WorldWideScience

Sample records for raw meats electronic

  1. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage

    Science.gov (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  2. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  3. Detection of horse meat contamination in raw and heat-processed meat products.

    Science.gov (United States)

    Hsieh, Yun-Hwa P; Ofori, Jack A

    2014-12-31

    Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

  4. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  5. The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product

    Directory of Open Access Journals (Sweden)

    Rini Mastuti

    2012-02-01

    Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value  7.89, WHC  48.345, and moisture content  75.20%.   Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.

  6. Artificial neural network as the tool in prediction rheological features of raw minced meat

    OpenAIRE

    Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko

    2012-01-01

      Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...

  7. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark

    DEFF Research Database (Denmark)

    Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud

    2006-01-01

    Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....

  8. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  9. Properties of raw meat and meat curry from spent goat in relation with post-mortem handling conditions.

    Science.gov (United States)

    Narayan, Raj; Mendiratta, S K; Mane, B G

    2013-04-01

    The properties of raw meat and meat curry from spent goat meat in relation with post-mortem handling conditions were evaluated. The conditions evaluated were: cooking of meat within 1-2 h post-slaughter (condition 1); deboning meat storage at 25 ± 2 °C for 5-6 h and cooking (condition 2); post-slaughter storage of carcass at room temperature for 5-6 h, then deboning followed by storage of meat at refrigeration temperature for 5-6 h and cooking (condition 3); deboning and storage of meat at 25 ± 2 °C for 10-12 h and cooking (condition 4). Significant difference was observed in pH values in condition 1 (p meat as compared to the conditions 2, 3 and 4. However, the moisture content of cooked meat was significantly higher (p meat chunks, that is, the mean value was significantly higher (p < 0.01) for condition 2 and significantly lower for condition 1. Sensory scores were significantly higher in condition 1 and significantly lower in condition 2. However, sensory scores for condition 4 were almost similar to the condition 1.

  10. IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. M. Bukreev

    2013-01-01

    Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.

  11. OFFGEL electrophoresis and tandem mass spectrometry approach compared with DNA-based PCR method for authentication of meat species from raw and cooked ground meat mixtures containing cattle meat, water buffalo meat and sheep meat.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth

    2017-10-15

    The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    OpenAIRE

    Claudiu-Dan Salagean; Dorin Tibulca; Radu Marin

    2013-01-01

    Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste) in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon) and mix of natural spices - fine grinding variant (1) and coarse grinding variant (3) - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon) + vegetable protein supplements (textured soy protein) + binder (protein + fiber) + add...

  13. Volatiles in raw and cooked meat from lambs fed olive cake and linseed.

    Science.gov (United States)

    Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A

    2015-04-01

    This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.

  14. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Dietary vitamin E affects lipid oxidation and total volatiles of irradiated raw turkey meat

    International Nuclear Information System (INIS)

    Ahn, D.U.; Sell, J.L.; Jeffery, M.; Jo, C.; Chen, X.; Lee, J.I.

    1997-01-01

    Breast and leg meat patties, prepared from turkeys fed diets containing 25, 200, 400 or 600 IU of dl-alpha-tocopheryl acetate (TA) per kg diet, were irradiated at 0 or 2.5 kGy with vacuum or loose packaging. The effects of dietary TA on storage stability and production of volatiles in irradiated raw turkey meat were determined. Dietary TA at 200 IU/kg decreased lipid oxidation and reduced total volatiles of raw turkey patties after 7-days of storage. However, the antioxidant effects of dietary TA were more notable when the patties were loosely packaged than when vacuum-packaged. Irradiation increased lipid oxidation of raw turkey meats only when loosely packaged but had limited effects on formation of total volatiles after storage at 4 degrees C for 7 days or longer

  16. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  17. Artificial neural network as the tool in prediction rheological features of raw minced meat.

    Science.gov (United States)

    Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta

    2012-01-01

    The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.

  18. The Influence of Stunning Method, Refrigeration and Freezing Time on the Rheological and Textural Properties of Raw Meat

    Directory of Open Access Journals (Sweden)

    Liliana Tudoreanu

    2013-11-01

    Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio

  19. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  20. Survival of Salmonella Copenhagen in food bowls following contamination with experimentally inoculated raw meat: Effects of time, cleaning, and disinfection

    OpenAIRE

    Weese, J Scott; Rousseau, J.

    2006-01-01

    There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.

  1. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    NARCIS (Netherlands)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-01

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and

  2. 76 FR 44855 - Common or Usual Name for Raw Meat and Poultry Products Containing Added Solutions

    Science.gov (United States)

    2011-07-27

    ...'s experience in reviewing labels of meat and poultry products with added solution, the Agency has... or prior to consumption. Therefore, to ensure that labels adequately inform consumers that raw... of identity and that are sold for retail sale, institutional use, or further processing. If retail...

  3. Freezing of meat raw materials affects tyramine and diamine accumulation in spontaneously fermented sausages.

    Science.gov (United States)

    Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen

    2006-01-01

    Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.

  4. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

    2014-02-05

    Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

  5. Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland

    Directory of Open Access Journals (Sweden)

    Danuser Jürg

    2003-12-01

    Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other

  6. Fate of gamma-irradiated Listeria monocytogenes during refrigerated storage on raw or cooked turkey breast meat

    International Nuclear Information System (INIS)

    Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.

    1998-01-01

    The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat

  7. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  8. Flavour development in pork. Influence of flavour precursor concentrations in longissimus dorsi from pigs with different raw meat qualities

    DEFF Research Database (Denmark)

    Meinert, Lene; Tikk, Kaja; Tikk, Meelis

    2009-01-01

    Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...... the differences in sensory perception of the pan-fried pork chops. Overall, the differences were small....

  9. Physico-chemical and microbiological properties of raw fermented sausages are not influenced by color differences of turkey breast meat.

    Science.gov (United States)

    Popp, J; Krischek, C; Janisch, S; Wicke, M; Klein, G

    2013-05-01

    It has been suggested that the color of turkey breast meat influences both physico-chemical and microbiological properties of raw fermented sausages. In this study, raw fermented sausages were produced with turkey breast meat in 3 different colors (pale, normal, or dark), which were obtained from 2 fast-growing-genetic-line toms at 2 slaughterhouses. Prior to the sausage production, the breast muscles were sorted into color groups according to the lightness values determined at 24 h postmortem. This meat was subsequently processed to raw fermented sausages using 1.5 or 2.5% curing salt (CS). The pale meat had higher lightness, electrical conductivity, and drip loss, whereas the dark meat showed a darker color only. The physico-chemical (pH, water activity), visual (lightness, redness), and microbial (total plate count) properties of the sausages were not influenced by the color of the turkey breast meat. The sausage made with 2.5% CS had lower aw and higher ash and hardness values than the sausages produced with 1.5% CS. In conclusion, processing of differently colored turkey meat to raw fermented sausages does not influence the quality characteristics of the products. Based on these findings, there is no reason for the sausage producer to separate turkey breast muscles by color before producing raw fermented sausages.

  10. Applications of electronic noses in meat analysis

    Directory of Open Access Journals (Sweden)

    Elżbieta GÓRSKA-HORCZYCZAK

    2016-01-01

    Full Text Available Abstract Electronic noses are devices able to characterize and differentiate the aroma profiles of various food, especially meat and meat products. During recent years e-noses have been widely used in food analysis and proved to provide a fast, simple, non-expensive and non-destructive method of food assessment and quality control. The aim of this study is to summarize the most important features of this analytic tool and to present basic fields and typical areas of e-nose use as well as most commonly used sensor types and patterns for e-nose design. Prospects for the future development of this technique are presented. Methods and research results presented in this manuscript may be a guideline for practical e-nose use.

  11. Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria

    Directory of Open Access Journals (Sweden)

    Adekunbi Bridget Omotoso

    2015-07-01

    Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry

  12. In vitro antimicrobial effect of Satureja wiedemanniana against Bacillus species isolated from raw meat samples.

    Science.gov (United States)

    Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan

    2009-08-01

    In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.

  13. Campylobacter fetus meningitis associated with eating habits of raw meat and raw liver in a healthy patient: A case report and literature review.

    Science.gov (United States)

    Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi

    2018-01-01

    Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.

  14. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2016-07-01

    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  15. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

    2010-04-01

    Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

  16. Occurrence of Thermotolerant Campylobacter in Raw Poultry Meat, Environmental and Pigeon Stools Collected in Open-Air Markets.

    Science.gov (United States)

    Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia

    2014-08-28

    Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.

  17. Development of a Rapid Immunodiagnostic Test for Pork Components in Raw Beef and Chicken Meats: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    S. N. Depamede

    2011-08-01

    Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.

  18. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    Science.gov (United States)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-13

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and parasitic pathogens in Dutch commercial RMBDs. We analysed 35 commercial frozen RMBDs from eight different brands. Escherichia coli serotype O157:H7 was isolated from eight products (23 per cent) and extended-spectrum beta-lactamases-producing E coli was found in 28 products (80 per cent). Listeria monocytogenes was present in 19 products (54 per cent), other Listeria species in 15 products (43 per cent) and Salmonella species in seven products (20 per cent). Concerning parasites, four products (11 per cent) contained Sarcocystis cruzi and another four (11 per cent) S tenella In two products (6 per cent) Toxoplasma gondii was found. The results of this study demonstrate the presence of potential zoonotic pathogens in frozen RMBDs that may be a possible source of bacterial infections in pet animals and if transmitted pose a risk for human beings. If non-frozen meat is fed, parasitic infections are also possible. Pet owners should therefore be informed about the risks associated with feeding their animals RMBDs. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Comparison of the amounts of taste-related compounds in raw and cooked meats from broilers and Korean native chickens.

    Science.gov (United States)

    Jayasena, Dinesh D; Kim, Sun Hyo; Lee, Hyun Jung; Jung, Samooel; Lee, Jun Heon; Park, Hee Bok; Jo, Cheorun

    2014-12-01

    This study was aimed at comparing the taste-related compound content in the breast and leg meat from 100-d-old Korean native chickens (KNC-100) and 32-d-old commercial broilers (CB-32) and determining the changes in these compounds during cooking. Cocks from certified meat-type commercial broiler (Ross) and Korean native chicken (Woorimatdag) strains were raised under similar standard commercial conditions, and a total of 10 birds from each breed were slaughtered at 32 and 100 d of age, which represents their market ages, respectively. Raw and cooked meat samples were prepared separately from the breast and leg and analyzed. The KNC-100 showed significantly higher concentrations of inosine 5'-monophosphate, reducing sugars, glutamic acid, linoleic acid, arachidonic acid, and docosahexaenoic acid than CB-32 did. Additionally, significantly higher inosine 5'-monophosphate, cysteine, arachidonic acid, and docosahexaenoic acid concentrations were observed in the breast meat, whereas the leg meat had higher concentration of glutamic acid, oleic acid, and linoleic acid (P cooking process, except oleic and linoleic acids. We suggest that the higher levels of taste-related compounds present in KNC-100 meat compared with CB-32 meat may result in the unique taste of the former meat, as has been previously reported. In addition, the results of this study may provide useful information for selection and breeding programs. ©2014 Poultry Science Association Inc.

  20. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat.

    Science.gov (United States)

    Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M

    2015-04-01

    One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.

  1. Antioxidant Enzyme Activity, Iron Content and Lipid Oxidation of Raw and Cooked Meat of Korean Native Chickens and Other Poultry

    Directory of Open Access Journals (Sweden)

    Muhlisin

    2016-05-01

    Full Text Available This study was conducted to observe antioxidant enzyme activity, iron content and lipid oxidation of Korean native chickens and other poultry. The breast and thigh meat of three Korean native chicken breeds including Woorimatdak, Hyunin black and Yeonsan ogye, and three commercial poultry breeds including the broiler, White Leghorn and Pekin duck (Anasplatyrhyncos domesticus were studied. The analyses of the antioxidant enzymes activity, iron content and lipid oxidation were performed in raw and cooked samples. The activity of catalase (CAT in the thigh meat was higher than that of the breast meat of three Korean native chickens and the broiler, respectively. The activity of glutathione peroxidase (GPx in the uncooked thigh meat of three Korean native chickens was higher than that of the breasts. The breast meat of Woorimatdak and Pekin duck had higher superoxide dismutase (SOD activity than the others, while only the thigh meat of Pekin duck had the highest activity. Cooking inactivated CAT and decreased the activity of GPx and SOD. The thigh meat of Woorimatdak, White Leghorn, Yeonsan ogye and Hyunin black contained more total iron than the breast meat of those breeds. The heme-iron lost during cooking ranged from 3.2% to 14.8%. It is noted that the thigh meat had higher thiobarbituric acid reactive substances values than the breast in all chicken breeds. Though Woorimatdak showed higher antioxidant enzyme activity and lower released-iron percentage among Korean native chickens, no differences were found on lipid oxidation. We confirm that the dark meat of poultry exhibited higher antioxidant enzyme activity and contained more iron than the white meat.

  2. Isolation of Yersinia from raw meat (pork and chicken) and precooked meat (porcine tongues and sausages) collected from commercial establishments in Mexico City.

    Science.gov (United States)

    Ramírez, E I; Vázquez-Salinas, C; Rodas-Suárez, O R; Pedroche, F F

    2000-04-01

    A total of 160 meat product samples were collected from commercial outlets in Mexico City to investigate the presence of different species of Yersinia by the 4 degrees C enrichment method after 1, 3, 5, and 7 days of incubation using alkaline treatment and isolating in cefsulodin-Irgasan-novobiocin and MacConkey agars with Tween 80. Overall, Yersinia spp. were isolated from 27% of the samples analyzed, whereas 40% of the raw and only 13% of the precooked samples were contaminated. Although 2,970 colonies showed Yersinia characteristics, only 706 (24%) actually corresponded to this genus: 49% were Yersinia enterocolitica, 25% Yersinia kristensenii, 15% Yersinia intermedia, 9% Yersinia frederiksenii, and 2% Yersinia aldovae; 10% corresponded to biotype 2, 2% to biotype 3, and 4% to biotype 4. The presence of Yersinia in raw and cooked meat products represents a health risk for consumers in Mexico, where further clinical studies are needed to assess the epidemiological importance of this pathogen.

  3. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  4. Decontamination of drug vegetative raw material by relativistic electron beam

    International Nuclear Information System (INIS)

    Gorbanyuk, A.G.; Dikiy, I.L.; Yegorov, A.M.; Linnik, A.F.; Uskov, V.V.

    2004-01-01

    The new technology of decontamination of drug vegetative raw material and medical products is proposed. Advantages of use of relativistic beams in a range of electron energies from 0.5 MeV to 5 MeV for these purposes are shown in comparison with X-radiation of energy from 80 keV to 1 MeV

  5. Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

    Science.gov (United States)

    Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

    2015-07-01

    The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

  6. Effect of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat during refrigerated storage.

    Science.gov (United States)

    Devatkal, Suresh K; Naveena, B M

    2010-06-01

    Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

  7. Effects of Tannic Acid on Lipid and Protein Oxidation, Color, and Volatiles of Raw and Cooked Chicken Breast Meat during Storage

    Directory of Open Access Journals (Sweden)

    Marwan Al-Hijazeen

    2016-06-01

    Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.

  8. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus

    OpenAIRE

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E.; Hanson, Blake M.; Smith, Tara C.

    2017-01-01

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n?=?3347) and contemporaneously from meat produc...

  9. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia.

    Science.gov (United States)

    Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S

    2016-08-01

    Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.

  10. Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

    Science.gov (United States)

    Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

    2017-08-01

    Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. The physicochemical properties and antioxidative potential of raw thigh meat from broilers fed a dietary medicinal herb extract mixture

    Directory of Open Access Journals (Sweden)

    K. Shirzadegan

    2014-07-01

    Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.

  12. Residual Nitrite in Some Egyptian Meat Products and the Reduction Effect of Electron Beam Irradiation

    OpenAIRE

    Dalia A. Zahran; Gehan M.A. Kassem

    2011-01-01

    Nitrite, a curing agent of meat products, is a precursor of carcinogenic N-nitrosamines during processing of meat products or under human stomach conditions, as well as having its own toxicity. To investigate the residual nitrite level in meat products marketed in Egyptian markets, 160 samples of cured cooked (luncheon and frankfurter) and cured raw (oriental sausages and pastirma) meat products (40 sample each) were analyzed for residual nitrite by a spectrophotometric method. Samples were s...

  13. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus.

    Science.gov (United States)

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E; Hanson, Blake M; Smith, Tara C

    2017-09-07

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n = 3347) and contemporaneously from meat products in stores where participants report purchasing meat (n = 913). The staphylococcal protein A (spa) gene was sequenced for all isolates to determine a spa type. Morisita indices and Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) were used to determine the relationship between spa type composition among human samples and meat samples. spa type composition was significantly different between households and meat sampled from their associated grocery stores. spa types found in meat were not significantly different regardless of the store or county in which they were sampled. spa types in people also exhibit high similarity regardless of residential location in urban or rural counties. Such findings suggest meat is not an important source of S. aureus colonization in shoppers.

  14. Omega-3 fatty acids, nutrient retention values, and sensory meat eating quality in cooked and raw Australian lamb.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    This study evaluated omega-3 intramuscular fatty acids in the longissimus thoracis et lumborum of commercially prepared Australian lamb loin chops. Meats, denuded of external fats were cooked by means of conductive dry-heat using a fry grilling hot plate, to a core temperature of 70°C. An untrained consumer panel assessed meat appearance, aroma, tenderness, juiciness, taste and overall liking. Results showed no compositional alterations (P>0.05) to omega-3 fatty acids due to cooking treatment, whereas on absolute terms (mg/100g muscle) omega-3 fatty acids significantly (Pcooked meat at 32.8±2.3mg/100g muscle exceeded the minimum 30mg/100g per edible portion required for the defined Australian classification as 'source' long-chain (≥C 20 ) omega-3 for cooked lamb. A 3.4% intramuscular fat content in the initial raw meat was sufficient to maintain acceptable overall sensory eating quality. Results endorse the application of this cooking method to enable delivery of health beneficial long-chain omega-3 fatty acids of commercially prepared Australian lamb loin chops to consumers without impediments to sensory eating properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR.

    Science.gov (United States)

    Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg

    2012-01-01

    The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

  16. The use of electron beams for pasteurization of meats

    International Nuclear Information System (INIS)

    Prestwich, K.R.; Kaye, R.J.; Turman, B.N.; Neau, E.L.

    1994-01-01

    Electron beam accelerators can be used for electronic pasteurization of meat products by: (1) using the electrons directly impacting the products, or (2) optimizing the conversion of electron energy to x-rays and treating the product with these x-rays. The choice of process depends on the configuration of the product when it is treated. For electron treatment, ten million electron volt (MeV) kinetic energy is the maximum allowed by international agreement. The depth of penetration of electrons with that energy into a product with density of meat is about five centimeters (cm). Two-sided treatment can be done on products up to 10 cm thick with a two-to-one ratio between minimum and maximum dose. Ground beef patties are about 1.25 cm (0.5 inch thick). Beams with 2.5 MeV electron energy could be used to treat these products. Our calculations show that maximum to minimum dose ratios less than 1.2 can be achieved with this energy if the transverse beam energy is small. If the product thickness is greater than 10 cm, x-rays can provide the needed dose uniformity. Uniform doses can be supplied for pallets with dimensions greater than 1.2 m on each side using x-rays from a 5 MeV electron beam. The efficiency of converting the electron beam to x-rays and configurations to achieve dose uniformity are discussed

  17. Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2017-01-01

    Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

  18. Meat Quality Assessment by Electronic Nose (Machine Olfaction Technology

    Directory of Open Access Journals (Sweden)

    Sundar Balasubramanian

    2009-07-01

    Full Text Available Over the last twenty years, newly developed chemical sensor systems (so called “electronic noses” have made odor analyses possible. These systems involve various types of electronic chemical gas sensors with partial specificity, as well as suitable statistical methods enabling the recognition of complex odors. As commercial instruments have become available, a substantial increase in research into the application of electronic noses in the evaluation of volatile compounds in food, cosmetic and other items of everyday life is observed. At present, the commercial gas sensor technologies comprise metal oxide semiconductors, metal oxide semiconductor field effect transistors, organic conducting polymers, and piezoelectric crystal sensors. Further sensors based on fibreoptic, electrochemical and bi-metal principles are still in the developmental stage. Statistical analysis techniques range from simple graphical evaluation to multivariate analysis such as artificial neural network and radial basis function. The introduction of electronic noses into the area of food is envisaged for quality control, process monitoring, freshness evaluation, shelf-life investigation and authenticity assessment. Considerable work has already been carried out on meat, grains, coffee, mushrooms, cheese, sugar, fish, beer and other beverages, as well as on the odor quality evaluation of food packaging material. This paper describes the applications of these systems for meat quality assessment, where fast detection methods are essential for appropriate product management. The results suggest the possibility of using this new technology in meat handling.

  19. Meat quality assessment by electronic nose (machine olfaction technology).

    Science.gov (United States)

    Ghasemi-Varnamkhasti, Mahdi; Mohtasebi, Seyed Saeid; Siadat, Maryam; Balasubramanian, Sundar

    2009-01-01

    Over the last twenty years, newly developed chemical sensor systems (so called "electronic noses") have made odor analyses possible. These systems involve various types of electronic chemical gas sensors with partial specificity, as well as suitable statistical methods enabling the recognition of complex odors. As commercial instruments have become available, a substantial increase in research into the application of electronic noses in the evaluation of volatile compounds in food, cosmetic and other items of everyday life is observed. At present, the commercial gas sensor technologies comprise metal oxide semiconductors, metal oxide semiconductor field effect transistors, organic conducting polymers, and piezoelectric crystal sensors. Further sensors based on fibreoptic, electrochemical and bi-metal principles are still in the developmental stage. Statistical analysis techniques range from simple graphical evaluation to multivariate analysis such as artificial neural network and radial basis function. The introduction of electronic noses into the area of food is envisaged for quality control, process monitoring, freshness evaluation, shelf-life investigation and authenticity assessment. Considerable work has already been carried out on meat, grains, coffee, mushrooms, cheese, sugar, fish, beer and other beverages, as well as on the odor quality evaluation of food packaging material. This paper describes the applications of these systems for meat quality assessment, where fast detection methods are essential for appropriate product management. The results suggest the possibility of using this new technology in meat handling.

  20. Effect of chosen lactic acid bacteria strains on Staphylococcus aureus in vitro as well as in meat and raw sausages.

    Science.gov (United States)

    Gomółka-Pawlicka, M; Uradziński, J; Wiszniewska, A

    2004-01-01

    The present study was aimed at determining the influence of 15 strains of lactic acid bacteria on the growth of 2 Staphylococcus aureus strains in vitro as well as in meat and raw sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus sp. strains and, partly, methodological approach. The study also considered water activity (a(w)) and pH of the products investigated. The results obtained are demonstrated in 5 diagrams. It was found that among 15 strains of Lactobacillus aureus investigated only one strain, Lactobacillus helveticus T 78, showed antagonistic effect on studied strains of Staphylococcus aureus both in vitro as well as in meat and raw sausages. Five other strains of Lactobacillus spp. displayed the antagonistic effect in vitro only. The temperature and incubation time of sausages, but also the type of sausage stuffing were found to have a distinct or slight influence, respectively, on the antagonistic interaction between the bacteria. However, this phenomenon was affected by neither a(w) nor pH.

  1. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Prevalence and antimicrobial susceptibility of Salmonella isolated from a variety of raw meat sausages in Gaborone (Botswana) retail stores.

    Science.gov (United States)

    Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz

    2012-04-01

    The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.

  3. Compared with Raw Bovine Meat, Boiling but Not Grilling, Barbecuing, or Roasting Decreases Protein Digestibility without Any Major Consequences for Intestinal Mucosa in Rats, although the Daily Ingestion of Bovine Meat Induces Histologic Modifications in the Colon.

    Science.gov (United States)

    Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire

    2016-08-01

    Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications

  4. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  5. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  6. THE USAGE OF ANIMAL AND VEGETABLE ORIGIN RAW MATERIALS COMBINATORICS IN MEAT PRODUCTS OF “HALAL†CATEGORY DEVELOPMENT

    OpenAIRE

    Ivan F. Gorlov; Oksana B. Gelunova; Tatiana M. Giro; Ekaterina P. Mirzayanova

    2014-01-01

    Integrated researches aimed to develop technologies and recipes for meat products of “Halal†category using seed fat and Milk Protein-Carbohydrate Concentrate (MPCC) represent a new generation of scientific and practical interest. In this connection, the authors propose technologies and recipes for meat products of “Halal†category, designed on the basis of rational combinatorics of animal and vegetable origin raw materials, that l...

  7. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  8. Presence of Staphylococcus aureus and Shiga Toxigenic Escherichia coli O157:H7 in Raw Meat in Ağrı, Turkey

    Directory of Open Access Journals (Sweden)

    Naim Deniz Ayaz

    2016-08-01

    Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.

  9. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  10. Impact of rearing conditions on the microbiological quality of raw retail poultry meat.

    Science.gov (United States)

    Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene

    2013-08-01

    There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®

  11. Effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits.

    Science.gov (United States)

    Liao, Kuoyao; Cai, Jingyi; Shi, Zhujun; Tian, Gang; Yan, Dong; Chen, Delin

    2017-06-01

    This study was conducted to investigate the effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits, in order to determine appropriate rabbit feed processing methods and processing parameters. In Exp. 1, an orthogonal design was adopted. Barrel temperature, material moisture content and feed rate were selected as test factors, and acid detergent fiber (ADF) content was selected as an evaluation index to research the optimum extrusion parameters. In Exp. 2, a two-factor design was adopted. Four kinds of rabbit feeds were processed and raw material extrusion adopted optimum extrusion parameters of Exp. 1. A total of 40 healthy and 42-day-old rabbits with similar weight were used in a randomized design, which consisted of 4 groups and 10 replicates in each group (1 rabbits in each replicate). The adaptation period lasted for 7 d, and the digestion trial lasted for 4 d. The results showed as follows: 1) ADF was significantly affected by barrel temperature ( P  digestibility of dry matter and total energy ( P  digestibility of crude fiber (CF), ADF and NDF ( P  digestibility of rabbit feed. Thus, using extrusion and steam conditioning technology at the same time in the weaning rabbits feed processing can improve the pellet quality and nutrient apparent digestibility of rabbit feed.

  12. Effect of type of suckling and polyunsaturated fatty acid use on lamb production. 2. Chemical and fatty acid composition of raw and cooked meat

    Directory of Open Access Journals (Sweden)

    Francesco Toteda

    2010-01-01

    Full Text Available This study was carried out in order to examine the chemical and fatty acid composition of raw and cooked meat obtained fromlambs raised under mothers or reared by artificial suckling with acidified milk replacers with or without polyunsaturated fattyacid (PUFA supplementation. Meat samples were taken from twenty Gentile di Puglia male lambs subjected to the followingfeeding treatments: the control group received only maternal milk (MM, n.=6 while two groups were reared by artificial sucklingwith an acidified milk replacer (MR, n.=7 or with an acidified milk replacer supplemented with 10 ml/l of a PUFA enrichedoil (MR+PUFA, n.=7. Lambs were slaughtered at 45 days of age. After 24 hours of refrigeration at 4 °C, the lumbar regionwas dissected from each right half-carcass and split into pieces, one of which was used raw while the other was cooked in aventilated electric oven at 180 °C until an internal temperature of 75 °C was reached. Chemical and fatty acid analysis wereperformed on raw and cooked meat, while only raw meat was assessed for cholesterol. Cooking losses were also evaluated.Meat obtained from MR+PUFA fed lambs contained more fat (Punder mothers increased the total amount of saturated fatty acids (SFA, compared with both the MR group (Pthe MR+PUFA one (Pcomparison with both MR diets. The highest PUFA/SFA ratio of meat was recorded for the MR+PUFA group (0.27, with statisticaldifferences respect to the MR group (0.21; Pmilk produced meat containing more cholesterol than the MR+PUFA group (85.89 vs 76.26 mg/100 g; Pindex of meat was higher following natural rearing in comparison with the MR+PUFA treatment (1.34 vs 1.05;Pand 0.76, respectively; Pparameters evaluated. In conclusion, artificial suckling with acidified milk replacers improves some meat quality features.Supplementation of milk replacers with PUFAs, although in a limited way, may improve the dietetic properties of lamb meat.

  13. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    Directory of Open Access Journals (Sweden)

    Claudiu-Dan Salagean

    2013-11-01

    Full Text Available Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon and mix of natural spices - fine grinding variant (1 and coarse grinding variant (3 - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon + vegetable protein supplements (textured soy protein + binder (protein + fiber + additive mix - fine grinding variant (2 and coarse grinding variant (4 - chopping at the volf through the sieve of 3 - 4 mm. In this respect organoleptic analyzes were performed on appearance (exterior and section, color, smell, texture and taste of the finished product (after roasting, the results highlighting that, in terms of organoleptic, sample 1 obtained the highest score (on a scale of 1-poor to 5-very good quality (average 21.83, followed by sample 3 (average 19.22, the very small difference in the case of sample 2 (average 19.19 and finally, sample 4 (average 18.75. It was noted that sample 1 obtained the highest score (average of all analyzed organoleptic indicators: appearance (4.33, color (4.39, smell (4.67, texture (4.33 and taste (4.11 being favorite by all volunteer subjects who participated at the analysis. The same thing was found in sensory analysis of mici paste in fresh/chilled condition: 65% of subjects preferred variant 1 followed by variant 3 (19.2%, variant 2 (11.5% and finally, variant 4 (3.8%. In terms of economic the highest efficiency was found in 2 (specific consumption 0.73 and 4 (specific consumption 0.77 variants compared to 1 (specific consumption 0.80 and 3 (specific consumption 0.82 variants, which translates into a reduction in the cost of products manufactured in the variants 2 and 4 (with protein supplements and additive mix by about 25-20% (with importance for the manufacturer. Also, thermal processing (roasting revealed the

  14. Raw meat based diet influences faecal microbiome and end products of fermentation in healthy dogs.

    Science.gov (United States)

    Sandri, Misa; Dal Monego, Simeone; Conte, Giuseppe; Sgorlon, Sandy; Stefanon, Bruno

    2017-02-28

    Dietary intervention studies are required to deeper understand the variability of gut microbial ecosystem in healthy dogs under different feeding conditions and to improve diet formulations. The aim of the study was to investigate in dogs the influence of a raw based diet supplemented with vegetable foods on faecal microbiome in comparison with extruded food. Eight healthy adult Boxer dogs were recruited and randomly divided in two experimental blocks of 4 individuals. Dogs were regularly fed a commercial extruded diet (RD) and starting from the beginning of the trial, one group received the raw based diet (MD) and the other group continued to be fed with the RD diet (CD) for a fortnight. After 14 days, the two groups were inverted, the CD group shifted to the MD and the MD shifted to the CD, for the next 14 days. Faeces were collected at the beginning of the study (T0), after 14 days (T14) before the change of diet and at the end of experimental period (T28) for DNA extraction and analysis of metagenome by sequencing 16SrRNA V3 and V4 regions, short chain fatty acids (SCFA), lactate and faecal score. A decreased proportion of Lactobacillus, Paralactobacillus (P diet significantly (P diet composition modifies faecal microbial composition and end products of fermentation. The administration of MD diet promoted a more balanced growth of bacterial communities and a positive change in the readouts of healthy gut functions in comparison to RD diet.

