face-to-face interviews from 399 incident lung cancer cases and 466 healthy controls. We used unconditional logistic regression models to estimate crude and adjusted ORs (aOR) and their 95% confidence intervals (CI). Adjusted models controlled for age, sex, average annual household income 10 years ago, smoking, and indoor air pollution. Compared with no intake, raw garlic intake was associated with lower risk of development of lung cancer with a dose-response pattern (aOR for garlic consumption with indoor air pollution and with any supplement use in association with lung cancer. The results of the current study suggest that raw garlic consumption is associated with reduced risk of lung cancer in a Chinese population. This study contributes to the limited research in human population on the association between garlic and lung cancer and advocates further investigation into the use of garlic in chemoprevention of lung cancer. Cancer Epidemiol Biomarkers Prev; 25(4); 624-33. ©2016 AACR. ©2016 American Association for Cancer Research.

Milk consumption and mucus production in children with asthma.

Science.gov (United States)

Thiara, Gurkaran; Goldman, Ran D

2012-02-01

Many parents of children with asthma are becoming increasingly reluctant to add milk to their children's diet because they believe it will worsen their children's asthma owing to increased mucus secretion. Recognizing the importance of milk as part of a healthy diet in supporting growth and calcium consumption, is it advisable to restrict milk in the diet? Dating back to the 12th century, milk has been proscribed for patients with asthma. However, to this very date studies have not been able to provide a definitive link for this recommendation. As there is a need for more conclusive evidence to determine the effect of milk among children with asthma and further understanding of mechanisms involved in mucus production, milk should not be eliminated or restricted. Health Canada recommends 2 servings of milk (0.5 L) a day for children 2 to 8 years of age and 3 to 4 servings of milk a day (0.75 to 1 L) for children 9 to 13 years of age for unrestricted healthy development.

The human milk project: a quality improvement initiative to increase human milk consumption in very low birth weight infants.

Science.gov (United States)

Ward, Laura; Auer, Christine; Smith, Carrie; Schoettker, Pamela J; Pruett, Raymond; Shah, Nilesh Y; Kotagal, Uma R

2012-08-01

Human milk has well-established health benefits for preterm infants. We conducted a multidisciplinary quality improvement effort aimed at providing at least 500 mL of human milk/kg in the first 14 days of life to very low birth weight (VLBW) (milk program, and twice-daily physician evaluation of infants' ability to tolerate feedings. The number of infants receiving at least 500 mL of human milk/kg in their first 14 days of life increased from 50% to 80% within 11 months of implementation, and this increase has been sustained for 4 years. Infants who met the feeding goal because they received donor milk increased each year. Since September 2007, infants have received, on average, 1,111 mL of human milk/kg. Approximately 4% of infants did not receive any human milk. Respiratory instability was the most frequent physiological reason given by clinicians for not initiating or advancing feedings in the first 14 days of life. Our quality improvement initiative resulted in a higher consumption of human milk in VLBW infants in the first 14 days of life. Other clinicians can use these described quality improvement methods and techniques to improve their VLBW babies' consumption of human milk.

Pathogenic bacteria and heavy metals toxicity assessments in evaluating unpasteurized raw milk quality through biochemical tests collected from dairy cows

Directory of Open Access Journals (Sweden)

Hamid Iqbal

2016-11-01

Full Text Available Objective: To evaluate the hygienic quality by determining the presence of predominant pathogenic microbial contaminants (contagious or environmental and indiscriminate heavy metals contained in unpasteurized milk samples collected from cattle specie of cow. Methods: Raw milk samples were collected in October, 2014 from different regions of District Kohat, Khyber Pakhtunkhwa, Pakistan and cultured on the selective media plates according to the manufacturer instructions to observe pathogenic microbial flora and confirm it with relevant biochemical tests to specify bacterial specie. Results: Milk samples analyzed on MacConkey and nutrient agar media were found contaminated mostly with coliform, Staphylococcus aureus, Enterobacter aerogenes and Proteus vulgaris. Similarly, result of the heavy metals analysis performed using atomic absorption spectrophotometer flame photometry showed that raw milk contains heavy metals residues of lead and cadmium contents at higher levels while copper, zinc and chromium were observed lower than permissible limits whereas manganese within specified recommended values. Conclusions: Microbial contamination of milk and toxic metals is mainly accredited to the scrupulous unhygienic measures during processing of milk exhibiting a wide array of hazardous impacts on human health.

Milk Consumption and Mortality from All Causes, Cardiovascular Disease, and Cancer: A Systematic Review and Meta-Analysis.

Science.gov (United States)

Larsson, Susanna C; Crippa, Alessio; Orsini, Nicola; Wolk, Alicja; Michaëlsson, Karl

2015-09-11

Results from epidemiological studies of milk consumption and mortality are inconsistent. We conducted a systematic review and meta-analysis of prospective studies assessing the association of non-fermented and fermented milk consumption with mortality from all causes, cardiovascular disease, and cancer. PubMed was searched until August 2015. A two-stage, random-effects, dose-response meta-analysis was used to combine study-specific results. Heterogeneity among studies was assessed with the I² statistic. During follow-up periods ranging from 4.1 to 25 years, 70,743 deaths occurred among 367,505 participants. The range of non-fermented and fermented milk consumption and the shape of the associations between milk consumption and mortality differed considerably between studies. There was substantial heterogeneity among studies of non-fermented milk consumption in relation to mortality from all causes (12 studies; I² = 94%), cardiovascular disease (five studies; I² = 93%), and cancer (four studies; I² = 75%) as well as among studies of fermented milk consumption and all-cause mortality (seven studies; I² = 88%). Thus, estimating pooled hazard ratios was not appropriate. Heterogeneity among studies was observed in most subgroups defined by sex, country, and study quality. In conclusion, we observed no consistent association between milk consumption and all-cause or cause-specific mortality.

High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

Science.gov (United States)

Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

2008-05-10

Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

Association between milk and milk product consumption and anthropometric measures in adult men and women in India: a cross-sectional study.

Directory of Open Access Journals (Sweden)

Ambika Satija

Full Text Available The nutritional aetiology of obesity remains unclear, especially with regard to the role of dairy products in developing countries.To examine whether milk/milk product consumption is associated with obesity and high waist circumference among adult Indians.Information on plain milk, tea, curd and buttermilk/lassi consumption assessed using a Food Frequency Questionnaire was obtained from the cross-sectional sib-pair designed Indian Migration Study (3698 men and 2659 women, conducted at four factory locations across north, central and south India. The anthropometric measures included were Body Mass Index (BMI and Waist Circumference (WC. Mixed-effect logistic regression models were conducted to accommodate sib-pair design and adjust for potential confounders.After controlling for potential confounders, the risk of being obese (BMI ≥ 25 kg/m(2 was lower among women (OR = 0.57;95%CI:0.43-0.76;p ≤ 0.0001 and men (OR = 0.67;95%CI: 0.51-0.87;p = 0.005, and the risk of a high WC (men: >90 cm; women: >80 cm was lower among men (OR = 0.71;95%CI:0.54-0.93;p = 0.005 and women (OR = 0.79;95%CI:0.59-1.05;p>0.05 who consume ≥1 portions of plain milk daily than those who do not consume any milk. The inverse association between daily plain milk consumption and obesity was also confirmed in sibling-pair analyses. Daily tea consumption of ≥ 1 portion was associated with obesity (OR = 1.51;95%CI:1.00-2.25;p>0.050 and high WC (OR = 1.65;95%CI:1.08-2.51;p>0.019 among men but not among women but there was no strong evidence of association of curd and buttermilk/lassi consumption with obesity and high waist circumference among both men and women.The independent, inverse association of daily plain milk consumption with the risk of being obese suggests that high plain milk intake may lower the risk of obesity in adult Indians. However, this is an observational finding and uncontrolled confounding cannot be excluded as an explanation for the association. Therefore

A Raman-spectroscopy-based approach for detection and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages at low titer in raw milk.

Science.gov (United States)

Tayyarcan, Emine Kübra; Acar Soykut, Esra; Boyaci, Ismail Hakki

2018-04-11

In this study, a method combining Raman spectroscopy with chemometric analysis was developed for detection of phage presence in raw milk and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages which are among the main phages causing problems in dairy industry. For this purpose, S. thermophilus and L. bulgaricus phages were added into raw milk separately, and then some pretreatments such as fat separation, removal of casein, and filtration were applied to the raw milk samples. Raman spectra of the samples were collected and then analyzed using principal component analysis in order to discriminate these phages in raw milk. In the next step, dilutions of S. thermophilus phages in pretreated raw milk were prepared, and Raman spectra were collected. These spectra were analyzed by using partial least squares method to quantify phages in low titer. Consequently, it has been demonstrated that S. thermophilus and L. bulgaricus phages, which have titers sufficient to fail the fermentation (~ 10 7  pfu/mL) and have lower titers (10 2 -10 3  pfu/mL), could be discriminated from antibiotic and each other. Additionally, low concentrations of S. thermophilus phages (10 2  pfu/mL) could be detected through Raman spectroscopy with a short analysis time (60 min) and high coefficient of determination (R 2 ) values for both calibration (0.985) and validation (0.906) with a root mean square error of calibration of 70.54 and root mean square error of prediction of 165.47. However, a lower success was achieved with L. bulgaricus phages and the obtained coefficient of determination values were not sufficiently high (0.649).

Risco à saúde representado pelo consumo de leite cru comercializado clandestinamente Health risk due to the consumption of raw milk commercialized without due authorization

Directory of Open Access Journals (Sweden)

Kathia Brienza Badini

1996-12-01

Full Text Available Foram submetidas às contagens de microrganismos mesófilos, Staphylococccus coagulase positiva, e às determinações do número mais provável (NMP de coliformes totais e de coliformes fecais, 60 amostras de leite cru comercializado clandestinamente nos Municípios de Botucatu e de São Manuel, Estado de São Paulo, Brasil. Os resultados obtidos evidenciaram a ocorrência de 41 (68,3% e 50 (83,3% amostras com contagens de microrganismos mesófilos e de coliformes totais, respectivamente, acima dos limites máximos estabelecidos pelo Ministério da Saúde para o leite pasteurizado tipo C. Evidenciaram, ainda, a presença de 30 (50,0% e 11 (18,3% amostras contaminadas por cepas de Staphylococcus coagulase positiva e por coliformes fecais, respectivamente. Apenas 5 (8,3% amostras mostraram-se dentro dos referidos padrões legais.Sixty raw milk samples commercialized without due authorization in the counties of Botucatu and S. Manuel, State of S. Paulo (Brazil, were submitted to mesophilic microorganism and coagulase-positive Staphylococcus and most probable number of total coliform and fecal coliform counts. Forty-one (68.3% and 50 (83.3% of the samples were found, respectively to contain mesophilic microorganisms and total coliforms above the maximum limits established by the Health Ministry for type C pasteurized milk. Thirty (50.0% and 11 (18.3% of the samples were found, respectively, to the contaminated by coagulase-positive Staphylococcus and fecal coliforms. Only 5 (8.3% samples were found to comply with the required legal standards. The results showed the unsatisfactory hygienic and sanitary conditions of the raw milk and suggest the existence of great risk to the health of the consumers, especially when the product is taken without being boiled.

Investigation of some additive residues in bulk raw milk collected from Pakdasht area in 2009

Directory of Open Access Journals (Sweden)

T Moosavi

2011-05-01

Full Text Available Milk is one of the most important sources of human nutrition and because of high nutrient content; it is a very suitable medium for microbial growth and spoilage. Sometimes farmers cheat and add some additives to milk in order to cover the spoilage or other defects in milk. In this study 120 samples of bulk raw milk (10 samples each month were collected from dairy farms of Pakdasht under sterile condition and send to veterinary faculty of GarmsarUniversity. The following tests were done on each sample: Anti-microbial residues, residues milk acidity neutralizer, evaluation of sugar, formalin, Hydrogen peroxide, Salicylic acid and salt presence. Results were analyzed with Spss software and the results of the first six months of the year were compared statistically with the results of the second six months of the year. The mean of antimicrobial agents, milk acid neutralizer, formalin, hydrogen peroxide and salicylic acid showed no significant difference. But sugar in first semester were more than second semester (p

A 100-Year Review: The production of fluid (market) milk.

Science.gov (United States)

Barbano, David M

2017-12-01

During the first 100 years of the Journal of Dairy Science, dairy foods and dairy production dairy scientists have partnered to publish new data and research results that have fostered the development of new knowledge. This knowledge has been the underpinning of both the commercial development of the fluid milk processing industry and regulations and marketing policies for the benefit of dairy farmers, processors, and consumers. During the first 50 years, most of the focus was on producing and delivering high-quality raw milk to factories and improving the shelf life of pasteurized fluid milk. During the second 50 years, raw milk quality was further improved through the use of milk quality payment incentives. Due to changing demographics and lifestyle, whole fluid milk consumption declined and processing technologies were developed to increase the range of fluid milk products (skim and low-fat milks, flavored milks, lactose-reduced milk, long-shelf-life milks, and milks with higher protein and calcium contents) offered to the consumer. In addition, technology to produce specialty high-protein sports beverages was developed, which expanded the milk-based beverage offerings to the consumer. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Pasture practices, milk distribution, and consumption in the continental U.S. in the 1950s

International Nuclear Information System (INIS)

Dreicer, M.; Bouville, A.; Wachholz, B.W.