  15. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  16. Effect of electron beam irradiation on the quality of mackerel (Pneumatophorus japonicus) Meat

    International Nuclear Information System (INIS)

    Wu Dongxiao; Yang Wenge; Xu Dalun; Zhou Xingyu; Ou Changrong; Shi Huidong

    2012-01-01

    The effect of 3, 5, 7 kGy electron beam irradiation on the volatile basic nitrogen (VBN) and peroxide value (POV), the contents of histamine and unsaturated fatty acid (UFA) in Pneumatophorus japonicus meat with vacuum or ordinary package were measured during refrigeration. The results showed that electron beam treatment could effectively control the contents of histamine and VBN, postpone the oxidation of unsaturated fatty acid in P. japonicus meat. The shelf life of P. japonicus meat could be extended with electron beam irradiation. Before cold storage, it is appropriate that the P. japonicus meat were ordinary packaged and irradiated at the dose of 5 kGy. (authors)

  17. Identification of irradiated chicken meat using electron spin resonance spectroscopy

    International Nuclear Information System (INIS)

    Chawla, S.P.; Thomas, Paul

    2004-01-01

    Studies were carried out on detection of irradiation treatment in chicken using electron spin resonance (ESR) spectroscopy. The effect of gamma- irradiation treatment on radiation induced signal in different types of chicken namely, broiler, deshi and layers was studied. Irradiation treatment induced a characteristic ESR signal that was not detected in non-irradiated samples. The shape of the signal was not affected by type of the bone. The intensity of radiation induced ESR signal was affected by factors such as absorbed radiation dose, bone type irradiation temperature, post-irradiation storage, post-irradiation cooking and age of the bird. Deep-frying resulted in the formation of a symmetric signal that had a different shape and was weaker than the radiation induced signal. This technique can be effectively used to detect irradiation treatment in bone-in chicken meat even if stored and/or subjected to various traditional cooking procedures. (author)

  18. meat

    African Journals Online (AJOL)

    p2492989

    These nutrient values determined in meat from red hartebeest could ... percentage of a-linolenic acid (C18:3n-3) (Wiklund et al., 2001). .... system (1525 HPLC with a binary gradient delivery, 717 auto-sampler and Injector, 1500 ..... polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork: A review.

  19. Effects of diet, packaging, and irradiation on protein oxidation, lipid oxidation, and color of raw broiler thigh meat during refrigerated storage.

    Science.gov (United States)

    Xiao, S; Zhang, W G; Lee, E J; Ma, C W; Ahn, D U

    2011-06-01

    This study was designed to evaluate the effects of dietary treatment, packaging, and irradiation singly or in combination on the oxidative stability of broiler chicken thigh meat. A total of 120 four-week-old chickens were divided into 12 pens (10 birds/pen), and 4 pens of broilers were randomly assigned to a control oxidized diet (5% oxidized oil) or an antioxidant-added diet [500 IU of vitamin E + 200 mg/kg of butylated hydroxyanisole (BHA)] and fed for 2 wk. After slaughter, thigh meats were separated, ground, packaged in either oxygen-permeable or oxygen-impermeable vacuum bags, and irradiated at 0 or 3 kGy. Lipid oxidation (TBA-reactive substances), protein oxidation (carbonyl), and color of the meat were measured at 1, 4, and 7 d of refrigerated storage. The lipid and protein oxidation of thigh meats from birds fed the diet supplemented with antioxidants (vitamin E + BHA) was significantly lower than the lipid and protein oxidation of birds fed the control diet, whereas the lipid and protein oxidation of broilers fed the oxidized oil diet was higher than that of birds fed the control diet. Vacuum packaging slowed, but irradiation accelerated, the lipid and protein oxidation of thigh meat during storage. Dietary antioxidants (vitamin E + BHA) and irradiation treatments showed a stronger effect on lipid oxidation than on protein oxidation. A significant correlation between lipid and protein oxidation in meat was found during storage. Dietary supplementation of vitamin E + BHA and the irradiation treatment increased the lightness and redness of thigh meat, respectively. It is suggested that appropriate use of dietary antioxidants in combination with packaging could be effective in minimizing oxidative changes in irradiated raw chicken thigh meat.

  20. Predicting the concentration of verotoxin-producing Escherichia coli bacteria during processing and storage of fermented raw-meat sausages.

    Science.gov (United States)

    Quinto, E J; Arinder, P; Axelsson, L; Heir, E; Holck, A; Lindqvist, R; Lindblad, M; Andreou, P; Lauzon, H L; Marteinsson, V Þ; Pin, C

    2014-05-01

    A model to predict the population density of verotoxigenic Escherichia coli (VTEC) throughout the elaboration and storage of fermented raw-meat sausages (FRMS) was developed. Probabilistic and kinetic measurement data sets collected from publicly available resources were completed with new measurements when required and used to quantify the dependence of VTEC growth and inactivation on the temperature, pH, water activity (aw), and concentration of lactic acid. Predictions were compared with observations in VTEC-contaminated FRMS manufactured in a pilot plant. Slight differences in the reduction of VTEC were predicted according to the fermentation temperature, 24 or 34°C, with greater inactivation at the highest temperature. The greatest reduction was observed during storage at high temperatures. A population decrease greater than 6 decimal logarithmic units was observed after 66 days of storage at 25°C, while a reduction of only ca. 1 logarithmic unit was detected at 12°C. The performance of our model and other modeling approaches was evaluated throughout the processing of dry and semidry FRMS. The greatest inactivation of VTEC was predicted in dry FRMS with long drying periods, while the smallest reduction was predicted in semidry FMRS with short drying periods. The model is implemented in a computing tool, E. coli SafeFerment (EcSF), freely available from http://www.ifr.ac.uk/safety/EcoliSafeFerment. EcSF integrates growth, probability of growth, and thermal and nonthermal inactivation models to predict the VTEC concentration throughout FRMS manufacturing and storage under constant or fluctuating environmental conditions.

  1. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    Omega-3 long-chain (≥C 20 ) polyunsaturated fatty acids (ω3 LC-PUFA) confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL) muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO) was evaluated. Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO): a control diet at 0 mL/kg DM of DCCO (DCCOC); 25 mL/kg DM of DCCO (DCCOM) and 50 mL/kg DCCO (DCCOH). Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Within raw meats: DCCOH supplemented lambs had significantly ( P  culinary preparation method can be used as effective management tools to deliver nutritionally improved ω3 LC-PUFA lamb to meat consumers.

  2. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  3. Quality characteristics of raw and canned goat meat in water, brine, oil and Thai curry during storage

    OpenAIRE

    Yoottana Polpara; Thanyaporn Sornprasitt; Saowakon Wattanachant

    2008-01-01

    The quality characteristics of three groups of goat meat obtained from one year and three years old Anglonubian crossed native, and culled Saanen crossed native were investigated. Significant differences in fat, ash and total collagen content, were observed among groups of goat meat (P

  4. Analysis of raw meat for heavy metals and bacterial contamination and comparison of antibiotic susceptibility of isolated bacteria

    International Nuclear Information System (INIS)

    Ahmad, F.

    2016-01-01

    The focus of the study was to analyze the commercially available meat for its heavy metal contents and bacterial contamination. The meat samples were collected from four commercial markets of Lahore, i.e., as Wafaqi Colony (Site I),Township (Site II), G-1 Market (Site III) and Zenith (Site IV), and analyzed for heavy metal [i.e., manganese (Mn), nickel (Ni), chromium (Cr), cadmium (Cd) and copper (Cu)] contents and bacterial contaminants (E. coli, Pseudomonas sp., Bacillus sp. and Salmonella sp.) Atomic absorption spectrophotometery was employed for the detection of the heavy metals and plate count method was used for the detection of bacterial contaminants. The Ni concentration in the Site II sample only and Cd concentration in all meat samples were found above the standard value and the concentration of other metals (Cu, Cr, and Mn) was less than the standard concentrations. Bacterial (E. coli, Pseudomonas sp., Bacillus sp., Salmonella sp. and Staphylococcus sp.) contamination was found in all meat samples; however, the number was a little lower in the Site IV samples. Statistical analysis was done, by one-way ANOVA using SPSS, to compare heavy metal contamination in the meat samples. The results showed distribution of heavy metals in all meat samples there was significant difference of Ni concentration in the meat samples. The measure of antibiotic susceptibility showed that isolated species of bacteria were resistant to lincomycin, streptomycin, tertracyclin, ampicillin, amoxicillin and doxycyclin, but did not survive in the medium containing ofloxacin. (author)

  5. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

    Science.gov (United States)

    Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

    2017-01-01

    Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

  6. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand.

    Science.gov (United States)

    Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E

    2017-09-01

    Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.

  7. Chemical and biotechnological processing of collagen-containing raw materials into functional components of feed suitable for production of high-quality meat from farm animals

    Science.gov (United States)

    Baburina, M. I.; Ivankin, A. N.; Stanovova, I. A.

    2017-09-01

    The process of chemical biotechnological processing of collagen-containing raw materials into functional components of feeds for effective pig rearing was studied. Protein components of feeds were obtained as a result of hydrolysis in the presence of lactic acid of the animal collagen from secondary raw materials, which comprised subcutaneous collagen (cuticle), skin and veined mass with tendons from cattle. For comparison, a method is described for preparing protein components of feeds by cultivating Lactobacillus plantarum. Analysis of the kinetic data of the conversion of a high-molecular collagen protein to an aminolyte polypeptide mixture showed the advantage of microbiological synthesis in obtaining a protein for feeds. Feed formulations have been developed to include the components obtained, and which result in high quality pork suitable for the production of quality meat products.

  8. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  9. Lessons learned from a textbook outbreak: EHEC-O157:H7 infections associated with the consumption of raw meat products, June 2012, Limburg, Belgium.

    Science.gov (United States)

    Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis

    2014-01-01

    On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.

  10. Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

    Science.gov (United States)

    Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

    2017-07-01

    Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

  11. Aerobic Mesophilic, Coliform, Escherichia coli, and Staphylococcus aureus Counts of Raw Meat from the Formal and Informal Meat Sectors in South Africa.

    Science.gov (United States)

    Jaja, Ishmael Festus; Green, Ezekiel; Muchenje, Voster

    2018-04-21

    Foodborne disease (FBD) is a global public health concern, and foods from animal sources have been associated with outbreaks of food-related illness. In this study, animal carcasses from the two abattoirs (HT1 and HT2) in the formal meat sector (FMS) and slaughter points in the informal meat sector (INMS) were examined at two stages of slaughter (before washing and after washing) for aerobic colony counts (ACC) and total viable count (TCC), as well as Escherichia coli and Staphylococcus aureus count. At each stage, carcasses were sampled by swabbing at the neck, brisket, flank, and rump. ACC for beef, mutton, and pork carcasses at HT1 and HT2 before washing were between 2.5⁻5.8, 2.2⁻4.7, and 2.7⁻3.7 mean log CFU/cm², respectively, and TCC count before washing was highest on the neck of cattle (6.3 ± 2.4) and after washing was highest on the perineal of sheep (5.7 ± 6.9). In the INMS, TCC count was highest on the brisket (6.9 ± 3.2) and in the neck (5.5 ± 2.4). Higher ACC values of 6.2⁻6.7 mean log CFU/cm² were obtained in the INMS. The highest count for E. coli (4.2 mean log CFU/cm²) after washing was in the neck, while the highest count for S. aureus (4.0 mean log CFU/cm²) was in the flank. All bacteria count in the INMS exceeded acceptable limits, and washing did not significantly reduce microbial load in meat in the FMS and INMS. Bacteria count in the FMS and INMS exceeded acceptable standards. However, meat processed in the INMS poses a more significant risk of FBD to consumers.

  12. FEEDING OF FERRETS WITH THE RAW MEAT AND LIVER OF CHICKENS CHRONICALLY POISONED WITH TOXIC GROUNDNUT MEAL.

    Science.gov (United States)

    PLATONOW, N; BEAUREGARD, M

    1965-03-01

    Chickens were fed a ration containing 30 per cent of toxic groundnut meal for up to six weeks. The concentration of aflatoxin (toxic metabolites of Aspergillus flavus) in the above ration was 3.06 p.p.m. At the end of 2nd, 4th or 6th week the birds were killed. The meat was removed from the bones and put through a meat grinder. The livers of three groups were pooled together. Three control groups of birds kept on commercial pellets were treated similarly. Female ferrets, two years of age, were used in the present study. They were divided into four groups. The first three groups were given for one month meat from chickens fed the toxic ration for 2, 4, and 6 weeks, respectively. Each of these three groups contained one control ferret that was fed with the meat of chickens fed a commercial ration for a similar period of time. One half of the 4th group was fed pooled liver from intoxicated birds and one half was fed liver from control birds. No significant changes in the ferret tissues were observed as a consequence of feeding them with the meat or liver from the chickens chronically poisoned with toxic groundnut meal.

  13. Unraveling the chemical identity of meat pigments.

    Science.gov (United States)

    Pegg, R B; Shahidi, F

    1997-10-01

    This review examines the chemistry of nitrite curing of meat and meat products as it relates to the development of cured meat color and provides a detailed account of how nitrite-free processed meats could be prepared using the preformed cooked cured-meat pigment (CCMP). Thus, a chemical description of meat color, both raw and cooked, and characterization of nitrosylheme pigments follows. Based on electron paramagnetic resonance (EPR), visible and infrared spectroscopic studies, evidence has been provided to support the hypothesis that the chemical structure of the preformed CCMP is identical to that of the pigment prepared in situ after thermal processing of nitrite-cured meat and is in fact a mononitrosylheme complex. An appendix, which describes the basic principles of EPR spectroscopy used in the context of this review, is attached.

  14. Effect of electron beam irradiation on the nutritional ingredient of Sciaenops ocellatus meat

    International Nuclear Information System (INIS)

    Zhang Chunfang; Yang Wenge; Xu Dalun; Shi Huidong

    2011-01-01

    The influences of electron beam irradiation and package pattern (vacuum or ordinary) on the nutritional ingredient of Sciaenops ocellatus meat were investigated. The results were summarized as follows: (1) Electron-beam irradiation dose had notable effect on the moisture content, but no significant impact on the content of ash, protein, lipid and total carbohydrate. Teh package pattern had no significant effect on the common nutrional composition of Sciaenops ocellatus meat. (2) Either package pattern or irradiation dose showed little influence on the total amino acids, delicious amino acid, EAA/TAA and EAA/NEAA of Sciaenops ocellatus meat. The first limiting amino acid of Sciaenops ocellatus meat changed from Met plus Cys to Val in virtue of electron beam irradiation. (3) Both irradiation dose and package pattern showed no difference to the total fatty acid content. But the irradiation dose had notable effect on the relative content of unsaturated fatty acid, polyunsaturated fatty acid and DHA. The vacuum-packaged group had less DHA loss than the ordinary-packaged group with the same absorbed dose, and low dose groups had less DHA loss than the high groups. As conclusion, combining with the bactericidal effect of electron beam irradiation to Sciaenops ocellatus meat, the recommended dose has been proposed to be 3-5 kGy. (authors)

  15. Analysis of micro-structure in raw and heat treated meat emulsions from multimodal X-ray microtomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2014-01-01

    This study presents a novel non-destructive X-ray technique for analyzing meat emulsions before and after heat treatment. The method is based on X-ray grating-interferometry where three complementary imaging modalities are obtained simultaneously measuring the absorption, refraction and scatterin...

  16. Potential of Electronic Plastic Waste as a Source of Raw Material and Energy Recovery

    International Nuclear Information System (INIS)

    Norazli Othman; Nor Ezlin Ahmad Basri; Lariyah Mohd Sidek

    2009-01-01

    Nowadays, the production of electronic equipment is one of the fastest growing industrial activities in this world. The increase use of plastic in this sector resulted in an increase of electronic plastic waste. Basically, electronic plastic material contains various chemical elements which act as a flame retardant when electronic equipment is operated. In general, the concept of recycling electronic plastic waste should be considered in order to protect the environment. For this purpose, research has been conducted to different resins of electronic plastic waste to identify the potential of electronic plastic waste as a source of raw material and energy recovery. This study was divided into two part for example determination of physical and chemical characteristics of plastic resins and calculation of heating value for plastic resins based on Dulong formula. Results of this research show that the average calorific value of electronic waste is 30,872.42 kJ/ kg (7,375 kcal/ kg). The emission factor analysis showed that the concentration of emission value that might occur during waste management activities is below the standard set by the Environment Quality Act 1974. Basically, this research shows that electronic plastic waste has the potential to become the source of raw material and energy recovery. (author)

  17. Experimental research on fresh mussel meat irradiated by high-dose electron beam

    International Nuclear Information System (INIS)

    Xiao Lin; Lu Ruifeng; Hu Huachao; Wang Chaoqi; Liu Yanna

    2011-01-01

    The sterilization storage of fresh mussel irradiated high-dose electron beam was studied. From the subjective assessment by the weighted average of the test and other determined parameters, it can be concluded that the flavor of fresh mussel meat sealed canned food irradiated by high-dose electron beam has not been significant affected, and various micro-organisms can be killed effectively, which means that the irradiated fresh mussel meat can be preserved for long-term at room temperature. Therefore the method might resolve the problems induced by traditional frozen preservation methods. (authors)

  18. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat

    Directory of Open Access Journals (Sweden)

    Aaron Ross Flakemore

    2017-08-01

    Full Text Available Abstract Background Omega-3 long-chain (≥C20 polyunsaturated fatty acids (ω3 LC-PUFA confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO was evaluated. Methods Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO: a control diet at 0 mL/kg DM of DCCO (DCCOC; 25 mL/kg DM of DCCO (DCCOM and 50 mL/kg DCCO (DCCOH. Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Results Within raw meats: DCCOH supplemented lambs had significantly (P < 0.05 higher concentrations of eicosapentaenoic (EPA, 20:5ω3 and EPA + docosahexaenoic (DHA, 22:6ω3 acids than those supplemented with DCCOM or DCCOC; Dorset sired lambs contained significantly (P < 0.05 more EPA and EPA + DHA than other sire breeds; diet and sire breed interactions were significant (P < 0.05 in affecting EPA and EPA + DHA concentrations. In cooked meat, ω3 LC-PUFA concentrations in DCCOM (32 mg/100 g, DCCOH (38 mg/100 g, Dorset (36 mg/100 g, White Suffolk (32 mg/100 g, ewes (32 mg/100 g and wethers (33 mg/100 g, all exceeded the minimum content of 30 mg/100 g of edible cooked portion of EPA + DHA for Australian defined ‘source’ level ω3 LC-PUFA classification. Conclusion These results present that combinations of dietary degummed crude canola oil, sheep genetics and culinary preparation method can be used as

  19. Improvement of biomolecular methods for the identification and typing of Escherichia coli O157:H7 isolated from raw meat.

    Science.gov (United States)

    Paris, A; Bonardi, S; Bacci, C; Boni, E; Salmi, F; Bassi, L; Brindani, F

    2010-06-01

    The aim of the study was to evaluate the sensitivity of two m-PCR methods for the quantitative determination of E. coli O157:H7 in foodstuffs. Genomic serotyping was carried out on bacterial cultures, and the necessary time was optimized to increase the resolution of the method. Subsequently, artificial contamination trials using meat were conducted to assess method accuracy in foodstuffs and pursue the genetic typing of pathogens. Measurement thresholds were shown to range between 10(5) and 10(6) CFU/mL, but were reduced by four logarithmic cycles in 80% of samples. Relative to the meat contamination trials, serotypes were identified after 24 hours, corresponding to 10 CFU/mL inoculum, with higher rates seen when m-TSB was used for enrichment. Inoculated samples were found to contain three virulence factors (hlyA, eaeA, and stx1).

  20. 78 FR 19182 - Electronic Filing of Import Inspection Applications for Meat, Poultry, and Egg Products...

    Science.gov (United States)

    2013-03-29

    ...] Electronic Filing of Import Inspection Applications for Meat, Poultry, and Egg Products: Availability of..., and egg products through the Automated Commercial Environment (ACE). ACE is the Web- based portal for... products (21 U.S.C. 620, 466). The Egg Products Inspection Act (EPIA) (21 U.S.C. 1031 et seq.) prohibits...

  1. Effect of irradiation dose and irradiation temperature on the thiamin content of raw and cooked chicken breast meat

    International Nuclear Information System (INIS)

    Graham, W.D.; Stevenson, M.H.; Stewart, E.M.

    1998-01-01

    The usefulness of ionising radiation for the elimination of pathogenic bacteria in poultry meat has been well documented as have the effects of this processing treatment on the nutritional status of the food, in particular, the vitamins. Unfortunately, much of the earlier research carried out on the effect of irradiation on vitamins was carried out in solution or in model systems at doses much greater than those used commercially thereby resulting in considerable destruction of these compounds. Thus, those opposed to the process of food irradiation labelled the treated food as nutritionally poor. However, in reality, due to the complexity of food systems the effects of irradiation on vitamins are generally not as marked and many processes, for example cooking, cause the same degree of change to the vitamins. Thiamin (vitamin B1) is the most radiation sensitive of the water-soluble vitamins and is therefore a good indicator of the effect of irradiation treatment. In this study the effects of irradiation at either 4°C or −20°C followed by cooking on the thiamin content of chicken breast meat was determined. Results showed that whilst both irradiation and cooking resulted in a decrease in thiamin concentration, the losses incurred were unlikely to be of nutritional significance and could be further minimised by irradiating the chicken meat at a low temperature. Thiamin analyses were carried out using high-performance liquid chromatography since this technique is faster and more selective than the chemical or microbiological methods more commonly employed. Total thiamin, both free and combined form, was determined following acid and enzyme hydrolysis. © 1998 Society of Chemical Industry

  2. Comparative antioxidant effect of BHT and water extracts of banana and sapodilla peels in raw poultry meat.

    Science.gov (United States)

    Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita

    2014-02-01

    Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.

  3. Incomplete sanitation of a meat grinder and ingestion of raw ground beef: contributing factors to a large outbreak of Salmonella typhimurium infection.

    Science.gov (United States)

    Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P

    1997-10-01

    Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.

  4. Effect of electron beam-cross-linked gels on the rheological properties of raw natural rubber

    Energy Technology Data Exchange (ETDEWEB)

    Mitra, Suman; Chattopadhyay, Santanu [Rubber Technology Centre, Indian Institute of Technology, Kharagpur, West Bengal 721302 (India); Bharadwaj, Y.K.; Sabharwal, S. [Radiation Technology Development Section, Bhabha Atomic Research Center, Trombay, Mumbai 400085 (India); Bhowmick, Anil K. [Rubber Technology Centre, Indian Institute of Technology, Kharagpur, West Bengal 721302 (India)], E-mail: anilkb@rtc.iitkgp.ernet.in

    2008-05-15

    Electron beam (EB)-cross-linked natural rubber (NR) gels were prepared from latex and characterized by various techniques. The addition of a small amount of these gels to raw NR was found to reduce the apparent shear viscosity and die swell remarkably. This effect was further enhanced with the addition of butyl acrylate as a sensitizer. The apparent shear viscosity first decreased up to 8 phr of gel loading and then increased. However, the percent die swell value decreased steadily upon gel loading. These were explained by calculating principal normal stress difference, the activation energy of melt flow and characteristics of EB-cross-linked gels. These effects were also reflected in the changes of mechanical and dynamic mechanical properties of gel-filled raw NR. Tailoring of the above properties could be done with the help of these gels.

  5. Microbiological, physicochemical and sensory parameters of dry fermented sausages manufactured with high hydrostatic pressure processed raw meat.

    Science.gov (United States)

    Omer, M K; Prieto, B; Rendueles, E; Alvarez-Ordoñez, A; Lunde, K; Alvseike, O; Prieto, M

    2015-10-01

    The aim of this trial was to describe physicochemical, microbiological and organoleptic characteristics of dry fermented sausages produced from high hydrostatic pressure (HHP) pre-processed trimmings. During ripening of the meat products pH, weight, water activity (aw), and several microbiological parameters were measured at zero, eight, fifteen days and after 6weeks. Sensory characteristics were estimated at day 15 and after six weeks by a test panel by using several sensory tests. Enterobacteriaceae were not detected in sausages from HHP-processed trimmings. Fermentation was little affected, but weight and aw of the HHP-processed sausages decreased faster during ripening. HHP-treated sausages were consistently less favoured than non HHP-treated sausages, but the strategy may be an alternative approach if the process is optimized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. OPTICAL-ELECTRONIC SYSTEM FOR EXPRESS ANALYSIS OF ORE DRESSABILITY FOR MINERAL RAW MATERIALS BY OPTICAL METHOD

    Directory of Open Access Journals (Sweden)

    A. A. Alekhin

    2013-05-01

    Full Text Available The article deals with creation results of experimental prototype of optical-electronic complex, designed to assess ore dressability of mineral raw materials by optical sorting method.

  7. The Structural Characterisation of Risk in the R&D Process of Functional Raw Materials for Electronic Devices

    OpenAIRE

    Chikamori, Yoji; Nasu, Seigo

    2017-01-01

    The electronic materials and electronics device industries remain important to Japan in spite of the general decline of the Japanese electronics industry. There is risk and uncertainty when developing functional materials in the electronics industry. However, studies examining the uncertainty and risk variables in the development of functional materials are scarce. This study examines incremental research and development (R&D) developed for raw functional materials for electronics. Our analys...

  8. Fate of acid-resistant and non-acid resistant Shiga toxin-producing Escherichia coli strains in experimentally contaminated French fermented raw meat sausages.

    Science.gov (United States)

    Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C

    2009-02-28

    Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.

  9. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  10. Healthier meat and meat products: Their role as functional foods

    OpenAIRE

    Jiménez Colmenero, Francisco; Carballo, José; Cofrades, Susana

    2001-01-01

    This review deals with the implications of meat and meat products for human health. It analyses the effect of the presence or absence of various factors: fat, fatty acid composition, cholesterol, calorific value, salt, nitrite or lipid oxidation products that can cause health problems. Bearing in mind these considerations, it then describes the strategies used in animal production, treatment of meat raw material and reformulation of meat products to obtain healthier meat and meat products. Fu...

  11. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  12. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  13. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  14. Effect of cooking temperatures on characteristics and microstructure of camel meat emulsion sausages.

    Science.gov (United States)

    Mohamed, Hussein Mh; Emara, Mohamed Mt; Nouman, Taha M

    2016-07-01

    The camel is an excellent source of high quality meat and camel meat might be a potential alternative for beef. This study aimed to manipulate the raw camel meat for the production of stable and acceptable emulsion sausage, as well as to study the effect of cooking at different core temperatures on the tenderness, sensory quality and microstructure of produced sausage. Increasing the cooking temperature of sausages resulted in reduction of the shear force values from 2.67 kgf after cooking at 85 °C to 1.57 kgf after cooking at 105 °C. The sensory scores of sausages have been improved by increasing the cooking core temperature of meat batter. The light and scanning electron microscope micrographs revealed solubilisation of the high quantity of connective tissue of camel meat. High emulsion stability values for the camel meat batter associated with high values of water-holding capacity for raw camel meat and meat batter have been recorded. Stable and acceptable camel meat emulsion can be developed from camel meat. Increasing the cooking core temperature of meat batter improved the quality of produced sausages. Therefore, camel meat emulsion sausages might be a potential alternative for beef particularly in Asian and African countries. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  15. Effect of electron beam irradiation on nutritional ingredient of Tegillarca granosa meat

    International Nuclear Information System (INIS)

    Li Chao; Yang Wenge; Xu Dalun; Ou Changrong; Shi Huidong

    2011-01-01

    The influences of 0, 1, 3, 5, 7 and 9 kGy electron beam irradiation on the contents of protein and amino acid and the composition of amino acids and fatty acids in Tegillarca granosa meat were investigated. The results showed that the electron beam had no significant effect on contents of moisture, ash and protein. Fat was sensitive to electron beam irradiation, which decreased with the increasing of irradiation dose. The composition of amino acids remained stable with different doses. The values of EAA/TAA and EAA/NEAA were kept in accordance with FAO/WHO protein model. Besides, electron beam irradiation made no effect on the limiting amino acid (the first and second limiting amino acids were Met + Cys and Val, respectively). The relative content of PUFA increased significantly 1 ∼ 7 kGy irradiation. Electron beam irradiation produced a notable impact on the essential fatty acid, induced the increase of linoleic acid, linolenic acid and arachidonic acid at the doses of 5 ∼ 9 kGy. After the irradiation of 9 kGy, the increments of relative contents of the three essential fatty acids reached 94.61%, 41.37% and 89.91%, respectively. Electron beam irradiation had positive effect on EPA with the doses of 3, 5 and 9 kGy. However, DHA was sensitive to electron beam irradiation, whose relative content decreased with the increasing of irradiation dose and undetected at the dose of 9 kGy. According to the research of decontamination effect, the recommended dose of electron beam irradiation on Tegillarca granosa ws fixed at 3 ∼ 5 kGy. (authors)

  16. Detection of irradiated deboned turkey meat using electron spin resonance spectroscopy

    International Nuclear Information System (INIS)

    Gray, Richard; Stevenson, M.H.

    1989-01-01

    Bone fragments were extracted from two blocks of frozen deboned turkey meat (irradiated and non-irradiated) using alcoholic KOH digestion. Electron spin resonance (ESR) spectroscopy was used to differentiate between the samples. Comparison of an alcoholic KOH digestion procedure with a freeze drying and grinding method showed that the former method gave a signal which was 78% of that obtained using the freeze drying procedure. Regression analysis of the results obtained after subjection of the original non-irradiated sample to irradiation doses of 3.0, 5.0 and 7.0 kGy gave a linear relationship between irradiation dose and ESR signal strength over this range. Using this relationship the estimated mean dose received by the irradiated block was 4.72 kGy. (author)

  17. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market

    Directory of Open Access Journals (Sweden)

    Alvarado Pavel Espinoza

    2017-08-01

    Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.

  18. Factors Affecting Detection Of Irradiated Bone Meat By Using Electron Spine Resonance

    International Nuclear Information System (INIS)

    FARAG, S.A.; ATIA, A.I.; HASSAN, G.M.

    2009-01-01

    Different types of bone meats were purchased locally such as camel, cow and sheep. The bones were removed, cleaned and irradiated with gamma rays at different doses (5, 10 and 20 kGy). The bone samples were stored in a refrigerator for five months for studying their stability of radiation-induced free radicals using electron spin resonance (ESR) technique. The effect of thermal treatment at 50 o C at intervals was studied besides effect of storage period and re-irradiation process on ESR signal intensity. The ESR spectrum for radical species in irradiated samples was characterized by signal with spectroscopic splitting factor (g factor) of g1=2.0025 and g2=1.9973 for camel, cow and sheep bones, respectively. The signal at g = 2.0025 was ascribed to free radical rotation CO -2 that was derived from radiation-induced hydroxyapatite. Generally, the results proved that all above mentioned factors under investigation can affect ESR signal intensity but not prevent the recognize of irradiated bones, therefore, it must be taken in mind when calculating the absorbed dose.

  19. ANTE-MORTEM FORMATION OF THE QUALITATIVE CHARACTERISTICS OF ENVIRONMENTALLY FRIENDLY MEAT RAW MATERIAL BY INTENSIFICATION OF THE MECHANISMS OF THE METABOLIC PROCESSES IN GILTS

    Directory of Open Access Journals (Sweden)

    T. M. Giro

    2016-01-01

    Full Text Available Abstract In order to reduce the time of feeding, increase the intensity of weight gain without hormones, antibiotics, anabolic drugs, as well as to obtain high-quality meat with marble structure, the authors studied the influence of ovarioectomy on the intensification of the metabolic processes in gilts. The experiments were carried out in the FGUP “Mummovskoe” – the educational experimental enterprise of the Russian State Agrarian University - Moscow Timiryazev Agricultural Academy (RSAU – MAA named after K.A.  Timiryazev, in the Atkarsky district of the Saratov region. Two groups of Duroc gilts (10 animals each raised under the same conditions were studied. As a result of the experiment, the influence of ovariectomy on the level of insulinlike growth factor-1 (IGF-1 and indicators of metabolic processes in gilts were established. It is confirmed that stimulation of the the somatotropin/insulin-like growth factor (ST-IGF system along with hereditary factors and the characteristics of feeding contributes to the development of muscle tissue. Stimulation of ST secretion with insulin-like growth factor facilitates the development of muscle tissue.An increase in IGF-1 level leads to the development of new muscle fibers and muscle hyperplasia. After surgery, the major factors of changes in meat and feeding indicators in gilts were the rise in the metabolic activity of muscle tissue and fat metabolism, enhancement of production of IGF-1, which has insulin-like action and ensures activation of the processes of cell proliferation and differentiation. Increase in IGF-1 level had a positive impact on meat productivity, chemical and biochemical composition of pork. Simultaneous triggering of the systemic catabolic and local anabolic reactions in gilts after ovariectomy contributed to obtaining higher nutritional value of meat.