1990-01-01

Determining the consumption of milk contaminated with 131I, resulting from atmospheric nuclear weapons tests conducted at the Nevada Test Site, by the United States population during the 1950s constitutes one part of the methodology used by the National Cancer Institute to assess radiation exposures to Americans. In order to make these estimates for locations throughout the United States, it is necessary to determine the pasture intake by cows and the distribution of the milk produced for human consumption at times when the weapons were tested. Since the milk industry has undergone many changes during the past 35 y, historical records and information must be used. The methodology developed to estimate the intake of contaminated pasture by dairy cows, milk production, and milk distribution on a county basis for the continental U.S. during the 1950s is described in detail. The relevant data on milk consumption by humans are also discussed

New School Meal Regulations and Consumption of Flavored Milk in Ten US Elementary Schools, 2010 and 2013.

Science.gov (United States)

Yon, Bethany A; Johnson, Rachel K

2015-10-01

Milk is a source of shortfall nutrients in children's diets, but most children do not consume recommended amounts. We measured consumption of milk by elementary-schoolchildren (grades 3-5) in a diverse sample of schools before and after implementation of the US Department of Agriculture's updated meal regulations requiring flavored milk to be fat-free. Flavored milk consumption did not change from 2010 to 2013; 52.2% of students in 2010 and 49.7% in 2013 consumed 7 ounces or more of an 8-ounce container. Updated regulations succeeded in lowering the amount of fat, added sugars, and calories in school milk but did not change overall milk consumption, thus improving children's diet quality.

Extension of raw milk quality through supplementation of hydrocyanic acid from fresh cassava peel in dairy cattle diet

Directory of Open Access Journals (Sweden)

Supreena Srisaikham

2017-12-01

Full Text Available The objective of this study was to evaluate the effects on the extension of raw milk quality through supplementation of hydrocyanic acid (HCN levels from fresh cassava peel (FCPe in dairy cattle diet by increasing the milk thiocyanate (SCN concentration and lactoperoxidase (LP activity. The sample was twenty-four Holstein Friesian crossbred lactating dairy cows, averaging 87±31 days in milk (DIM, 13.4±2.9 kg of milk and 397±52 kg body weight (BW. All cows were fed the control diet with 6.5 kg/d of 21% crude protein (CP concentrate and ad libitum grass silage (GS. The treatments groups were as follows: 1 the control diet for the 1st group, the 2nd group received the control diet supplemented with 400 g/d of FCPe (75 ppm HCN and the 3rd group received the control diet supplemented with 800 g/d of FCPe (150 ppm HCN. The results showed that 800 g/h/d FCPe enhanced the efficiency of LP activity in raw milk to reduce total bacterial count (TBC and coliform count (CC; therefore, 400 g/h/d FCPe can be used in the concentrate for lactating dairy cows.

Rate of inactivation of cytomegalovirus in raw banked milk during storage at -20 degrees C and pasteurisation

DEFF Research Database (Denmark)

Friis, Henrik; Andersen, H K

1982-01-01

Samples of milk from 23 mothers attending the department of obstetrics and gynaecology and 36 who donated milk to the department's milk bank were cultured for cytomegalovirus. Virus was isolated from samples from 12 of the milk donors but none of the mothers attending the department; follow......-up studies during lactation in seven of these 12 women showed that five continued to excrete the virus. Samples were taken on three occasions from one woman who regularly excreted high titres of the virus. Storage at -20 degrees C for over three days reduced the titre by over 99%; after pasteurisation at 63...... degrees C for eight minutes the milk did not contain any viable virus. It is recommended that raw banked milk used for feeding preterm babies should be kept frozen for at least 72 hours before feeding....

Sustainability evaluation of pasteurized milk production with a life cycle assessment approach: An Iranian case study

Energy Technology Data Exchange (ETDEWEB)

Rafiee, Shahin, E-mail: shahinrafiee@ut.ac.ir [Department of Agricultural Machinery Engineering, Faculty of Agricultural, Engineering and Technology, University of Tehran, Karaj (Iran, Islamic Republic of); Khoshnevisan, Benyamin, E-mail: b_khoshnevisan@ut.ac.ir [Department of Agricultural Machinery Engineering, Faculty of Agricultural, Engineering and Technology, University of Tehran, Karaj (Iran, Islamic Republic of); Environmental Specialist Research Team (ESRTeam), Tehran (Iran, Islamic Republic of); Mohammadi, Issa; Aghbashlo, Mortaza; Musazadeh, Hossein [Department of Agricultural Machinery Engineering, Faculty of Agricultural, Engineering and Technology, University of Tehran, Karaj (Iran, Islamic Republic of); Clark, Sean [Agriculture and Natural Resources Program, Berea College, Berea, KY (United States)

2016-08-15

Agro-food systems play a significant role in the economies of all nations due to energy use and the resulting environmental consequences. The sustainability of these systems is determined by a multitude of interacting economic, social and environmental factors. Dairy production presents a relevant example of the sustainability trade-offs that occur within such systems. On the one hand, dairy production constitutes an important part of the human diet, but it is also responsible for significant emissions of potent greenhouse gases and other pollutants. In this study, the environmental aspects of pasteurized milk production in Iran were investigated using a life-cycle approach. Three sub-systems, namely feed production, dairy farm and dairy factory, were taken into account to determine how and where Iranian pasteurized milk production might be made more environmentally friendly and energy efficient. The results clearly demonstrate that the feed production stage was the hot spot in pasteurized milk production in terms of energy consumption, environmental burdens and economic costs. The largest share of the total production costs belonged to animal feeds (43%), which were part of the feed production stage. The largest consumers of energy in the production of raw milk were alfalfa (30.3%), concentrate (24%), straw (17.8%) and maize (10.9%) for cows, followed by diesel fuel (6.6%) and electricity (5.6%). The global warming potential for the production of 1000 kg of raw milk at the dairy-farm gate was estimated at 457 kg CO{sub 2,eq}. Thus, more than 69% of the total impact at the milk-processing gate resulted from the previous two sub-systems (feed production and dairy farm), with the feed-production stage accounting for the largest fractions of the environmental burdens. - Highlights: • Environmental aspects of milk production in Iran were investigated using LCA. • Feed production, dairy farm and dairy factory were taken into account. • Feed production stage was

Sustainability evaluation of pasteurized milk production with a life cycle assessment approach: An Iranian case study

International Nuclear Information System (INIS)

Rafiee, Shahin; Khoshnevisan, Benyamin; Mohammadi, Issa; Aghbashlo, Mortaza; Musazadeh, Hossein; Clark, Sean

2016-01-01

Agro-food systems play a significant role in the economies of all nations due to energy use and the resulting environmental consequences. The sustainability of these systems is determined by a multitude of interacting economic, social and environmental factors. Dairy production presents a relevant example of the sustainability trade-offs that occur within such systems. On the one hand, dairy production constitutes an important part of the human diet, but it is also responsible for significant emissions of potent greenhouse gases and other pollutants. In this study, the environmental aspects of pasteurized milk production in Iran were investigated using a life-cycle approach. Three sub-systems, namely feed production, dairy farm and dairy factory, were taken into account to determine how and where Iranian pasteurized milk production might be made more environmentally friendly and energy efficient. The results clearly demonstrate that the feed production stage was the hot spot in pasteurized milk production in terms of energy consumption, environmental burdens and economic costs. The largest share of the total production costs belonged to animal feeds (43%), which were part of the feed production stage. The largest consumers of energy in the production of raw milk were alfalfa (30.3%), concentrate (24%), straw (17.8%) and maize (10.9%) for cows, followed by diesel fuel (6.6%) and electricity (5.6%). The global warming potential for the production of 1000 kg of raw milk at the dairy-farm gate was estimated at 457 kg CO_2_,_e_q. Thus, more than 69% of the total impact at the milk-processing gate resulted from the previous two sub-systems (feed production and dairy farm), with the feed-production stage accounting for the largest fractions of the environmental burdens. - Highlights: • Environmental aspects of milk production in Iran were investigated using LCA. • Feed production, dairy farm and dairy factory were taken into account. • Feed production stage was the

Early cow's milk consumption among Brazilian children: results of a national survey.

Science.gov (United States)

Bortolini, Gisele Ane; Vitolo, Márcia Regina; Gubert, Muriel Bauermann; Santos, Leonor Maria Pacheco

2013-01-01

to assess the intake, frequency, and type of milk consumed by Brazilian children younger than 60 months of age. this was a cross-sectional study, which used secondary data from the National Demographic and Health Survey of 2006-2007. Data from 4,817 children under the age of 60 months were used. All analyses were performed with expanded samples. The dietetic survey assessed the previous day's consumption, and estimates were made through univariate analysis, presented as a percentage. on the day prior to the survey, breast milk was consumed by 91% of the children younger than six months of age, by 61.5% of the children aged 6 to 12 months, and by 34.8% of the children aged 13 to 24 months. Among the children who had received other types of milk, cow's milk was consumed by 62.4% of the children younger than six months, by 74.6% of the children aged 6 to 12 months, and by approximately 80% of the children older than 12 months. Infant formulas were consumed by 23% of the children younger than six months of age, by 9.8% of the children aged 6 to 12 months, and by less than 1% of the older children. Soy milk consumption varied from 14.6% to 20% among the investigated ages. Non-breast milk consumption before the age of six months was more frequent in children living in the Northeastern and Southern regions. the results of the present study demonstrated that most children received cow's milk prematurely as a substitute for breast milk, highlighting the importance of the development of public policies to promote, protect, and support breastfeeding in all regions of Brazil, aiming at reversing the observed scenario. Copyright © 2013 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

The microbial content of raw and pasteurized cow milk as determined by molecular approaches.

Science.gov (United States)

Quigley, Lisa; McCarthy, Robert; O'Sullivan, Orla; Beresford, Tom P; Fitzgerald, Gerald F; Ross, R Paul; Stanton, Catherine; Cotter, Paul D

2013-08-01

The microbial composition of raw and pasteurized milk is assessed on a daily basis. However, many such tests are culture-dependent, and, thus, bacteria that are present at subdominant levels, or that cannot be easily grown in the laboratory, may be overlooked. To address this potential bias, we have used several culture-independent techniques, including flow cytometry, real-time quantitative PCR, and high-throughput DNA sequencing, to assess the microbial population of milk from a selection of commercial milk producers, pre- and postpasteurization. The combination of techniques employed reveals the presence of a previously unrecognized and diverse bacterial population in unpasteurized cow milk. Most notably, the use of high-throughput DNA sequencing resulted in several bacterial genera being identified in milk samples for the first time. These included Bacteroides, Faecalibacterium, Prevotella, and Catenibacterium. Our culture-independent analyses also indicate that the bacterial population of pasteurized milk is more diverse than previously appreciated, and that nonthermoduric bacteria within these populations are likely to be in a damaged, nonculturable form. It is thus apparent that the application of state-of-the-art approaches can provide a detailed insight into the bacterial composition of milk and could potentially be employed in the future to investigate the factors that influence the composition of these populations. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The risk of Vibrio parahaemolyticus infections associated with consumption of raw oysters as affected by processing and distribution conditions in Taiwan

Science.gov (United States)

The steadily increased consumption of raw oysters in Taiwan warrants an assessment of the risk (probability of illness) of raw oyster consumption attributed by Vibrio parahaemolyticus. The aim of this study was to estimate the risk of V. parahaemolyticus infection associated with raw oyster consumpt...

Assessment of Staphylococcus aureus along milk value chain and its public health importance in Sebeta, central Oromia, Ethiopia.

Science.gov (United States)

Ayele, Yodit; Gutema, Fanta Desissa; Edao, Bedaso Mamo; Girma, Robel; Tufa, Takele Beyene; Beyene, Tariku Jibat; Tadesse, Fanos; Geloye, Mesula; Beyi, Ashenafi Feyisa

2017-06-27

Staphylococcus aureus is one of the leading causes of gastroenteritis acquired from contaminated foods such as milk and milk products. However, such information is limited in Ethiopia. A cross-sectional study was conducted to assess the contamination of milk with S. aureus and knowledge, attitudes and practices (KAP) of actors along the milk value chain in Sebeta, Central Oromia, Ethiopia. A total of 291 samples collected from dairy farms, milk collection centers (MCCs) and processing plant were examined using standard microbiological techniques. The antimicrobial susceptibility profiles of the isolates were also investigated. The KAP of actors in milk value chain were evaluated through a structured questionnaire. Overall, 23.4% (n = 68) of the samples were positive for S. aureus. The prevalence of S. aureus was 19.6% (95% CI: 14.5-25.6) and 80.0% (95% CI: 14.5-25.6) at farm level and MCCs, respectively. Higher isolation rate was observed in the MCCs (p = 0.000) than the farms. The contamination rates of hands of milkers' and milking buckets with S. aureus were 32% and 11.1%, respectively. S. aureus was not isolated from pasteurized milk samples. The isolates were found to be resistant to cefoxitin (100%), penicillin G (98.5%), and streptomycin (77.9%). Among 23 interviewed farmers, 35% of them consumed raw milk, none of them wash their hands and 82.6% did not wash udder and teat before milking. Six percent of consumers had the habit of raw milk consumption. Eighty seven percent of dairy farmers and 54% of consumers had no awareness about milk borne diseases and staphylococcal food poisoning. The study revealed a high prevalence of S. aureus along the milk value chain, poor milk handling practices, raw milk consumption behavior, lack of awareness about milk borne diseases and occurrence of antimicrobials resistant S. aureus. S. aureus seems to pose a public health risk in Sebeta. Authors recommended the urgent need of public awareness creation about the

Identification of lactose ureide, a urea derivative of lactose, in milk and milk products.

Science.gov (United States)

Suyama, K; Sasaki, A; Oritani, T; Hosono, A

2011-12-01

With the widespread consumption of milk, the complete characterization of the constituents of milk and milk products is important in terms of functionality and safety. In this study, a novel nonreducing carbohydrate was separated from powdered skim milk and was identified using electron spray ionization-mass spectrometry (m/z 385.1[M + H(+)]), ¹H, ¹³C, ¹H¹H-correlation spectroscopy, and heteronuclear single quantum-nuclear magnetic resonance spectra. The carbohydrate was identified as a lactose derivative of urea, N-carbamoyl-o-β-D-galactopyranosyl-(1-4)-D-glucopyranosylamine (lactose ureide, LU). For the HPLC analysis of LU in milk and milk products, benzoylated LU, hepta-o-benzoyl lactose ureide (melting point 137-139°C; m/z 1,113 [M + H⁺]; wavelength of maximum absorption, λ(max), 229 nm; molar extinction coefficient, ε, 8.1037 × 10⁷), was used as a standard. The crude nonreducing carbohydrate fraction from raw milk, thermally processed milk, and milk products such as powdered milks were directly benzoylated and subjected to HPLC analysis using an octadecylsilyl column to determine the quantity of LU. The content of LU in 10% solutions of powdered skim milk and powdered infant formula (5.0±1.1 and 4.9±1.5 mg/L, respectively) were almost 3-fold higher than that of UHT milk (1.6±0.5 mg/L) and higher than that of low-temperature, long-time-processed (pasteurized at 65°C for 30 min) milk (1.2±0.3 mg/L) and the fresh raw milk sample (0.3±0.1 mg/L). A time-course of the LU content in raw milk during heating at 110°C revealed that LU increased with time. From these results, it is likely that LU is formed by the Maillard-type reaction between the lactose and urea in milk and milk products. Because the concentration of LU in milk increased with the degree of processing heat treatment, it could serve as an indicator of the thermal deterioration of milk. Although it is known that the human intestine is unable to digest LU, the gastrointestinal bacteria

A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

Directory of Open Access Journals (Sweden)

Tian Ding

2017-05-01

Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

EFFECTIVENESS OF RISK MANAGEMENT IN DIRECTLY RAW MILK SELLING AT “E. AVANZI” CENTER OF PISA UNIVERSITY

Directory of Open Access Journals (Sweden)

S. Rindi

2010-03-01

Full Text Available Authors show the results about the effectiveness verification of prevention measures adopted in raw milk directly selling at “E. Avanzi” Centre of Pisa University. The good hygienic practices applied during production, storage and selling phases demonstrated to guarantee, in raw milk, conditions complying to hygienic criteria provided for the current regulation in Tuscany. The effectiveness verification about risk communication, carried out interviewing a sample of buyers, shows as, beside a predominant attitude towards attention to potential hygienic risks, overstay areas of reduced awareness about food risk and the ways to manage prevention. Authors hope for, in this context, such as in other similar productions, the approach yet launched towards continuous improvement of good hygienic practices adopted by businesses, could be extended to risk communication, with the aim to promote conscious and responsable choices of consumer.

PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

Science.gov (United States)

Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

2008-12-10

Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

Determination of protein concentration in raw milk by mid-infrared fourier transform infrared/attenuated total reflectance spectroscopy.

Science.gov (United States)

Etzion, Y; Linker, R; Cogan, U; Shmulevich, I

2004-09-01

This study investigates the potential use of attenuated total reflectance spectroscopy in the mid-infrared range for determining protein concentration in raw cow milk. The determination of protein concentration is based on the characteristic absorbance of milk proteins, which includes 2 absorbance bands in the 1500 to 1700 cm(-1) range, known as the amide I and amide II bands, and absorbance in the 1060 to 1100 cm(-1) range, which is associated with phosphate groups covalently bound to casein proteins. To minimize the influence of the strong water band (centered around 1640 cm(-1)) that overlaps with the amide I and amide II bands, an optimized automatic procedure for accurate water subtraction was applied. Following water subtraction, the spectra were analyzed by 3 methods, namely simple band integration, partial least squares (PLS) and neural networks. For the neural network models, the spectra were first decomposed by principal component analysis (PCA), and the neural network inputs were the spectra principal components scores. In addition, the concentrations of 2 constituents expected to interact with the protein (i.e., fat and lactose) were also used as inputs. These approaches were tested with 235 spectra of standardized raw milk samples, corresponding to 26 protein concentrations in the 2.47 to 3.90% (weight per volume) range. The simple integration method led to very poor results, whereas PLS resulted in prediction errors of about 0.22% protein. The neural network approach led to prediction errors of 0.20% protein when based on PCA scores only, and 0.08% protein when lactose and fat concentrations were also included in the model. These results indicate the potential usefulness of Fourier transform infrared/attenuated total reflectance spectroscopy for rapid, possibly online, determination of protein concentration in raw milk.

Exploratory analysis of dynamics of frequency distribution of raw cow milk quality indicators in the Czech Republic

Directory of Open Access Journals (Sweden)

Oto Hanuš

2011-01-01

Full Text Available A consistent link of the raw milk quality (RMQ to the farmer price is essential. The aim was to analyse the properties of milk quality indicators (MQIs and propose a new synthetic relative MQI (SQSM from among various individual MQIs. SQSM could serve for consistent inclusion each quality change into the price. The paper was focused on exploratory analysis (normality (N testing of files of MQIs. On the basis of the results, the MQIs were divided into two groups without and with necessity of original data transformation (TRN. Log and Box–Cox TRNs were tested in terms of possibilities of the files approach to the normal data frequency distribution (FD. The compositional MQIs deviated less and health and hygienic MQIs more from normal FD in original data (P < 0.05. The TRNs approached the data files to N very markedly in health and hygienic MQIs. The synthesis of various values of MQIs into SQSM was proposed. SQSM values were derived from model file of real data about MQIs and validated for use at farmer milk price modifications by the normality FD test. 33.3% of month SQSM files were normal (P > 0.05, the other were very close to the N with negligible deviations. The useability of the SQSM system for the balancing of raw milk purchase price premiums and penalties was tentatively confirmed.

Cow milk consumption, insulin-like growth factor-I, and human biology: a life history approach.

Science.gov (United States)

Wiley, Andrea S

2012-01-01

To assess the life history consequences of cow milk consumption at different stages in early life (prenatal to adolescence), especially with regard to linear growth and age at menarche and the role of insulin-like growth factor I (IGF-I) in mediating a relationship among milk, growth and development, and long-term biological outcomes. United States National Health and Nutrition Examination Survey (NHANES) data from 1999 to 2004 and review of existing literature. The literature tends to support milk's role in enhancing growth early in life (prior to age 5 years), but there is less support for this relationship during middle childhood. Milk has been associated with early menarche and with acceleration of linear growth in adolescence. NHANES data show a positive relationship between milk intake and linear growth in early childhood and adolescence, but not middle childhood, a period of relatively slow growth. IGF-I is a candidate bioactive molecule linking milk consumption to more rapid growth and development, although the mechanism by which it may exert such effects is unknown. Routine milk consumption is an evolutionarily novel dietary behavior that has the potential to alter human life history parameters, especially vis-à-vis linear growth, which in turn may have negative long-term biological consequences. Copyright © 2011 Wiley Periodicals, Inc.

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

High-pressure homogenization of raw and pasteurized milk modifies the yield, composition, and texture of queso fresco cheese.

Science.gov (United States)

Escobar, D; Clark, S; Ganesan, V; Repiso, L; Waller, J; Harte, F

2011-03-01

High-pressure homogenization (HPH) of milk was studied as an alternative processing operation in the manufacturing of queso fresco cheese. Raw and pasteurized (65°C for 30 min) milks were subjected to HPH at 0, 100, 200, and 300 MPa and then used to manufacture queso fresco. The cheeses were evaluated for yield, moisture content, titratable acidity, nitrogen content, whey protein content, yield force, yield strain, and tactile texture by instrumental or trained panel analyses. The combination of HPH and thermal processing of milk resulted in cheeses with increased yield and moisture content. The net amount of protein transferred to the cheese per kilogram of milk remained constant for all treatments except raw milk processed at 300 MPa. The highest cheese yield, moisture content, and crumbliness were obtained for thermally processed milk subjected to HPH at 300 MPa. The principal component analysis of all measured variables showed that the variables yield, moisture content, and crumbliness were strongly correlated to each other and negatively correlated to the variables yield strain, protein content (wet basis), and sensory cohesiveness. It is suggested that the combination of thermal processing and HPH promotes thermally induced denaturation of whey protein, together with homogenization-induced dissociation of casein micelles. The combined effect results in queso fresco containing a thin casein-whey matrix that is able to better retain sweet whey. These results indicate that HPH has a strong potential for the manufacture of queso fresco with excellent yield and textural properties. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Interspecies and seasonal differences of retinol in dairy ruminant´s milk

Directory of Open Access Journals (Sweden)

Lucia Hodulová

2015-08-01

Full Text Available Milk is an essential source of macronutrients and among lipophilic vitamins is significant source of retinol. The contribution of milk to the reference daily intake for retinol varies from 11% to 16%, worldwide. The most consumed dairy products are fresh, dehydrated and condensed milk in which the amonuts of retinol are not modified to those of in whole milk. Retinol is essential to ensure a good functionality of the immune system and plays a critical role in vision, reproduction, cell differentiation as well as growth and development and is found only in animal tissues. The aim of our study was to evaluate the interspecies differences in the retinol concentration of whole raw bovine, caprine and ovine milk and to observe seasonal variation of retinol in bulk tank milk samples. Samples of raw milk were colleceted on different farms in the Czech Republic between 2013 and 2014. Retinol was measured by ultra high performance liquid chromatography with UV detection (325 nm in isocratic mode after alkaline saponification with methanolic potassium hydroxide solution and liquid-liquid extraction into non polar organic solvent of whole raw milk. To avoid vitamin losses or degradation during the procedure, antioxidants were added to the sample extraction media. Our results indicate significant interspecies differences between bovine and ovine milk and caprine and ovine milk. Concentration of retinol is very similar in bovine and caprine milk 0.96 ±0.11 mg/L, 0.94 ±0.25 mg/L, respectively. The mean concentration in sheep´s milk is 1.75 ±0.24 mg/L. The seasonal variation of retinol in raw bovine milk was detected as high significant, with the highest concentration during winter. These results contribute to the nutrition evaluation of milk in the Czech Republic and indicate, that the sheep´s milk is the best source of retinol among the milks of ruminants kept in the Czech Republic, however it is not used in its fluid form for human consumption.

Type of cows' milk consumption and relationship to health predictors in New Zealand preschool children.

Science.gov (United States)

Mazahery, Hajar; Camargo, Carlos A; Cairncross, Carolyn; Houghton, Lisa A; Grant, Cameron C; Coad, Jane; Conlon, Cathryn A; von Hurst, Pamela R

2018-01-19

New Zealand dietary guidelines recommend children from two years of age consume low- or reduced-fat milk. We aimed to investigate the predictors of type of milk consumption in preschool children. Data were drawn from a cross-sectional study which enrolled preschool children (2-milk was consumed regularly by 88% of children. Of these, 26% consumed plain low- or reduced-fat milk, while 74% consumed full-fat milk. The adjusted odds of consuming plain low- or reduced-fat milk were increased in older children: three-year old (OR=1.80, 95% CI 1.29-2.50); four-year old (OR=1.93, 95% CI 1.38-2.72) versus two-year old children, and were decreased in Māori (OR=0.56, 95% CI 0.36-0.88) and Pacific children (OR=0.32, 95% CI 0.12-0.86) compared with New Zealand European children. Approximately 18% of children were overweight/obese. The odds (adjusted for socio-demographic characteristics) of consuming plain low- or reduced-fat milk were increased in overweight children (OR=1.74, 95% CI 1.20-2.54) than normal weight children. The type of milk consumed by preschool children varies with child demographics and anthropometry. Further research is warranted to investigate caregivers/parents' knowledge about dietary guidelines and to determine the causal relationship between obesity and milk type consumption. The findings of the current study may have important implications for developing and shaping interventions and in helping shape public health policy and practice to promote cows' milk consumption in preschool children.