  20. In Dogs with Periodontal Disease Is Feeding a Complete Raw Meat Diet More Effective Than a Complete Kibble 'Dental' Diet at Reducing Periodontal Disease?

    Directory of Open Access Journals (Sweden)

    Nieky van Veggel

    2017-04-01

    Full Text Available Clinical bottom line:In light of the absence of evidence, vets and vet nurses should be cautious when recommending raw diets to support periodontal health and advise clients accordingly by relying on their clinical experience rather than the literature until more evidence is generated.

  1. Presence of Salmonella Spp and Escherichia Coli O157:H7 in Raw Meat, in São Paulo City, Brazil and Evaluation of Low Temperature (Refrigeration and Freezing) Resistance of these Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)

    2005-01-15

    A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)

  2. Close-To-Practice Assessment Of Meat Freshness With Metal Oxide Sensor Microarray Electronic Nose

    International Nuclear Information System (INIS)

    Musatov, V. Yu.; Sysoev, V. V.; Sommer, M.; Kiselev, I.

    2009-01-01

    In this report we estimate the ability of KAMINA e-nose, based on a metal oxide sensor (MOS) microarray and Linear Discriminant Analysis (LDA) pattern recognition, to evaluate meat freshness. The received results show that, 1) one or two exposures of standard meat samples to the e-nose are enough for the instrument to recognize the fresh meat prepared by the same supplier with 100% probability; 2) the meat samples of two kinds, stored at 4 deg. C and 25 deg. C, are mutually recognized at early stages of decay with the help of the LDA model built independently under the e-nose training to each kind of meat; 3) the 3-4 training cycles of exposure to meat from different suppliers are necessary for the e-nose to build a reliable LDA model accounting for the supplier factor. This study approves that the MOS e-nose is ready to be currently utilised in food industry for evaluation of product freshness. The e-nose performance is characterized by low training cost, a confident recognition power of various product decay conditions and easy adjustment to changing conditions.

  3. Use of scanning electron microscopy and microanalysis to determine chloride content of concrete and raw materials.

    Science.gov (United States)

    2013-02-01

    Standard sample sets of cement and mortar formulations with known levels of Cl as well as concrete samples subject to Cl diffusion were all prepared for and analyzed with scanning electron microscopy (SEM) and electron microprobe (EPMA). Using x-ray ...

  4. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  5. Volatile compounds in meat and meat products

    Directory of Open Access Journals (Sweden)

    Monika KOSOWSKA

    Full Text Available Abstract Meaty flavor is composed of a few hundreds of volatile compounds, only minor part of which are responsible for the characteristic odor. It is developed as a result of multi-directional reactions proceeding between non-volatile precursors contained in raw meat under the influence of temperature. The volatile compounds are generated upon: Maillard reactions, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products as well as upon thiamine degradation. The developed flavor is determined by many factors associated with: raw material (breed, sex, diet and age of animal, conditions and process of slaughter, duration and conditions of meat storage, type of muscle, additives applied and the course of the technological process. The objective of this review article is to draw attention to the issue of volatile compounds characteristic for meat products and factors that affect their synthesis.

  6. In vitro evaluation of the antimicrobial effect of a raw bacteriocin extract in combination with chemical preservatives employed in meat industry

    Directory of Open Access Journals (Sweden)

    Luis A. Aguado Bautista

    2010-12-01

    Full Text Available Biopreservation can be defined as the foods shelf life extension employing antibacterial products like bacteriocins. The objective of this work was to determinate the efficacy of E. faecium MXVK29 bacteriocin in combination with chemical preservatives against spoilage and pathogens microorganisms. Bacteriocin raw extrac antimicrobial activity was 46.34 UA/g of protein. Growth of Pseudomonas putida was not affected by the preservatives employed at the conditions employed. Antimicrobial response was different for other microorganisms since a synergetic effect of the preservatives combination inhibited Brochothrix thermosphacta and Escherichia coli growth. Sodium lactate had additive effect only against Listeria innocua.

  7. Metabolic bone disease and central retinal degeneration in a kitten due to nutritional inadequacy of an all-meat raw diet

    Directory of Open Access Journals (Sweden)

    Catherine Lenox

    2015-05-01

    Full Text Available A 5-month-old castrated male Sphynx kitten presented with left hindlimb lameness shortly after adoption. Prior to adoption, the breeder had fed the kitten an exclusively raw chicken diet. Radiographs revealed generalized osteopenia and a left tibia–fibula fracture. Ophthalmic examination revealed corneal vascularization and opacity in the right eye, and lesions suggestive of feline central retinal degeneration in the left eye. The patient’s diagnoses included metabolic bone disease and feline central retinal degeneration, which can result from taurine deficiency. The kitten’s nutritional diseases were managed with a complete and balanced canned diet designed for kitten growth and with taurine supplementation.

  8. Myoglobin chemistry and meat color.

    Science.gov (United States)

    Suman, Surendranath P; Joseph, Poulson

    2013-01-01

    Consumers rely heavily on fresh meat color as an indicator of wholesomeness at the point of sale, whereas cooked color is exploited as an indicator of doneness at the point of consumption. Deviations from the bright cherry-red color of fresh meat lead to product rejection and revenue loss. Myoglobin is the sarcoplasmic heme protein primarily responsible for the meat color, and the chemistry of myoglobin is species specific. The mechanistic interactions between myoglobin and multiple extrinsic and intrinsic factors govern the color of raw as well as cooked meats. The objective of this review is to provide an overview of the current research in meat color and how the findings are applied in the meat industry. Characterizing the fundamental basis of myoglobin's interactions with biomolecules in postmortem skeletal muscles is necessary to interpret the chemistry of meat color phenomena and to engineer innovative processing strategies to minimize meat discoloration-induced revenue loss to the agricultural economy.

  9. Strand-specific transcriptomes of Enterohemorrhagic Escherichia coli in response to interactions with ground beef microbiota: interactions between microorganisms in raw meat.

    Science.gov (United States)

    Galia, Wessam; Leriche, Francoise; Cruveiller, Stéphane; Garnier, Cindy; Navratil, Vincent; Dubost, Audrey; Blanquet-Diot, Stéphanie; Thevenot-Sergentet, Delphine

    2017-08-03

    Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O26 21765 and O157 EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O26 21765 , the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157 EDL933 , the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial community on relevant functions of an individual

  10. Rapid detection of E. coli on goat meat by electronic nose

    Science.gov (United States)

    Much attention has been paid on the foodborne illness of food, which is easily contaminated with bacterial or pathogens. Escherichia coli (E. coli) is one of these bacterial that commonly live in the contaminated animal meat. There is a growing need in the food industry for pathogen detection syst...

  11. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    OpenAIRE

    Juni Sumarmono; Samsu Wasito

    2010-01-01

    Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thor...

  12. Radiation decontamination of meat lyophylized products

    International Nuclear Information System (INIS)

    Migdal, W.; Owczarczyk, H.B.

    2002-01-01

    There is an increasing demand for a powder soups and sauces composed with lyophylizated meat. Technology of lyophylization is not always accompanied by thermal treatment of raw materials. That is the reason the meat lyophylization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment

  13. Assessment of the application of an automated electronic milk analyzer for the enumeration of total bacteria in raw goat milk.

    Science.gov (United States)

    Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A

    2011-07-01

    Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d

  14. Microbiological and other characteristics of chicken breast meat following electron-beam and sous-vide treatments

    International Nuclear Information System (INIS)

    Shamsuzzaman, K.; Chuaqui-Offermanns, N.; Lucht, L.; McDougall, T.; Borsa, J.

    1992-01-01

    The combined effects of radiation and sous-vide treatment of chicken breast meat were investigated with respect to survival and growth of Listeria monocytogenes, shelf life, thiamine content, and sensory qualities. Chicken breasts were inoculated with L. monocytogenes 81-861 (10(5) CFU/G), vacuum-packed, irradiated with electron beam (EB) up to 2.9 kGy, and cooked to an internal temperature of 65.6 degrees C. Sous-vide treatment alone had marginal lethal effect on the L. monocytogenes; the residual inoculum reached 10(7) CFU/g after 8 weeks at 2 degrees C. However, after the combined treatments of sous-vide and EB at 2.9 kGy, the organism remained undetectable during the 8-week storage period. Parallel studies on uninoculated breast meat revealed that sous-vide samples had a shelf life of less than 6 weeks without EB treatment, whereas samples that were irradiated and then received sous-vide treatment had a shelf life of at least 8 weeks. There was a slight reduction in thiamine levels as a result of the EB treatment, but there was essentially no additional loss of thiamine due to the subsequent sous-vide treatment and storage at 2 degrees C. Electron-beam treatment had very little effect on the odor and flavor of the reheated samples. It was concluded that EB treatment combined with, sous-vide treatment can greatly enhance the microbial safety and shelf life of chicken breast meat

  15. Advancements in meat packaging.

    Science.gov (United States)

    McMillin, Kenneth W

    2017-10-01

    Packaging of meat provides the same or similar benefits for raw chilled and processed meats as other types of food packaging. Although air-permeable packaging is most prevalent for raw chilled red meat, vacuum and modified atmosphere packaging offer longer shelf life. The major advancements in meat packaging have been in the widely used plastic polymers while biobased materials and their integration into composite packaging are receiving much attention for functionality and sustainability. At this time, active and intelligent packaging are not widely used for antioxidant, antimicrobial, and other functions to stabilize and enhance meat properties although many options are being developed and investigated. The advances being made in nanotechnology will be incorporated into food packaging and presumably into meat packaging when appropriate and useful. Intelligent packaging using sensors for transmission of desired information and prompting of subsequent changes in packaging materials, environments or the products to maintain safety and quality are still in developmental stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Behavioral, Ecological, and Evolutionary Aspects of Meat-Eating by Sumatran Orangutans (Pongo abelii).

    Science.gov (United States)

    Hardus, Madeleine E; Lameira, Adriano R; Zulfa, Astri; Atmoko, S Suci Utami; de Vries, Han; Wich, Serge A

    2012-04-01

    Meat-eating is an important aspect of human evolution, but how meat became a substantial component of the human diet is still poorly understood. Meat-eating in our closest relatives, the great apes, may provide insight into the emergence of this trait, but most existing data are for chimpanzees. We report 3 rare cases of meat-eating of slow lorises, Nycticebus coucang, by 1 Sumatran orangutan mother-infant dyad in Ketambe, Indonesia, to examine how orangutans find slow lorises and share meat. We combine these 3 cases with 2 previous ones to test the hypothesis that slow loris captures by orangutans are seasonal and dependent on fruit availability. We also provide the first (to our knowledge) quantitative data and high-definition video recordings of meat chewing rates by great apes, which we use to estimate the minimum time necessary for a female Australopithecus africanus to reach its daily energy requirements when feeding partially on raw meat. Captures seemed to be opportunistic but orangutans may have used olfactory cues to detect the prey. The mother often rejected meat sharing requests and only the infant initiated meat sharing. Slow loris captures occurred only during low ripe fruit availability, suggesting that meat may represent a filler fallback food for orangutans. Orangutans ate meat more than twice as slowly as chimpanzees (Pan troglodytes), suggesting that group living may function as a meat intake accelerator in hominoids. Using orangutan data as a model, time spent chewing per day would not require an excessive amount of time for our social ancestors (australopithecines and hominids), as long as meat represented no more than a quarter of their diet. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s10764-011-9574-z) contains supplementary material, which is available to authorized users.

  17. ASSESSMENT OF RADIATION SAFETY OF CHILLED MEAT USING THE METHOD OF ELECTRON PARAMAGNETIC RESONANCE

    Directory of Open Access Journals (Sweden)

    R. T. Timakova

    2016-01-01

    Full Text Available In the world practice, the radiation technologies for food product processing are extensively used; with that, free radicals are found in products. Scientists have not made a final conclusion about the complete safety of the method of radiation sterilization, so it is very important to control irradiated food products to determinea fact of irradiation and residual effects. The experimental data obtained on the domestic spectrometer EPR series Labrador Expert X, which was developed by Spektr LLC with the assistance of the research team of the authors from the Institute of Natural Sciences of UrFU named after Yeltsin B. N., indicate the presence of free radicals in the samples of boneless beef, which is probably associated with °Ccurrence of ante-mortem technological and slaughter stress in animals. Irradiation of the chicken meat samples carried out in laboratory conditions allows a comparison of the spectra before and after irradiation. The dose of irradiation of poultry was 12 kGy. This dose was selected based on the practice of recognizing the radiation doses of 10-12 kGy as safe, which was established in many countries. It was found that in the range of the magnetic fields from 3272 to 3280 Gs, there was a weak EPR signal with an amplitude of 7.28 e-05 and D less than 1. Such a background signal can be explained by stress in the birds, peculiarities of feeding and other factors. After irradiation at a dose of 12 kGy, the ESR signal increased in the range of the magnetic fields from 3273 to 3286 Gs and D was higher than 1. This technology or, in other words, radappertization, is an industrialsterilization of food products for long storage at positive temperatures, which precludes re-contamination by microorganisms. After irradiation, the fivefold increase in the amplitude of the ESR signal was observed and two additional signals with small amplitude appeared. The fact of irradiation/absence of irradiation of the samples was also confirmed by

  18. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  19. CLOSTRIDIUM PERFRINGENS IN MEAT AND MEAT PRODUCTS.

    Science.gov (United States)

    HALL, H E; ANGELOTTI, R

    1965-05-01

    A total of 262 specimens of meat and meat dishes were examined for the presence of Clostridium perfringens. Of this total, 161 were raw, unprocessed beef, veal, lamb, pork, or chicken; 101 were processed meats and meat dishes. C. perfringens was isolated from 113 (43.1%) of these specimens. The highest percentage of contamination (82%) was found in veal cuts, and the lowest (4.7%) in sliced sandwich meats and spreads. Only 2 of the 113 isolates were shown to produce heat-resistant spores, which indicates a very low incidence (0.8%) of contamination. These findings indicate that outbreaks of C. perfringens food-borne disease in the Cincinnati area are caused principally by the contamination of the food with vegetative cells or spores of the organism after cooking. Studies of the effects of various holding temperatures on the growth of C. perfringens indicated that, in the range of 5 to 15 C, no multiplication would occur, but that viable cells would still be present at the end of a 5-day holding period. Extremely rapid growth occurred at temperatures around 45 C, and complete inhibition of growth was accomplished between 49 and 52 C.

  20. Meat Processing.

    Science.gov (United States)

    Legacy, Jim; And Others

    This publication provides an introduction to meat processing for adult students in vocational and technical education programs. Organized in four chapters, the booklet provides a brief overview of the meat processing industry and the techniques of meat processing and butchering. The first chapter introduces the meat processing industry and…

  1. The freezing and thawing of water in poultry meat and vegetables irradiated by electrons at doses of 0.1-4 kGy

    International Nuclear Information System (INIS)

    Dubini, B.; Montecchia, F.; Ponzi-Bossi, M.G.; Messina, G.

    1993-01-01

    Poultry meat and some vegetables, irradiated by 5 MeV electrons (0.1-4 kGy), were analysed by differential scanning calorimetry, from 24 h after irradiation. The temperature and enthalpy transitions of the water contained in the irradiated samples were measured and compared with those of unirradiated samples. The authors analysed 18 meat and 10 vegetable samples for each irradiation dose together with a similar number of unirradiated controls. The mean supercooling temperatures of water in the irradiated poultry meat samples and in some vegetables are significantly lower than those of controls. Moreover, the freezing enthalpies of the irradiated poultry breast are significantly lower than those of controls, while they are unchanged in the other cases. The mean ice melting temperatures and enthalpies are similar for all samples. The amount of the lowering of the water-ice transition depends on the nature of the sample and is highest in poultry breast and lowest in vegetables. (author)

  2. Meat spoilage during distribution.

    Science.gov (United States)

    Nychas, George-John E; Skandamis, Panos N; Tassou, Chrysoula C; Koutsoumanis, Konstantinos P

    2008-01-01

    Meat spoilage during distribution can be considered as an ecological phenomenon that encompasses the changes of the available substrata (e.g., low molecular compounds), during the prevailing of a particular microbial association, the so-called specific spoilage organisms (SSO). In fact, spoilage of meat depends on an even smaller fraction of SSO, called ephemeral spoilage organisms (ESO). These ESO are the consequence of factors that dynamically persist or imposed during, e.g., processing, transportation and storage in the market. Meanwhile spoilage is a subjective judgment by the consumer, which may be influenced by cultural and economic considerations and background as well as by the sensory acuity of the individual and the intensity of the change. Indeed, when spoilage progresses, most consumers would agree that gross discoloration, strong off-odors, and the development of slime would constitute the main qualitative criteria for meat rejection. On the other hand, meat industry needs rapid analytical methods or tools for quantification of these indicators to determine the type of processing needed for their raw material and to predict remaining shelf life of their products. The need of an objective evaluation of meat spoilage is of great importance. The use of metabolomics as a potential tool for the evaluation of meat spoilage can be of great importance. The microbial association of meat should be monitored in parallel with the estimation of changes occurring in the production and/or assimilation of certain compounds would allow us to evaluate spoilage found or produced during the storage of meat under different temperatures as well as packaging conditions.

  3. Forecast of the direction changes of meat products odor in the development of new recipes according to the results of “electronic nose” data treatment with chemometric methods

    Directory of Open Access Journals (Sweden)

    T. A. Kuchmenko

    2016-01-01

    Full Text Available The possibility of using new parameters of quartz crystal microbalance and methods of principal component analysis and discriminant analysis using regression to latent structures for processing the output data of piezosensors array for the detection of individual odor-forming compounds, quantitative assessment of odor properties in routine analysis, in the development of new recipes of food systems with the introduction of functional additives in the factory laboratories are discussed. Sorption of volatile organic compounds that make up the odor of meat products, on thin films of sorbents - modifiers of piezoelectric resonators electrodes, forming an array of sensors of gases analyzer "electronic nose" is studied. The resulting sensor array is trained on the main marker substances (distilled water, ethane, butyric acids, aliphatic alcohols (C2-C5 of normal and isomeric structure, dimethyl ketone, methyl ethyl ketone, alkyl acetates (C2-C5 methylpropionate. The effect of of water vapors as interfering factor in sorption of organic compounds was assessed. The parameters of the efficiency of volatile compounds sorption, allowing the identification of individual organic compounds or a class of similar to them in nature in gas mixtures were calculated. The use of discriminant analysis with regression to latent structures allowed the identification of individual organic compounds in the equilibrium gas phases over the real models for forecasting of change of direction of meat products odor with partial replacement of meat raw materials with functional preparations of plant origin (buckwheat and millet cereals, pickles of soybean and rapeseed protein and products of microbial synthesis (preparation of yeast and wheat bran. For a detailed study of the changes in odor direction _ during the introduction of different amounts of cereals in the product the principal components method was applied. As the input parameters for the chemometric methods

  4. Effects of high-energy electron irradiation of chicken meat on Salmonella and aerobic plate count

    International Nuclear Information System (INIS)

    Heath, J.L.; Owens, S.L.; Tesch, S.; Hannah, K.W.

    1990-01-01

    Four experiments were used to determine the effects of high-energy irradiation on the number of aerobic microorganisms and Salmonella on broiler breasts and thighs. Irradiation ranging from 100 to 700 kilorads (krads) was provided by a commercial-scale, electron-beam accelerator. Irradiation of broiler breast and thigh pieces with electron beams at levels of 100, 200, 300, 400, 500, and 600 krads showed that levels as low as 100 krads would eliminate Salmonella. When 33 thighs were tested after irradiation at 200 krads, only one thigh tested presumptive positive. The total number of aerobic organisms was reduced by 2 to 3 log10 cycles at irradiation levels of 100, 200, 300, 400, 500, 600, and 700 krads. Increasing the dose above 100 krads gave little if any additional benefit

  5. Physicochemical properties of meat of ducks of mulberries in modern technologies of meat products

    Directory of Open Access Journals (Sweden)

    R. F. Galin

    2017-01-01

    Full Text Available The article presents the results of studying the chemical composition of mullards duck meat in comparison with the ducks of the Beijingg white breed and musk ducks. The chemical analysis results allow us to note the high moisture content for mullard duck meat. The low fat content for white and red mullard duck meat opens up wide opportunities for the development of an assortment of meat products with a functional orientation. The limited amino acids are determined. The total number of essential amino acids in the mullard duck meat is higher than in musk (by 1.02 g / 100 g protein and Beijingg (by 0.86 g / 100 g protein, which indicates a higher biological value. The limiting amino acid is methionine and cysteine. The article presents the results of the raw material aroma assessment using the "MAG 8" - "electronic nose" analyzer. The content of easily volatile compounds in the equilibrium gas phase for samples of muscle and fat tissue from ducks of different breeding was compared and evaluated. The most informative in the matrix are sensors with films of polydiethylene glycol succinate, polyvinylpyrrolidone, polyethylene glycol PEG-2000, 18-crown-6, trioctylphosphine oxidase, which show maximum sensitivity to polar and nitrogen-containing compounds, aromatic hydrocarbons. This is explained by the fact that the easily volatile fraction of both meat and fat of the samples under study is represented by a variety of organic compounds of different concentrations. Such a variety of substances can be perceived by tasters as "a noticeable smell, difficult". In accordance with the results obtained, we concluded that the aroma of muscle and fat tissue of mulard ducks is more intense, more saturated than the Beijingg duck. The obtained data on the chemical composition indicate possible dietary properties of meat of ducks of mullards. The rich, pronounced aroma of muscle and fatty tissue causes high organoleptic parameters of the finished product, which is

  6. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  7. Effects of combined electron-beam irradiation and sous-vide treatments on microbiological and other qualities of chicken breast meat

    International Nuclear Information System (INIS)

    Shamsuzzaman, K.; Lucht, L.; Chuaqui-Offermanns, N.

    1994-01-01

    The microbiological safety, refrigeration shelf-life, and nutritional quality of chicken breast meat were investigated following combined electron-beam irradiation and cooking under vacuum (sous-vide). Chicken breast meat inoculated with 10 6 CFU/g of Listeria monocytogenes was irradiated with an electron beam at doses up to 3.1 kGy under vacuum in barrier bags, cooked in a boiling water bath for 3 min 45 s (previously determined to achieve an internal temperature of 71.1 o C), and stored at 8 o C for up to 5 weeks. Listeria was undetectable in samples treated with combined sous-vide and irradiation at 3.1 kGy, but the organism survived the sous-vide treatment without irradiation and multiplied during storage. A similar study, conducted with uninoculated chicken breast meat, revealed that the product which received both irradiation (3 kGy) and sous-vide treatment had a shelf-life of at least 8 weeks at 8 o C, whereas the unirradiated samples treated sous-vide spoiled in 16 days. Listeria was undetectable in combination treated samples, but some of the unirradiated sous-vide samples tested after long storage showed high levels of Listeria. Some loss of thiamine occurred with the combined treatments. (author)

  8. Studies on the quality of duck meat sausages during refrigeration.

    Science.gov (United States)

    Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M

    2016-01-01

    Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating

  9. Nutritional quality of raw and processed unripe Carica papaya fruit ...

    African Journals Online (AJOL)

    the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...

  10. Trichinellosis acquired in Nunavut, Canada in September 2009: meat from grizzly bear suspected.

    Science.gov (United States)

    Houzé, S; Ancelle, T; Matra, R; Boceno, C; Carlier, Y; Gajadhar, A A; Dupouy-Camet, J

    2009-11-05

    Five cases of trichinellosis with onset of symptoms in September 2009, were reported in France, and were probably linked to the consumption of meat from a grizzly bear in Cambridge Bay in Nunavut, Canada. Travellers should be aware of the risks of eating raw or rare meat products in arctic regions, particularly game meat such as bear or walrus meat.

  11. Influence of Skin Packaging on Raw Beef Quality: A Review

    Directory of Open Access Journals (Sweden)

    S. Stella

    2018-01-01

    Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.

  12. Meet meat

    NARCIS (Netherlands)

    Bekker, Gerben A.; Tobi, Hilde; Fischer, Arnout R.H.

    2017-01-01

    In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries

  13. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    Directory of Open Access Journals (Sweden)

    Juni Sumarmono

    2010-01-01

    Full Text Available Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thoroughly and ground using a 5 mm diameter grinding plate. The ground meat was divided into 4 batches (group of treatments; one batch was treated with iced tap water (M1, one batch with 0.1% NaCl solution (M2, one batch with 0.5% NaHCO3 solution (M3, and one batch was left as is as control (M4. Variables measured were water holding capacity (WHC, pH, emulsion capacity and stability of the meat; and firmness and tenderness of the meat gel. Results showed that M1 meat has significantly higher WHC (less percentage of free water than control (M4, whereas M2 and M3 meat has similar WHC to control. Processing caused the ground duck meat to have significantly higher pH than control. The highest meat pH was observed in M3, followed by M2, M1 and control. Processing duck meat with iced tap water, NaCl or NaHCO3 produced significantly more tender meat gel compared to untreated meat (as is. Tenderness of meat gel of M3 was the most tender followed by M2 and M1. Similar results for meat gel firmness were observed. No significant differences were observed in term of emulsion capacity (expressed as ml oil/gr protein and ml oil/gr fresh meat, emulsion stability (expressed as ml oil and total liquid released per 100 gr emulsion, and cooking recovery (%. The study reported in this paper offers simple processing technologies to improve functional characteristics of spent duck meat to be use as raw material for the production of emulsion type meat products. (Animal Production 12

  14. Detection of irradiated food: Electron spin resonance measurement of irradiated meat, fish and nuts. Elektronen-Spin-Resonanz-Messungen an bestrahltem Fleisch, Fisch und bestrahlten Nuessen

    Energy Technology Data Exchange (ETDEWEB)

    Linke, B [Fachgebiet Lebensmittelbestrahlung, Bundesgesundheitsamt, Berlin (Germany); Helle, N [Fachgebiet Lebensmittelbestrahlung, Bundesgesundheitsamt, Berlin (Germany); Mager, M [Fachgebiet Lebensmittelbestrahlung, Bundesgesundheitsamt, Berlin (Germany); Schreiber, G A [Fachgebiet Lebensmittelbestrahlung, Bundesgesundheitsamt, Berlin (Germany); Boegl, K W [Fachgebiet Lebensmittelbestrahlung, Bundesgesundheitsamt, Berlin (Germany)

    1993-09-01

    In an intercomparison study organized by the German Federal Health Office (BGA) the use of electron spin resonance (ESR) spectroscopy as a routine method according to paragraph 35 of the German Food Legislation (LMBG) was tested for bone containing meat, fish and nuts (shells). Each participating laboratory examined six chicken, six rainbow trout and four pistachio samples. The examinations were successful, only three samples were not identified correctly and moreover these mistakes were caused by misinterpretation of the ESR spectra. 13 out of 18 participating laboratories used a new routine ESR spectrometer and all samples were identified correctly with this instrument. (orig.)

  15. Significance of authenticity in meat and meat products in Iran

    Directory of Open Access Journals (Sweden)

    Tahereh Rezazadeh

    2014-06-01

    Full Text Available The Authenticity of meat products is very important for religious and health reasons in Iran. According to legislation in Iran, the consumption and importation of pork, horse, donkey and cat products should be banned. Therefore, the identification of meat products cannot be judged solely by its appearance. This issue led to the authenticity of bovine, sheep, pig, horse, donkey, chicken and soya (Glycine max in raw and processed meat products.In this study, specific primers were designed for the identification of pig ( base pair, donkey (325 base pair, chicken (391 base pair, sheep (499 base pair, horse (607 base pair, soya (707 base pair and bovine (853 base pair by Polymerase chain reaction. Following PCR, expected,, , 499,,  and  base pair fragments were detectable in pig, donkey, chicken, sheep, horse, soya and bovine, respectively. This protocol can be used for identification of raw and processed meat products in various animal species for replication to regulatory obligations for meat species safety in Iran.

  16. Meat flavour

    International Nuclear Information System (INIS)

    Rosset, R.; Liger, P.; Roussel-Ciquard, N.

    1978-01-01

    For the consumer, meat is characterized by a certain number of organoleptic qualities; among them, flavour -that is to say the association of both odour and taste- plays a leading part. This property is based upon a great number of chemical components: some volatile components are responsible for the aroma and some non-volatile ones for the taste. These substances are either made or released during the heating of the meat on account of components called precursors which are produced during the aging of the meat. The two main reactions which preside over the elaboration of flavour are: the Maillard's reaction and the autooxidation reactions. Meat flavour is associated with the animal characteristics; it is influenced by the ante- and post mortem treatments as well as by the technological treatments for storing it. The use of synthetical flavours is to be considered as possible in the future [fr

  17. Microscopic appearance analysis of raw material used for the production of sintered UO2 by scanning electron microscope

    International Nuclear Information System (INIS)

    Liu feiming

    1992-01-01

    The paper describes the microscopic appearance of UO 2 , U 3 O 8 , ADU and AUC powders used for the production of sintered UO 2 slug of nuclear fuel component of PWR. The characteristic analysis of the microscopic appearance observed by scanning electron microscope shows that the quality and finished product rate of sintered UO 2 depend on the appearance characteristic of the active Uo 2 powder, such as grade size and its distribution, spherulitized extent, surface condition and heap model etc.. The addition of U 3 O 8 to the UO 2 powder improves significantly the quality and the finished product rate. The mechanism of this effect is discussed on the basis of the microscopic appearance characteristic for two kinds of powder

  18. Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria

    DEFF Research Database (Denmark)

    Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.

    2013-01-01

    Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...

  19. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

  20. INFLUENCE OF AUTOLYTIC TRANSFORMATIONS ON ELECTROPHYSICAL PROPERTIES OF GOAT MEAT

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2014-01-01

    Full Text Available Functional foods represented an important element of a balanced, healthy diet. They play an important role in improving the structure of the diet of the population, are a means of prevention, correction and prevention of early transition premorbid conditions and various diseases. Meat and meat products based on it can be considered as a promising raw material for functional foods. Goat has certain dietary properties and can be used in manufacturing, but the production of high-grade products from goat meat, capable of long-term storage is not well developed. The chemical composition of the new raw meat - goat meat, on the example of the longissimus muscle of back is rich in protein, moisture, ash, and low-fat compared with other types of raw meat, which lets you create based on goat meat sector wide functional meat products. Therefore investigated the possibility of using goat meat in the production technology of functional foods. Showing the prospects for the development of goat in Russia. Investigated character of autolysis goat meat electro-physical methods and histological analysis. In the process of autolysis of goat meat are changing the electrical properties of raw meat, which are correlated with the morphological characteristics. Basic autolytic changes occurring in muscle tissue in the early stages of ripening, were reduced to a small extent the political process involving varying degrees of muscle structure in the early stages. In the later stages of maturation revealed changing widespread. Revealed that autolysis has characteristic periods and develops within 12 hours, further changes are irreversible. Shows the change in pH, carbohydrate fractions in the longissimus muscle of back goat. Results of the study of dynamics of change in pH, carbohydrate fractions in the longissimus muscle of back goat show compliance with the laws of classical autolysis noted in other sources, but differ in the time period. Defined stages of autolysis in

  1. Identification of irradiated meat using electron spin resonance (ESR) spectroscopy and estimation of applied dose using re-irradiation

    International Nuclear Information System (INIS)

    Chawla, S.P.; Thomas, Paul; Bongirwar, D.R.