Prevalence of antibiotic resistant Staphylococcus aureus from raw milk samples collected from the local vendors in the region of Tirupathi, India

Directory of Open Access Journals (Sweden)

Sudhanthirakodi Sudhanthiramani

2015-04-01

Full Text Available Aim: The study was carried out with the aim to identify the suitability of the milk for consumer use with special reference to Staphylococcus aureus from milk samples collected from various local vendors and determine the antibiotic susceptibility pattern of those positive isolates. Materials and Methods: A total of 110 milk samples were collected from the local milk vendors in and around Tirupathi region of India. All the samples were enriched with buffered peptone water in 9:1 ratio and the then inoculated on baird parker agar medium with added 2% egg yolk tellurite emulsion as selective medium for S.aureus and confirmed with mannitol salt agar, Gram’s staining and biochemical tests. The typical cultural characters with coagulase-positive samples were taken as positive samples the positive samples were tested for antibiotic susceptibility with 10 different antibiotics by employing disc diffusion method. Results: Prevalence of coagulase-positive S. aureus was 39.09% (43/110 from the milk samples. The antibiotic susceptibility test of positive isolates showed high resistant toward penicillin G 37/43 (86.04% and ampicillin 32/43 (74.42%, and also showed resistant to methicillin 6/43 (13.95%, cephalothin 6/43 (13.95%, tetracycline 6/43 (13.95%, ciprofloxacin 4/43 (9.30%, enrofloxacin 3/43 (6.97%, cefoxitin 2/43 (4.65%, gentamicin 2/43 (4.65%, and co-trimoxazole 2/43 (4.65%. Many individual isolates showed resistant against two or more antibiotics in our study. Conclusion: The above study results show that the milk samples collected from local vendor having S. aureus, which can induce disease condition as well as antibiotic resistant to the humans particularly young children and old age peoples by means of consumption of raw milk and its products. This is the public health issue, which needs to be solved by educating the local vendors regarding health problems related to unhygienic milk supply and make the awareness among the consumers about this

Milking systems and milking robots. Insight in energy consumption; Melksystemen en melkrobots. Inzicht in energiegebruik

Energy Technology Data Exchange (ETDEWEB)

Wientjes, H.; Rougoor, C. [DLV Rundvee Advies, Uden (Netherlands)

2012-03-15

Insight is given in the energy consumption during milking and how much energy can be saved. The goal is to reduce greenhouse gas emissions, produce renewable energy and the minimization of energy consumption in the dairy industry [Dutch] Inzicht wordt gegeven in het energieverbruik bij de melkwinning en de vraag welke energiebesparing hierbij nog haalbaar is. Het doel is vermindering van de uitstoot van broeikasgassen, productie van duurzame energie en de minimalisatie van het energieverbruik in de melkveehouderij.

The consumption of flavored milk among a children population. The influence of beliefs and the association of brands with emotions.

Science.gov (United States)

De Pelsmaeker, Sara; Schouteten, Joachim; Gellynck, Xavier

2013-12-01

Although milk and dairy products are seen as an important part of a child's diet, their consumption is declining. The aim of this study is to investigate the consumption of milk and flavored milk among a sample of 513 Belgian children aged between 8 and 13 years. In addition, the association between flavored milk brands and emotions is examined. Children prefer and consume more flavored than plain milk. They indicate that consumption is a self-made choice and that parents mainly ensure the availability of these products. Children prefer flavored milk to plain milk, although it is perceived to be less healthy. No correlation could be found between brand awareness and the consumption of flavored milk. Brands of flavored milk evoke divergent emotions and can be classified into different groups based upon their association with a type of emotion (i.e. positive/negative). This study demonstrates that taste is an important factor in flavored milk consumption by children and shows a strong relationship between brands and emotions. Consequently, the taste needs to be appealing for children, but it is equally important that children associate the brand with positive emotions, as this will lead to a higher preference. Milk producers who target children can use the insights gained from this study in the development of new products. Copyright © 2013 Elsevier Ltd. All rights reserved.

Low-fat Milk Consumption among Children and Adolescents in the United States, 2007-2008

Science.gov (United States)

... the National Technical Information Service NCHS Low-fat Milk Consumption Among Children and Adolescents in the United ... Survey How frequently do children and adolescents drink milk? During the preceding 30 days, girls reported daily ...

Validation of a rapid lateral flow test for the simultaneous determination of β-lactam drugs and flunixin in raw milk.

Science.gov (United States)

Douglas, David; Banaszewski, Katie; Juskelis, Rima; Al-Taher, Fadwa; Chen, Yang; Cappozzo, Jack; McRobbie, Lindsay; Salter, Robert S

2012-07-01

β-Lactam antibiotics are the most commonly used drugs on dairy farms. β-Lactam residues in milk are kept out of the human milk supply with good agricultural practices and mandatory truck screening performed by the dairy industry under Appendix N of the Pasteurized Milk Ordinance. Flunixin, a nonsteroidal and anti-inflammatory drug, appears in dairy cattle tissue residues with a frequency similar to the occurrence of penicillin G. This creates concern that flunixin residues could be in milk and would go undetected under current milk screening programs. A single test that combines mandatory β-lactam screening with voluntary flunixin screening is an economical approach for monitoring and controlling for potential flunixin or 5-hydroxyflunixin, the primary flunixin metabolite marker in milk. The objective of this study was to validate a β-lactam and flunixin rapid lateral flow test (LFT) and compare the results obtained with a liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS) method for the simultaneous determination of flunixin and 5-hydroxyflunixin in raw milk with a limit of detection of , 1 ppb, equivalent to 1 ng/ml. Using the LFT, three combined manufactured lots of test strips detected penicillin G at 2.0 ppb, ampicillin at 6.8 ppb, amoxicillin at 5.9 ppb, cephapirin at 13.4 ppb, ceftiofur (total metabolites) at 63 ppb, and 5-hydroxyflunixin at 1.9 ppb at least 90% of the time with 95% confidence. The LFT also detected incurred flunixin milk samples that were analyzed with the LC-MS/MS and diluted to tolerance in raw milk. The detection levels for the LFT are lower than the U.S. safe levels or tolerances and qualify the test to be used in compliance with U.S. milk screening programs.

Contamination Level of Staphylococcus spp. in Raw Goat Milk and Associated Risk Factors

Directory of Open Access Journals (Sweden)

E. Taufik

2008-12-01

Full Text Available This study was aimed to investigate the presence of pathogenic bacteria in raw goat milk by using Staphylococcus spp. as indicator bacteria, and also to evaluate the potential risk factors associated with them. Information regarding potential risk factors was collected by questionnaire. The conventional bacteriological method for bacterial isolation and the indirect test (California Mastitis Test (CMT for determining udder inflammation status were employed. A sample size of 300 udder halves milk samples from three commercial dairy goat farms in the Bogor District, West Java Province, Indonesia were investigated for counts and prevalence of indicator bacteria. Ten potential risk factors were also evaluated in relation to counts and prevalence of indicator bacteria. The results showed that the median value of indicator bacterial count from overall udder-half milk samples was 3.00 log cfu/ml. The indicator bacterial count from udder-half milk samples was significantly different (P<0.05 among farms. Overall prevalence of Staphylococcus spp. was 78.7%. As one of potential risk factors, udder inflammation status was found to be risk factor for Staphylococcus spp. contamination in milk. Udders with inflammation had significant association and a higher chance of having contaminated samples by Staphylococcus spp. as compared to udders without inflammation. Additionally, according to these study results, CMT can be used as an effective, reliable, cheap and “farm and farmer friendly test” for screening test of intramammary infection (IMI or sub clinical mastitis in dairy goats.

Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

Science.gov (United States)

Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

2015-01-01

Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, psap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk

Directory of Open Access Journals (Sweden)

Milan Vasiľ

2016-12-01

Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics.  Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.

Relationships between milk consumption and academic performance, learning motivation and strategy, and personality in Korean adolescents.

Science.gov (United States)

Kim, Sun Hyo; Kim, Woo Kyoung; Kang, Myung-Hee

2016-04-01

A healthy diet has been reported to be associated with physical development, cognition and academic performance, and personality during adolescence. This study was performed to investigate the relationships among milk consumption and academic performance, learning motivation and strategies, and personality among Korean adolescents. The study was divided into two parts. The first part was a survey on the relationship between milk consumption and academic performance, in which intakes of milk and milk products and academic scores were examined in percentiles among 630 middle and high school students residing in small and medium-sized cities in 2009. The second part was a survey on the relationships between milk consumption and learning motivation and strategy as well as personality, in which milk consumption habits were collected and Learning Motivation and Strategy Test (L-MOST) for adolescents and Total Personality Inventory for Adolescents (TPI-A) were conducted in 262 high school students in 2011. In the 2009 survey, milk and milk product intakes of subjects were divided into a low intake group (LM: ≤ 60.2 g/day), medium intake group (MM: 60.3-150.9 g/day), and high intake group (HM: ≥ 151.0 g/day). Academic performance of each group was expressed as a percentile, and performance in Korean, social science, and mathematics was significantly higher in the HM group (P learning strategy total," "testing technique," and "resources management technique" scores (P learning strategy total, class participation technique, and testing technique showed significantly positive correlations (P academic performance (Korean, social science, and mathematics) in Korean adolescents. In male high school students, particularly, higher milk intake frequency was positively correlated with learning motivation and strategy as well as some items of the personality inventory.

Full fat milk consumption protects against severe childhood obesity in Latinos

OpenAIRE

Amy L. Beck; Melvin Heyman; Cewin Chao; Janet Wojcicki

2017-01-01

Consumption of non- or low-fat dairy products is recommended as a strategy to lower the risk of childhood obesity. However, recent evidence suggests that consumption of whole fat dairy products may, in fact, be protective against obesity. Our objective was to determine the association between milk fat consumption and severe obesity among three-year-old Latino children, a population with a disproportionate burden of obesity and severe obesity. 24-hour-dietary recalls were conducted to determin...

Economic analysis of milk production and consumption in the Middle East and North Africa

Directory of Open Access Journals (Sweden)

Mansoor Maitah

2012-01-01

Full Text Available Milk products are considered as the essential food commodities for humans. Milk products contain essential elements for the human body such as protein, glucose, minerals and vitamins. Moreover, milk is considered the cheapest source of animal protein, an important resource for some related transformation industries and provides employment opportunities for a large number of small producers in both rural and urban areas. The aim of this paper is to analyze the factors which determine the supply and demand for liquid milk (henceforth milk in the Middle East and North Africa in order to point out the main problems and constraints obstructing the milk production in this region. The research also attempts to understand the drivers for the development in milk production in the Middle East and North Africa.Total milk production in the Middle East and North Africa increased from about 12.57 million tons in 1990 to about 25.18 millions tons in 2008. This paper attempts to identify the factors which influence the effectiveness of production, consumption and foreign trade of milk in the Middle East and North Africa. The most important factors affecting consumption is the population, per capita income and produced quantity where a 1% increase in all of them results in increasing the quantity consumed by 1.3%, 2.86% and 0.611%, respectively. Milk sector provides employment opportunities for more than 25% of the working force in some Middle East and North Africa countries.

β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

Science.gov (United States)

Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

2011-07-01

Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

District Policies and Practices Vary in Their Association With Adolescents' Consumption of Milk and 100% Fruit Juice.

Science.gov (United States)

Sliwa, Sarah A; Miller, Gabrielle F; Brener, Nancy D; Park, Sohyun; Merlo, Caitlin L

2017-05-01

Researchers previously examined the relationship between school beverage policies and sugar-sweetened beverage (SSB) consumption. This study addressed a research gap by examining cross-sectional associations between district-level policies and practices and U.S. high school students' consumption of milk and 100% fruit juice. Data from the 2012 School Health Policies and Practices Study and 2013 Youth Risk Behavior Surveillance System were linked for 12 large urban school districts. Outcome variables were daily milk consumption (≥1 glass/day) and 100% fruit juice consumption (≥1 time/day). Exposure variables were five district policies (i.e., restrict SSB sales, maintain closed campuses, offer/sell healthful alternatives, restrict promotional products, and require nutrition education). Logistic regression models estimated the odds of consuming milk or 100% fruit juice daily, conditional on the policies and adjusting for sex, race/ethnicity, grade level, weight status, and district free/reduced-price lunch eligibility (n = 23,173). Students in districts that required/recommended restricting the times of SSB sales had 55% higher (adjusted odds ratio [AOR], 1.55; 95% confidence interval [CI], 1.28-1.87) odds of consuming ≥1 glass/day of milk than students in districts without this policy. Closed campus policies were associated with lower odds of consuming milk (AOR, .72; 95% CI, .63-.82) and higher odds of consuming juice (AOR, 1.27; 95% CI, 1.07-1.50). Policies requiring/recommending that districts offer/sell healthful alternatives were associated with lower odds of consuming 100% fruit juice daily. Results suggest that restricting SSB sales may support adolescents' milk consumption. Future studies should assess whether the implementation of federal standards that further restrict SSB sales in school leads to increased milk consumption. Published by Elsevier Inc.

Association of Milk and Dairy Products Consumption During Pregnancy with Fetal and Neonatal Head Circumferences: A Systematic Review

Directory of Open Access Journals (Sweden)

Razieh Karimbeiki

2016-11-01

Full Text Available Context Milk and dairy products consumed by mothers seem to be effective for fetal and neonatal anthropometric measurements, because they contain various nutrients. Objectives The aim of this study was to systematically review the influence of milk and dairy products consumption by mothers on fetal and neonatal head circumferences. Data Sources Systematic searches were conducted in electronic databases including PubMed/MEDLINE, Scopus, ISI, Ovid, Embase, Medlib, Google Scholar, clinical trials and Cochrane central register of clinical trials. Study Selection All studies that assessed the relationship between milk and dairy products consumption in healthy females during pregnancy and fetal and neonatal head circumferences were included in our systematic review. Finally, seven studies were relevant that included five cohort studies, one cross-sectional study and one randomized clinical trial. Data Extraction This systematic review was performed based on the preferred reporting item for systematic reviews and meta-analysis (PRISMA statement recommendation, and for quality assessment, the Newcastle-Ottawa scale (NOS for cohort studies, the adapted NOS for a cross-sectional study and the Jadad quality assessment score for a randomized clinical trial, were used. Results Seven studies that comprised of more than 50000 pregnant females were included in this review. One cohort study, one cross-sectional study and one randomized controlled trial study showed that milk or dairy products consumption by pregnant mothers was not associated with neonatal birth head circumference, while three cohort studies reported that maternal milk or dairy products intake had a positive effect on neonatal birth head circumference. Two cohort studies showed that there was no relationship between maternal milk or dairy products consumption and fetal head circumference while a cross-sectional study reported that there was a positive relationship between milk or dairy products

Evaluation of effectiveness of class-based nutrition intervention on changes in soft drink and milk consumption among young adults.

Science.gov (United States)

Ha, Eun-Jeong; Caine-Bish, Natalie; Holloman, Christopher; Lowry-Gordon, Karen

2009-10-26

During last few decades, soft drink consumption has steadily increased while milk intake has decreased. Excess consumption of soft drinks and low milk intake may pose risks of several diseases such as dental caries, obesity, and osteoporosis. Although beverage consumption habits form during young adulthood, which has a strong impact on beverage choices in later life, nutrition education programs on beverages are scarce in this population. The purpose of this investigation was 1) to assess soft drink and milk consumption and 2) to evaluate the effectiveness of 15-week class-based nutrition intervention in changing beverage choices among college students. A total of 80 college students aged 18 to 24 years who were enrolled in basic nutrition class participated in the study. Three-day dietary records were collected, verified, and analyzed before and after the intervention. Class lectures focused on healthful dietary choices related to prevention of chronic diseases and were combined with interactive hands on activities and dietary feedback. Class-based nutrition intervention combining traditional lecture and interactive activities was successful in decreasing soft drink consumption. Total milk consumption, specifically fat free milk, increased in females and male students changed milk choice favoring skim milk over low fat milk. (1% and 2%). Class-based nutrition education focusing on prevention of chronic diseases can be an effective strategy in improving both male and female college students' beverage choices. Using this type of intervention in a general nutrition course may be an effective approach to motivate changes in eating behaviors in a college setting.

Evaluation of effectiveness of class-based nutrition intervention on changes in soft drink and milk consumption among young adults

Directory of Open Access Journals (Sweden)

Holloman Christopher

2009-10-01

Full Text Available Abstract Background During last few decades, soft drink consumption has steadily increased while milk intake has decreased. Excess consumption of soft drinks and low milk intake may pose risks of several diseases such as dental caries, obesity, and osteoporosis. Although beverage consumption habits form during young adulthood, which has a strong impact on beverage choices in later life, nutrition education programs on beverages are scarce in this population. The purpose of this investigation was 1 to assess soft drink and milk consumption and 2 to evaluate the effectiveness of 15-week class-based nutrition intervention in changing beverage choices among college students. Methods A total of 80 college students aged 18 to 24 years who were enrolled in basic nutrition class participated in the study. Three-day dietary records were collected, verified, and analyzed before and after the intervention. Class lectures focused on healthful dietary choices related to prevention of chronic diseases and were combined with interactive hands on activities and dietary feedback. Results Class-based nutrition intervention combining traditional lecture and interactive activities was successful in decreasing soft drink consumption. Total milk consumption, specifically fat free milk, increased in females and male students changed milk choice favoring skim milk over low fat milk. (1% and 2%. Conclusion Class-based nutrition education focusing on prevention of chronic diseases can be an effective strategy in improving both male and female college students' beverage choices. Using this type of intervention in a general nutrition course may be an effective approach to motivate changes in eating behaviors in a college setting.

The use of the Fourier Transform Infrared spectroscopy to determine adulterants in raw milk

Directory of Open Access Journals (Sweden)

Laerte Dagher Cassoli

2011-11-01

Full Text Available The objective of this study was to develop calibrations to determine the concentration of some milk adulterants by using the automated methodology of Fourier Transform Infrared (FTIR. For construction of calibrations, samples were collected from 100 farms in the states of São Paulo and Minas Gerais. Samples were tainted with three different adulterants commonly used in the adulteration of raw milk: sodium bicarbonate (SB, sodium citrate (SC and cheese whey (W. Each adulterant was used at three different concentrations (SB: 0.05, 0.10 and 0.25%; SC: 0.025, 0.050 and 0.075% and W: 5, 10 and 20%. For validation, 60 samples were collected in other farms, which were not considered at the development stage of calibration. Adulterants were added at the following concentrations: 0.03, 0.06, 0.10 and 0.12% for SB; 0.02, 0.04, 0.06 and 0.08% for SC and 5, 10 and 20% for W. Performance of each calibration was evaluated in terms of accuracy (Se, detection limit (DL and determination coefficient (R². All calibrations presented R² higher than 0.91 with DL of 0.015%; 0.017% and 3.9% for SB, SC and W, respectively. Accuracy was 0.005%, 0.009% and 2.26% for SB, SC and W, respectively. Results show that the FTIR methodology can be used for determining the concentration of sodium bicarbonate, sodium citrate and whey in raw milk. Associated with automated equipment, it is a viable option for monitoring these adulterants, having low operational costs and high analytical performance as additional features.

The changes of proteins fractions shares in milk and fermented milk drinks.

Science.gov (United States)

Bonczar, Genowefa; Walczycka, Maria; Duda, Iwona

2016-01-01

The aim of this research was to observe the changes which take place in the electrophoretic picture of milk proteins after pasteurisation and inoculation with different starter cultures (both traditional and probiotic). After incubation, the yoghurt, kefir, acidified milk, fermented Bifidobacterium bifidum drink and Lactobacillus acidophillus drink were chilled for 14 days to observe the changes which occurred. The research materials were raw and pasteurised milk, as well as fermented milk- based drinks. The raw milk used for research came from Polish Holstein-Fresian black and white cows. The milk was sampled 3 times and divided into 5 parts, each of which was pasteurised at 95°C for 10 min and then cooled for inoculation: yoghurt to 45°C, kefir and acidified milk to 22°C and drinks with Bifidobacterium bifidum and Lactobacillus acidophillus to 38°C. Milk was inoculated with lyophilised, direct vat starter cultures, in an amount equal to 2% of the working starter. For the production of fermented drinks, the subsequent starters were applied: "YC-180" Christian Hansen for yoghurt, "D" Biolacta-Texel-Rhodia for kefir, CH-N--11 Christian Hansen for acidified milk, starter by Christian Hansen for the probiotic Bifidobacterium bifidum milk, starter by Biolacta-Texel-Rhodia for the probiotic Lactobacillus acidophillus milk. The analyses were conducted in raw, pasteurised and freshly fermented milk as well as in milk drinks stored for 14 days. The total solid content was estimated by the drying method; the fat content by the Gerber method; the lactose content by the Bertrand method; the protein content by the Kjeldahl method with Buchi apparatus; the density of milk was measured with lactodensimeter; acidity with a pH-meter; and potential acidity by Soxhlet-Henkl method (AOAC, 1990). The electrophoretic separation of proteins in raw and pasteurised milk, as well as in freshly produced milk drinks and those stored for 14 days, was performed with SDS-PAGE (on

RESEARCH ON ENVIRONMENTAL CONTAMINATION IN RAW MILK IN TURIN DEPARTEMENT : HEAVY METALS, P.C.B, ORGANOCHLORINE AND ORGANOPHOSPHORUS PESTICIDES – YEARS 2005 – 2008

Directory of Open Access Journals (Sweden)

S. Cavallera

2013-02-01

Full Text Available In the period between 2005 and 2008 was carried out a survey on 252 samples of raw bovine milk collected in Turin departement to certain levels of contamination by heavy metals (Cd, Cr, Fe, Hg, Pb, Zn, PCB and organophosphorus and organochlorine pesticides. These results argue that the levels of heavy metals, PCB and pesticides are well below what is expected by the European legislation and that the situation is under control and that raw milk meets the hygiene requirements for human health.

INTRODUCTION OF PASTEURIZED/RAW COW'S MILK DURING THE SECOND SEMESTER OF LIFE AS A RISK FACTOR OF TYPE 1 DIABETES MELLITUS IN SCHOOL CHILDREN AND ADOLESCENTS.

Science.gov (United States)

Villagrán-García, Edna F; Hurtado-López, Erika F; Vasquez-Garibay, Edgar M; Troyo-Sanromán, Rogelio; Aguirre-Salas, Liuba M; Larrosa-Haro, Alfredo; León-Robles, Ruth V

2015-08-01

to demonstrate that type 1 diabetes mellitus (T1DM) in school children and adolescents is associated with the early introduction of pasteurized/raw cow's milk in the second semester of life. this non-probabilistic study included 150 subjects (75 patients and 75 controls), divided according to sex and age (range, 6 to 16 years). T1DM was considered to be a dependent variable, and pasteurized/ raw cow's milk (P/RCM) was considered to be an independent variable in the study. The statistical analyses included chi-squared test, odds ratio and 95% confidence intervals. the subjects were 51% male, age 11 ± 3.2 years, and 80% were breastfed, 18% were exclusively breastfed, and 13% received pasteurized/raw cow's milk. The children receiving P/RCM had a higher risk of T1DM [OR, 3.9 (1.2-12.8)]. The presence of T1DM was three times higher in those consuming P/RCM vs. those receiving follow-up formula [RM, 3.2 (1.03-10.07)]. introducing pasteurized/raw cow's milk in the second semester of life increased by four times the likelihood of developing T1DM in children and adolescents. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Factors Associated with Milk Consumption among College Students of Yazd University of Medical Sciences Based on Theory of Planned Behavior

Directory of Open Access Journals (Sweden)

Mohammad Hossein Baghianimoghadam

2016-02-01

Full Text Available Introduction: Daily milk consumption can be introduced as a healthy dietary pattern associated with a range of health benefits. This study aimed to determine factors associated with milk consumption among students of Yazd university of medical sciences based on the theory of planned behavior. Materials & Methods: This cross-sectional study was conducted on 385 students in 2014, who were selected via stratified random sampling. The study data was collected from a questionnaire based on the indirect construct of theory of planned behavior. Finally, the study data were analyzed using the T-test, Chi-square, and Fisher's exact tests. Results: In the present study, 64% of the students consumed milk daily. The behavioral intention, behavioral beliefs, normative beliefs, control beliefs, and perceived power were significantly associated with the milk consumption (p<0.05. Conclusion: Educating the students in regard with the importance of receiving enough amount of milk, modifying their misconceptions as well as reinforcing positive beliefs can be effective in increasing milk consumption. In addition, increasing access to milk in university campuses should be taken into consideration.

Outbreak of Human Brucellosis from Consumption of Raw Goats' Milk in Penang, Malaysia.

Science.gov (United States)

Leong, Kar Nim; Chow, Ting Soo; Wong, Peng Shyan; Hamzah, Siti Hawa; Ahmad, Norazah; Ch'ng, Chin Chin

2015-09-01

We report the largest outbreak of brucellosis in Penang, Malaysia. Brucellosis is not endemic in this region. The index case was a 45-year-old goat farm owner presented with 3 weeks of fever, headache, severe lethargy, poor appetite, and excessive sweating. He claimed to have consumed unpasteurized goat's milk that he had also sold to the public. Tests were negative for tropical diseases (i.e., dengue fever, malaria, leptospirosis and scrub typhus) and blood culture showed no growth. Based on epidemiological clues, Brucella serology was ordered and returned positive. Over a period of 1 year, 79 patients who had consumed milk bought from the same farm were diagnosed with brucellosis. Two of these patients were workers on the farm. Four laboratory staff had also contracted the disease presumably through handling of the blood samples. The mean duration from onset of symptoms to diagnosis was 53 days with a maximum duration of 210 days. A combination treatment of rifampin and doxycycline for 6 weeks was the first line of treatment in 90.5% of patients. One-third of the patients had sequelae after recovering and 21% had a relapse. We highlight the importance of Brucellosis as a differential diagnosis when a patient has unexplained chronic fever. © The American Society of Tropical Medicine and Hygiene.

The role of unpasteurized "hawked" milk in the transmission of brucellosis in Eldoret municipality, Kenya.