    2001-01-01

    An in-house blind trail on bone-in meat chunks was carried out in which 35 coded samples were correctly identified. The samples were either left unirradiated or had been irradiated to dose of 1, 2.5 or 4 kGy. Using re-irradiation, the dose received by the samples were determined with either linear, quadratic or exponential equation. The quadratic or exponential equation gave more successful estimates of irradiation dose whereas linear fit equations tend to over estimate the dose. (author)

  2. Effect of different ionizing radiation doses and dose rates, using Cobalt-60 and electrons beam sources, on the staphylococcal enterotoxin inoculated in mechanically deboned chicken meat

    Energy Technology Data Exchange (ETDEWEB)

    Pomarico Neto, Walter; Brito, Poliana de Paula; Azevedo, Heliana de; Roque, Claudio Vitor; Fukuma, Henrique Takuji, E-mail: pbrito@cnen.gov.br, E-mail: hazevedo@cnen.gov.br, E-mail: cvroque@cnen.gov.br, E-mail: htfukuma@cnen.gov.br [Brazilian Nuclear Energy Commission (LAPOC/CNEN), Pocos de Caldas, MG (Brazil); Kodama, Yasko, E-mail: ykodama@ipen.br [Nuclear and Energy Research Institute (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Miya, Norma Terugo Nago; Pereira, Jose Luiz, E-mail: miya@fea.unicamp.br, E-mail: pereira@fea.unicamp.br [Campinas State University (UNICAMP), SP (Brazil). Dept. of Food Sciences

    2011-07-01

    The purpose of food irradiation is the destruction of present pathogenic microorganisms and the increase of shelf life of foods. To achieve this process, the source of cobalt-60 and the electron accelerator can be used. The mechanically deboned chicken meat (MDCM) is used for the production of traditional meat products, and it may come to present pathogenic microorganisms such as staphylococcus aureus, a bacterium that produces enterotoxin, which causes food poisoning. The objective of this study is to analyze the effect of ionizing irradiation with different doses and dose rates, deriving from different radiation sources, on staphylococcal enterotoxin type B (SEB) in the MDCM. 50 g samples of MDCM were prepared in a batch of 6 kg of MDCM. The samples were contaminated, with the exception of the control, with SEB in amounts of about 100 ng. Then they were conditioned in a transparent bag made of low density polyethylene, frozen at -18{+-}1 deg C overnight and irradiated in these conditions with doses of 0.0 kGy (control), 1.5 kGy and 3.0 kGy, and with three different dose rates, both in the Cobalt-60 and the electron accelerator. The experiments were conducted in quintuplicate. The SEB extraction from the MDCM was performed according to the protocol recommended by the manufacturer of the kit VIDAS Staph Enterotoxin II (bioMerrieux). The principle of mass balance was used to determine the actual amount of SEB removed by irradiation. The treatment that presented the best results was the one with a dose of 1.5 kGy, high dose rate of the electron accelerator. (author)

  3. Effect of different ionizing radiation doses and dose rates, using Cobalt-60 and electrons beam sources, on the staphylococcal enterotoxin inoculated in mechanically deboned chicken meat

    International Nuclear Information System (INIS)

    Pomarico Neto, Walter; Brito, Poliana de Paula; Azevedo, Heliana de; Roque, Claudio Vitor; Fukuma, Henrique Takuji; Kodama, Yasko; Miya, Norma Terugo Nago; Pereira, Jose Luiz

    2011-01-01

    The purpose of food irradiation is the destruction of present pathogenic microorganisms and the increase of shelf life of foods. To achieve this process, the source of cobalt-60 and the electron accelerator can be used. The mechanically deboned chicken meat (MDCM) is used for the production of traditional meat products, and it may come to present pathogenic microorganisms such as staphylococcus aureus, a bacterium that produces enterotoxin, which causes food poisoning. The objective of this study is to analyze the effect of ionizing irradiation with different doses and dose rates, deriving from different radiation sources, on staphylococcal enterotoxin type B (SEB) in the MDCM. 50 g samples of MDCM were prepared in a batch of 6 kg of MDCM. The samples were contaminated, with the exception of the control, with SEB in amounts of about 100 ng. Then they were conditioned in a transparent bag made of low density polyethylene, frozen at -18±1 deg C overnight and irradiated in these conditions with doses of 0.0 kGy (control), 1.5 kGy and 3.0 kGy, and with three different dose rates, both in the Cobalt-60 and the electron accelerator. The experiments were conducted in quintuplicate. The SEB extraction from the MDCM was performed according to the protocol recommended by the manufacturer of the kit VIDAS Staph Enterotoxin II (bioMerrieux). The principle of mass balance was used to determine the actual amount of SEB removed by irradiation. The treatment that presented the best results was the one with a dose of 1.5 kGy, high dose rate of the electron accelerator. (author)

  4. Nondestructive measurement of total volatile basic nitrogen (TVB-N) in pork meat by integrating near infrared spectroscopy, computer vision and electronic nose techniques.

    Science.gov (United States)

    Huang, Lin; Zhao, Jiewen; Chen, Quansheng; Zhang, Yanhua

    2014-02-15

    Total volatile basic nitrogen (TVB-N) content is an important reference index for evaluating pork freshness. This paper attempted to measure TVB-N content in pork meat using integrating near infrared spectroscopy (NIRS), computer vision (CV), and electronic nose (E-nose) techniques. In the experiment, 90 pork samples with different freshness were collected for data acquisition by three different techniques, respectively. Then, the individual characteristic variables were extracted from each sensor. Next, principal component analysis (PCA) was used to achieve data fusion based on these characteristic variables from 3 different sensors data. Back-propagation artificial neural network (BP-ANN) was used to construct the model for TVB-N content prediction, and the top principal components (PCs) were extracted as the input of model. The result of the model was achieved as follows: the root mean square error of prediction (RMSEP) = 2.73 mg/100g and the determination coefficient (R(p)(2)) = 0.9527 in the prediction set. Compared with single technique, integrating three techniques, in this paper, has its own superiority. This work demonstrates that it has the potential in nondestructive detection of TVB-N content in pork meat using integrating NIRS, CV and E-nose, and data fusion from multi-technique could significantly improve TVB-N prediction performance. Copyright © 2013. Published by Elsevier Ltd.

  5. High pressure processing of meat: effects on ultrastructure and protein digestibility.

    Science.gov (United States)

    Kaur, Lovedeep; Astruc, Thierry; Vénien, Annie; Loison, Olivier; Cui, Jian; Irastorza, Marion; Boland, Mike

    2016-05-18

    The effects of high pressure processing (HPP, at 175 and 600 MPa) on the ultrastructure and in vitro protein digestion of bovine longissimus dorsi muscle meat were studied. HPP caused a significant change in the visual appearance and texture of the meat subjected to HPP at 600 MPa so that it appeared similar to cooked meat, unlike the meat subjected to HPP at 175 MPa that showed no significant visible change in the colour and texture compared to the raw meat. The muscles were subjected to digestion under simulated gastric conditions for 1 h and then under simulated small-intestinal conditions for a further 2 h. The digests were analysed using gel electrophoresis (SDS-PAGE) and ninhydrin assay for amino N. The effect of the acid conditions of the stomach alone was also investigated. Reduced SDS-PAGE results showed that pepsin-digested (60 min) HPP meats showed fewer proteins or peptides of high molecular weight than the pepsin-digested untreated meat, suggesting more breakdown of the parent proteins in HPP-treated meats. This effect was more pronounced in the muscles treated at 600 MPa. These results are in accordance with microscopy results, which showed greater changes in the myofibrillar structure after simulated gastric digestion of the sample processed at 600 MPa than at 175 MPa. Transmission electron microscopy also showed the presence of protein aggregates in the former sample, resulting probably from protein denaturation of sarcoplasmic proteins, in the subcellular space and between myofibrils; along with cell contraction (similar to that caused by heating) in the former.

  6. Molecular assay to fraud identification of meat products.

    Science.gov (United States)

    Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim

    2014-01-01

    Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.

  7. In-gel and OFFGEL-based proteomic approach for authentication of meat species from minced meat and meat products.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth

    2018-02-01

    Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. SELECTION OF MICROORGANISMS FOR FERMENTATION OF MEAT MATERIALS

    Directory of Open Access Journals (Sweden)

    Danylenko S. G.

    2014-08-01

    Full Text Available Principal criteria for the selection of microorganisms with a wide range of biological and technological properties for fermentation of raw meats are considered. Attention is paid to the main groups of microorganisms such as Micrococсus, Staphylococcus, Lactobacillus, Bifidobacterium and Propionibacterium which are promising for creation of bacterial preparations. To create bacterial preparations, the basic criteria of selection for microorganisms were determined as follows: the ability of microorganisms to be developed within the specific ecological niche (raw meat materials and their influence on flavor characteristics of the final product under the conditions of intensification of production technologies of meat products. Methods used for search and retrieval of technologically promising strains from different natural sources (fresh meats, minced meats, meat, dairy and sour-milk products, vegetables, fruit, brines and mixtures for salting are considered.

  9. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    International Nuclear Information System (INIS)

    Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel

    2015-01-01

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  10. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    Energy Technology Data Exchange (ETDEWEB)

    Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2015-12-11

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  11. Advances in ingredient and processing systems for meat and meat products.

    Science.gov (United States)

    Weiss, Jochen; Gibis, Monika; Schuh, Valerie; Salminen, Hanna

    2010-09-01

    Changes in consumer demand of meat products as well as increased global competition are causing an unprecedented spur in processing and ingredient system developments within the meat manufacturing sector. Consumers demand healthier meat products that are low in salt, fat, cholesterol, nitrites and calories in general and contain in addition health-promoting bioactive components such as for example carotenoids, unsaturated fatty acids, sterols, and fibers. On the other hand, consumers expect these novel meat products with altered formulations to taste, look and smell the same way as their traditionally formulated and processed counterparts. At the same time, competition is forcing the meat processing industry to use the increasingly expensive raw material "meat" more efficiently and produce products at lower costs. With these changes in mind, this article presents a review of novel ingredient systems and processing approaches that are emerging to create high quality, affordable meat products not only in batch mode but also in large-scale continuous processes. Fat replacers, fat profile modification and cholesterol reduction techniques, new texture modifiers and alternative antioxidant and antimicrobial systems are being discussed. Modern processing equipment to establish continuously operating product manufacturing lines and that allow new meat product structures to be created and novel ingredients to be effectively utilized including vacuum fillers, grinders and fine dispersers, and slicers is reviewed in the context of structure creation in meat products. Finally, trends in future developments of ingredient and processing systems for meat products are highlighted.

  12. Radiation decontamination of meat lyophilized products

    International Nuclear Information System (INIS)

    Owczarczyk, H.B.; Migdal, W.

    2002-01-01

    There is an increasing demand for powder soups and sauces compose with lyophilized products. Technology of lyophilization is not always accompanied by thermal treatment of raw materials. That is the reason the products lyophilization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment. (author)

  13. U.S. Food safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: an establishment-level analysis.

    Science.gov (United States)

    Eblen, Denise R; Barlow, Kristina E; Naugle, Alecia Larew

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) pathogen reduction-hazard analysis critical control point systems final rule, published in 1996, established Salmonella performance standards for broiler chicken, cow and bull, market hog, and steer and heifer carcasses and for ground beef, chicken, and turkey meat. In 1998, the FSIS began testing to verify that establishments are meeting performance standards. Samples are collected in sets in which the number of samples is defined but varies according to product class. A sample set fails when the number of positive Salmonella samples exceeds the maximum number of positive samples allowed under the performance standard. Salmonella sample sets collected at 1,584 establishments from 1998 through 2003 were examined to identify factors associated with failure of one or more sets. Overall, 1,282 (80.9%) of establishments never had failed sets. In establishments that did experience set failure(s), generally the failed sets were collected early in the establishment testing history, with the exception of broiler establishments where failure(s) occurred both early and late in the course of testing. Small establishments were more likely to have experienced a set failure than were large or very small establishments, and broiler establishments were more likely to have failed than were ground beef, market hog, or steer-heifer establishments. Agency response to failed Salmonella sample sets in the form of in-depth verification reviews and related establishment-initiated corrective actions have likely contributed to declines in the number of establishments that failed sets. A focus on food safety measures in small establishments and broiler processing establishments should further reduce the number of sample sets that fail to meet the Salmonella performance standard.

  14. Some technological aspects of combined processing of meat by heat and ionizing radiations

    International Nuclear Information System (INIS)

    Gel'fand, S.Yu.; Nomenotskaya, N.F.; Mozul', M.Ya.

    1974-01-01

    The paper discusses the use of ionizing radiation to prolong the storage life of meat and meat products. Irradiating raw meat with doses of 0.4-0.6 Mrad increased storage life up to two months at low above-zero C temperatures. The difficulty of inhibiting autolytic processes during storage of irradiated raw meat led to searches for combined methods of meat treatment. A series of experiments was staged with pre-irradiation heating of meat up to 75, 77, and 80 0 C in order to see how cathepsin activity is affected by the duration and temperature of heating in the case of combined treatment. To increase the resistance of meat products to microbial damage, tests were carried out in which meat was exposed to short-term but intensive heat by immersing it in hot (130-160 0 C) vegetable oil (frying grease). The results are presented in the form of tables and diagrams. (E.T.)

  15. PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available Abstract Use of the prediction technologies is one of the directions of the research work carried out both in Russia and abroad. Meat processing is accompanied by the complex physico-chemical, biochemical and mechanical processes. To predict the behavior of meat raw material during the technological processing, a complex of physico-technological and structural-mechanical indicators, which objectively reflects its quality, is used. Among these indicators are pH value, water binding and fat holding capacities, water activity, adhesiveness, viscosity, plasticity and so on. The paper demonstrates the influence of animal proteins (beef and pork on the physico-chemical and functional properties before and after thermal treatment of minced meat made from meat raw material with different content of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence parameters linking the quantitative resultant and factor variables were obtained using the regression analysis, and the degree of the correlation with the experimental data was assessed. The maximum allowable levels of meat raw material replacement with animal proteins (beef and pork were established by the methods of mathematical programming. Use of the information technologies will significantly reduce the costs of the experimental search and substantiation of the optimal level of replacement of meat raw material with animal proteins (beef, pork, and will also allow establishing a relationship of product quality indicators with quantity and quality of minced meat ingredients.

  16. The quality evaluation of frankfurter-type sausages from hand and mechanically deboned turkey meat.

    Science.gov (United States)

    Radomyski, T; Niewiarowicz, A

    1987-03-01

    A quality evaluation was made of frankfurter-type sausages made from hand and mechanically deboned meat from various parts of turkey carcasses. The results led to the conclusions that despite some differences in objective measurements of the sausage quality, mechanically deboned turkey meat can be considered as an exclusive meat raw material for the production of frankfurter-type sausages. The quality of sausages from mechanically deboned turkey meat from wings and frames with skin was the least satisfactory.

  17. MODERN TECHNOLOGY OF FERMENTED MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2015-01-01

    Full Text Available Summary. New trends of meat industry development, on the example of sausages are shown. The detailed description of indicators of quality of meat raw materials, auxiliary materials and their influence on the processes of tissue and microbial fermentation in the process of ripening raw sausages. Measures for improving the quality control of meat raw materials, auxiliary materials, as well as the processing conditions in all stages of production of smoked products are suggested. The modern technology of production of raw sausages with starter cultures and complex products, allowing better standardization process is considered. Questions of chemistry of color formation, the formation of taste and flavor, textures and the suppression of undesired microflora in foods in general, and in particular the raw sausage are thoroughly covered. Ideas about factors affecting the formation of color in sausages are given. It is pointed out that the susceptibility to oxidation of nitrosilmioglobin is directly related to the fat oxidation in the whole redox potential. Trends in the market of raw sausages are shown. Requirements used in the meat industry to starting cultures are shown. Recommendations on the rational use of starter cultures, and other functional additives in technology of uncooked fermented products, which are used to improve the quality and ensure a high level of product safety are given. The characteristic of the innovative series of starter cultures Protect, its species belonging and qualitative composition, providing a unique protection system in the process of ripening and storage of smoked products is given. The properties are proved on the example of smoked poultry sausage.

  18. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  19. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  20. Effect of high-energy electron irradiation of chicken meat on thiobarbituric acid values, shear values, odor, and cooked yield

    International Nuclear Information System (INIS)

    Heath, J.L.; Owens, S.L.; Tesch, S.; Hannah, K.W.

    1990-01-01

    Experiments were conducted to determine whether electron-beam irradiation would affect shear values, yield, odor, and thiobarbituric acid (TBA) values of chicken tissues. Broiler breasts (pectoralis superficialis) and whole thighs were irradiated with an electron-beam accelerator at levels to produce adsorbed doses of 100, 200, and 300 krads on the surface of the sample. The thigh samples were stored for 2, 4, and 8 days before testing for TBA values. The depth to which the radiation had penetrated the pectoralis superficialis muscle was also determined. Radiation penetrated 22 mm into slices of pectoralis superficialis muscle when 100 krad was absorbed by the surface of the tissue. The dose absorbed beneath the tissue surface to a depth of 10 mm was larger than the dose absorbed at the surface. The absorbed dose decreased as the depth of penetration increased. For cooked breast tissue, the shear values and moisture content were not affected by the absorbed radiation. Cooking losses of aged breast tissue were not affected by irradiation, but cooking losses were reduced in breast tissue that had not been aged. Irradiating uncooked thigh and uncooked breast samples produced a characteristic odor that remained after the thighs were cooked but was not detectable after the breast samples were cooked. With two exceptions, no significantly different TBA values were found that could be attributed to irradiation

  1. RAW CHICKEN LEG AND BREAST SENSORY EVALUATION

    Directory of Open Access Journals (Sweden)

    Octavian Baston

    2010-01-01

    Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.

  2. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  3. Structural changes evaluation with Raman spectroscopy in meat batters prepared by different processes.

    Science.gov (United States)

    Kang, Zhuang-Li; Li, Xiang; He, Hong-Ju; Ma, Han-Jun; Song, Zhao-Jun

    2017-08-01

    A comprehensive study was conducted to evaluate the structural changes of meat and protein of pork batters produced by chopping or beating process through the phase-contrast micrograph, laser light scattering analyzer, scanning electronic microscopy and Raman spectrometer. The results showed that the shattered myofibrilla fragments were shorter and particle-sizes were smaller in the raw batter produced by beating process than those in the chopping process. Compared with the raw and cooked batters produced by chopping process, modifications in amide I and amide III bands revealed a significant decrease of α -helix content and an increase of β -sheet, β -turn and random coils content in the beating process. The changes in secondary structure of protein in the batter produced by beating process was thermally stable. Moreover, more tyrosine residues were buried, and more gauche-gauche-trans disulfide bonds conformations and hydrophobic interactions were formed in the batter produced by beating process.

  4. Chemistry in the kitchen. Making ground meat more healthful.

    Science.gov (United States)

    Small, D M; Oliva, C; Tercyak, A

    1991-01-10

    The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and

  5. Qualitative Assessment for Toxoplasma gondii Exposure Risk Associated with Meat Products in the United States.

    Science.gov (United States)

    Guo, Miao; Buchanan, Robert L; Dubey, Jitender P; Hill, Dolores E; Lambertini, Elisabetta; Ying, Yuqing; Gamble, H Ray; Jones, Jeffrey L; Pradhan, Abani K

    2015-12-01

    Toxoplasma gondii is a global protozoan parasite capable of infecting most warm-blooded animals. Although healthy adult humans generally have no symptoms, severe illness does occur in certain groups, including congenitally infected fetuses and newborns, immunocompromised individuals including transplant patients. Epidemiological studies have demonstrated that consumption of raw or undercooked meat products is one of the major sources of infection with T. gondii. The goal of this study was to develop a framework to qualitatively estimate the exposure risk to T. gondii from various meat products consumed in the United States. Risk estimates of various meats were analyzed by a farm-to-retail qualitative assessment that included evaluation of farm, abattoir, storage and transportation, meat processing, packaging, and retail modules. It was found that exposure risks associated with meats from free-range chickens, nonconfinement-raised pigs, goats, and lamb are higher than those from confinement-raised pigs, cattle, and caged chickens. For fresh meat products, risk at the retail level was similar to that at the farm level unless meats had been frozen or moisture enhanced. Our results showed that meat processing, such as salting, freezing, commercial hot air drying, long fermentation times, hot smoking, and cooking, are able to reduce T. gondii levels in meat products. whereas nitrite and/or nitrate, spice, low pH, and cold storage have no effect on the viability of T. gondii tissue cysts. Raw-fermented sausage, cured raw meat, meat that is not hot-air dried, and fresh processed meat were associated with higher exposure risks compared with cooked meat and frozen meat. This study provides a reference for meat management control programs to determine critical control points and serves as the foundation for future quantitative risk assessments.

  6. Changes in endogenous bioactive compounds of Korean native chicken meat at different ages and during cooking.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Bae, Young Sik; Kim, Sun Hyo; Lee, Soo Kee; Lee, Jun Heon; Jo, Cheorun

    2014-07-01

    This study aimed to examine the effect of bird age on the contents of endogenous bioactive compounds, including carnosine, anserine, creatine, betaine, and carnitine, in meat from a certified meat-type commercial Korean native chicken strain (KNC; Woorimatdag). Additionally, the effects of the meat type (breast or leg meat) and the state of the meat (raw or cooked) were examined. Cocks of KNC were raised under similar standard commercial conditions at a commercial chicken farm. At various ages (10, 11, 12, 13, and 14 wk), breast and leg meats from a total of 10 birds from each age group were obtained. Raw and cooked meat samples were then prepared separately and analyzed for bioactive compounds. The age of the KNC had a significant effect only on the betaine content. The breast meat of KNC had higher amounts of carnosine and anserine but had lower amounts of betaine and carnitine than the leg meat (P cooking (P cooking, whereas breast meat showed almost complete retention of betaine and carnitine. The results of this study provide useful and rare information regarding the presence, amounts, and determinants of endogenous bioactive compounds in KNC meat, which can be useful for selection and breeding programs, and also for popularizing indigenous chicken meat. © 2014 Poultry Science Association Inc.

  7. Detection of IgG against Toxocara in Sera of Employees of Meat Industry

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernández-Tinoco, Jesús; Sánchez-Anguiano, Luis Francisco; Ramos-Nevárez, Agar; Cerrillo-Soto, Sandra Margarita; Guido-Arreola, Carlos Alberto; Saenz-Soto, Leandro

    2015-01-01

    Contact with raw meat could represent a risk for Toxocara infection. We assessed the association of Toxocara infection with an occupation of meat worker though a case-control seroprevalence study of 124 meat workers and 248 subjects without this occupation. Sera of participants was analyzed for the presence of anti-Toxocara IgG antibodies. One (0.8%) of the 124 meat workers, and 5 (2.0%) of the 248 controls were positive for anti-Toxocara IgG antibodies (OR=0.39; 95% CI: 0.04-3.41; P=0.66). The seropositive meat worker was a male aged 28 years old, without vision impairment. None of the work characteristics i.e. frequency of contact with raw meat, use of safety practices, history of splashes at face with blood or raw meat, and injuries with sharp material at work was associated with Toxocara exposure. Seroprevalence of Toxocara infection was significantly higher (P=0.04) in meat workers with consumption of boar meat (1/6: 16.7%) than in those without this consumption (0/117: 0%). We conclude that meat workers do not have a higher risk for Toxocara infection than subjects without this occupation do. The 2% seroprevalence of Toxocara infection found in control subjects might suggest a low seroprevalence of this infection among people with other occupations in Durango City. However, additional case-control studies with larger sample sizes to confirm our results are needed. PMID:26508909

  8. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Science.gov (United States)

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  9. Metronidazole resistance in Campylobacter jejuni from poultry meat

    DEFF Research Database (Denmark)

    Andersen, Sigrid Rita; Shukri, Naseer Mahmoud; Boel, Jeppe

    2006-01-01

    The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution with a signific......The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution...

  10. USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION

    Directory of Open Access Journals (Sweden)

    A. K. Kakimov

    2016-01-01

    Full Text Available In this paper, the results of the experimental research on developing the technology of a protein complex based on the meat-bone paste and protein-fat-blood emulsion are shown. The technological scheme of meat-bone paste production on the basis of complex grinding meat-bone raw material to bone particle size of 100 ∙10–6 m and further processing of bone particles using reagent, cheese whey, with pH 4,3 is presented. When studying the nutritive and biological value of the protein complex, it was established that the protein complex consisting of the food component from bone and protein-fat-blood emulsion could be used instead of the basic raw material in meat product production. The comparative analysis of the nutritive value of the protein complex and horse meat demonstrated the following results: the amino acid composition of the protein complex showed a balance of the essential amino acids and the high content of the essential amino acids which limit the biological value: lysine, leucine and threonine. The high content of polyunsaturated fatty acids was observed, which justified the biological value of the protein complex.

  11. Eosinophilic meningitis risk associated with raw Ampullarium canaliculatus snails consumption

    Directory of Open Access Journals (Sweden)

    Jiun-Jye Wang

    2011-05-01

    Full Text Available In Taiwan, Angiostrongylus cantonensis infection has been reported in foreign laborers who had consumed raw Ampullarium canaliculatus snails. This study analyzed three foreign laborers who had contracted enzyme-linked immunosorbent assay-confirmed A cantonensis infection while working in Taiwan. All three workers had consumed either roasted snails or raw snails flavored with seasoning while drinking wine. This study investigated possible risk factors for A cantonensis, including naturally occurring A cantonensis in A canaliculatus snails, viability of third-stage A cantonensis larvae in raw seasoned snails and in roasted snails, infectivity of larvae, and effects of alcohol while consuming snails. Positive infection rates in snails from five different irrigation canals in south Taiwan ranged from 12.3% to 29.4% and the average number of motile larvae per infected snail ranged from 36 to 65. The number of motile and coiled larvae in snail meat after 120 minutes seasoning was 93 (27.7% and 233 (69.3%, respectively. After 20 minutes of roasting, most larvae in the snail meat were dead. The infectivities of motile and coiled larvae from snail meat after 60 minutes seasoning were 53.2% and 33.2%, respectively, and those from snail meat after 5 minutes roasting were 33.2% and 7.0%, respectively. Eating Taiwan A canaliculatus snails raw is extremely risky given their high infection rates and infection intensities. Even after 120 minutes seasoning or after 20 minutes roasting, snail meat should be considered unsafe for human consumption. Finally, experimental rodent studies indicated that consuming alcohol while ingesting larvae does not significantly reduced infectivity.

  12. Lipid stability in meat and meat products.

    Science.gov (United States)

    Morrissey, P A; Sheehy, P J; Galvin, K; Kerry, J P; Buckley, D J

    1998-01-01

    Lipid oxidation is one of the main factors limiting the quality and acceptability of meats and meat products. Oxidative damage to lipids occurs in the living animal because of an imbalance between the production of reactive oxygen species and the animal's defence mechanisms. This may be brought about by a high intake of oxidized lipids or poly-unsaturated fatty acids, or a low intake of nutrients involved in the antioxidant defence system. Damage to lipids may be accentuated in the immediate post-slaughter period and, in particular, during handling, processing, storage and cooking. In recent years, pressure to reduce artificial additive use in foods has led to attempts to increase meat stability by dietary strategies. These include supplementation of animal diets with vitamin E, ascorbic acid, or carotenoids, or withdrawal of trace mineral supplements. Dietary vitamin E supplementation reduces lipid and myoglobin oxidation, and, in certain situations, drip losses in meats. However, vitamin C supplementation appears to have little, if any, beneficial effects on meat stability. The effect of feeding higher levels of carotenoids on meat stability requires further study. Some studies have demonstrated that reducing the iron and copper content of feeds improves meat stability. Post-slaughter carnosine addition may be an effective means of improving lipid stability in processed meats, perhaps in combination with dietary vitamin E supplementation.

  13. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.

    1975-01-01

    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  14. 9 CFR 317.344 - Identification of major cuts of meat products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Identification of major cuts of meat... AND VOLUNTARY INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.344 Identification of major cuts of meat products. The major cuts of single-ingredient, raw...

  15. SAG2 locus genotyping of Toxoplasma gondii in meat products of ...

    African Journals Online (AJOL)

    Toxoplasmosis is an infection caused by Toxoplasma gondii, an intracellular obligate parasite. Its transmission is usually attributed to ingestion of undercooked or raw meat. The aim of this study was the detection and genotyping of T. gondii in meat products using the molecular method in East Azerbaijan. DNA was ...

  16. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Studies on emulsion-type buffalo meat sausages incorporating skeletal and offal meat with different levels of pork fat.

    Science.gov (United States)

    Krishnan, K R; Sharma, N

    1990-01-01

    Ready-to-eat emulsion-type buffalo meat sausages were developed by using a combination of 80% meat components with 20% pork back fat. The meat components were constituted of 70 parts buffalo skeletal meat and 30 parts offal meat (rumen meat and heart meat in equal proportions). The emulsion stability, cooking losses of emulsions and sausages, composition of cooked sausages, eating quality of sausages and the microscopic characteristics of the raw emulsion and cooked sausages were studied. The light microscope micrograph of the raw emulsion showed uniformly well distributed fat globules embedded in a dense protein gel. The cooked emulsion also showed uniformly sized fat globules well distributed in a fine, compact, coagulated protein gel, which retained their original spherical shape. Good quality emulsion-type sausages could be produced having a high emulsion stability (0·87 ± 0·07 ml fat release/100 g emulsion); a low emulsion cooking loss (9·60 ± 0·60%) and a low sausage cooking loss (8·83 ± 0·48%). The overall acceptability of sausages was also high. Copyright © 1990. Published by Elsevier Ltd.

  18. Repetitively pulsed power for meat pasteurization

    International Nuclear Information System (INIS)

    Patterson, E.L.; Kaye, R.J.; Neau, E.L.

    1994-01-01

    Electronic pasteurization of meat offers the potential for drastically reducing the incidence of food poisoning caused by biological pathogens accidentally introduced into meat products. Previous work has shown that γ-rays are an effective method of destroying E. coli 0157:H7, Salmonella, C. jejuni, L. monocytogenes, Listeria, and S. aureus bacteria types. The concern with the use of γ-rays is that radioactive material must be used in the pasteurization process that can lead to some market resistance and activist pressure on the meat industry. The use of accelerator generated high average power electron beams, at energies less than 10 MeV, or X-rays, with energies below 5 MeV, have been approved by the FDA for use in pasteurizing foods. Accelerator produced electronic pasteurization has the advantage that no radioactive material inventory is required. Electronic pasteurization has the additional benefit that it removes bacterial pathogens on the meat surface as well as within the volume of the meat product. High average power, repetitively-pulsed, broad-area electron beam sources being developed in the RHEPP program are suitable for large scale meat treatment in packing plant environments. RHEPP-II, which operates at 2.5 MeV and 25 kA at pulse repetition frequencies up to 120 Hz has adequate electron energy to penetrate hamburger patties which comprise about half of the beef consumption in the United States. Ground beef also has the highest potential for contamination since considerable processing is required in its production. A meat pasteurization facility using this size of accelerator source should be capable of treating 10 6 pounds of hamburger patties per hour to a dose of up to 3 kGy (300 kilorads). The RHEPP modular accelerator technology can easily be modified for other production rates and types of products

  19. Nutritional value of traditional Italian meat-based dishes: influence of cooking methods and recipe formulation.

    Science.gov (United States)

    D'Evoli, L; Salvatore, P; Lucarini, M; Nicoli, S; Aguzzi, A; Gabrielli, P; Lombardi-Boccia, G

    2009-01-01

    The present study provides a picture of the compositional figure and nutritive value of meat-based dishes typical of Italian culinary tradition. Recipes specific for a bovine meat cut (top-side) were selected among the most widespread ones in Italy: in pan, pizzaiola, cutlet, meat ball, and escalope. The total fat and cholesterol content varied depending on the ingredients utilized (extra-virgin olive oil, parmesan, egg). Meat-based dishes that utilized extra-virgin olive oil showed a significant reduction in palmitic and stearic acids and a parallel increase in oleic acid compared with raw meat; furthermore, the ratio among saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids shifted in favour of monounsaturated fatty acids. B vitamins were affected at different extent by heating; by contrast, vitamin E content increased because of the new sources of this vitamin, which masked losses due to heating. Ingredients (parmesan, discretionary salt) induced significant increases in the calcium and sodium concentrations compared with raw meat. The total iron content did not show marked differences in most of the meat-based dishes compared with raw meat; by contrast, losses in the heme-iron concentration were detected depending on the severity of heating treatments. Our findings suggest that heme iron, because of its important health aspects, might be a useful index of the nutritional quality of cooked meats.