Science.gov (United States)

Namanda, Augustine Taban; Kakai, Rose; Otsyula, Mary

2009-05-01

Brucellosis is a zoonotic disease that continues to infect many people worldwide. Though its mortality rate is low, long convalescent periods associated with brucellosis translate into reduced socio-economic capacity of the people affected. Human brucellosis is mostly transmitted from animals. In Kenya, the prevalence of the disease has increased recently, along with the increased hawking of unpasteurized milk. The extent of the risk such raw milk poses to human health with respect to brucellosis is unknown. This study investigates the possibility of brucellosis being transmitted through unprocessed milk sold by hawkers in Eldoret municipality. In this cross-sectional study, 130 samples of unpasteurized pooled milk from hawkers and 14 pasteurized milk samples were collected from shops in selected estates using cluster and simple random sampling techniques. All samples were subjected to the Brucella Milk Ring Test (MRT) for screening. A milk consumption questionnaire was administered to households in the selected estates to establish their milk sources and consumption patterns. Data analysis involved comparing computed percentages of different variables. A high proportion of households (77.5%) consume unpasteurized milk from hawkers. However, no antibody to Brucella was detected in any of the milk samples collected. We find no evidence that hawked milk in Eldoret is responsible for transmitting brucellosis to consumers. More research in the potential transmission of brucellosis through milk consumption is recommended.

Methodology for the determination of residues of organophosphorous pesticides in milk of domestic consumption by means of gas chromatography and extraction in solid phase

International Nuclear Information System (INIS)

Romero Blanco, Eric; Meza Nunez, Humberto; Poveda Calvo, Vanessa

2005-01-01

A new method oriented to the detection and quantification of 15 organophosphate pesticide in raw milk samples for national consumption has been developed by using a gas chromatograph equipped with polydimethylsiloxane capillary column and a nitrogen-phosphorus detector (NPD), in combination with the extraction technique in solid phase (SPE) for the sample cleaning process and pesticide extraction. Recovery percentages obtained were close to 100% and the detection limits obtained were lower than 20 μg/L for 13 of the organophosphates analyzed. Overall, the method showed important improvement as compared to conventional liquid/liquid extraction methodologies. (Author) [es

Cyclic lipodepsipeptides produced by Pseudomonas spp. naturally present in raw milk induce inhibitory effects on microbiological inhibitor assays for antibiotic residue screening.

Directory of Open Access Journals (Sweden)

Wim Reybroeck

Full Text Available Two Pseudomonas strains, identified as closely related to Pseudomonas tolaasii, were isolated from milk of a farm with frequent false-positive Delvotest results for screening putative antibiotic residues in raw milk executed as part of the regulatory quality programme. Growth at 5 to 7°C of these isolates in milk resulted in high lipolysis and the production of bacterial inhibitors. The two main bacterial inhibitors have a molecular weight of 1168.7 and 1140.7 Da respectively, are heat-tolerant and inhibit Geobacillus stearothermophilus var. calidolactis, the test strain of most of the commercially available microbiological inhibitor tests for screening of antibiotic residues in milk. Furthermore, these bacterial inhibitors show antimicrobial activity against Staphylococcus aureus, Bacillus cereus and B. subtilis and also interfere negatively with yoghurt production. Following their isolation and purification with RP-HPLC, the inhibitors were identified by NMR analysis as cyclic lipodepsipeptides of the viscosin group. Our findings bring to light a new challenge for quality control in the dairy industry. By prolonging the refrigerated storage of raw milk, the keeping quality of milk is influenced by growth and metabolic activities of psychrotrophic bacteria such as pseudomonads. Besides an increased risk of possible spoilage of long shelf-life milk, the production at low temperature of natural bacterial inhibitors may also result in false-positive results for antibiotic residue screening tests based on microbial inhibitor assays thus leading to undue production loss.

Occurrence and antimicrobial resistance of Staphylococcus aureus in bulk tank milk and milk filters

Directory of Open Access Journals (Sweden)

Kateřina Bogdanovičová

2014-02-01

Full Text Available This work is focused on the monitoring of Staphylococcus aureus prevalence in raw milk and milk filters, its antibiotic resistance and detection of methicillin resistant Staphylococcus aureus (MRSA. Samples of raw cow´s milk and milk filters were collected in the period from 2012 till 2014, from 50 dairy farms in the Czech Republic. The total of 261 samples (164 samples of raw milk and 97 milk filters were cultivated on Baird-Parker agar. Both the typical and atypical colonies were examined by plasmacoagulase test and PCR method was used for detection of species specific fragment SA442 and mecA gene. Standard disk diffusion method was used to determinate resistance to antimicrobial agents. The bacterium Staphylococcus aureus was detected on 25 farms (50%. The antimicrobial resistance showed differences between the farms. Total of 58 samples were positive for Staphylococcus aureus, of which were 37 (14.2% isolated from raw milk samples and 21 (8.1% from milk filters. From these samples we isolated 62 Staphylococcus aureus strains, 41 isolates bacteria S. aureus from raw milk (66.1% and 21 isolates S. aureus from milk filters (33.9%. The presence of antibiotic resistance in Staphylococcus aureus isolates was low, most of them were resistant to amoxicilin. According to the results obtained by the PCR method for the methicillin - resistant S. aureus (MRSA, the mecA gene was present in 6 strains (9.7%, 4 isolates obtained from milk samples (6.5% and 2 isolates from milk filters (3.2%.  These isolates can be considered as a possible source of resistance genes, which can be spread through the food chain. Nowadays, a globally unfavourable increasing trend of prevalence of methicillin resistant staphylococci strains especially Staphylococcus aureus is being observed worldwide. The improper hygiene and poor farm management practices contributed to the presence of S. aureus in the milk. This may have contributed to the high level of S. aureus isolated

Confirmed low prevalence of Listeria mastitis in she-camel milk delivers a safe, alternative milk for human consumption.

Science.gov (United States)

Osman, Kamelia M; Samir, Ahmed; Orabi, Ahmed; Zolnikov, Tara Rava

2014-02-01

She-camel milk is an alternative solution for people allergic to milk; unfortunately, potential harmful bacteria have not been tested in she-camel milk. Listeria monocytogenes is one harmful bacterium that causes adverse health effects if chronically or acutely ingested by humans. The purpose of this study was to estimate the prevalence, characterize the phenotypic, genetic characterization, virulence factors, and antibiopotential harmful bacteria resistance profile of Listeria isolated from the milk of she-camel. Udder milk samples were collected from 100 she-camels and screened for mastitis using the California mastitis test (46 healthy female camels, 24 subclinical mastitic animals and 30 clinical mastitic animals). Samples were then examined for the presence of pathogenic Listeria spp; if located, the isolation of Listeria was completed using the International Organization for Standards technique to test for pathogenicity. The isolates were subjected to PCR assay for virulence-associated genes. Listeria spp. were isolated from 4% of samples and only 1.0% was confirmed as L. monocytogenes. The results of this study provide evidence for the low prevalence of intramammary Listeria infection; additionally, this study concludes she-camel milk in healthy camels milked and harvested in proper hygienic conditions may be used as alternative milk for human consumption. Copyright © 2013 Elsevier B.V. All rights reserved.

Milk consumption during pregnancy increases birth weight, a risk factor for the development of diseases of civilization.

Science.gov (United States)

Melnik, Bodo C; John, Swen Malte; Schmitz, Gerd

2015-01-16

Antenatal dietary lifestyle intervention and nutrition during pregnancy and early postnatal life are important for appropriate lifelong metabolic programming. Epidemiological evidence underlines the crucial role of increased birth weight as a risk factor for the development of chronic diseases of civilization such as obesity, diabetes and cancer. Obstetricians and general practitioners usually recommend milk consumption during pregnancy as a nutrient enriched in valuable proteins and calcium for bone growth. However, milk is not just a simple nutrient, but has been recognized to function as an endocrine signaling system promoting anabolism and postnatal growth by activating the nutrient-sensitive kinase mTORC1. Moreover, pasteurized cow's milk transfers biologically active exosomal microRNAs into the systemic circulation of the milk consumer apparently affecting more than 11,000 human genes including the mTORC1-signaling pathway. This review provides literature evidence and evidence derived from translational research that milk consumption during pregnancy increases gestational, placental, fetal and birth weight. Increased birth weight is a risk factor for the development of diseases of civilization thus involving key disciplines of medicine. With regard to the presented evidence we suggest that dietary recommendations promoting milk consumption during pregnancy have to be re-evaluated.

Fluid milk consumption and demand response to advertising for non-alcoholic beverages

Directory of Open Access Journals (Sweden)

K. RICKERTSEN

2008-12-01

Full Text Available Norwegian fluid milk consumption has declined steadily over the last twenty years, despite the dairy industry spending increasing amounts of money on advertising. Using a two-stage model, we investigate whether advertising has increased the demand for milk. No effect of advertising on the demand for non-alcoholic beverages is found in the first stage. In the second stage, an almost ideal demand system including advertising expenditures on competing beverages is estimated. The effects of generic advertising within the beverage group are positive and significant for whole milk and negative and significant for lower fat milk. The own-advertising elasticity for the combined fluid milk group is 0.0008. This highly inelastic elasticity suggests that increased advertising will not be profitable for the producers. Several cross-advertising effects are statistically significant, emphasizing the usefulness of a demand system approach.

Proteolysis of milk fat globule membrane proteins during in vitro gastric digestion of milk.

Science.gov (United States)

Ye, A; Cui, J; Singh, H

2011-06-01

The influence of gastric proteolysis on the physicochemical characteristics of milk fat globules and the proteins of the milk fat globule membrane (MFGM) in raw milk and cream was examined in vitro in simulated gastric fluid (SGF) containing various pepsin concentrations at pH 1.6 for up to 2h. Apparent flocculation of the milk fat globules occurred in raw milk samples incubated in SGF containing pepsin, but no coalescence was observed in either raw milk samples or cream samples. The changes in the particle size of the fat globules as a result of the flocculation were dependent on the pepsin concentration. Correspondingly, the physical characteristics of the fat globules and the composition of the MFGM proteins in raw milk changed during incubation in SGF containing pepsin. The major MFGM proteins were hydrolyzed at different rates by the pepsin in the SGF; butyrophilin was more resistant than xanthine oxidase, PAS 6, or PAS 7. Peptides with various molecular weights, which altered with the time of incubation and the pepsin concentration, were present at the surfaces of the fat globules. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Quantitative assessment of Lactococcus lactis subsp. cremoris present in artisanal raw cow’s milk cheese

Directory of Open Access Journals (Sweden)

Milena Alicja Stachelska

2018-01-01

Full Text Available Lactococcus lactis subsp. cremoris belongs to lactic acid bacteria that play a crucial role in cheese production and it is known to be beneficial to human health. The aim of the study was to establish a rapid and accurate quantitative real-time polymerase chain reaction (qPCR method to detect and enumerate L. lactis subsp. cremoris in artisanal raw cow’s milk cheese. Artisanal raw cow’s milk cheese samples were used to check for presence and number of L. lactis subsp. cremoris strains. The method applies a set of target-specific PCR (polymerase chain reaction primers and a fluorogenic probe, and amplifies a part of the LACR_RS01280 gene that encodes the aminoacetone oxidase family flavin adenine dinucleotide (FAD binding enzyme. All 5 L. lactis subsp. cremoris strains examined were found to be qPCR positive. There was no signal recorded for 8 strains which belong to closely related species. The limit of detection amounted to ten copies per reaction and the assay indicated a linear dynamic range of seven logs. This method may be applied in detection and enumeration of L. lactis subsp. cremoris in cheese during its ripening. Moreover, it may be applied to examine the distribution of L. lactis subsp. cremoris during the cheese production and ripening.

A review of the current situation of aflatoxin M1 in cow's milk in Serbia: risk assessment and regulatory aspects.

Science.gov (United States)

Milićević, Dragan R; Spirić, Danka; Radičević, Tatjana; Velebit, Branko; Stefanović, Srdjan; Milojević, Lazar; Janković, Saša

2017-09-01

The aim of this systematic review is to provide information regarding the incidence and levels of aflatoxin M 1 (AFM 1 ) in raw and heat processed cow's milk in Serbia during 2015-16 and to compare these with collected data on the occurrence of AFM 1 in raw milk and dairy products during the last decade in our region. Estimation of dietary exposure (EDI) and hazard index (HI) calculations for different age groups of the population were also carried out, based on the AFM 1 content of milk samples and on available food consumption data in Serbia. AFM 1 was detected in 69.9% (984/1408) of raw milk samples in 2015 versus 84.9% (3094/3646) in 2016, while in heat-processed milk, AFM 1 was detected in 77.8% (364/468) in 2015 versus 98.5% (753/765) in 2016. On the basis of the obtained results, 450 (9%) of raw and 14 (1.1%) of heat-processed milk samples were contaminated with AFM 1 levels above the maximum permitted level in Serbia (0.25 μg kg -1 ). However, a large percentage of raw and heat processed milk in Serbia (30.1% and 17.3%, respectively) was contaminated with AFM 1 levels above the maximum permitted level regulated in the European Union (0.05 μg kg -1 ). Therefore, in order to protect consumer health, it is extremely important to further control the level of aflatoxins in milk, and this should be considered as a high priority for risk management actions.