  20. Meat analog: a review.

    Science.gov (United States)

    Malav, O P; Talukder, S; Gokulakrishnan, P; Chand, S

    2015-01-01

    The health-conscious consumers are in search of nutritious and convenient food item which can be best suited in their busy life. The vegetarianism is the key for the search of such food which resembles the meat in respect of nutrition and sensory characters, but not of animal origin and contains vegetable or its modified form, this is the point when meat analog evolved out and gets shape. The consumers gets full satisfaction by consumption of meat analog due to its typical meaty texture, appearance and the flavor which are being imparted during the skilled production of meat analog. The supplement of protein in vegetarian diet through meat alike food can be fulfilled by incorporating protein-rich vegetative food grade materials in meat analog and by adopting proper technological process which can promote the proper fabrication of meat analog with acceptable meat like texture, appearance, flavor, etc. The easily available vegetables, cereals, and pulses in India have great advantages and prospects to be used in food products and it can improve the nutritional and functional characters of the food items. The various form and functional characters of food items are available world over and attracts the meat technologists and the food processors to bring some innovativeness in meat analog and its presentation and marketability so that the acceptability of meat analog can be overgrown by the consumers.

  1. Antimicrobial Edible Films and Coatings for Meat and Meat Products Preservation

    Directory of Open Access Journals (Sweden)

    Irais Sánchez-Ortega

    2014-01-01

    Full Text Available Animal origin foods are widely distributed and consumed around the world due to their high nutrients availability but may also provide a suitable environment for growth of pathogenic and spoilage microorganisms. Nowadays consumers demand high quality food with an extended shelf life without chemical additives. Edible films and coatings (EFC added with natural antimicrobials are a promising preservation technology for raw and processed meats because they provide good barrier against spoilage and pathogenic microorganisms. This review gathers updated research reported over the last ten years related to antimicrobial EFC applied to meat and meat products. In addition, the films gas barrier properties contribute to extended shelf life because physicochemical changes, such as color, texture, and moisture, may be significantly minimized. The effectiveness showed by different types of antimicrobial EFC depends on meat source, polymer used, film barrier properties, target microorganism, antimicrobial substance properties, and storage conditions. The perspective of this technology includes tailoring of coating procedures to meet industry requirements and shelf life increase of meat and meat products to ensure quality and safety without changes in sensory characteristics.

  2. Irradiation of bovine meat: effect of heme-iron concentration

    International Nuclear Information System (INIS)

    Mistura, Liliana Perazzini Furtado

    2002-01-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  3. Effects of meat juice on biofilm formation of Campylobacter and Salmonella.

    Science.gov (United States)

    Li, Jiaqi; Feng, Jinsong; Ma, Lina; de la Fuente Núñez, César; Gölz, Greta; Lu, Xiaonan

    2017-07-17

    Campylobacter and Salmonella are leading causes of foodborne illnesses worldwide, vastly harboured by raw meat as their common food reservoir. Both microbes are prevalent in meat processing environments in the form of biofilms that contribute to cross-contamination and foodborne infection. This study applied raw meat juice (chicken juice and pork juice) as a minimally processed food model to study its effects on bacterial biofilm formation. Meat juice was collected during the freeze-thaw process of raw meat and sterilized by filtration. In 96-well polystyrene plates and glass chambers, supplementation of over 25% meat juice (v/v) in laboratory media led to an increase in biofilm formation of Campylobacter and Salmonella. During the initial attachment stage of biofilm development, more bacterial cells were present on surfaces treated with meat juice residues compared to control surfaces. Meat juice particulates on abiotic surfaces facilitated biofilm formation of Campylobacter and Salmonella under both static and flow conditions, with the latter being assessed using a microfluidic platform. Further, the deficiency in biofilm formation of selected Campylobacter and Salmonella mutant strains was restored in the presence of meat juice particulates. These results suggested that meat juice residues on the abiotic surfaces might act as a surface conditioner to support initial attachment and biofilm formation of Campylobacter and Salmonella. This study sheds light on a possible survival mechanism of Campylobacter and Salmonella in meat processing environments, and indicates that thorough cleaning of meat residues during meat production and handling is critical to reduce the bacterial load of Campylobacter and Salmonella. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Technological characteristics of meat - viscosity

    OpenAIRE

    DIBĎÁK, Tomáš

    2012-01-01

    This bachelor thesis is focused on the technological characteristics of meat, mainly viscosity of meat. At the beginning I dealt with construction of meat and various types of meat: beef, veal, pork, mutton, rabbit, poultry and venison. Then I described basic chemical composition of meat and it?s characteristic. In detail I dealt with viscosity of meat. Viscosity is the ability of meat to bind water both own and added. I mentioned influences, which effects viscosity and I presented the possib...

  5. UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN

    OpenAIRE

    Rimal, Arbindra; Fletcher, Stanley M.

    2003-01-01

    This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.

  6. Raw and renewable polymers

    CSIR Research Space (South Africa)

    Joseph, S

    2010-01-01

    Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...

  7. Quality, functionality, and shelf life of fermented meat and meat products: A review.

    Science.gov (United States)

    Kumar, Pavan; Chatli, M K; Verma, Akhilesh K; Mehta, Nitin; Malav, O P; Kumar, Devendra; Sharma, Neelesh

    2017-09-02

    Fermentation of meat is a traditional preservation method used widely for improving quality and shelf life of fermented meat products. Fermentation of meat causes a number of physical, biochemical, and microbial changes, which eventually impart functional properties, sensory characteristics, and nutritional aspects to these products and inhibit the growth of various pathogenic and spoilage microorganisms. These changes include acidification (carbohydrate catabolism), solubilization and gelation of myofibrillar and sarcoplasmic proteins of muscle, degradation of proteins and lipids, reduction of nitrate into nitrite, formation of nitrosomyoglobin, and dehydration. Dry-fermented sausages are increasingly being used as carrier of probiotics. The production of biogenic amines during fermentation can be controlled by selecting proper starter cultures and other preventive measures such as quality of raw materials, hygienic measures, temperature, etc.

  8. Evaluation of Technological Quality of Meat Produced from Nsukka ...

    African Journals Online (AJOL)

    The technological quality of raw meat from Nsukka local abattoir was evaluated by analyzing the proximate composition, water holding capacity, pH, Napole yield and sensory colour and texture of longissimus dorsi [LD] and psoas major [PM] of beef and pork. Results show that moisture [71.36 – 72.76%], protein [21.37 ...

  9. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-01-01

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100–400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat. PMID:27338486

  10. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat.

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-06-07

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100-400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat.

  11. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  12. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  14. Meat : a natural symbol.

    OpenAIRE

    Fiddes, Nick

    1989-01-01

    In Britain, and in cultures around the world, meat's significance extends beyond what might be anticipated from its nutritional utility. By looking at the academic and popular literature, and through a series of looselystructured interviews, this study investigates the range of ideas that people hold about meat in modern Britain for evidence as to what it is that makes animal flesh such an esteemed foodstuff. The principle conclusion is that meat's pre-eminence derives from ...

  15. Recovery of the secondary raw materials, recycling

    International Nuclear Information System (INIS)

    Chmielewska, E.

    2010-01-01

    In this chapter the recovery and recycling of secondary raw materials is explained. This chapter consists of the following parts: Paper and tetrapaks; Car wrecks; Scrap metal; Plastics; Used tires; Electrical and electronic equipment; Glass; Accumulators and batteries; Spent oil; Low-and non-waste technology.

  16. Meat science research tendencies

    Directory of Open Access Journals (Sweden)

    José Arturo García Macías

    2010-12-01

    Full Text Available Meat is a high quality food due its higher protein content, besides to provide energy, vitamins particularly B complex, water and minerals, resulting in an appreciated food for humans. Even in same country, consumers search for different stuffs, since north consumers looks for meat cuts with fat and bone, whereas center-south consumers prefers fatless debones meat cuts. Modern consumers demand excellent appearance, color, taste and flavor in foods, microbiologically safe, minimal processed and curing salts, very nutritive and cheap. All these together in one single product are a hard challenge in the meat products area.

  17. Use of artificial intelligence in the production of high quality minced meat

    Science.gov (United States)

    Kapovsky, B. R.; Pchelkina, V. A.; Plyasheshnik, P. I.; Dydykin, A. S.; Lazarev, A. A.

    2017-09-01

    A design for an automatic line for minced meat production according to new production technology based on an innovative meat milling method is proposed. This method allows the necessary degree of raw material comminution at the stage of raw material preparation to be obtained, which leads to production intensification due to the traditional meat mass comminution equipment being unnecessary. To ensure consistent quality of the product obtained, the use of on-line automatic control of the technological process for minced meat production is envisaged. This system has been developed using artificial intelligence methods and technologies. The system is trainable during the operation process, adapts to changes in processed raw material characteristics and to external impacts that affect the system operation, and manufactures meat shavings with minimal dispersion of the typical particle size. The control system includes equipment for express analysis of the chemical composition of the minced meat and its temperature after comminution. In this case, the minced meat production process can be controlled strictly as a function of time, which excludes subjective factors for assessing the degree of finished product readiness. This will allow finished meat products with consistent, targeted high quality to be produced.

  18. A cluster of three cases of trichinellosis linked to bear meat consumption in the Arctic.

    Science.gov (United States)

    Dupouy-Camet, Jean; Yera, Hélène; Dahane, Naïma; Bouthry, Elise; Kapel, Christian M O

    2016-05-01

    We report here three cases of trichinellosis due to polar bear meat consumption in East Greenland. In the past 20 years, 31 cases of trichinellosis have been reported in French travellers to the Arctic (North Quebec, Nunavut and Greenland) who consumed undercooked meat from black, brown, or polar bears. If local communities are increasingly becoming aware of the risk of trichinellosis, travellers visiting regions where bear meat is consumed should be informed of the risk of eating raw or non-heat-processed meats. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

  19. Importance of the producer on retail broiler meat product contamination with Campylobacter spp

    DEFF Research Database (Denmark)

    Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta

    2013-01-01

    Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...

  20. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some factors belonging to the intrinsic quality of meat, animal slaughter methods, technological operations applied to the meat, and the auxiliary materials used.

  1. Flavonoids in the development of functional meat products: A review

    Directory of Open Access Journals (Sweden)

    Pramod K. Singh

    2013-06-01

    Full Text Available Flavonoids or bioflavonoids are unique low molecular weight ubiquitous polyphenolic compounds produced by plants during their metabolic activities as a secondary metabolites and responsible for major organoleptic characteristics and health benefits of plant derived foods. The flavonoids are potent antioxidants agents and protect the cells by scavenging and inhibiting the production and initiation of free radicals, superoxide anions and lipid peroxy radicals. Besides potent antioxidant capacity, flavonoids also shows antimicrobial, antimutagenic, antidiabetic, antithrombosis, antirheumatic, antiatherosclerotic, antiallergic, anti-inflammatory, antiulcers and hepatoprotectives and better termed as neutraceuticals. The antioxidant capacity of meat is very low and this can be increased by adding flavonoids in meat during processing in the form of plant parts rich in flavonoids such as seeds, fruit skin or peel, bark and flower as raw or in extract form without comprising the sensory attributes of meat and meat products. [Vet World 2013; 6(8.000: 573-578

  2. Heterocyclic amines in meat and meat products

    Directory of Open Access Journals (Sweden)

    Aliye BULGAN

    2013-06-01

    Full Text Available Heterocyclic amines (HA are the mutagenic/carcinogenic compounds which generate as a result of cooking of red meat, poultry meat and fish fillets at high temperatures. Up to 20 different HAs were detected and classified in the researches that conducted on these types of meats cooked at high temperatures. HAs are the products of Maillard reactions and the Strecker degredation of main precursors such as creatine/creatinine, aminoacid and the polysaccharides. Many physical and chemical factors effect the formation of HAs. Thus, it was reported by many researchers that utilizing coating and marination processes in addition to using natural and synthetic antioxidants and seasonings-plant extracts were effective on inhibiting/decreasing the formation of HAs. Additionally, boiling/steaming and microwave cooking methodologies were recommended instead of barbecuing, grilling or frying to inhibit/decrease the formation of HAs. The HAs formed in meat and meat products and the factors which have effects on the formation of HAs are presented in this review.

  3. Safe meat-handling knowledge, attitudes and practices of private and government meat processing plants' workers: implications for future policy.

    Science.gov (United States)

    Adesokan, H K; Raji, A O Q

    2014-03-01

    Food-borne disease outbreaks remain a major global health challenge and cross-contamination from raw meat due to poor handling is a major cause in developing countries. Adequate knowledge of meat handlers is important in limiting these outbreaks. This study evaluated and compared the safe meat-handling knowledge, attitudes and practices (KAP) of private (PMPP) and government meat processing plants' (GMPP) workers in south-western Nigeria. This cross sectional study comprised 190 meat handlers (PMPP = 55; GMPP = 135). Data concerning their safe meat-handling knowledge, attitudes and practices as well as their socio-demographic characteristics, such as age, gender and work experience were collected. A significant association was observed between the type of meat processing plants and their knowledge (p = 0.000), attitudes (p = 0.000) and practices (p = 0.000) of safe meat-handling. Meat handlers in the GMPP were respectively, about 17 times (OR = 0.060, 95% CI: 0.018-0.203), 57 times (OR = 0.019, 95% CI: 0.007-0.054) and 111 times (OR = 0.009, 95% CI: 0.001- 0.067) less likely to obtain good knowledge, attitude and practice level of safe meat-handling than those from PMPP. Further, KAP levels were significantly associated with age group, education and work experience (p < 0.05). Study findings suggest the need for future policy in food industry in developing countries to accommodate increased involvement of private sector for improved food safety and quality delivery. Public health education on safe food handling and hygiene should be on the front burner among food handlers in general.

  4. Survey of Toxoplasma gondii antibodies in meat juice of wild boar (Sus scrofa in several districts of the Czech Republic

    Directory of Open Access Journals (Sweden)

    Karol Račka

    2015-05-01

    The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.

  5. Meat and meat product preservation by ionizing radiation

    International Nuclear Information System (INIS)

    Egginger, R.

    A brief summary is given of experience with the preservation of meat and meat products by ionizing radiation, or by combined methods. The results of the research have proved that hygienically significant microorganisms (mainly salmonellas) are reliably destroyed and that the consumption of thus irradiated meat and meat products presents no danger to human health. (B.S.)

  6. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter

    2014-01-01

    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

  7. Prevalence and antibiotic resistance of Salmonella spp. in meat products, meat preparations and minced meat

    Science.gov (United States)

    Rašeta, M.; Mrdović, B.; Janković, V.; Bečkei, Z.; Lakićević, B.; Vidanović, D.; Polaček, V.

    2017-09-01

    This study aimed to determine Salmonella spp. prevalence in meat products, meat preparations and minced meat. Over a period of three years, a total of 300 samples were taken (100 RTE meat products, 100 meat preparations and 100 minced meat) and examined for the presence of Salmonella spp. Sampling was carried out at the warehouses of the food manufacturers. Salmonella spp. were not detected in RTE meat products, while 7% of semi-finished meat products (fresh sausages, grill meat formed and unformed) contained Salmonella, as did 18% of minced meats (minced pork II category, minced beef II category, mixed minced meat). The 25 Salmonella isolates obtained were examined for antibiotic resistance by the disk diffusion test, according to the NCCLS and CLSI guidelines. Isolates showed resistance to ampicillin and nalidixic acid (80%), tetracycline (72%), cefotaxime/clavulanic acid (48%), but not to gentamicin (8%) or trimethoprim/sulfamethoxazole (0%).

  8. Tenacity of Alaria alata mesocercariae in homemade German meat products.

    Science.gov (United States)

    González-Fuentes, Hiromi; Hamedy, Ahmad; von Borell, Eberhard; Luecker, Ernst; Riehn, Katharina

    2014-04-17

    A renewed interest in the pathogenic potential of Alaria alata mesocercariae emerged over the last 10years as a result of increased findings of this parasite in feral pigs during official examination for Trichinella spp. Cases of food associated human alariosis in North America suggest that a risk associated with the consumption of traditional raw cured products from infected wild boar meat cannot be neglected because the commonly applied preservation techniques may not necessarily kill the mesocercariae. In addition, changes in consumer behavior and new preparation methods for game meat (e.g. pink roasting and grilling) may increase the risk for food-associated parasitic infections. Thus, there is a strong need for the evaluation of the tenacity of A. alata mesocercariae against different physical and chemical influences as pertaining to common preservation and preparation techniques. Against this backdrop the aim of our work was a sound analysis of the survivability of A. alata mesocercariae during curing, fermentation, cold smoking and drying in raw cured meat products. Eighty three samples of traditional German meat products were prepared from naturally infected game meat and partly spiked with additional vital mesocercariae to achieve an adequate dose of infection. The resultant products were examined chronologically for dead and viable A. alata mesocercariae with the Alaria mesocercariae migration technique. After 24h of production, vital A. alata mesocercariae were still found in raw type sausages but no vital parasites were detected in the final products. Based on these results a possible risk for the consumer for an infection with A. alata mesocercariae through the consumption of contaminated raw cured products can be largely ruled out if the respective food technological procedures are carried out properly. However, a risk for the consumer cannot be excluded in cases of very early consumption of these products. Copyright © 2014 Elsevier B.V. All rights

  9. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    , and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...

  10. Prevalence of methicillin-resistant Staphylococcus aureus in meat.

    Science.gov (United States)

    de Boer, E; Zwartkruis-Nahuis, J T M; Wit, B; Huijsdens, X W; de Neeling, A J; Bosch, T; van Oosterom, R A A; Vila, A; Heuvelink, A E

    2009-08-31

    Recently the isolation of methicillin-resistant Staphylococcus aureus (MRSA) strains from several food-producing animals has been reported. During slaughtering of MRSA-positive animals, contamination of carcasses with MRSA may occur and consequently the meat of these animals may get contaminated. The aim of this study was to estimate the prevalence of MRSA in raw meat samples from the retail trade. Samples of raw beef, pork, veal, lamb/mutton, chicken, turkey, fowl and game were collected from the retail trade. A detection method including a two-step enrichment in Mueller-Hinton broth+6.5% NaCl and phenol red mannitol broth containing ceftizoxime and aztreonam, followed by isolation on MRSA ID agar (bioMérieux) was evaluated and subsequently applied for the detection of MRSA in samples of raw meats. MRSA strains were isolated from 264 (11.9%) of 2217 samples analyzed. Isolation percentages for the meat species were: beef (10.6%), veal (15.2%), lamb and mutton (6.2%), pork (10.7%), chicken (16.0%), turkey (35.3%), fowl (3.4%) and game (2.2%). The majority (85%) of the isolated strains belonged to spa-types of pulsed-field gel electrophoresis (PFGE) non-typeable (NT)-MRSA, corresponding to the multilocus sequence type ST398, a type also recently isolated in the Netherlands from pigs. However, a smaller part of these strains were found to be of other ST's, possibly of human origin. Further studies are needed to elucidate transmission routes of MRSA in relation to meat and other foods and to provide the tools for preventing the spread of MRSA. At present the high prevalence of MRSA in meat has not been shown to contribute significantly to the dissemination of MRSA to humans and the possible health hazard for consumers of the presence of MRSA in foods should be further elucidated.

  11. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    OpenAIRE

    Silvius STANCIU; Nicoleta STANCIUC; Loredana DUMITRASCU; Roxana ION; Costel NISTOR

    2013-01-01

    Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appea...

  12. Meat and Fish Freshness Inspection System Based on Odor Sensing

    OpenAIRE

    Hasan, Najam ul; Ejaz, Naveed; Ejaz, Waleed; Kim, Hyung Seok

    2012-01-01

    We propose a method for building a simple electronic nose based on commercially available sensors used to sniff in the market and identify spoiled/contaminated meat stocked for sale in butcher shops. Using a metal oxide semiconductor-based electronic nose, we measured the smell signature from two of the most common meat foods (beef and fish) stored at room temperature. Food samples were divided into two groups: fresh beef with decayed fish and fresh fish with decayed beef. The prime objective...

  13. Rabbit meat processing: historical perspective to future directions

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2013-12-01

    Full Text Available In past centuries, because rabbits are relatively small, animals slaughtered for consumption were generally eaten immediately. However, since a single rabbit would offer little more product than could be consumed at one sitting, little effort was devoted to developing preserved rabbit products (such as salted or dried meat, sausages, etc.. For this reason, although there is a rich history of recipes using rabbit meat in the Mediterranean area, there are few traditional further-processed products. Nowadays, even though the processing industry is pushing more and more towards the introduction of more attractive products (i.e. ready meals, ready-to-cook, etc. for consumers with little time for meal preparation, most rabbit meat worldwide is still sold as whole carcass or cut-up parts. This review analyses the main strength and weakness factors regarding the use of rabbit meat to manufacture further processed products. Bearing in mind these considerations, it then describes the more promising processing technologies for raw meat materials to obtain added-value products (marinated, formed, emulsified, coated, etc. by exploiting rabbit meat’s intrinsic characteristics, such as high protein/low fat content coupled with a balanced n-6 to n-3 PUFA ratio, low cholesterol and heme-iron content. Major trends in meat product formulation (modulation of lipid content and composition, use of novel antioxidants and salt reduction are also discussed by highlighting strategies to provide healthier meat products meeting current nutritional needs. Finally, major packaging solutions for rabbit meat and meat products (ordinary and modified atmosphere, vacuum are considered.

  14. Dietary energy source affecting fat deposition mechanism, muscle fiber metabolic and overall meat quality

    Directory of Open Access Journals (Sweden)

    M. Al-Hijazeen

    2017-03-01

    Full Text Available A study was conducted to investigate the effect of two dietary energy sources, soy bean oil, and sucrose on regulatory mechanisms of meat preservation. Twenty one day-old Hubbard commercial broilers were randomly allocated into two dietary treatment groups with six replicates per treatment, and four broilers per replicate. All birds were coded for the influence of energy source: fat based diet (FD, and sugar based diet (SD. Formulated grower diets were isonitrogenous and isocaloric. The chickens were slaughtered and then boneless, skinless ground chicken tight meat was prepared. Both raw and cooked meats were analyzed for lipid and protein oxidation, and sensory panel evaluation. In addition, meat from the small muscles of the raw thigh was used to evaluate other meat quality characteristics. Proximate analyses showed no significant differences between both dietary treatments on protein, ash and moisture percentage values. Meat samples of the group that was fed FD showed higher significant values of both TBARS and total carbonyl at day 7 of storage time. However, samples of the second group (Fed SD showed lower values of both ultimate pH and water separation % using raw thigh meat. The effect of FD treatment on the meat composition appeared clearly especially on fat percentage content. In addition, meat samples obtained from chickens fed SD showed better significant values of the overall acceptability attribute. According to the current findings, sucrose could be an excellent alternative to oil in dietary broilers which improved the meat preservation bio-system, and post-mortem storage stability.

  15. The Meat City

    DEFF Research Database (Denmark)

    Thelle, Mikkel

    2017-01-01

    This article investigates the emergence of the Copenhagen slaughterhouse, called the Meat City, during the late nineteenth century. This slaughterhouse was a product of a number of heterogeneous components: industrialization and new infrastructures were important, but hygiene and the significance...... of Danish bacon exports also played a key role. In the Meat City, this created a distinction between rising production and consumption on the one hand, and the isolation and closure of the slaughtering facility on the other. This friction mirrored an ambivalent attitude towards meat in the urban space: one...... where consumers demanded more meat than ever before, while animals were being removed from the public eye. These contradictions, it is argued, illustrate and underline the change of the city towards a ‘post-domestic’ culture. The article employs a variety of sources, but primarily the Copenhagen...

  16. Meat for keeps

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1981-01-01

    The advantages of gamma irradiation as a food preservation technique for meat are such that the author envisages its wide acceptance and application during this decade both locally and internationally

  17. Irradiation and additive combinations on the pathogen reduction and quality of poultry meat.

    Science.gov (United States)

    Ahn, Dong U; Kim, Il Suk; Lee, Eun Joo

    2013-02-01

    Reduction of foodborne illnesses and deaths by improving the safety of poultry products is one of the priority areas in the United States, and developing and implementing effective food processing technologies can be very effective to accomplish that goal. Irradiation is an effective processing technology for eliminating pathogens in poultry meat. Addition of antimicrobial agents during processing can be another approach to control pathogens in poultry products. However, the adoption of irradiation technology by the meat industry is limited because of quality and health concerns about irradiated meat products. Irradiation produces a characteristic aroma as well as alters meat flavor and color that significantly affect consumer acceptance. The generation of a pink color in cooked poultry and off-odor in poultry by irradiation is a critical issue because consumers associate the presence of a pink color in cooked poultry breast meat as contaminated or undercooked, and off-odor in raw meat and off-flavor in cooked meat with undesirable chemical reactions. As a result, the meat industry has difficulties in using irradiation to achieve its food safety benefits. Antimicrobials such as sodium lactate, sodium diacetate, and potassium benzoate are extensively used to extend the shelf-life and ensure the safety of meat products. However, the use of these antimicrobial agents alone cannot guarantee the safety of poultry products. It is known that some of the herbs, spices, and antimicrobials commonly used in meat processing can have synergistic effects with irradiation in controlling pathogens in meat. Also, the addition of spices or herbs in irradiated meat improves the quality of irradiated poultry by reducing lipid oxidation and production of off-odor volatiles or masking off-flavor. Therefore, combinations of irradiation with these additives can accomplish better pathogen reduction in meat products than using them alone even at lower levels of antimicrobials/herbs and

  18. Assessment of levels of bacterial contamination of large wild game meat in Europe.

    Science.gov (United States)

    Membré, Jeanne-Marie; Laroche, Michel; Magras, Catherine

    2011-08-01

    The variations in prevalence and levels of pathogens and fecal contamination indicators in large wild game meat were studied to assess their potential impact on consumers. This analysis was based on hazard analysis, data generation and statistical analysis. A total of 2919 meat samples from three species (red deer, roe deer, wild boar) were collected at French game meat traders' facilities using two sampling protocols. Information was gathered on the types of meat cuts (forequarter or haunch; first sampling protocol) or type of retail-ready meat (stewing meat or roasting meat; second protocol), and also on the meat storage conditions (frozen or chilled), country of origin (eight countries) and shooting season (autumn, winter, spring). The samples were analyzed in both protocols for detection and enumeration of Escherichia coli, coagulase+staphylococci and Clostridium perfringens. In addition, detection and enumeration of thermotolerant coliforms and Listeria monocytogenes were performed for samples collected in the first and second protocols, respectively. The levels of bacterial contamination of the raw meat were determined by performing statistical analysis involving probabilistic techniques and Bayesian inference. C. perfringens was found in the highest numbers for the three indicators of microbial quality, hygiene and good handling, and L. monocytogenes in the lowest. Differences in contamination levels between game species and between meats distributed as chilled or frozen products were not significant. These results might be included in quantitative exposure assessments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Identification of characteristic aroma compounds in raw and thermally processed African giant snail (Achatina fulica).

    Science.gov (United States)

    Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma

    2018-04-24

    Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.

  20. Effect of comminution method and raw binder system in restructured beef.

    Science.gov (United States)

    Boles, J A; Shand, P J

    1998-07-01

    The effect of particle size, method of particle size reduction (grinding, flaking, slicing) and alginate or Fibrimex(™) binding systems on processing properties of restructured beef were investigated. The size of semimembranosus muscles was reduced with a meat slicer, grinder or flaker (Comitrol) through machine openings that were 2, 4 and 8 mm in size. Bind of meat pieces in raw and cooked beef steakettes were measured. Sensory evaluation to determine the effect of method of size reduction on texture of beef steakettes was done only on steakettes manufactured with alginate. Beef steakettes manufactured with the alginate binding system had significantly (p meat for the manufacture of restructured beef steakettes resulted in a higher raw bind than did either grinding or flaking the meat. Significant (p meat was sliced than when it was ground or flaked. However, when Fibrimex was used, bind was stronger when sliced meat was used. The alginate system resulted in higher binds for cooked product when particle size was smaller but with the Fibrimex system bind was higher when particle sizes were larger. A consumer panel on alginate restructured steakettes showed no preference for the texture produced by the different methods of particle size reduction.

  1. Update on the bird-egg syndrome and genuine poultry meat allergy.

    Science.gov (United States)

    Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines

    Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to sensitization to serum albumins present in many tissues including muscle tissue and egg yolk (Gal d 5). Primary sensitization to serum albumin may happen via the respiratory tract through exposure to pet birds (mainly in adults) or within the context of egg allergy in early childhood. Due to the heat lability of serum albumins, reactions are often limited to the skin upon contact with raw meat. Symptoms from meat ingestion are rare and mostly mild, whereas systemic reactions are common after ingestion of raw or soft-boiled egg yolk. Primary poultry meat allergy is mainly seen in adolescents and young adults, though hypersensitivity may have started already at (pre)school age. Egg allergy is usually absent. Typical symptoms of primary poultry meat allergy include OAS (±dyspnea), gastrointestinal complaints, urticaria and angioedema. Severe anaphylaxis with cardiovascular symptoms is rare. Chicken and turkey meat are highly cross-reactive and responsible for most reactions, while duck and goose meat causes milder or no symptoms. Soups, sausages, and ham represent relevant allergen sources, too. Patients with poultry meat allergy unexpectedly often suffer from concomitant allergy to fish and possibly shrimp. Serum specific IgE against fish and shrimp is found in respectively 60 and 40 % of sera, suggestive of cross-reactive allergens in these foods. The allergens thus far recognized in genuine poultry meat are LMW proteins of 5-25 kDa. One of them has been identified as

  2. Integrity of nuclear genomic deoxyribonucleic acid in cooked meat: Implications for food traceability.

    Science.gov (United States)

    Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M

    2009-01-01

    It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P 800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.

  3. VARIATION IN MEAT COMPOSITION VISCOSITY DURING THE MIXING PROCESS

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Animal raw material processing is directly influenced by the physical and chemical characteristics of the materials which also influence their water holding capacity. The various combinations and status of the raw materials used in the food industry determine specific behaviours that may influence the processing equipment performance and construction. The study on meat composition viscosity depending upon the added components, temperature and mixing time length, has shown that viscosity is increasing with lower added water percentage, lower mixing temperature and higher mixing time length.

  4. Cardiotoxic Effects of Raw Opium.

    Science.gov (United States)

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  5. Cardiotoxic Effects of Raw Opium

    OpenAIRE

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  6. NEW MEAT PRODUCTS WITH IMMUNOMODULATORY EFFECT CREATION METHOD

    Directory of Open Access Journals (Sweden)

    I. V. Kaltovich

    2016-01-01

    Full Text Available New meat products with immunomodulatory effect creation method reflecting differential characteristics of technological stages of manufacture of those types of meat products, including issues on the selection of primary and secondary raw materials, guidelines for development of formulations and production technologies, legislative requirements towards its labeling, etc, has been developed for the first time. A list of prospective meat raw materials for the manufacture of products with immunomodulatory effect was established: beef, pork, rabbit meat, broiler chicken meat, turkey, veal, ostrich meat, which have high content of protein (14,3– 21,7%, low content of fat (1,2–16,1%, excluding pork (33,3%, high levels of minimum amino-acid score (90,0–104,0%, protein quality indicator(0,91–1,64, essential amino acid index (1,16-1,25, coefficient of utility of amino acid content (0,72–0,86 and close to optimum fatty acid content, and also contain a great number of vitamins and minerals which play a significant role for immunity improvement. It was determined that the following functional ingredients are recommended to use: amino acids (valine, leucine, isoleucine, methionine, threonine, arginine, tryptophan, lysine, histidin, phenylalanyl, vitamins and provitamins (C,E, beta-carotene, B vitamins(Bc, B12, PP, etc., P(bioflavonoid complex, H, K, minerals (calcium, magnesium, iron, cuprum, zinc, manganese, selenium, polyunsaturated fatty acids omega-3 and omega-6, pseudo-vitamins (L-carnitin, coenzyme Q10, polysaccharides and peptides naturally occurring(squalen, B-Carotene, ginger, shiitake mushrooms, probiotics and prebiotics, glutathione, indole and lycopienes, bioflavonoids, L-arginine, N-acetylcysteine, gel from seaweed «Lamifaren». The use of the developed meat products with immunomodulatory effect creation method by process engineers of meat processing factories will allow them to form a single scientifically grounded approach during the

  7. Microstructure and physical changes in the Mexican cooked lamb meat barbacoa made with chilled and frozen meat.

    Science.gov (United States)

    Estrada-Solís, Joaquín; Figueroa-Rodríguez, Katia A; Figueroa-Sandoval, Benjamín; Hernández-Rosas, Francisco; Hernández-Cazares, Aleida S

    2016-08-01

    Longissimus dorci (LD) samples of different origin (imported and domestic) with pre-treatments (imported meat stored at -18°C for 6months, domestic meat stored at -18°C for 10days, and domestic meat stored at 4°C for 24h) were cooked as barbacoa and frozen using two treatments (air blast and liquid immersion) and then evaluated after 30days of storage. The results showed that the origin and pre-treatment of meat affected L*, a*, instrumental texture and microstructure; that the storage time affected pH, aw, b* and microstructure; and that the freezing treatments did not affect the meat. Overall, the frozen cooked lamb dish barbacoa could present some problems at the conservation stage due to an increase in pH, aw and changes in microstructure; however, the physical traits (color and texture) remained mostly unchanged and depended more on the quality of the raw meat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    Science.gov (United States)

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (ppork head meat was increased from 0% to 20%, cooking loss, total expressible fluid separation, fat separation, and pH of frankfurters were increased, while the lightness, redness, yellowness, and apparent viscosity of frankfurters were decreased. Ash contents, cohesiveness, color, and tenderness of sensory characteristics of frankfurters added with different amounts of pork meat or pork head meat were not significantly (p>0.05) different from those of the control or there treatments. Frankfurters in T4 (frankfurter with 30% pork meat + 20% pork head) had the lowest (p0.05) from that in the control. Frankfurters with higher pork head meat concentrations had lower flavor, juiciness, and overall acceptability scores. Therefore, replacing pork meat with pork head meat in the formulation could successfully produce results similar to those of control frankfurters. The best results were obtained when 10% pork head meat was used to replace pork meat. PMID:27621683

  9. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    OpenAIRE

    DANIELA IANIłCHI; CARMEN NICOLAE; CRISTIANA DIACONESCU; GABRIELA MALOS; I. G. MALOS

    2008-01-01

    Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some...

  10. Nutritional value and fatty acid composition of some traditional Argentinean meat sausages

    OpenAIRE

    Mara Cristina Romero; Ana María Romero; Mirtha Marina Doval; Maria Alicia Judis

    2013-01-01

    The aim of this work was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat) of meat products elaborated in the northeast of Argentina, analyzing fatty acids composition, PUFA/SFA ratio, n-6/n-3 relation, and CLA content. Thirty traditional meat products from different processes were used. Samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage), chorizos (raw sausage), chorizo ahumado (cooked and smoked s...

  11. Effect of irradiated pork on physicochemical properties of meat emulsions

    Science.gov (United States)

    Choi, Yun-Sang; Sung, Jung-Min; Jeong, Tae-Jun; Hwang, Ko-Eun; Song, Dong-Heon; Ham, Youn-Kyung; Kim, Hyun-Wook; Kim, Young-Boong; Kim, Cheon-Jei

    2016-02-01

    The effect of pork irradiated with doses up to 10 kGy on meat emulsions formulated with carboxy methyl cellulose (CMC) was investigated. Raw pork was vacuums packaged at a thickness of 2.0 cm and irradiated by X-ray linear accelerator (15 kW, 5 MeV). The emulsion had higher lightness, myofibrillar protein solubility, total protein solubility, and apparent viscosity with increasing doses, whereas cooking loss, total expressible fluid separation, and hardness decreased. There were no significant differences in fat separation, sarcoplasmic protein solubility, springiness, and cohesiveness. Our results indicated that it is treatment by ionizing radiation which causes the effects the physicochemical properties of the final raw meat product.

  12. Effect of chopping time and heating on 1 H nuclear magnetic resonance and rheological behavior of meat batter matrix.

    Science.gov (United States)

    Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong

    2018-04-01

    The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.

  13. Effect of Selected Alternative Fuels and Raw Materials on the Cement Clinker Quality

    Directory of Open Access Journals (Sweden)

    Strigáč Július

    2015-11-01

    Full Text Available The article deals with the study of the effects of alternative fuels and raw materials on the cement clinker quality. The clinker quality was expressed by the content of two principal minerals alite C3S and belite C2S. The additions of alternative fuels ashes and raw materials, in principle, always increased the belite content and conversely reduced the amount of alite. The alternative fuels with high ash content were used such as the meat-bone meal, sewage sludge from sewage treatment plants and paper sludge and the used alternative raw materials were metallurgical slags - granulated blastfurnace slag, air cooled blastfurnace slag and demetallized steel slag, fluidized bed combustion fly ash and waste glass. Meat-bone meal, sewage sludge from sewage treatment plants and paper sludge were evaluated as moderately suitable alternative fuels which can be added in the amounts of 2.8 wt. % addition of meat-bone meals ash, 3.64 wt. % addition of sewage sludge ash and 3.8 wt. % addition of paper sludge ash to the cement raw mixture. Demetallised steel slag is suitable for production of special sulphate resistant cement clinker for CEM I –SR cement with addition up to 5 wt. %. Granulated blastfurnace slag is a suitable alternative raw material with addition 4 wt. %. Air cooled blastfurnace slag is a suitable alternative raw material with addition 4.2 wt. %. Waste glass is not very appropriate alternative raw material with addition only 1.16 wt. %. Fluidized bed combustion fly ash appears not to be equally appropriate alternative raw material for cement clinker burning with less potential utilization in the cement industry and with addition 3.41 wt. %, which forms undesired anhydrite CaSO4 in the cement clinker.

  14. An improved UPLC method for the detection of undeclared horse meat addition by using myoglobin as molecular marker.

    Science.gov (United States)

    Di Giuseppe, Antonella M A; Giarretta, Nicola; Lippert, Martina; Severino, Valeria; Di Maro, Antimo

    2015-02-15

    In 2013, following the scandal of the presence of undeclared horse meat in various processed beef products across the Europe, several researches have been undertaken for the safety of consumer health. In this framework, an improved UPLC separation method has been developed to detect the presence of horse myoglobin in raw meat samples. The separation of both horse and beef myoglobins was achieved in only seven minutes. The methodology was improved by preparing mixtures with different composition percentages of horse and beef meat. By using myoglobin as marker, low amounts (0.50mg/0.50g, w/w; ∼0.1%) of horse meat can be detected and quantified in minced raw meat samples with high reproducibility and sensitivity, thus offering a valid alternative to conventional PCR techniques. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Potential Biomarker of Myofibrillar Protein Oxidation in Raw and Cooked Ham: 3-Nitrotyrosine Formed by Nitrosation.

    Science.gov (United States)

    Feng, Xianchao; Li, Chenyi; Ullah, Niamat; Hackman, Robert M; Chen, Lin; Zhou, Guanghong

    2015-12-30

    The stability of cured meat products is increased by the protection of its proteins from oxidation by sodium nitrite (NaNO2) during processing. This study investigated the effects of NaNO2 (0, 50, 100, 200, and 400 mg/kg) on the physiochemical and structural characteristics of myofibrillar protein (MP) in raw and cooked ham. The NaNO2 showed a dose-dependent antioxidant effect, by inhibiting carbonyl formation, dityrosine formation, and denaturation of MP, and a nitrosative effect, through the formation of 3-Nitrotyrosine (3-NT). The 3-NT content within MP of raw ham had distinct negative correlations with sulfhydryl content and surface hydrophobicity. The 3-NT content within MP of cooked ham had significantly negative correlations with carbonyl, sulfhydryl content and turbidity and had significantly positive correlations with disulfide content. These results indicated that 3-NT may be a potential marker for protein oxidation in raw and cooked cured meat products.

  16. Vitamin D-3 and 25-hydroxyvitamin D-3 in raw and cooked pork cuts

    DEFF Research Database (Denmark)

    Clausen, Ina; Jakobsen, Jette; Leth, Torben

    2003-01-01

    The contents of vitamin D-3 and its metabolically active metabolite 25-hydroxyvitamin D-3 (25OHD(3)) were examined by HPLC in different parts of four common raw pork cuts (loin boneless, leg inside, thin belly, neck) and in cooked meat (loin boneless). In whole raw pork cuts, varying in fat content......, and that rind, despite its limited fat content, has a high concentration of vitamin D-3 and 25OHD(3). Cooking increased vitamin D-3 and 25OHD(3) calculated per 100 g of tissue in all parts and in the whole cut (in whole cuts in raw and cooked meat, respectively: vitamin D-3: 0.15 (0.08-0.24) mug/100 g and 0...... 25OHD(3) contributes significantly to vitamin D activity. Food databases should include concentrations of both vitamin D and 25OHD(3). (C) 2003 Elsevier Ltd. All rights reserved....

  17. Meat and meat products as a source of bioactive peptides

    Directory of Open Access Journals (Sweden)

    Alfonso Totosaus

    2016-12-01

    Full Text Available Meat is a high protein content food, with great nutritional and biological value. Meat protein hydrolysis begins with the muscle to meat conversion, during meat ageing. After slaughter, endogen enzymes are responsible of meat softening since myofibrillar anchorage proteins are degraded. Protein hydrolysis continues during food preparation. When meat reaches the stomach, pepsin is the first enzyme to interact. As the food travel trough out gastrointestinal tract, pancreatic enzymes degraded the remained protein and the peptidases made the final proteolysis process. The small proteins or peptides are the absorbed to the circulatory system and distributed to the rest of the body. Bioactive peptides activity of meat and meat products is anti-hypertensive mainly, where histidine, carnosine and anserine are the main peptides identified. Another peptide with anti-oxidant activity is glutathione. The content depends on animal species.

  18. Czech Foreign Trade with Meat and Meat Products

    Directory of Open Access Journals (Sweden)

    Karina Pohlová

    2016-04-01

    Full Text Available The meat production and meat processing industry are the most important parts of the agribusiness in the Czech Republic. The problem of the industry is its low competitiveness towards foreign producers and processors which results in negative balance of foreign trade. The aim of the article is to evaluate long-term development of value and structure of Czech foreign trade flows of meat and meat products. The analysis covers the period of 2001–2014. The problems of the negative trade balance are revealed through description of the trade flows of meat and meat products, the RCA index and relations between import and export prices. The analysis points out the problems of low competitiveness of the intermediate and finalized meat. Alternatively, Czech Republic has comparative advantage in live animals, sausages and homogenized meat products.

  19. Halal authenticity issues in meat and meat products.

    Science.gov (United States)

    Nakyinsige, Khadijah; Man, Yaakob Bin Che; Sazili, Awis Qurni

    2012-07-01

    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. A comparative study of functional properties of normal and wooden breast broiler chicken meat with NaCl addition.

    Science.gov (United States)

    Xing, Tong; Zhao, Xue; Han, Minyi; Cai, Linlin; Deng, Shaolin; Zhou, Guanghong; Xu, Xinglian

    2017-09-01

    The selection of broilers for augmented growth rate and breast has brought about wooden-breast (WB) muscle abnormalities, which caused substantial economic losses. The objective of this study was to compare water holding capacity, water mobility and distribution, salt-soluble protein (SSP) content, and protein profiles of normal and WB chicken meat with different additions of NaCl. Thirty WB and 30 normal chicken breasts were selected from a deboning line of a major Chinese processing plant at 2 to 3 h post mortem. Two different meat batters were formulated to 150 mg/g meat protein and different NaCl contents (0%, 1%, 2%, 3%, and 4%). Results indicated that as NaCl contents increased, the cooking loss of meat batters decreased (P meat showed different protein profiles, with myosin heavy chain exhibiting a higher intensity at ≥3% salt level. Low-field nuclear magnetic resonance (LF-NMR)revealed an increased T22 and higher P22 in raw WB meat compared to normal meat (P meat batters, WB meat batters had reduced T21 and lower immobilized water proportions at low NaCl contents (meat gels. Meat gels prepared from WB had a lower proportion of water within the myofibrillar protein matrix and a greater proportion of exuded bulk water at NaCl contents meat, meat batters and gels, water distribution and mobility of WB exhibited significant differences compared to normal meat. The addition of NaCl affected water mobility and distributions in meat batters, with a level of 3% NaCl eliminating the differences between processed normal and WB meat products. © 2017 Poultry Science Association Inc.

  1. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    OpenAIRE

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (p0...

  2. Decarbonising meat : Exploring greenhouse gas emissions in the meat sector

    NARCIS (Netherlands)

    Aan Den Toorn, S. I.; Van Den Broek, M. A.; Worrell, E.

    Consumption of meat is an important source of global greenhouse gas (GHG) emission and deep decarbonisation of the whole meat production chain is required to be able to meet global climate change (CC) mitigation goals. Emissions happen in different stages of meat production ranging from agricultural

  3. Meat and Appetite Regulation

    DEFF Research Database (Denmark)

    Kehlet, Ursula Nana

    effects of new formulations of pork products. Different strategies can be applied to potentially enhance the satiating properties of pork. Processed meat products such as meatballs can serve as a matrix for the addition of fiber ingredients. Based on their high protein and fiber contents, high......-fibre meatballs could provide a dual mechanistic action that would lead to greater satiety. For whole muscles, cooking is known to induce structural, physical and chemical changes of the meat proteins, which in turn may affect protein digestibility and potentially affect satiety. The overall aim of this Ph......D thesis was to investigate the effects of fiber addition to meatballs and the effects of cooking methods of pork on appetite regulation. The PhD thesis is based on three human meal test studies and one analytical study related to the characteristics of fiber meat products. In paper I, the objective...

  4. Ecological safety of meat products

    OpenAIRE

    A. K. Mikhailenko

    2009-01-01

    The level of toxicants was studied, and the biological value of sheep meat in the area of anthropogenic influence was checked up. The level of toxicants in meat depends straight on the age of animals.

  5. [Evaluation of the quality of poultry meat and its processing for vacuum packaging].

    Science.gov (United States)

    Swiderski, F; Russel, S; Waszkiewicz-Robak, B; Cholewińska, E

    1997-01-01

    The aim of study was to evaluate the quality of poultry meat, roasted and smoked chicken and poultry pie packing under low and high vacuum. All investigated products were stored at +4 degrees C and evaluated by microbiological analysis. It was showed that packing under low and high vacuum inhibited development of aerobic microorganisms, proteolytic bacteria, yeasts and moulds. Vacuum-packaged storage of poultry meat and its products stimulated activity of anaerobic, nonsporeforming bacteria. The fast spoilage of fresh poultry meat was observed both under vacuum and conventional storage. The microbiology quality of poultry products depended on technology of production and microbiological quality of raw material.

  6. Sustainability and meat consumption: is reduction realistic?

    NARCIS (Netherlands)

    Dagevos, H.; Voordouw, J.

    2013-01-01

    Meat is critical with respect to sustainability because meat products are among the most energy-intensive and ecologically burdensome foods. Empirical studies of the meat-consumption frequency of Dutch consumers show that, apart from meat-avoiders and meat-eaters, many people are meat-reducers that

  7. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Directory of Open Access Journals (Sweden)

    Monique Zagorec

    2017-09-01

    Full Text Available Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage.

  8. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Science.gov (United States)

    Zagorec, Monique; Champomier-Vergès, Marie-Christine

    2017-01-01

    Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage. PMID:28878171

  9. Comparision of the BAX® System with an in-house MSRV method for the detection of Salmonella in chicken carcasses and pork meat

    OpenAIRE

    Franchin,Paulo R.; Ogliari,Paulo J.; Andrade,Dalton F.; Chiapinoto,Maura; Lemos,Giovana; Rebelatto,Marina; Silva,Ivair G. da; Batista,Cleide R.V.

    2006-01-01

    A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV) method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762) and raw pork meat (n = 566). The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and oth...

  10. Methods and approaches to prediction in the meat industry

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available The modern stage of the agro-industrial complex is characterized by an increasing complexity, intensification of technological processes of complex processing of materials of animal origin also the need for a systematic analysis of the variety of determining factors and relationships between them, complexity of the objective function of product quality and severe restrictions on technological regimes. One of the main tasks that face the employees of the enterprises of the agro-industrial complex, which are engaged in processing biotechnological raw materials, is the further organizational improvement of work at all stages of the food chain, besides an increase in the production volume. The meat industry as a part of the agro-industrial complex has to use the biological raw materials with maximum efficiency, while reducing and even eliminating losses at all stages of processing; rationally use raw material when selecting a type of processing products; steadily increase quality, biological and food value of products; broaden the assortment of manufactured products in order to satisfy increasing consumer requirements and extend the market for their realization in the conditions of uncertainty of external environment, due to the uneven receipt of raw materials, variations in its properties and parameters, limited time sales and fluctuations in demand for products. The challenges facing the meat industry cannot be solved without changes to the strategy for scientific and technological development of the industry. To achieve these tasks, it is necessary to use the prediction as a method of constant improvement of all technological processes and their performance under the rational and optimal regimes, while constantly controlling quality of raw material, semi-prepared products and finished products at all stages of the technological processing by the physico-chemical, physico-mechanical (rheological, microbiological and organoleptic methods. The paper

  11. Polina Fedorova, About Camel Meat

    OpenAIRE

    Gedeeva, Darina; Babaev, Andrei

    2016-01-01

    In the past, the Kalmyks ate beef and horse meat. The poor ate camel meat. People who ate camel meat had pimples on their faces. The camel’s pelt and humps were used to make vessels. The intestines were cleaned, stretched and dried. It was used to make strings for dombra instruments. Arcadia

  12. Effect of antioxidants on thiobarbituric acid reactive substances, psychrotrophic bacteria and functional properties of mechanically deboned chicken meat irradiated with Cobalto-60 and electron beam sources

    Energy Technology Data Exchange (ETDEWEB)

    Brito, Poliana de Paula; Azevedo, Heliana de; Roque, Claudio Vitor; Pomarico Neto, Walter, E-mail: hgomes@cnen.gov.br, E-mail: pbrito@cnen.gov.br, E-mail: cvroque@cnen.gov.br, E-mail: abrusqui@cnen.gov.br [Comissao Nacional de Energia Nuclear (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Laboratorio de Pocos de Caldas; Mourao, Gerson Barreto; Orlando, Eduardo Adilson; Miyagusku, Luciana, E-mail: marciamh@ital.sp.gov.br, E-mail: eduardo.orlando@ital.sp.gov.br [Instituto de Tecnologia dos Alimentos (ITAL), Campinas, SP (Brazil)

    2013-07-01

    Samples of MDCM with skin were divided into three groups: control (without antioxidants), Antioxidant 1 (Sodium Polyphosphate and Sodium Ascorbate and Antioxidant 2 (Rosemary Extract and α-Tocopherol. The three batches of samples were divided into nine groups: no antioxidant and non-irradiated (C), with antioxidant A1 and non-irradiated (A1), with antioxidant A2 and non-irradiated (A2) without antioxidant and irradiated in Cobalt-60 source (Co), with antioxidant A1 irradiated in Cobalt 60 source (A1Co) with antioxidant A2 irradiated in Cobalt-60 source (A2Co) with antioxidant A1 irradiated in Electron beam (A1Eb) and with antioxidant A2 irradiated in Electron beam (A2Eb). The samples was conditioned in a transparent, low density frozen overnight at a temperature of -18 ± 1 deg C in a chamber, and irradiated in this state with a dose of 3.0 kGy, used two sources of radiation: Cobalt-60 (3.1 kGy/h) and electron beam (7.86 kGy/s). After this process, the samples were evaluated during the refrigeration period (2 ± 1 deg C) for 11 days for the following analysis: total psychrotrophic bacteria count and thiobarbituric acid reactive substances (TBARS) and the analysis of functional properties were performed after the irradiation process. The use of the combination of rosemary antioxidant and α-tocopherol were able to significantly decrease TBARS values caused by the irradiation of samples in MDCM cobalt-60 sources and electron beam, and show a synergetic effect to processing with ionizing radiation to reduce of psychrotrophic bacteria count. The use of irradiation processing of MDCM did not negatively affect the functional properties studied. (author)

  13. Effect of antioxidants on thiobarbituric acid reactive substances, psychrotrophic bacteria and functional properties of mechanically deboned chicken meat irradiated with Cobalto-60 and electron beam sources

    International Nuclear Information System (INIS)

    Brito, Poliana de Paula; Azevedo, Heliana de; Roque, Claudio Vitor; Pomarico Neto, Walter

    2013-01-01

    Samples of MDCM with skin were divided into three groups: control (without antioxidants), Antioxidant 1 (Sodium Polyphosphate and Sodium Ascorbate and Antioxidant 2 (Rosemary Extract and α-Tocopherol. The three batches of samples were divided into nine groups: no antioxidant and non-irradiated (C), with antioxidant A1 and non-irradiated (A1), with antioxidant A2 and non-irradiated (A2) without antioxidant and irradiated in Cobalt-60 source (Co), with antioxidant A1 irradiated in Cobalt 60 source (A1Co) with antioxidant A2 irradiated in Cobalt-60 source (A2Co) with antioxidant A1 irradiated in Electron beam (A1Eb) and with antioxidant A2 irradiated in Electron beam (A2Eb). The samples was conditioned in a transparent, low density frozen overnight at a temperature of -18 ± 1 deg C in a chamber, and irradiated in this state with a dose of 3.0 kGy, used two sources of radiation: Cobalt-60 (3.1 kGy/h) and electron beam (7.86 kGy/s). After this process, the samples were evaluated during the refrigeration period (2 ± 1 deg C) for 11 days for the following analysis: total psychrotrophic bacteria count and thiobarbituric acid reactive substances (TBARS) and the analysis of functional properties were performed after the irradiation process. The use of the combination of rosemary antioxidant and α-tocopherol were able to significantly decrease TBARS values caused by the irradiation of samples in MDCM cobalt-60 sources and electron beam, and show a synergetic effect to processing with ionizing radiation to reduce of psychrotrophic bacteria count. The use of irradiation processing of MDCM did not negatively affect the functional properties studied. (author)

  14. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    Directory of Open Access Journals (Sweden)

    Silvius STANCIU

    2013-06-01

    Full Text Available Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appeared lately. Lack of safety measures in the field can affect business continuity critically, creating significant losses.

  15. High Seroprevalence of Leptospira Exposure in Meat Workers in Northern Mexico: A Case-Control Study

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernandez-Tinoco, Jesus; Sanchez-Anguiano, Luis Francisco; Ramos-Nevarez, Agar; Cerrillo-Soto, Sandra Margarita; Saenz-Soto, Leandro; Martinez-Ramirez, Lucio

    2016-01-01

    Background The seroepidemiology of Leptospira infection in workers occupationally exposed to raw meat has been poorly studied. This work aimed to determine the association between Leptospira exposure and the occupation of meat worker, and to determine the seroprevalence association with socio-demographic, work, clinical and behavioral characteristics of the meat workers studied. Methods We performed a case-control study in 124 meat workers and 124 age- and gender-matched control subjects in Durango City, Mexico. Sera of cases and controls were analyzed for anti-Leptospira IgG antibodies using a commercially available enzyme immunoassay. Data of meat workers were obtained with the aid of a questionnaire. The association of Leptospira exposure with the characteristics of meat workers was analyzed by bivariate and multivariate analyses. Results Anti-Leptospira IgG antibodies were found in 22 (17.7%) of 124 meat workers and in eight (6.5%) of 124 controls (OR = 3.12; 95% CI: 1.33 - 7.33; P = 0.006). Seroprevalence of Leptospira infection was similar between male butchers (17.6%) and female butchers (18.2%) (P = 1.00). Multivariate analysis of socio-demographic, work and behavioral variables showed that Leptospira exposure was associated with duration in the activity, rural residence, and consumption of snake meat and unwashed raw fruits. Conclusions This is the first case-control study of the association of Leptospira exposure with the occupation of meat worker. Results indicate that meat workers represent a risk group for Leptospira exposure. Risk factors for Leptospira exposure found in this study may help in the design of optimal preventive measures against Leptospira infection. PMID:26858797

  16. Effect of antioxidants on thiobarbituric acid reactive substances of mechanically de boned chicken meat irradiated with ionizing radiation: cobalt-60 and electron beam sources

    International Nuclear Information System (INIS)

    Brito, Poliana de Paula; Azevedo, Heliana de; Pomarico Neto, Walter; Roque, Claudio Vitor; Brusqui, Armando Luiz; Haguiwara, Marcia Mayumi Harada; Miyagusku, Luciana

    2011-01-01

    Samples of MDCM with skin were divided into three groups: control (without antioxidants), Antioxidant 1 - A1 (0.3% Sodium Polyphosphate and Sodium Erythorbate 0.05%) and Antioxidant 2 - A2 (Rosemary Extract 0.02% and α-Tocopherol 0.01%). The three batches of samples were divided into nine groups: no antioxidant and non-irradiated (Cn/I), with antioxidant A1 and non-irradiated (A1n/I), with antioxidant A2 and non-irradiated (A2n/I) without antioxidant and irradiated in Cobalt-60 source (CCo), with antioxidant A1 irradiated in Cobalt 60 source (A1Co) with antioxidant A2 irradiated in Cobalt-60 source (A2Co) with antioxidant A1 irradiated in Electron beam (A1Eb) and with antioxidant A2 irradiated in Electron beam (A2Eb). Each 100 g sample was conditioned in a transparent, low density polyethylene oxygen permeable bag, frozen overnight at a temperature of -18 +- 1 deg C in a chamber, and irradiated in this state, maintaining the temperature low with dry ice. The samples were irradiated with a dose of 3.0 kGy, used two sources of radiation: Cobalt-60 (3.1 kGy.h -1 ) and electron beam (2.9 kGy.s -1 ). After this process, the samples were evaluated during the refrigeration period (2 +- 1 deg C) for 11 days for the following analysis: total psychotropic bacteria count, thiobarbituric acid reactive substances (TBARS). The addition of antioxidants was able to reduce lipid oxidation caused by the irradiation. There were no differences between the radiation sources used in the same parameters. The better antioxidants mixture in the TBARS reducing it was rosemary extract and α-tocopherol (A2). (author)

  17. Effect of antioxidants on thiobarbituric acid reactive substances of mechanically de boned chicken meat irradiated with ionizing radiation: cobalt-60 and electron beam sources

    Energy Technology Data Exchange (ETDEWEB)

    Brito, Poliana de Paula; Azevedo, Heliana de; Pomarico Neto, Walter; Roque, Claudio Vitor; Brusqui, Armando Luiz, E-mail: hgomes@cnen.gov.b, E-mail: pbrito@cnen.gov.b, E-mail: cvroque@cnen.gov.b, E-mail: abrusqui@cnen.gov.b [Brazilian Nuclear Energy Commission (LAPOC/CNEN), Pocos de Caldas, MG (Brazil); Haguiwara, Marcia Mayumi Harada; Miyagusku, Luciana, E-mail: marciamh@ital.gov.b, E-mail: lucianam@ital.gov.b [Food Technology Institute (ITAL), SP (Brazil). Meat Technology Center

    2011-07-01

    Samples of MDCM with skin were divided into three groups: control (without antioxidants), Antioxidant 1 - A1 (0.3% Sodium Polyphosphate and Sodium Erythorbate 0.05%) and Antioxidant 2 - A2 (Rosemary Extract 0.02% and {alpha}-Tocopherol 0.01%). The three batches of samples were divided into nine groups: no antioxidant and non-irradiated (Cn/I), with antioxidant A1 and non-irradiated (A1n/I), with antioxidant A2 and non-irradiated (A2n/I) without antioxidant and irradiated in Cobalt-60 source (CCo), with antioxidant A1 irradiated in Cobalt 60 source (A1Co) with antioxidant A2 irradiated in Cobalt-60 source (A2Co) with antioxidant A1 irradiated in Electron beam (A1Eb) and with antioxidant A2 irradiated in Electron beam (A2Eb). Each 100 g sample was conditioned in a transparent, low density polyethylene oxygen permeable bag, frozen overnight at a temperature of -18 +- 1 deg C in a chamber, and irradiated in this state, maintaining the temperature low with dry ice. The samples were irradiated with a dose of 3.0 kGy, used two sources of radiation: Cobalt-60 (3.1 kGy.h{sup -1}) and electron beam (2.9 kGy.s{sup -1}). After this process, the samples were evaluated during the refrigeration period (2 +- 1 deg C) for 11 days for the following analysis: total psychotropic bacteria count, thiobarbituric acid reactive substances (TBARS). The addition of antioxidants was able to reduce lipid oxidation caused by the irradiation. There were no differences between the radiation sources used in the same parameters. The better antioxidants mixture in the TBARS reducing it was rosemary extract and {alpha}-tocopherol (A2). (author)

  18. an intermediate moisture meat

    African Journals Online (AJOL)

    Bunmi

    A total of 50 sticks of Suya weighing from 38.10 - 59.30 grams of sliced meat per stick were prepared for .... prolong shelflife and provide a natural alternative (or supplement) to chemical preservatives. Its antimicrobial ... Although O. gratissimum appears safe to use in both food and as medicine, its level of inclusion in food.

  19. MARKET CHOICES FOR BROILER CHICKEN MEAT IN THE OPINION

    Directory of Open Access Journals (Sweden)

    Anna Augustyńska-Prejsnar

    2014-09-01

    Full Text Available Recently there has, been growing a increase in consumption of poultry meat in Poland. The most important material for slaughter poultry are broilers. Among factors that influence rising demand for poultry meat are: low price, availability of raw materials and promotional campaigns of safe nutrition. Its nutritional and sensory value makes it a choice product. University students are a specific group that has aroused the interest of nutritionists. The students’ lifestyle is characterised by high active social life and intense responsibilities, which ought to be augmented with a carefully chosen diet. The youth do not only have significant impact on the family purchasing decisions but display a strong purchasing power due to financial resources at their disposal and would in the future become mature and rational consumers. The article lists factors that determine purchasing needs, reasons for choice of markets and the consumption frequency of broiler meat. The feeling of lack of other products coupled with current sales promotions were, in the opinion of the students surveyed, often responsible for the decision to purchase of broiler chicken meat. Low price and the ease of preparation were also key reasons for the choice of this meat product. Responding students noted that skinless chicken breast fillet was most commonly consumed.

  20. Detection of Salmonella in Meat

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, Flemming; Mansdal, Susanne

    2012-01-01

    Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective of this study was to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab samples...... obtained (SP, SE, and AC were 100, 95, and 97%, respectively). This test is under implementation by the Danish meat industry, and can be useful for screening of large number of samples in the meat production, especially for fast release of minced meat with a short shelf life....