Lead Concentrations in Raw Cow and Goat Milk Collected in Rural Areas of Croatia from 2010 to 2014.

Science.gov (United States)

Bilandžić, Nina; Sedak, Marija; Čalopek, Bruno; Luburić, Đurđica Božić; Solomun Kolanović, Božica; Varenina, Ivana; Đokić, Maja; Kmetič, Ivana; Murati, Teuta

2016-05-01

A total of 249 cow and 33 goat milk samples were collected in rural areas of Croatia during the period 2010-2014. Lead concentrations in milk samples were analyzed by graphite furnace-atomic absorption spectroscopy. Mean Pb concentrations in milk ranged from (μg/kg): cow 10.8-12.2; goat 9.33-60.0. The highest Pb level of 131 μg/kg in cow milk was measured during 2014. There were no significant differences in Pb levels between cow and goat milk and also in goat milk among the analysed years. However, significant differences were found in cow milk among years. The highest Pb was determined in 2011 (157 μg/kg in goat milk). The calculated estimated weekly intakes of Pb concentrations for cow and goat milk contribute only 1.37 % and 1.84 % to the provisional tolerable weekly intake. Therefore, the consumption of milk from both species should not pose a consumer health risk.

Quantitative Determination of Ivermectin in Raw Milk Using Positive ESI LC-MS/MS

Directory of Open Access Journals (Sweden)

Meenakshi Dahiya

2010-01-01

Full Text Available Ivermectin, a veterinary drug, is commonly used endectocide for animal husbandry. The drug is available in the form of subcutaneous or topical formulations. Its application may cause accumulation of its residues into the animal tissues, which ultimately find their way into the food products, such as milk and meat products. In order to determine the residues of ivermectin in milk, a comparatively simple, sensitive and rapid method was developed and validated using LC-MS/MS. The MRM transitions corresponding to m/z 892.71>569.6, 892.71>551.5 and 892.71>307.3 were used for the purpose of quantification and evaluation of other parameters of the method. The limit of detection of the method was found to be 0.1 μg/kg and the limit of quantitation was calculated as 0.2 μg/kg. The method was found to be linear in the range of 1.0 ng/mL to 100.0 ng/mL with correlation coefficient of 0.9992 for pure calibration curve and 0.9990 for the matrix- matched calibration curve. The recoveries of ivermectin from the spiked samples of raw milk were found between 85 to 105%.

Molecular characterization and antibiotic resistance of enterotoxigenic and entero-aggregative Escherichia coli isolated from raw milk and unpasteurized cheeses

Directory of Open Access Journals (Sweden)

Mojtaba Bonyadian

2014-04-01

Full Text Available The aim of this study was to determine the occurrence of enterotoxigenic and enteroaggregative Escherichia coli strains and antibiotic resistance of the isolates in raw milk and unpasteurized cheese. Out of 200 samples of raw milk and 50 samples of unpasteurized cheeses, 96 and 24 strains of E. coli were isolated, respectively. Polymerase chain reaction (PCR was used to detect the genes encoding heat-stable enterotoxin a (STa, heat-stable enterotoxin b (STb, heat labile toxin (LT and enteroaggregative heat-stable toxin1 (EAST1. Twelve out of 120 (10.00% isolates harbored the gene for EAST1, 2(1.66% isolates were detected as producing STb and LT toxins and 12 (10.00% strains contained STb and EAST1 genes. None of the strains contain the STa gene. All of the strains were tested for antibiotic resistance by disk diffusion method. Disks included: ciprofloxacin (CFN, trimetoprim-sulfamethoxazole (TSX, oxytetracycline (OTC, gentamicin (GMN, cephalexin (CPN, nalidixic acid (NDA and nitrofurantoin (NFN, ampicillin (AMP, neomycin (NEO and streptomycin (STM. Among 120 isolated strains of E. coli, the resistance to each antibiotics were as follows: OTC100%, CPN 86.00%, NDA 56.00%, NFN 42.00%, GMN 30.00%, TSX 28.00%, CFN 20%, AM 23.40% and STM 4.25%. None of the isolates were resistant to NEO. The present data indicate that different resistant E. coli pathogens may be found in raw milk and unpasteurized cheese. It poses an infection risk for human and transferring the resistant factors to microflora of the consumers gut.

Continuous raw skim milk processing by pulsed electric field at non-lethal temperature: effect on microbial inactivation and functional properties

OpenAIRE

Floury , Juliane; Grosset , Noël; Leconte , Nadine; Pasco , Maryvonne; Madec , Marie-Noëlle; Jeantet , Romain

2006-01-01

International audience; Pulsed electric field (PEF) is an emerging non-thermal processing technology used to inactivate microorganisms in liquid foods such as milk. The objective of this research was to study the effectiveness of continuous PEF equipment (square wave pulses) on total microorganisms of raw skim milk and on Salmonella enteritidis inactivation under moderate temperatures (T < 50 °C). Processing parameters (electric field and pulse width) were chosen as follows: 45 kV*cm-1/500 ns...

[Bacteriological evaluation of goat milk and cheese distributed in the Metropolitan Area of San José, Costa Rica].

Science.gov (United States)

Araya, Viviana; Gallo, Leslie; Quesada, Carlos; Chaves, Carolina; Arias, María Laura

2008-06-01

In the last years, there has been an increase in the production, industrialization and consumption of goat's milk and derivate products, including cheese, worldwide. Nevertheless, in Costa Rica there is no study of these products, reason why the objective of this work was to determine the microbiological characteristics of goat's milk and fresh cheese distributed in the Metropolitan Area of San José, Costa Rica, in order to evaluate its impact in the economical field and as a potential risk for Public Health. A total of 25 raw goat's milk samples, obtained by manual milking from 5 different producers tested in five different dates and 15 cheese samples, elaborated with pasteurized milk, commercially available and coming from three different producers were analyzed. The study included the analysis of spoilage bacteria (total aeobic count and lactic bacteria count), indicators of hygiene (total coliforms), fecal contamination (fecal coliforms), manipulation (Staphylococcus aureus) and pathogens (Listeria monocytogenes and Salmonella spp). High results were obtained for the total aerobic count and lactic bacteria count of the milk and cheese samples, showing a reduced shelf life. Total coliforms, in limits beyond the established ones by the Costa Rican legislation for human consumption raw milk, were found in 100% of milk samples, as well as for fecal coliforms in 76% of them. All cheese samples, except one, were negative for these indicators, suggesting good manufacturing practices. S. aureus counts were low and both Salmonella spp. and L. monocytogenes were not isolated from samples analyzed.

Steroid hormones level in milk of non-pregnant and pregnant river buffalos at various gestational trimesters

Directory of Open Access Journals (Sweden)

Yaser Shahbazi

2011-09-01

Full Text Available Background: Milk is a valuable sources of nutrition in the human diet however; there are reports on safety of milk steroid hormones contain. This study designed to determine the level of steroid hormones including estrone (E1, 17β-estradiol (E2, and estriol (E3 in raw and pasteurized milk from non-pregnant and pregnant buffalos.Methods: Steroids was extracted using liquid extraction, enzymatical deconjugation, and C18 solid-phase extraction from collected milk samples. Estrogens were analyzed using high performance liquid chromatography equipped by fluorescence detector.Results: Free E1 (554.1±77.0 ng/L and deconjugated E1 (701.6±44.7 ng/L was found highest level estrogen followed by E2, while E3 level was under the detection limit (10 ng/L. The lowest E1: 554.1±77.0 and E2: 28.1±4.4ng/L estrogens level were determined in raw milk from non-pregnant and highest E1: 1014.7±123.8 and E2: 108.2±9.1 ng/L estrogens were found in milk of animals in the third trimester of gestation. The estrogens concentration in pasteurized milk did not show significant (P>0.05 differences with those in raw milk.Conclusion: As buffalo milk poses more fat than cow's milk, it may contain higher level of steroid hormones. Since consumption of buffalo's milk with higher amount of steroidal hormones could be considered one of the potential risk factors for carcinogenesis.

The potential of the endolysin Lysdb from Lactobacillus delbrueckii phage for combating Staphylococcus aureus during cheese manufacture from raw milk.

Science.gov (United States)

Guo, Tingting; Xin, YongPing; Zhang, Chenchen; Ouyang, Xudong; Kong, Jian

2016-04-01

Phage endolysins have received increased attention in recent times as potential antibacterial agents and the biopreservatives in food production processes. Staphylococcus aureus is one of the most common pathogens in bacterial food poisoning outbreaks. In this study, the endolysin Lysdb, one of the two-component cell lysis cassette of Lactobacillus delbrueckii phage phiLdb, was shown to possess a muramidase domain and catalytic sites with homology to Chalaropsis-type lysozymes. Peptidoglycan hydrolytic bond specificity determination revealed that Lysdb was able to cleave the 6-O-acetylated peptidoglycans present in the cell walls of S. aureus. Turbidity reduction assays demonstrated that Lysdb could effectively lyse the S. aureus live cells under acidic and mesothermal conditions. To further evaluate the ability of Lysdb as a potential antibacterial agent against S. aureus in cheese manufacture, Lactobacillus casei BL23 was engineered to constitutively deliver active Lysdb to challenge S. aureus in lab-scale cheese making from raw milk. Compared with the raw milk, the viable counts of S. aureus were reduced by 10(5)-fold in the cheese inoculated with the engineered L. casei strain during the fermentation process, and the pathogenic bacterial numbers remained at a low level (10(4) CFU/g) after 6 weeks of ripening at 10 °C. Taken together, all results indicated that the Lysdb has the function as an effective tool for combating S. aureus during cheese manufacture from raw milk.

Determination of total bacterial count in raw milk by flow cytometry

Directory of Open Access Journals (Sweden)

Dubravka Samaržija

2004-01-01

Full Text Available The automatic flow cytometry as routine method for total bacterial count determination of raw ex-farm milk has recently been accepted in Croatia. This method significantly differs from the reference method (Standard Plate Count mostly in the presentation of the results obtained. Therefore, this paper summarized experiences in the application of flow cytometry in the dairy laboratories practice. The principle and the practice of the method, methodological details and factors influencing the results were described. In order to avoid problems regarding the interpretation of the results, which aregeneral problems of the quantitative microbiology, this article try to explain an appropriate conversion of the results with regards to SPC/ml, as an official method for the bacteriological quality proposal by the national legislation.

Intake of Milk or Fermented Milk Combined With Fruit and Vegetable Consumption in Relation to Hip Fracture Rates: A Cohort Study of Swedish Women.

Science.gov (United States)

Michaëlsson, Karl; Wolk, Alicja; Lemming, Eva Warensjö; Melhus, Håkan; Byberg, Liisa

2018-03-01

Milk products may differ in pro-oxidant properties and their effects on fracture risk could potentially be modified by the intake of foods with antioxidant activity. In the population-based Swedish Mammography Cohort study, we aimed to determine how milk and fermented milk combined with fruit and vegetable consumption are associated with hip fracture. Women born in 1914-1948 (n = 61,240) answered food frequency and lifestyle questionnaires in 1987-1990 and 38,071 women contributed with updated information in 1997. During a mean follow-up of 22 years, 5827 women had a hip fracture (ascertained via official register data). Compared with a low intake of milk (yogurt or soured milk) yielded a different pattern with lowest rates of hip fracture in high consumers: HR, 0.81 (95% CI, 0.68 to 0.97) for ≥2 servings/day of fermented milk and ≥5 servings/day of fruits and vegetables compared with low consumption of both fruit and vegetables and fermented milk. We conclude that the amount and type of dairy products as well as fruit and vegetable intake are differentially associated with hip fracture rates in women. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

Incidence of Nocardia species in raw milk collected from different localities of Assiut City of Egypt

Directory of Open Access Journals (Sweden)

Nahed Mohamad Wahba

2011-10-01

Full Text Available This study aimed to isolate and enumerate Nocardiae from the examined raw milk samples. 240 random milk samples were collected from cows, buffaloes, sheep and goats from different localities in Assiut city- Egypt. The incidences of Nocardia spp. were 47.8, 43.3, 53.3 and 66.7% with average counts of 3.8 x104, 4.5x104, 1.4x104 and 7.6x103/CFUmL of the examined samples, respectively. Pathogenicity of the isolates was also studied. N. otitidiscavarium and N. brasiliensis caused sudden death of rats while, N. farcinica and N. carnea strains were non pathogenic. Other species caused several lesions. It was concluded from the study that, Nocardia species are existed in retailed and fresh milk of different farm animals. Most of the isolated strains were highly pathogenic to rats. Consequently, preventive measures should be taken to protect consumers from being infected. [Vet. World 2011; 4(5.000: 201-204

Modeling of Bacillus cereus distribution in pasteurized milk at the time of consumption

Directory of Open Access Journals (Sweden)

Ľubomír Valík

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Modelling of Bacillus cereus distribution, using data from pasteurized milk produced in Slovakia, at the time of consumption was performed in this study. The Modular Process Risk Model (MPRM methodology was applied to over all the consecutive steps in the food chain. The main factors involved in the risk of being exposed to unacceptable levels of B. cereus (model output were the initial density of B. cereus after milk pasteurization, storage temperatures and times (model input. Monte Carlo simulations were used for probability calculation of B. cereus density. By applying the sensitivity analysis influence of the input factors and their threshold values on the final count of B. cereus were determined. The results of the general case exposure assessment indicated that almost 14 % of Tetra Brik cartons can contain > 104 cfu/ml of B. cereus at the temperature distribution taken into account and time of pasteurized milk consumption. doi:10.5219/264

Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

Science.gov (United States)

Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

2017-03-01

Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

Isolation and Evaluation Virulence Factors of Salmonella typhimurium and Salmonella enteritidis in Milk and Dairy Products

Directory of Open Access Journals (Sweden)

Shima Shaigan nia

2014-06-01

Conclusions: To our best knowledge the present study is the first prevalence report of Salmonella spp., Salmonella enteritidis and Salmonella typhimurium in raw sheep and goat samples in Iran. Consumption of pasteurized milk and dairy products can reduce the risk of salmonellosis.