  1. Quantitative Analysis of Micro-Structure in Meat Emulsions from Grating-Based Multimodal X-Ray Tomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2013-01-01

    Using novel X-ray techniques, based on grating-interferometry, new imaging modalities can be obtained simultaneously with absorption computed tomography (CT). These modalities, called phase contrast and dark field imaging, measure the electron density and the diffusion length of the sample....... Enhanced contrast capabilities of this X-ray technique makes studies on materials with similar attenuation properties possible. In this paper the focus is set on processing grating-based X-ray tomograms of meat emulsions to quantitatively measure micro-structural changes due to heat treatment. The emulsion...... samples were imaged both in a raw and cooked state. Additionally, different fat types were used in the emulsions in order to compare micro-structural differences when either pork fat or sunflower oil was used. From the reconstructed tomograms the different ingredients in the emulsions were segmented using...

  2. Single-walled carbon nanotube/metalloporphyrin composites for the chemiresistive detection of amines and meat spoilage.

    Science.gov (United States)

    Liu, Sophie F; Petty, Alexander R; Sazama, Graham T; Swager, Timothy M

    2015-05-26

    Chemiresistive detectors for amine vapors were made from single-walled carbon nanotubes by noncovalent modification with cobalt meso-arylporphyrin complexes. We show that through changes in the oxidation state of the metal, the electron-withdrawing character of the porphyrinato ligand, and the counteranion, the magnitude of the chemiresistive response to ammonia could be improved. The devices exhibited sub-ppm sensitivity and high selectivity toward amines as well as good stability to air, moisture, and time. The application of these chemiresistors in the detection of various biogenic amines (i.e. putrescine, cadaverine) and in the monitoring of spoilage in raw meat and fish samples (chicken, pork, salmon, cod) over several days was also demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Lead, cadmium and chromium in raw and boiled portions of Norway lobster.

    Science.gov (United States)

    Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele

    2014-01-01

    Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.

  4. Consumer attitudes to meat eating.

    Science.gov (United States)

    Richardson, N J; Macfie, H J; Shepherd, R

    1994-01-01

    This study reports on current meat consumption in the UK and the factors that are percieved by the subjects to be influential in their choice of diet. A random sample of individuals from the population (n-1018) were questioned on their consumption and attitudes towards meat by a postal survey. The study revealed that 28·3% of the population considered themselves to be reducing meat consumption; attitudes found to be determinant in changes in the consumption of meat were healthiness, taste and concerns over additives. Hypothetical future events were found to affect people's estimated meat-eating. Knowledge of meat-related information was investigated with specific reference to the respondents' trust in the various sources used; food package labels were found to be an influential source of meat-related information. Copyright © 1993. Published by Elsevier Ltd.

  5. Raw materials for aluminium production

    International Nuclear Information System (INIS)

    Galushkin, N.V.

    1995-01-01

    This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.

  6. Survival of experimentally induced Toxoplasma gondii tissue cysts in vacuum packed goat meat and dry fermented goat meat sausages.

    Science.gov (United States)

    Neumayerová, Helena; Juránková, Jana; Saláková, Alena; Gallas, Leo; Kovařčík, Kamil; Koudela, Břetislav

    2014-05-01

    Ingestion of raw or undercooked meat is a potential source of human toxoplasmosis. The aim of this study was to determine the viability of Toxoplasma gondii cysts in vacuum packed (VP) goat meat and in dry fermented sausages (DFS), and evaluate certain physical and chemical parameters, like water activity (aw), pH value, content of salt, dry matter and fat. A portion of muscle tissue from experimentally infected animals was used for production of VP meat with or without addition of 2.5% curing salt, and stored at 4 °C or at -20 °C. Results of bioassay showed that, samples of vacuum packed Toxoplasma positive meat without salt addition were alive after six weeks at 4 °C. Incubation at -20 °C supported the viability after 3 h, but not after 4 h. After 7 days in 2.5% of curing salt, samples of T. gondii VP goat meat were still viable, but not after 14 days at 4 °C. All the DFS samples were not positive for infective cysts which mean that, they do not pose a risk of T. gondii transmission. These data suggest that vacuum packaging increases the survival of T. gondii cysts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Total arsenic in raw and boiled portions of Norway lobster (Nephrops norvegicus) from the central Adriatic Sea.

    Science.gov (United States)

    Visciano, Pierina; Perugini, Monia; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Salese, Carmine; Amorena, Michele

    2013-12-18

    The distribution of total arsenic in different portions of Norway lobster (Nephrops norvegicus L., Crustacea) was studied both in fresh samples and after a boiling process. All individuals (n = 80) were selected of medium standard commercial size (13-15 cm). The highest mean concentrations (26.86 ± 1.57 mg/kg wet weight (ww)) were found in the raw brown meat of the crustacean, probably due to its detoxification role, whereas the lowest mean values (15.97 ± 0.85 mg/kg ww) were in the raw exoskeleton. The raw white meat reported mean values of 16.09 ± 0.61 mg/kg ww. The levels of arsenic contamination detected in the boiled portions showed a significant (p < 0.01) decrease compared to the raw portions, as a consequence of solubilization phenomena. In fact, a large amount of arsenic from raw lobsters was transferred to the corresponding boiling broth. In the most commonly consumed portion, the white meat, only slight losses (7.22%) in total arsenic content were observed compared to the raw portion.

  8. OZONE ABSORPTION IN RAW WATERS

    Directory of Open Access Journals (Sweden)

    LJILJANA TAKIĆ

    2008-03-01

    Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.

  9. Raw Materials Market of China

    Directory of Open Access Journals (Sweden)

    Dmitry Alexandrovich Izotov

    2013-12-01

    Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore

  10. Religiosity Aspect in Consumer Behaviour: Determinants of Halal Meat Consumption

    Directory of Open Access Journals (Sweden)

    Jusmaliani

    2009-06-01

    Full Text Available Previous studies indicate that religion may influence consumer attitude and behavior in general, especially in food purchasing decisions and eating habits. There are limited studies that examined the role of religiosity in consumer behaviour; especially in relations to halal meat consumption. Due to gaps found in the literature, this study investigates the determinants of intention to eat halal meat. It also examines the levels of determinants of halal meat consumption between Indonesian Muslim living in Jakarta and Melbourne. Respondents were personally and electronically contacted. In total, 160 questionnaires were completed for this initial study. The results indicate that behavioural control and availability of halal meat have significant impact on intention to eat halal meat. The results further suggest that in general there are no significant differences in the levels of determinants of halal meat consumption between Indonesian Muslim living in Jakarta compared to those of in Melbourne, except for availability of halal meat. This study contributes to the marketing literature focuses on the impacts of religion on consumer behaviour which is still under researched.

  11. Comparison of quality attributes of buffalo meat curry at different storage temperature.

    Science.gov (United States)

    Kandeepan, Gurunathan; Anjaneyulu, Anne Seet Ram; Kondaiah, Napa; Mendiratta, Sanjod Kumar

    2011-01-01

    The product quality of curry is determined by the food animal source, raw materials and the method of processing. Moreover the scientific information on processing and quality of traditional buffalo meat curry from different groups of buffaloes is not available. This study was undertaken to develop processed curry from different buffalo groups and to compare its quality during storage at ambient and refrigeration temperature. The meat samples were collected from the longissimus dorsi muscle of the carcasses from each group of buffaloes slaughtered according to the traditional halal method. Buffalo meat curry was prepared in a pressure cooker with the standardized formulation. This final product was subjected to evaluation of quality and shelf life. To evaluate the effect of different groups of meat samples on the quality of curry, product yield, pH, proximate composition, water activity (aw), thiobarbituric acid reactive substances (TBARS), calorific value, sensory attributes and microbiological assay were determined The energy of meat curry from young buffaloes was significantly lower than the meat curry from spent animal groups. The overall acceptability of curry decreased significantly during 3 days ambient storage compared to refrigeration storage. Scientific processing by adopting good manufacturing practices and suitable packaging helped greatly to improve the shelf life of the ambient temperature stored buffalo meat curry. Buffalo meat curry from young male group showed better product characteristics and overall acceptability scores than spent buffalo group.

  12. Development and validation of a rapid test system for detection of pork meat and collagen residues.

    Science.gov (United States)

    Masiri, J; Benoit, L; Barrios-Lopez, B; Thienes, C; Meshgi, M; Agapov, A; Dobritsa, A; Nadala, C; Samadpour, M

    2016-11-01

    Mislabeling, contamination, and economic adulteration of meat products with undeclared pork tissues are illegal under regulations promulgated by numerous regulatory agencies. Nonetheless, analysis of the European meat industry has revealed pervasive meat adulteration, necessitating more extensive application of meat authentication testing. As existing methods for meat speciation require specialized equipment and/or training, we developed a detection system based on a lateral flow device (LFD) assay format capable of rapidly (~35min) identifying porcine residues derived from raw meat, cooked meat, and gelatin down to 0.01%, 1.0%, and 2.5% contamination, respectively. Specificity analysis revealed no cross-reactivity with meat derived from chicken, turkey, horse, beef, lamb, or goat. Comparison with a commercial ELISA kit and PCR method revealed similar if not improved sensitivity, with the added feature that the LFD-based system required considerably less time to perform. Accordingly, this test system should aid the food industry and food control authorities in monitoring for adulteration with pork. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. COLD CHAIN MANAGEMENT IN MEAT SUPPLY: «OLD» AND NOVEL STRATEGIES

    Directory of Open Access Journals (Sweden)

    I. Nastasijevic

    2017-01-01

    Full Text Available Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP, active packaging, wireless sensors, supported with the software-based cold chain database (CCD.

  14. Nutritional profiling of Eurasian woodcock meat: chemical composition and myoglobin characterization.

    Science.gov (United States)

    Landi, Nicola; Ragucci, Sara; Di Giuseppe, Antonella Ma; Russo, Rosita; Poerio, Elia; Severino, Valeria; Di Maro, Antimo

    2018-04-10

    Meat from birds is a rich source of proteins for the human diet. In this framework, Eurasian woodcock (Scolopax rusticola L.), a medium-small wading bird hunted as game in many Eurasian countries, is considered one of the best meats for culinary purposes. Since the nutritional composition of Eurasian woodcock meat has not yet been reported, we decided to determine the nutritional profile of S. rusticola meat. Macronutrient components (proteins, lipids and fatty acids) were determined, as well as free and total amino acids, and compared with those of the common pheasant. Eurasian woodcock meat contains high levels of proteins and essential amino acids. The levels of unsaturated fatty acids represent a great contribution to the total lipid amount. Among polyunsaturated fatty acids, linoleic acid (C18:2, n-6) is the major essential fatty acid. Finally, we report the characterization of myoglobin (Mb) from Eurasian woodcock. The data revealed that meat from this bird could be a good source of quality raw proteins because of its amino acid composition, and it had a low lipid content. On the other hand, Mb characterization might be of benefit to the meat industry, by providing useful information for the determination of species-specific differences in meat from birds. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  15. Cold chain management in meat storage, distribution and retail: A review

    Science.gov (United States)

    Nastasijević, I.; Lakićević, B.; Petrović, Z.

    2017-09-01

    Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP), active packaging, wireless sensors, supported with the software-based cold chain database (CCD).

  16. Effects of goat milk or milk replacer diet on meat quality and fat composition of suckling goat kids.

    Science.gov (United States)

    Bañón, S; Vila, R; Price, A; Ferrandini, E; Garrido, M D

    2006-02-01

    The effects of a diet with goat milk "GM" or milk replacer "MR" on the meat quality and fat composition of suckling Murciano-Granadina kids were studied. MR consisted of powdered skimmed milk, coconut oil and fat, and cereal products and by-products. Raw meat quality (moisture, protein, lipids, ash, collagen, cholesterol, haem pigments, CIELab colour, pH and water retention capacity), fatty acid "FA" composition and eating quality of cooked meat (odour, flavour and texture) were determined. Diet had only a slight effect on raw meat quality but had a pronounced effect on fatty acid composition and eating quality of cooked meat. MR diet increased the water/protein proportion in the muscle. The saturated/unsaturated FA ratio in GM and MR fat was 0.94 and 2.27, respectively. The major FA in GM and MR fat were C16:0 and C18:1, respectively. Short-chain C4-C12 hardly accumulated in the adipose tissue of suckling kid, increasing the relative percentages of C14-C20. This effect was more pronounced in MR fat, due to the fact that MR contained more short-chain fatty acids than GM. MR diet gave cooked meat a more intense characteristic goat meat odour and flavour, more tenderness and more juiciness than the natural suckling diet. This fact could be related to differences in meat and fat composition.

  17. “Fish, chicken, lean meat and eggs can be eaten daily”: a food ...

    African Journals Online (AJOL)

    2013-04-09

    Apr 9, 2013 ... meat and eggs, constitute high-quantity and high-quality protein, as they contain essential ... Food (per 100 g, raw, edible portion). Fat. SFAs. MUFAs. PUFAs n-3 .... milk.27 The naturally present fibres, phytates, oxalates and.

  18. Effect of probiotics on broiler meat quality | Kabir | African Journal of ...

    African Journals Online (AJOL)

    The study was carried out on “Hubbard Isa Starbo” broilers to evaluate the raw meat quality of both probiotics and conventional fed broilers in pre-freezing condition and ... The groups C and D were taken as control birds and were fed with commercial ration and the groups A and B as experimental birds which were fed with ...

  19. Radurization of fowl meat

    International Nuclear Information System (INIS)

    Gel'fand, S.

    1974-01-01

    The effects of pre-slaughter adrenalization and of treatment with additives of semifinished poultry products were studied with a view to improving the storage quality of irradiated poultry. It was found that pre-slaughter adrenalization, pre-irradiation treatment with phosphates and, particularly, a combination of these two methods considerably delayed the formation of carbonyl compounds, the delay being somewhat greater in white meat. (E.T.)

  20. Gamma irradiation of meat

    International Nuclear Information System (INIS)

    Whitburn, K.D.; Hoffman, M.Z.; Taub, I.A.

    1982-01-01

    In ''A Re-Evaluation of the Products of Gamma Irradiation of Beef Ferrimyoglobin'', J. Food Sci. 46:1814 (1981), authors Whitburn, Hoffman and Taub state that color pigment myoglobin (Mb) undergoes chemical changes during irradiation that cause color changes in meat. They also state that they are in disagreement with Giddings and Markakis, J. Food Sci. 47:361 (1972) in regard to generation of MbO 2 in deaerated solutions, claiming their analysis demonstrates only Mb and Mb(IV) production. Giddings, in a letter, suggests that Whitburn, et al may have used differing systems and approaches which critically changed the radiation chemistry. He also states that radiation sterilization of aerobically packaged meats affects color only slightly. Whitburn, in a reply, shares Dr. Giddings concern for caution in interpretation of results for this system. The compositional changes are dependent on identity of free radicals, dose, O 2 and the time of analysis after irradiation. The quantification of these parameters in pure systems, sarcoplasma extracts and in meat samples should lead to a better understanding of color change mechanisms and how to minimize them

  1. Dietary exposure to short- and medium-chain chlorinated paraffins in meat and meat products from 20 provinces of China.

    Science.gov (United States)

    Huang, Huiting; Gao, Lirong; Zheng, Minghui; Li, Jingguang; Zhang, Lei; Wu, Yongning; Wang, Runhua; Xia, Dan; Qiao, Lin; Cui, Lili; Su, Guijin; Liu, Wenbin; Liu, Guorui

    2018-02-01

    Food intake is one of the main pathways of human exposure to chlorinated paraffins (CPs). This study assessed the dietary exposure for the general Chinese population to short-chain chlorinated paraffin (SCCPs) and medium-chain chlorinated paraffins (MCCPs) through meat and meat products. Twenty samples of meat and meat products from 20 Chinese provinces were collected in 2011. As the sampling sites covered about two-thirds of the Chinese population, the meat samples were considered to be representative of the true characteristics of CPs contamination in Chinese meat products. The concentrations of SCCPs and MCCPs in the meat samples were measured using the comprehensive two-dimensional gas chromatography electron capture negative ionization high-resolution time-of-flight mass spectrometry method. Forty-eight SCCP and MCCP homolog groups were detected in the meat samples. The mean SCCP and MCCP concentrations in all meat samples were 129 ± 4.1 ng g -1 wet weight and 5.7 ± 0.59 ng g -1 wet weight, respectively. The concentrations of SCCPs and MCCPs varied in samples from different provinces. The geographical distribution of CP concentrations was similar to the distribution of CPs manufacturing plants in China. The most abundant groups of SCCPs in all samples were C 10-11 Cl 6-7 , and the most abundant groups of MCCPs in most samples were C 14 Cl 7-8 . The possible sources of SCCPs and MCCPs in meat and meat products might be CP-42 and CP-52. The 50th percentile estimated daily intakes of SCCPs and MCCPs through meat consumption for a "standard" Chinese adult male were 0.13 and 0.0047 μg kg -1 bw d -1 , respectively, both much lower than the tolerable daily intakes (TDIs) for SCCPs and MCCPs. This preliminary risk assessment has indicated that the indirect exposure of SCCPs and MCCPs through meat consumption does not pose significant risk to human health in China. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. THE IMPORTANCE OF BACTERIOCINS IN MEAT AND MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    Meltem SERDAROĞLU

    2000-03-01

    Full Text Available There is an increasing consumer demand for food products which are free of chemical additives, reduced in salt and processed as little as possible. These minimally processed foods require special application to assure their microbiological safety. The use of microorganisms and enzymes for food preservatives is called biopreservation. The most important group of microorganisms with antimicrobial effect used in the production of foods is the lactic acid bacteria. In meats although lactic acid bacteria constitue apart of the initial microflora, they become dominant during the processing of meats. In this research bacteriocins of lactic acid bacteria and their usage in meat and meat products for biopreservation are discussed.

  3. QUALITY CONTROL OF SOME TRADITIONAL MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    S. DOBRINAS

    2014-03-01

    Full Text Available In this paper, we present the characterization of six traditional meat products: smoked file, smoked bacon, pork sausages, sausage prepared from swine’s entrails, pork pastrami, sheep sausages. Organoleptic tests (the aspect and shape, the aspect of freshly cut in the section, smell, taste and consistency, physico-chemical and microbiological determinations (NTG, Salmonella, Listeria monocytogenes and Escherichia coli were performed. These analyzes are a part of quality control that must be done in order to obtain a certificate from the Ministry of Agriculture for a traditional product. After identification of H2S and starch and according to fat oxidation degree it was concluded that analyzed samples didn’t contain counterfeiters and all parameters analyzed are within the maximum limits allowed by law. Considering all the procedures for manufacturing, characteristics of raw and auxiliary materials, organoleptic properties of final products analyzed in this study, it can be concluded that analyzed meat specialties meet the requirements of Ministry Order no. 690/28.09.2004 for the traditional products certification.

  4. International red meat trade.

    Science.gov (United States)

    Brester, Gary W; Marsh, John M; Plain, Ronald L

    2003-07-01

    The maturation of the US beef and pork markets and increasing consumer demands for convenience, safety, and nutrition suggests that the beef and pork industries must focus on product development and promotion. New marketing arrangements are developing that help coordinate production with consumer demands. The relative high levels of incomes in the United States are likely to increase the demands for branded products rather than increase total per capita consumption. Foreign markets represent the greatest opportunity for increased demand for commodity beef and pork products. Increasing incomes in developing countries will likely allow consumers to increase consumption of animal-source proteins. Real prices of beef and pork have declined substantially because of sagging domestic demand and increasing farm-level production technologies. Increasing US beef and pork exports have obviated some of the price declines. Pork attained a net export position from a quantity perspective in 1995. The United States continues to be a net importer of beef on a quantity basis but is close to becoming a net exporter in terms of value. By-products continue to play a critical role in determining the red meat trade balance and producer prices. The United States, however, must continue to become cost, price, and quality competitive with other suppliers and must secure additional market access if it is to sustain recent trade trends. Several trade tensions remain in the red meat industry. For example, mandated COOL will undoubtedly have domestic and international effects on the beef and pork sectors. Domestically, uncertainty regarding consumer demand responses or quality perceptions regarding product origin, as well as added processor-retailer costs will be nontrivial. How these factors balance out in terms of benefits versus costs to the industry is uncertain. From an international perspective, some beef and pork export suppliers to the United States could view required labeling as a

  5. Identification of new food alternatives: how do consumers categorize meat and meat substitutes?

    NARCIS (Netherlands)

    Hoek, A.C.; Boekel, van M.A.J.S.; Voordouw, J.; Luning, P.A.

    2011-01-01

    New meat substitutes need to be recognized as alternatives to meat. We therefore investigated which category representations consumers have of meat and meat substitutes. Thirty-four non-vegetarian participants performed a free sorting task with 17 meat products and 19 commercially available meat

  6. Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA.

    Science.gov (United States)

    Thapaliya, Dipendra; Forshey, Brett M; Kadariya, Jhalka; Quick, Megan K; Farina, Sarah; O' Brien, Ashley; Nair, Rajeshwari; Nworie, Amos; Hanson, Blake; Kates, Ashley; Wardyn, Shylo; Smith, Tara C

    2017-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of infectious disease morbidity and mortality. Previous studies have confirmed the presence of S. aureus, including MRSA, on raw meat products. We investigated the prevalence and molecular epidemiology of S. aureus and MRSA in commercially-distributed antibiotic-free and conventional raw meat products (n = 3290) purchased in 8 Iowa retail stores weekly for a period of one year. Isolates were characterized using spa typing, and PCR was used to detect the presence of the Panton-Valentine leukocidin (PVL) and mecA genes. Quantitation of S. aureus on meat products was carried out one week per month. The prevalence of S. aureus on meat samples was 27.8% (913/3290). Compared to antibiotic-free meat samples, higher prevalence of both MRSA and methicillin-susceptible S. aureus (MSSA) were found in conventional meat samples. Among the S. aureus isolates, 18 were PVL-positive (1.9%) and 41 (4.5%) carried mecA. Phenotypic oxacillin resistance was observed for 17.1% (41/239) of the isolates tested, while 23% (55/239) were multi-drug resistant. A total of 132 spa types were detected from 913 contaminated meat samples. Overall, t002 was the most common spa type identified (137; 15.0%). The number of colony-forming units (CFU) per 10 g meat ranged from 2 to 517 (median: 8 CFU per 10 g of meat; mean: 28) with the highest bacterial load observed on turkey samples. These data reinforce the need to consider meat products as potential vehicles of S. aureus transmission from farm into human households, and the potential need for public health intervention programs pre and post-slaughter in meat processing facilities. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. PENGARUH BERBAGAI KECAMBAH KACANG-KACANGAN LOKAL SEBAGAI BAHAN DASAR MEAT ANALOG TERHADAP SIFAT FISIK (TEKSTUR, KESUKAAN DAN RASIO ARGININ/LISIN

    Directory of Open Access Journals (Sweden)

    Bayu Kanetro

    2013-06-01

    Full Text Available The aims of this research were to determine the best of local legume sprout as raw material of meat analog, based on its texture, sensory (preference properties, and the ratio of arginine/lysine, compared to meat analog from soybean. Meat analogs were made of protein of local legumes sprout, which were velvet beans, cowpeas, and winged beans that had been germinated for 48, 36 and 24 hr respectively. The protein of velvet beans, cowpeas, and winged beans sprout for meat analog production were extracted at pH 9 and precipitated at pH 4, 5, and 5 respectively. Hence their products were analyzed the texture, the sensory properties (the hedonic scales of color, texture, odor, taste, and overall, and the ratio of arginine/lysine. The characteristics of meat analog from the legumes sprout were compared to meat analog from soybean for determination of the best legume sprout as raw material of meat analog. The result of this research showed the properties of meat analog from winged bean and cowpeas sprouts were better than velvet beans sprout. The meat analog from soybean was still better than meat analog from the local legumes sprout, especially its texture. The arginine content, that was known as  hypocholesterolemic and hypoglycemic component,  of meat analog from cowpeas sprout was lower than meat analog from soybean, but its ratio of arginie/lysine was not signifi cantly different. While the ratio of arginine/lysine of meat analog from the other legumes sprout were lower than meat analog from soybean. Therefore the meat analog from cowpeas sprout was chosen as the best product and was potential as functional food especially for reducing blood cholesterol. Keywords: Meat analog, sprout, local legumes, arginine/lysine ratio   ABSTRAK Tujuan penelitian ini adalah untuk menentukan jenis kecambah kacang-kacangan lokal terbaik sebagai bahan baku kedelai berdasarkan tekstur, sifat sensoris, dan rasio arginin/lisin dibandingkan meat analog dari biji

  8. Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

    Science.gov (United States)

    Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

    2008-10-01

    The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

  9. Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira

    2013-12-01

    Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

  10. Bacterial spoilage of meat and cured meat products

    NARCIS (Netherlands)

    Borch, E.; Kant-Muermans, M.L.T.; Blixt, Y.

    1996-01-01

    The influence of environmental factors (product composition and storage conditions) on the selection, growth rate and metabolic activity of the bacterial flora is presented for meat (pork and beef) and cooked, cured meat products. The predominant bacteria associated with spoilage of refrigerated

  11. Meat and Meat Product Consumption among Infants in Latvia

    Directory of Open Access Journals (Sweden)

    Širina Inga

    2017-12-01

    Full Text Available Meat consumption during the first year of life is especially important to provide necessary iron requirements. The aim of the study was to assess meat and meat product consumption of Latvian infants during their first year of life, in relation to different factors. Data were collected by interview method using two types of questionnaires: food frequency questionnaires and food diary. The study included a representative sample of infants and toddlers from all regions of Latvia with a target sample of 560 participants. The study included 266 infants: 127 girls, 139 boys, aged from 0 to 12 month. Data were summarised using the Excel software and analysed using the SPSS software. For data analysis two age groups were created: 0–5.9 months and 6–12 months. Consumption was analysed by two parameters: frequency and amount per feeding. Meat products were defined as offal products, sausages, and meat in baby food. Meat was mainly consumed after 6 months of age and by 73% of infants (n = 107. Meat from baby food was consumed only after 6 months and by 23% (n = 34. Sausages and offal products were consumed after 6 months of age. Sausages were consumed by 18% (n = 28 and offal products by 11% (n = 16 of infants. Meat consumption for the majority of infants was introduced after 6 months and was in accordance with recommendations.

  12. Breast meat yield, muscle linear measurements and meat ...

    African Journals Online (AJOL)

    Breast meat yield, chemical composition, mineral profile and linear measurement of the resultant breast meat Supracoracoides and Pectoralis thoracicus of one hundred and eighty (28 days old BUT) male turkeys fed diet containing wheat or sorghum as sole cereal source were studied. One hundred and eighty 28-days old ...

  13. GAME MEAT MARKET IN EASTERN CROATIA

    OpenAIRE

    Z. Tolušić; T. Florijančić; I. Kralik; M. Sesar; M. Tolušić

    2006-01-01

    In the Republic of Croatia, game meat is consumed far less than meat of domestic animals. Yearly game meat consumption amounts to only 0.55 kg per household member. Consumers prefer meat of domestic animals, because it is cheaper, not paying attention to specific nutritive advantages of game meat. A research on the game meat market and consumers’ preferences was carried out on 101 examinees, chosen among inhabitants of Slavonia and Baranja. The majority of questioned inhabitants did consume g...

  14. THE YIELD OF DNA IN THERMAL TERATED DEER MEAT

    Directory of Open Access Journals (Sweden)

    Jozef Golian

    2011-07-01

    Full Text Available Residuals of DNA are one of the most important factors for detection, traceability and reverse authentication of deer meat. In this project we isolated DNA from deer processed meat and analysed by electrophoresis. Goal of the study was compute ratio between raw meat and several heat processed deer meat. Samples were prepared by five heat treatment techniques (pan roasted with temperature 180-240°C, fried with 156°C, braised with temperature 100-150°C, boiled in 100.2°C water and autoclaved in different time intervals. The highest amount of residual DNA 1927ng was obtained with two hours boiled sample. The lowest value 89.89ng was obtained with one hour braised sample. In technological adjustments highest amount of DNA and 1927ng, so the total yield of 192.7ng.-l was observed in the sample we cooked for two hours at boiling temperature.   doi:10.5219/153 

  15. Topical papers on raw materials

    International Nuclear Information System (INIS)

    1978-01-01

    In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear

  16. A Potential Use of 3-D Scanning to Evaluate the Chemical Composition of Pork Meat.

    Science.gov (United States)

    Adamczak, Lech; Chmiel, Marta; Florowski, Tomasz; Pietrzak, Dorota; Witkowski, Marcin; Barczak, Tomasz

    2015-07-01

    The aim of this study was to determine the possibility of 3-D scanning method in chemical composition evaluation of pork meat. The sampling material comprised neck muscles (1000 g each) obtained from 20 pork carcasses. The volumetric estimation process of the elements was conducted on the basis of point cloud collected using 3-D scanner. Knowing the weight of neck muscles, their density was calculated which was subsequently correlated with the content of basic chemical components of the pork meat (water, protein and fat content, determined by standard methods). The significant correlations (P ≤ 0.05) between meat density and water (r = 0.5213), protein (r = 0.5887), and fat (r = -0.6601) content were obtained. Based on the obtained results it seems likely to employ the 3-D scanning method to compute the meat chemical composition. The use of the 3-D scanning method in industrial practice will allow to evaluate the chemical composition of meat in online mode on a dressing and fabrication line and in a rapid, noninvasive manner. The control of the raw material using the 3-D scanning will allow to make visual assessment more objective and will enable optimal standardization of meat batches prior to processing stage. It will ensure not only the repeatability of product quality characteristics, but also optimal use of raw material-lean and fat meat. The knowledge of chemical composition of meat is essential due to legal requirements associated with mandatory nutrition facts labels on food products. © 2015 Institute of Food Technologists®

  17. Color of Meat and Poultry

    Science.gov (United States)

    ... color. It can also occur when vegetables containing nitrites are cooked along with the meat. Because doneness and safety cannot be judged by ... or greenish cast when exposed to heat and processing. Wrapping the meat in airtight packages and storing it away from ...

  18. Ecological safety of meat products

    Directory of Open Access Journals (Sweden)

    A. K. Mikhailenko

    2009-01-01

    Full Text Available The level of toxicants was studied, and the biological value of sheep meat in the area of anthropogenic influence was checked up. The level of toxicants in meat depends straight on the age of animals.

  19. The In vitro meat cookbook

    NARCIS (Netherlands)

    Mensvoort, van K.M.; Grievink, H.J.

    2014-01-01

    With the world's population expected to reach nine billion people by 2050, it becomes impossible to produce and consume meat like we do today. In vitro meat, grown from cells in a laboratory, could provide a sustainable and animal-friendly alternative. Yet, before we can decide if we are willing to

  20. Cultured Meat in Islamic Perspective.

    Science.gov (United States)

    Hamdan, Mohammad Naqib; Post, Mark J; Ramli, Mohd Anuar; Mustafa, Amin Rukaini

    2017-04-29

    Cultured meat is a promising product that is derived through biotechnology that partially circumvents animal physiology, thereby being potentially more sustainable, environmentally friendly and animal friendly than traditional livestock meat. Such a novel technology that can impact many consumers evokes ethical, philosophical and religious discussions. For the Islamic community, the crucial question is whether cultured meat is halal, meaning compliant with Islamic laws. Since the culturing of meat is a new discovery, invention and innovation by scientists that has never been discussed by classical jurists (fuqaha'), an ijtihad by contemporary jurists must look for and provide answers for every technology introduced, whether it comply the requirements of Islamic law or not. So, this article will discuss an Islamic perspective on cultured meat based on the original scripture in the Qur'an and interpretations by authoritative Islamic jurists. The halal status of cultured meat can be resolve through identifying the source cell and culture medium used in culturing the meat. The halal cultured meat can be obtained if the stem cell is extracted from a (Halal) slaughtered animal, and no blood or serum is used in the process. The impact of this innovation will give positive results in the environmental and sustain the livestock industry.