Consumption of dark chocolate attenuates subsequent food intake compared with milk and white chocolate in postmenopausal women.

Science.gov (United States)

Marsh, Channa E; Green, Daniel J; Naylor, Louise H; Guelfi, Kym J

2017-09-01

Chocolate has a reputation for contributing to weight gain due to its high fat, sugar and calorie content. However, the effect of varying concentrations of cocoa in chocolate on energy intake and appetite is not clear. To compare the acute effect of consuming an isocaloric dose of dark, milk and white chocolate on subsequent energy intake, appetite and mood in postmenopausal women. Fourteen healthy postmenopausal women (57.6 ± 4.8yr) attended an introductory session followed by three experimental trials performed in a counterbalanced order at a standardised time of day, each separated by one week. Ad libitum energy intake, perceived appetite, mood and appetite-related peptides were assessed in response to consumption of 80% cocoa [dark chocolate], 35% cocoa [milk chocolate] and cocoa butter [white chocolate] (2099 kJ), prepared from a single-origin cacao bean. Ad libitum energy intake was significantly lower following dark (1355 ± 750 kJ) compared with both milk (1693 ± 969 kJ; P = 0.008) and white (1842 ± 756 kJ; P = 0.001) chocolate consumption. Blood glucose and insulin concentrations were transiently elevated in response to white and milk chocolate consumption compared with the dark chocolate (P cocoa content chocolate (dark and milk) compared with white chocolate (P  0.05). Dark chocolate attenuates subsequent food intake in postmenopausal women, compared to the impact of milk and white chocolate consumption. Copyright © 2017 Elsevier Ltd. All rights reserved.

60-day aging requirement does not ensure safety of surface-mold-ripened soft cheeses manufactured from raw or pasteurized milk when Listeria monocytogenes is introduced as a postprocessing contaminant.

Science.gov (United States)

D'Amico, Dennis J; Druart, Marc J; Donnelly, Catherine W

2008-08-01

Because of renewed interest in specialty cheeses, artisan and farmstead producers are manufacturing surface-mold-ripened soft cheeses from raw milk, using the 60-day holding standard (21 CFR 133.182) to achieve safety. This study compared the growth potential of Listeria monocytogenes on cheeses manufactured from raw or pasteurized milk and held for > 60 days at 4 degrees C. Final cheeses were within federal standards of identity for soft ripened cheese, with low moisture targets to facilitate the holding period. Wheels were surface inoculated with a five-strain cocktail of L. monocytogenes at approximately 0.2 CFU/ cm2 (low level) or 2 CFU/cm2 (high level), ripened, wrapped, and held at 4 degrees C. Listeria populations began to increase by day 28 for all treatments after initial population declines. From the low initial inoculation level, populations in raw and pasteurized milk cheese reached maximums of 2.96 +/- 2.79 and 2.33 +/- 2.10 log CFU/g, respectively, after 60 days of holding. Similar growth was observed in cheese inoculated at high levels, where populations reached 4.55 +/- 4.33 and 5.29 +/- 5.11 log CFU/g for raw and pasteurized milk cheeses, respectively. No significant differences (P milk types. Independent of the milk type, cheeses held for 60 days supported growth from very low initial levels of L. monocytogenes introduced as a postprocess contaminant. The safety of cheeses of this type must be achieved through control strategies other than aging, and thus revision of current federal regulations is warranted.

Avaliação da qualidade do leite cru comercializado informalmente em feiras livres no município de Santa Maria-RS / Quality assessment of raw milk informally commercialized in street markets in the city of Santa Maria-RS

Directory of Open Access Journals (Sweden)

Márcia Liliane Rippel Silveira

2014-05-01

presented at odds with the established standards. In relation to the microbiological analyzes, 30% of the samples had count of mesophilic microorganisms greater than 6.0x105 UFC/ml and the presence of thermotolerant coliforms was confirmed in all samples of raw milk, but no samples showed contamination by Salmonella sp. Considering that this product is illegally commercialized, the obtained results show the precariousness of hygiene in the commercialized milk in street markets. The consumption of raw milk without any hygienic-sanitary control type exposes consumer health to risks.

Influence of nutrition on somatotropic axis: Milk consumption in adult individuals with moderate-severe obesity.

Science.gov (United States)

Barrea, Luigi; Di Somma, Carolina; Macchia, Paolo Emidio; Falco, Andrea; Savanelli, Maria Cristina; Orio, Francesco; Colao, Annamaria; Savastano, Silvia

2017-02-01

Nutrition is the major environmental factor that influences the risk of developing pathologies, such as obesity. Although a number of recent reviews pinpoint a protective effects of milk on body weight and obesity related co-morbidities, an inaccurate estimate of milk might contribute to hamper its beneficial effects on health outcomes. Seven-day food records provide prospective food intake data, reducing recall bias and providing extra details about specific food items. Milk intake stimulates the somatotropic axis at multiple levels by increasing both growth hormone (GH) and insulin-like growth factor-1 (IGF-1) secretion. On the other hand, obesity is associated with reduced spontaneous and stimulated GH secretion and basal IGF-1 levels. Aim of this study was to evaluate the milk consumption by using the 7-days food record in obese individuals and to investigate the association between milk intake and GH secretory status in these subjects. Cross-sectional observational study carried out on 281 adult individuals (200 women and 81 men, aged 18-74 years) with moderate-severe obesity (BMI 35.2-69.4 kg/m 2 ). Baseline milk intake data were collected using a 7 day food record. Anthropometric measurements and biochemical profile were determined. The GH/IGF-1 axis was evaluated by peak GH response after GHRH + ARGININE and IGF-1 standard deviation score (SDS). The majority of individuals (72.2%) reported consuming milk; 250 mL low-fat milk was the most frequently serving of milk consumed, while no subjects reported to consume whole milk. Milk consumers vs no milk consumers presented the better anthropometric measurements and metabolic profile. At the bivariate proportional odds ratio model, after adjusting for BMI, age and gender, milk consumption was associated the better GH status (OR = 0.60; p milk consumers, subjects consuming 250 mL reduced-fat milk vs 250 mL low-fat milk presented the better anthropometric measurements and metabolic profile. At the

Effects of somatic cell count in subclinical mastitis on raw milk quality in dairy farms of Khuzestan province

Directory of Open Access Journals (Sweden)

mohammad Hossieni nejad

2016-01-01

Full Text Available Mastitis is an infectious disease that is spread in livestock and can cause cattle mortality. Generally a cow with mastitis has a 15 per cent decrease in milk production. In addition, losses from changes in some components of milk should also be considered. Any change in milk properties can be severe hazard for milk producers, dairy factories and consumers. In this study, the effect of somatic cell count on row milk quality of cows affected by subclinical mastitis was studied. For this purpose 240 milk samples were collected from dairy farms with subclinical mastitis (traditional and industrial of Khuzestan province in 2014 and their somatic cell count, protein and lipid contact and acidity determined. The mean±SD for somatic cells, acidity, protein and fat were 3.20×105±1.37×105 SCC/ml, 14.50±0.62 D°, 3.12±0.06% and 3.23±0.14% respectively. After statistical analysis, reverse correlation were found between somatic cell count with milk fat and protein. However, direct correlation was observed between range of milk fat and protein (p>0.01. Furthermore the results indicated that the range of acidity in spring and winter, protein and fat in winter and somatic cell in summer and autumn were more than the other seasons. According to statistical analysis, protein percent of milk samples in industrial farms were higher than traditional farms although the range of somatic cells was higher for traditional milk samples ‏p>0.05 According to the result, it seems that the somatic cell count of milk influences raw milk fat and protein content and acidity.

Effects of Milk vs Dark Chocolate Consumption on Visual Acuity and Contrast Sensitivity Within 2 Hours: A Randomized Clinical Trial.

Science.gov (United States)

Rabin, Jeff C; Karunathilake, Nirmani; Patrizi, Korey

2018-04-26

Consumption of dark chocolate can improve blood flow, mood, and cognition in the short term, but little is known about the possible effects of dark chocolate on visual performance. To compare the short-term effects of consumption of dark chocolate with those of milk chocolate on visual acuity and large- and small-letter contrast sensitivity. A randomized, single-masked crossover design was used to assess short-term visual performance after consumption of a dark or a milk chocolate bar. Thirty participants without pathologic eye disease each consumed dark and milk chocolate in separate sessions, and within-participant paired comparisons were used to assess outcomes. Testing was conducted at the Rosenberg School of Optometry from June 25 to August 15, 2017. Visual acuity (in logMAR units) and large- and small-letter contrast sensitivity (in the log of the inverse of the minimum detectable contrast [logCS units]) were measured 1.75 hours after consumption of dark and milk chocolate bars. Among the 30 participants (9 men and 21 women; mean [SD] age, 26 [5] years), small-letter contrast sensitivity was significantly higher after consumption of dark chocolate (mean [SE], 1.45 [0.04] logCS) vs milk chocolate (mean [SE], 1.30 [0.05] logCS; mean improvement, 0.15 logCS [95% CI, 0.08-0.22 logCS]; P chocolate (mean [SE], 2.05 [0.02] logCS) vs milk chocolate (mean [SE], 2.00 [0.02] logCS; mean improvement, 0.05 logCS [95% CI, 0.00-0.10 logCS]; P = .07). Visual acuity improved slightly after consumption of dark chocolate (mean [SE], -0.22 [0.01] logMAR; visual acuity, approximately 20/12) and milk chocolate (mean [SE], -0.18 [0.01] logMAR; visual acuity, approximately 20/15; mean improvement, 0.04 logMAR [95% CI, 0.02-0.06 logMAR]; P = .05). Composite scores combining results from all tests showed significant improvement after consumption of dark compared with milk chocolate (mean improvement, 0.20 log U [95% CI, 0.10-0.30 log U]; P chocolate bar compared with a

The Use of Multiplex PCR to Determine the Prevalence of Enterotoxigenic Staphylococcus aureus Isolated from Raw Milk, Feta Cheese, and Hand Swabs.

Science.gov (United States)

Zeinhom, Mohamed M A; Abdel-Latef, Gihan K; Jordan, Kieran

2015-12-01

Staphylococcus aureus (S. aureus) can cause mastitis in cattle and, therefore, can be present in milk. This study was undertaken to determine the prevalence of coagulase positive S. aureus and its enterotoxin genes sea, seb, and sec in isolates recovered from raw milk, feta cheese, and human hand swabs of milk and cheese handlers in Beni-Suef province, Egypt. A total of 100 samples of raw milk and 50 samples of pasteurized-milk feta cheese were collected. In addition, 50 hand swabs from milk handlers and 25 hand swabs from cheese handlers were examined for the presence of coagulase positive S. aureus. The isolates were characterized by multiplex PCR for detection of sea, seb, and sec genes, and for resistance to 5 classes of commonly used antibiotics. Twelve (12/100), 12 (6/50), and 17% (13/75) of milk, cheese, and hand swab samples, respectively, were positive for coagulase positive S. aureus. One isolate was obtained from each positive sample (31 isolates), and none contained genes for SEA or SEC production. Twenty-five percent, 33%, and 31%, respectively, of the isolates contained the genes for SEB, resulting in 3%, 4%, and 5% of samples being positive for toxin producing coagulase positive S. aureus, respectively. At least one isolate was resistant to each of the antibiotics tested. Despite the low potential for SEB production shown, preventative measures, such as maintenance of the cold-chain and good hygienic practices should be implemented to further reduce the potential risk to public health from SEB, and to reduce the spread of antimicrobial resistance. © 2015 Institute of Food Technologists®

Milk Options Observation (MOO): A Mixed-Methods Study of Chocolate Milk Removal on Beverage Consumption and Student/Staff Behaviors in a Rural Elementary School

Science.gov (United States)

Davis, Melinda M.; Spurlock, Margaret; Ramsey, Katrina; Smith, Jamie; Beamer, Beth Ann; Aromaa, Susan; McGinnis, Paul B.

2017-01-01

Providing flavored milk in school lunches is controversial, with conflicting evidence on its impact on nutritional intake versus added sugar consumption and excess weight gain. Nonindustry-sponsored studies using individual-level analyses are needed. Therefore, we conducted this mixed-methods study of flavored milk removal at a rural primary…