  1. Production of fungal chitosan from date wastes and its application as a biopreservative for minced meat.

    Science.gov (United States)

    Tayel, Ahmed A; Ibrahim, Sami I A; Al-Saman, Mahmoud A; Moussa, Shaaban H

    2014-08-01

    Raw and processed meat contaminated with pathogenic microorganisms is a continuing worldwide problem facing health and industry overseers. Fungal chitosan was extracted, purified and characterized from Aspergillus brasiliensis (niger) ATCC 16404 grown in date syrup (dips) and applied as a potential meat biopreservative. The main features of produced chitosan were a deacetylation degree of 81.3%, a molecular weight of 31,000Da, 96% solubility in 1% acetic acid solution and a harmonized IR-spectrum to standard commercial chitosan. The application of fungal chitosan, as a natural and safe biopreservative for minced meat, was conducted in comparison with potassium sorbate, as a commercial meat preservative. Treated meat samples with 0.02% chitosan was the least trials in microbial contents, i.e. total count, coliforms, β-glucuronidase-positive Escherichia coli, Enterobacteriaceae, yeasts and molds, Staphylococcus aureus and coagulase positive staphylococci. The antimicrobial activity of fungal chitosan was considerably greater than that of potassium sorbate or their combination at 0.01% from each. Sensory characteristics, e.g. color, odor and texture, of treated meat with chitosan, were higher than those of control and potassium sorbate treated samples. Fungal chitosan, however, could be recommended as a powerful, natural and eco-friendly alternative for meat preservation and overall quality maintenance. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Development of rabbit meat products fortified with n-3 polyunsaturated fatty acids.

    Science.gov (United States)

    Petracci, Massimiliano; Bianchi, Maurizio; Cavani, Claudio

    2009-02-01

    Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a "functional food" by including n-3 polyunsaturated fatty acids (n-3 PUFA), conjugated linoleic acid (CLA), vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA) for n-3 PUFA.

  3. Influence of the marinating type on the morphological and sensory properties of horse meat.

    Science.gov (United States)

    Vlahova-Vangelova, Dessislava B; Abjanova, Sholpan; Dragoev, Stefan G

    2014-01-01

    The aim of this study was to explore the influence of acid, alkaline and water-oil marinating on morphological changes and sensory properties of horse meat (m. Longissimus dorsi). Nine samples (C - control stored in air, AL - alkaline marinated in 2% polyphosphates and 2% sodium chloride brine solution, AC - acid marinated in 2% sodium lactate and 2% sodium chloride brine solution, WO - marinated in water-oil emulsion (50/50) contained and 2% sodium chloride and SC - marinated in 2% sodium chloride brine solution) were examined. After 24 h and 48 h of marinating changes in morphology of marinated meat, pH and sensory properties of raw and roasted samples were established. It was determined that sensory properties (aroma, flavor and tenderness) after roasting were classified as follows: AL48 > AL24 > AC24 > AC48 > SC48 > SC24 > WO24 > WO48 > С. Meat tenderness in AL48, AL24, AC24 and AC48 showed better results due to stronger morphological changes in connective and muscle tissues. Alkaline solutions were more suitable for horse meat marinating compared to acid solutions and the possible reason for strong action of alkaline solutions was lower internal meat pH. Alkaline marinating should be conducted for 24 h because after 48 h the meat acquires a soft and unusually tender texture. Water-oil marinating was not appropriate for horse meat.

  4. Design and testing of small scale fish meat bone separator useful for fish processing.

    Science.gov (United States)

    Ali Muhammed, M; Manjunatha, N; Murthy, K Venkatesh; Bhaskar, N

    2015-06-01

    The present study relates to the food processing machinery and, more specifically machine for producing boneless comminuted meat from raw fish fillet. This machine is of belt and drum type meat bone separator designed for small scale fish processing in a continuous mode. The basic principal involved in this machine is compression force. The electric geared motor consists of 1HP and the conveyor belt has a linear velocity of 19 to 22 m min(-1), which was sufficient to debone the fish effectively. During the meat bone separation trials an efficiency up to 75 % on dressed fish weight basis was observed and with a capacity to separate 70 kg h(-1) of meat from fish at the machine speed of 25 rpm. During the trials, it was demonstrated that there was no significant change in the proximate composition of comminuted fish meat when compared to unprocessed fish meat. This design has a greater emphasis on hygiene, provision for cleaning-in-place (CIP) and gives cost effective need and reliability for small scale industries to produce fish meat in turn used for their value added products.

  5. Development of Rabbit Meat Products Fortified With n-3 Polyunsaturated Fatty Acids

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2009-10-01

    Full Text Available Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a “functional food” by including n-3 polyunsaturated fatty acids (n-3 PUFA, conjugated linoleic acid (CLA, vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA for n-3 PUFA.

  6. Food safety and organic meats.

    Science.gov (United States)

    Van Loo, Ellen J; Alali, Walid; Ricke, Steven C

    2012-01-01

    The organic meat industry in the United States has grown substantially in the past decade in response to consumer demand for nonconventionally produced products. Consumers are often not aware that the United States Department of Agriculture (USDA) organic standards are based only on the methods used for production and processing of the product and not on the product's safety. Food safety hazards associated with organic meats remain unclear because of the limited research conducted to determine the safety of organic meat from farm-to-fork. The objective of this review is to provide an overview of the published results on the microbiological safety of organic meats. In addition, antimicrobial resistance of microbes in organic food animal production is addressed. Determining the food safety risks associated with organic meat production requires systematic longitudinal studies that quantify the risks of microbial and nonmicrobial hazards from farm-to-fork.

  7. Iodine in meat in Macedonia

    International Nuclear Information System (INIS)

    Bogdanov, Bogdan; Gonev, Mihajlo; Tadzher, Isak

    2000-01-01

    Iodine deficiency in Macedonia still persists in a mild form. In 1999 the iodination of salt rose to 20 m gr iodine in Kg salt. The consumption of salt diminished after the last war from 20-30 gr salt per day to 10-20 gr salt daily. This shows that the problem of the elimination of iodine deficiency is being vigorously tackled. Since 1956 the iodine in salt in Macedonia rose to 10 m gr KI/Kg salt. The content of iodine in the Macedonian diet seems to be important. The amount of iodine in milk, eggs and bread is low as found by the investigation of MANU. The content of iodine in meat is low, compared to British meat is 10 times lower. The average iodine content in Macedonian meat is 95.15 micro gr per Kg, whereas in British meat it is 850-1510 micro gr iodine per k gr meat. (Original)

  8. Effect of direct adding oregano essential oil (Origanum syriacum L. on quality and stability of chicken meat patties

    Directory of Open Access Journals (Sweden)

    Marwan AL-HIJAZEEN

    2017-09-01

    Full Text Available Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1 control (no additive; (2 100 ppm oregano essential oil (OE; (3 150 ppm OE; (4 300 ppm L-ascorbic acid (E-300; (5 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320 for both breast and thigh meat respectively, and 6 150 ppm Sodium nitrite (E-250, were prepared using ground chicken meat. Generally, OE at level of 150 ppm was the most effective decreasing TBARS, and total carbonyl values compared to the other treatments. Furthermore, it showed better color values (L* and a* in term of meat color stability. However, OE and E-250 also showed the highest significant values among the other treatments. Sensory evaluation results showed that adding OE at level of 150 ppm and 100 ppm were the best values maintaining meat storage stability. Therefore, it can be recommended that OE at level of 150 ppm could be an excellent replacement to the synthetic antioxidant in the future of uncured, natural fresh meat products, and raw meat prepared for processing.

  9. Radioecological studies of 137Cs in limnological ecosystems. Biochemical states of 137Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    International Nuclear Information System (INIS)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki; Izumo, Yoshiro; Nakamura, Fumio.

    1997-01-01

    Biochemical states of 137 Cs accumulated in killifish's (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of 137 Cs radioactivity in the killifish's raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish's control raw meat mixed with 137 Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to 137 CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD 280nm in the samples were different from those of each radioactive peak. It was so suggested that 137 Cs accumulated in the killifish's meat was shown not to be binding to protein's composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with 137 Cs in samples and ammonium phosphomolybdate, 137 Cs in the NPNC fraction of the killifish's meat was not almost different from those of each control and 137 CsCl solution. (author)

  10. The utilization of coconut waste fermentated by aspergillus niger and saccharomyces cerevisiae on meat quality of weaning males rex rabbit

    Science.gov (United States)

    Wahyuni, T. H.; Ginting, N.; Yunilas; Hasnudi; Mirwandono, E.; Siregar, G. A.; Sinaga, I. G.; Sembiring, I.

    2018-02-01

    Coconut waste (CW) could be applied for animal feed while its nutrition quality were low. This study aims to investigate fermented CW effect on meat quality of Rex rabbit which feed by fermented CW either by Aspergillus niger or Tape Yeast. This research was conducted in rabbit farm Brastagi, using 24 male Rex rabbits with initial weight 1012 ± 126.67 gram in July-October 2016. The design used was complete randomized design : 6 treatment 4 replications. Treatment were T1 (unfermented 10%); T2 (unfermented 20%); T3 (a.niger fermentation 10%); T4 (a niger fermentation 20%); T5 (tape yeast fermentation 10%) and T6 (tape yeast fermentation 20%). The parameters were pH, meat texture either raw or cooked, water content, fat content, protein content of meat and cooking loss. The results showed that effect of treatment was not significantly different (P>0.05) on pH and raw meat texture, but significantly different (Pmeat cooked and meat fat content and very significantly different effect ( P> 0,01) on cooking loss, water content and protein content of meat. The conclusion of this research was the utilization of fermented CW by Aspergillius niger and Tape Yeast improved the quality of Rex rabbit meat

  11. Managing meat tenderness.

    Science.gov (United States)

    Thompson, John

    2002-11-01

    This paper discusses the management of meat tenderness using a carcass grading scheme which utilizes the concept of total quality management of those factors which impact on beef palatability. The scheme called Meat Standards Australia (MSA) has identified the Critical Control Points (CCPs) from the production, pre-slaughter, processing and value adding sectors of the beef supply chain and quantified their relative importance using large-scale consumer testing. These CCPs have been used to manage beef palatability in two ways. Firstly, CCPs from the pre-slaughter and processing sectors have been used as mandatory criteria for carcasses to be graded. Secondly, other CCPs from the production and processing sectors have been incorporated into a model to predict palatability for individual muscles. The evidence for the importance of CCPs from the production (breed, growth path and HGP implants), pre-slaughter and processing (pH/temperature window, alternative carcass suspension, marbling and ageing) sectors are reviewed and the accuracy of the model to predict palatability for specific muscle×cooking techniques is presented.

  12. Ionizing energy treatment of meat and meat products

    International Nuclear Information System (INIS)

    Macfarlane, J.J.; Eustace, I.J.; Grau, F.H.

    1983-01-01

    The radiation treatments that have received most attention with respect to red meats are radappertization, i.e. radiation sterilization (25-70 kGy), to enable the long term storage of meat without refrigeration, and radurization (0.5-10 kGy) in which a sufficient proportion of spoilage organisms are inactivated to enable the storage life of chilled meat to be extended. Shelf-stable radappertized meats cannot be produced in the fresh-like condition; they need to be heated to about 70 deg. C to inactivate endogenous enzymes that would otherwise cause flavour and texture defects. The products should be vacuum sealed in oxgyen-impermeable packages and irradiated in the frozen state, otherwise pronounced off-flavours and off-odours are formed. The radiation dose required to give a useful degree of microbial inactivation and permit an increase of storage life depends upon treatment and storage conditions. The dose required is likely to be in the range 0.25 to 1.0 kGy if aerobic conditions apply, and 1 to 4 kGy if anaerobic conditions apply. An acceleration in the rate of development of rancidity in meat as a result of irradiation may be of concern when meat is treated under aerobic conditions. At the highest dose indicated above for meat irradiated under anaerobic conditions (4 kGy), effects on the organoleptic attributes of mutton have been detected

  13. Influence radurization on the sensory properties of broiler meat

    International Nuclear Information System (INIS)

    Zabielski, J.; Fiszer, W.; Mroz, J.; Niewiarowicz, A.

    1981-01-01

    The sensory properties of normal, PSE and DFD chicken carcasses have been investigated. Raw carcasses treated with 2,5 kGy and 5,0 kGy could be distinguished from non-irradiated by its appearance and slight irradiation odour, however all samples were in the acceptable range. The broiler carcasses after 14 days of storage in 4+-1 degC had received sensory acceptance ratings comparable with fresh, non-irradiated samples. Due to unpalatable odour, the shelf-life of radurized PSE carcasses was limited to 14 days in comparison with 21 days for normal and DFD type broiler meat. (author)

  14. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  15. Raw material uranium; Rohstoff Uran

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2017-03-15

    Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.

  16. Meat Consumption Culture in Ethiopia

    Science.gov (United States)

    Jo, Cheorun

    2014-01-01

    The consumption of animal flesh food in Ethiopia has associated with cultural practices. Meat plays pivotal and vital parts in special occasions and its cultural symbolic weight is markedly greater than that accorded to most other food. Processing and cooking of poultry is a gender based duty and has socio-cultural roles. Ethiopians are dependent on limited types of animals for meats due to the taboo associated culturally. Moreover, the consumption of meat and meat products has a very tidy association with religious beliefs, and are influenced by religions. The main religions of Ethiopia have their own peculiar doctrines of setting the feeding habits and customs of their followers. They influence meat products consumption through dictating the source animals that should be used or not be used for food, and scheduling the days of the years in periodical permeation and restriction of consumptions which in turn influences the pattern of meat consumption in the country. In Ethiopia, a cow or an ox is commonly butchered for the sole purpose of selling within the community. In special occasions, people have a cultural ceremony of slaughtering cow or ox and sharing among the group, called Kircha, which is a very common option of the people in rural area where access of meat is challenging frequently. PMID:26760739

  17. 9 CFR 319.80 - Barbecued meats.

    Science.gov (United States)

    2010-01-01

    ... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Cooked Meats § 319.80 Barbecued meats. Barbecued meats, such as product labeled “Beef Barbecue” or “Barbecued Pork,” shall be cooked by the direct... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Barbecued meats. 319.80 Section 319.80...

  18. GAME MEAT MARKET IN EASTERN CROATIA

    Directory of Open Access Journals (Sweden)

    Z. Tolušić

    2006-12-01

    Full Text Available In the Republic of Croatia, game meat is consumed far less than meat of domestic animals. Yearly game meat consumption amounts to only 0.55 kg per household member. Consumers prefer meat of domestic animals, because it is cheaper, not paying attention to specific nutritive advantages of game meat. A research on the game meat market and consumers’ preferences was carried out on 101 examinees, chosen among inhabitants of Slavonia and Baranja. The majority of questioned inhabitants did consume game meat (92%, of whom 66% consider game meat to be of better quality than meat of domestic animals. Significant number of examinees considers game meat as healthy food, being also convinced that game was healthier to consume if hunted in their natural environment, than if reared on specialized farms (90%. Irrespective of quality, only 22% of examinees buy game meat, and 51% think such meat is too expensive. This is the main reason why consumers have game meat only once a month (51%. Taking into consideration monthly income of their respective household, 58% of examinees can afford game meat only once a month, and, if having an opportunity, they would opt for meat of roe deer (55% and rabbit (25%. When asked what would stimulate the game meat market in Croatia, 56% of examinees believe this could be achieved by lowering of prices, 27% think the issue could be addressed by opening of specialty stores, and only 17% opted for more aggressive marketing activities.

  19. Irradiation of bovine meat: effect of heme-iron concentration.; Irradiacao de carne bovina: efeito na concentracao de ferro heme

    Energy Technology Data Exchange (ETDEWEB)

    Mistura, Liliana Perazzini Furtado

    2002-07-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  20. Irradiation of meats and poultry

    International Nuclear Information System (INIS)

    Urbain, W.M.

    1978-01-01

    A number of beneficial effects can be achieved by irradiating meats and poultry under different conditions. It is possible, for example, to extend the market life of both fresh and processed meats by applying radiation doses sufficient to reduce the microbial population, thereby delaying onset of spoilage; higher doses aimed at destroying both spoilage and pathogenic microorganisms can also be applied to meats, packaged to prevent recontamination, resulting in a shelf-stable product; the objective may also be to inactivate pathogenic bacteria, parasites and viruses in order to obtain a product which is acceptable from the point of view of public health. (orig.) [de

  1. Study on the meat isotopic composition for origin identification

    Directory of Open Access Journals (Sweden)

    Irina Chernukha

    2018-03-01

    Full Text Available Russian consumer and governmental authorities are equally concerned to know where food products come from. This requires more accurate and specialized methods for the evaluation of geographical location. The following methods are used: chemometrics, histological and histochemical, genomic and proteomic, microbiological, immunochemical and mass spectrometric. Method of stable isotope analysis is becoming increasingly promising nowadays for the identification of meat and meat products' place of origin. The isotope ratios of the four elements - carbon, nitrogen, oxygen and hydrogen, are mainly determined. The method is successfully used to identify a country of origin of wines, juices and water. The aim of the research was to study the stable isotope ratios for pork and beef samples purchased in Moscow supermarkets (Russian Federation. The country of production of meat samples was determined according to specifications and/or labels. The geography of countries of meat samples origin includes Europe, both America continents and Australia. Databases collected by the All-Russian Scientific Research Institute of the Brewing, Non-Alcoholic and Wine Industrywere used for the analysis and interpretation of the results. Values of 13С/12С, δ13С, 18О/16О, δ18О, 2Н/1Н, δ2Н for 30 pork and beef samples from 13 countries were obtained. Differences in stable isotope ratios were found depending on place of origin. The data correlated with the oxygen isotope characteristics for wine, which were in the range from 2.5 to 4.5 ppm. According to the 13С/12С, δ13С results, the assumption was made about a false indication of the region for the beef sample. Despite the fact that beef was labeled as a product of Lithuania, the region of origin was most probably defined as Germany. The studies carried out showed the possibility to identify the region of raw meat origin by the stable isotope ratio.

  2. Combination treatment of gamma radiation and paraben in controlling spoilage of poultry meat

    International Nuclear Information System (INIS)

    Shiralkar, N.D.; Rege, D.V.

    1977-01-01

    With a view of controlling spoilage, combination treatment of poultry meat with gamma radiation and a chemical preservative has been investigated. Raw poultry pieces of about 25 g. weight were dipped in 0.1% propyl-paraben solution for two hours and were given a 0.1 Mrad dose from 60 Co gamma radiation. It was found that paraben was not affected by irradiation. The flavour evaluation scores indicated the shelf-life of poultry meat was prolonged by a couple of days as compared to untreated controls in refrigerated storage. (M.G.B.)

  3. Meat and Fish Entree Item Production Guides Prepared for Walter Reed Army Medical Center

    Science.gov (United States)

    1977-04-01

    diced Salt 0.41 Vinegar, cider 0.32 Sugar, granulated 0.27 Paprika 0.13 Garlic, dehydrated 0.05 granular Pepper, black, ground 0!01 ARROZ CON...table pans. ARROZ CON POI.l.O Ingredients Percent Pounds Grans Procedure TarALs 100.00 2$708 NarES: 1. Reheating: Reheat in a convection oven at...yield from raw weigpt-~to cooked edible (boned) meat. Edible weight of chicken equals 12 lb {5443 g). 68 ARROZ CON POLLO Meat 1. Bacon - NSN

  4. Improving functional value of meat products.

    Science.gov (United States)

    Zhang, Wangang; Xiao, Shan; Samaraweera, Himali; Lee, Eun Joo; Ahn, Dong U

    2010-09-01

    In recent years, much attention has been paid to develop meat and meat products with physiological functions to promote health conditions and prevent the risk of diseases. This review focuses on strategies to improve the functional value of meat and meat products. Value improvement can be realized by adding functional compounds including conjugated linoneleic acid, vitamin E, n3 fatty acids and selenium in animal diets to improve animal production, carcass composition and fresh meat quality. In addition, functional ingredients such as vegetable proteins, dietary fibers, herbs and spices, and lactic acid bacteria can be directly incorporated into meat products during processing to improve their functional value for consumers. Functional compounds, especially peptides, can also be generated from meat and meat products during processing such as fermentation, curing and aging, and enzymatic hydrolysis. This review further discusses the current status, consumer acceptance, and market for functional foods from the global viewpoints. Future prospects for functional meat and meat products are also discussed.

  5. Effect of storage conditions on the biogenic amine content in wild boar meat

    Directory of Open Access Journals (Sweden)

    Zdeňka Hutařová

    2014-01-01

    Full Text Available Hygienic quality of game meat depends on many factors during and after hunting. Freshness of meat is connected with the concentration of biogenic amines which is related to meat spoilage. The aim of this study was to assess changes in concentration of biogenic amines in raw meat of wild boar (n = 20, mean age 1–2 years during storage at different temperatures. Carcases of wild boars hunted in winter 2012 in hunting districts of south Moravia were stored unskinned during 21 days at various temperatures (0, 7 and 15 °C. Concentrations of biogenic amines (putrescine, cadaverine, tyramine, tryptamine, phenylethylamine, histamine, spermine and spermidine were determined in the shoulder and leg muscles by high-performance liquid chromatography in combination with triple quadrupole tandem mass spectrometry. Good hygienic quality was maintained when wild boar carcasses were stored for a maximum of 14 days at 0 °C (content of biogenic amines in 3 meat samples exceed the limit of 5 mg/kg on day 21 of storage or a maximum of 7 days at 7 °C (content of biogenic amines in 4 meat samples exceed the limit of 5 mg/kg on day 14 of storage. The temperature of 15 °C should be considered as unsuitable storage temperature if good hygienic quality of game meat during storage is to be guaranteed (content of biogenic amines in 2 meat samples exceed the limit of 5 mg/kg already on day 7 of storage. The study brings new information about the biogenic amine content and its changes in wild boar meat during the storage period of 21 days.

  6. Meat and fish freshness inspection system based on odor sensing.

    Science.gov (United States)

    Najam ul Hasan; Ejaz, Naveed; Ejaz, Waleed; Kim, Hyung Seok

    2012-11-09

    We propose a method for building a simple electronic nose based on commercially available sensors used to sniff in the market and identify spoiled/contaminated meat stocked for sale in butcher shops. Using a metal oxide semiconductor-based electronic nose, we measured the smell signature from two of the most common meat foods (beef and fish) stored at room temperature. Food samples were divided into two groups: fresh beef with decayed fish and fresh fish with decayed beef. The prime objective was to identify the decayed item using the developed electronic nose. Additionally, we tested the electronic nose using three pattern classification algorithms (artificial neural network, support vector machine and k-nearest neighbor), and compared them based on accuracy, sensitivity, and specificity. The results demonstrate that the k-nearest neighbor algorithm has the highest accuracy.

  7. Meat and Fish Freshness Inspection System Based on Odor Sensing

    Directory of Open Access Journals (Sweden)

    Hyung Seok Kim

    2012-11-01

    Full Text Available We propose a method for building a simple electronic nose based on commercially available sensors used to sniff in the market and identify spoiled/contaminated meat stocked for sale in butcher shops. Using a metal oxide semiconductor-based electronic nose, we measured the smell signature from two of the most common meat foods (beef and fish stored at room temperature. Food samples were divided into two groups: fresh beef with decayed fish and fresh fish with decayed beef. The prime objective was to identify the decayed item using the developed electronic nose. Additionally, we tested the electronic nose using three pattern classification algorithms (artificial neural network, support vector machine and k-nearest neighbor, and compared them based on accuracy, sensitivity, and specificity. The results demonstrate that the k-nearest neighbor algorithm has the highest accuracy.

  8. The Ethics of Producing In Vitro Meat

    OpenAIRE

    Schaefer, G Owen; Savulescu, Julian

    2014-01-01

    The prospect of consumable meat produced in a laboratory setting without the need to raise and slaughter animals is both realistic and exciting. Not only could such in vitro meat become popular due to potential cost savings, but it also avoids many of the ethical and environmental problems with traditional meat productions. However, as with any new technology, in vitro meat is likely to face some detractors. We examine in detail three potential objections: 1) in vitro meat is disrespectful, e...

  9. Bioactive Compounds in Functional Meat Products

    OpenAIRE

    Ewelina Pogorzelska-Nowicka; Atanas G. Atanasov; Jarosław Horbańczuk; Agnieszka Wierzbicka

    2018-01-01

    Meat and meat products are a good source of bioactive compounds with positive effect on human health such as vitamins, minerals, peptides or fatty acids. Growing food consumer awareness and intensified global meat producers competition puts pressure on creating new healthier meat products. In order to meet these expectations, producers use supplements with functional properties for animal diet and as direct additives for meat products. In the presented work seven groups of key functional cons...

  10. A survey of commercially available broilers marketed as organic, free-range, and conventional broilers for cooked meat yields, meat composition, and relative value.

    Science.gov (United States)

    Husak, R L; Sebranek, J G; Bregendahl, K

    2008-11-01

    The objective of this survey was to investigate qualitative and quantitative properties of meat from organic, free-range, and conventional broilers as currently provided to consumers. Fifteen broilers from 4 suppliers of each type were evaluated for raw meat yield, cooked meat yield, proximate composition, pH, color, lipid oxidation, fatty acid composition, and sensory attributes. Organic broilers yielded more dark (thigh) meat (P free-range or conventional, when compared on a raw-meat basis, but conventional and free-range broilers yielded more (P free-range or conventional. Organic breast and thigh meat was less yellow (P free-range or conventional. Fatty acid analysis showed that organic breasts and thighs were lower (P free-range and conventional broilers. Shear force measurements were less (P free-range and organic broilers. Sensory panel results indicated that thighs from conventional broilers were more tender (P free-range and organic broilers, whereas other sensory properties did not differ. At the time of the study, March through May of 2006, the average retail prices for US broilers were USD 3.19, USD 2.78, and USD 1.29 per pound (USD 7.03, USD 6.13, and USD 2.84/kg) for organic, free-range, and conventional, respectively. Whereas a difference in the fatty acid composition was the largest difference observed between retail broilers in this survey, it is important to note that diets and production environments within the study were not controlled. It is apparent that the market prices for broilers at the time of this study are not fully reflected in the quantitative and qualitative measurements included in this study. It appears that consumers may be placing significant value on more intangible attributes associated with broilers marketed as organic and free-range chicken than on those attributes measured in this study.

  11. Meat production perspective in Yucatan

    Directory of Open Access Journals (Sweden)

    Victor M. Toledo-Lopez

    2011-12-01

    Full Text Available The evolution of meat production in Mexico during the last decade is the result of the complex interaction between different areas of livestock production and consumers’ preferences, being the former widely influenced by new tendencies and purchasing capacity. In Yucatan, there are two meat product processing plants. Yucatan’s research projects are basically focused to production, handling and genetics. This research is developed in Research Centers like Universidad Autonoma Yucatan’s Ciencias Biologicas Agropecuarias Campus, INIFAP Mococha, Instituto Tecnologico Conkal and Instituto Tecnologoco Merida. Many projects are inter-institutional and others by Cuerpos Academicos inside the institutions. Grants are provided by state, national or international dependencies. In the Instituto Tecnologico Merida research projects are on different animals’ meat quality and novel meat products.

  12. Environmental costs of meat production

    DEFF Research Database (Denmark)

    Nguyen, T Lan T; Hermansen, John Erik; Mogensen, Lisbeth

    2012-01-01

    This paper aims to address two questions: First, what is the real cost of meat to society if taking into account the environmental costs arising throughout the product life cycle; and second, whether and how the environmental costs related to meat production can be reduced. In addressing the issues...... to be the main contributor to the costs (55%), followed by global warming (21%) and respiratory inorganics (18%). A viable option combining improvement measures in three aspects: feed use, manure management, and manure utilization, reduces the environmental costs by a factor of 1.4. This results in an equal size......, we use pig meat production in the EU as a case study. The environmental costs of meat are displayed first as characterized results at different midpoint categories e.g. global warming, nature occupation, acidification, eutrophication, ecotoxicity, etc., and then aggregated into a single score using...

  13. Electrical impedance spectroscopy for quality assessment of meat and fish: A review on basic principles, measurement methods, and recent advances

    Science.gov (United States)

    Electrical impedance spectroscopy (EIS), as an effective analytical technique for electrochemical system, has shown a wide application for food quality and safety assessment recently. Individual differences of livestock cause high variation in quality of raw meat and fish and their commercialized pr...

  14. Effects of vitamin E and organic selenium on oxidative stability of omega-3 enriched dark chicken meat during cooking.

    Science.gov (United States)

    Perez, T I; Zuidhof, M J; Renema, R A; Curtis, J M; Ren, Y; Betti, M

    2010-03-01

    The influence of vitamin E and selenomethionine (SeMet) on lipid oxidation in frozen-raw and cooked omega-3 enriched dark chicken meat was evaluated. Feed was supplemented with 2 levels of vitamin E (250 and 50 IU/kg of feed) and selenium (0.1 mg of sodium selenite/kg of feed and 0.3 mg of SeMet/kg of feed). An extruded linseed product was used as the alpha-linolenic acid source. Fatty acid (FA) profile, oxysterols, and thiobarbituric reactive acid substances (TBARs) were analyzed in frozen-raw, boiled, pan-fried, and roasted meat. After 6 mo of storage, oxysterols in frozen-raw meat remained stable with either high or low levels of dietary antioxidants. During cooking, high levels of vitamin E reduced oxysterol formation, whereas high levels of SeMet were inconsistent and even increased oxysterols during roasting. TBARs in frozen-raw meat stored for 6 mo were inhibited by high levels of either antioxidant. Conversely, no protective effect during cooking was observed at this time of storage. After 12 mo at -30 degrees C no antioxidant protection was observed.

  15. 9 CFR 355.42 - Marking of mule meat and animal food mule meat by-product.

    Science.gov (United States)

    2010-01-01

    ... mule meat by-product. 355.42 Section 355.42 Animals and Animal Products FOOD SAFETY AND INSPECTION... Meat and Animal Food, Mule Meat By-Product § 355.42 Marking of mule meat and animal food mule meat by-product. All mule meat and animal food mule meat by-product inspected under this part shall be marked and...

  16. Microbiological quality of poultry meat: a review

    Directory of Open Access Journals (Sweden)

    GC Mead

    2004-09-01

    Full Text Available Poultry meat can be contaminated with a variety of microorganisms, including those capable of spoiling the product during chill storage, and certain foodborne pathogens. Human illness may follow from handling of raw meat, undercooking or mishandling of the cooked product. While Salmonella and Campylobacter spp. remain the organisms of greatest global concern in this respect, others present include the more recently reported Arcobacter and Helicobacter spp. and, occasionally, verotoxigenic Escherichia coli. Also considered here is the growing problem of antimicrobial resistance among poultry-associated pathogens. Because of the need for a systematic and universally applicable approach to food safety control, the Hazard Analysis Critical Control Point (HACCP concept is increasingly being introduced into the Poultry Industry, and Quantitative Risk Assessment (QRA is being applied to microbial hazards. Among a number of completed and on-going studies on QRA are those undertaken by FAO/WHO on Salmonella and Campylobacter in broilers. In the case of Campylobacter, however, any QRA must assume at present that all strains have the same pathogenic potential for humans and comparable survival capabilities, even though this is unlikely to be the case. Implementation of the HACCP system in poultry processing plants addresses zoonotic agents that are not detectable by conventional meat inspection procedures and can help to control contamination of carcasses with spoilage organisms. The system brings obvious benefits in optimising plant hygiene, ensuring compliance with legislation and providing evidence of 'due diligence' on the part of the processor. It is now being applied globally in two different situations: in one, such as that occurring in the USA, carcass contamination is clearly reduced as carcasses pass through the process and are finally chilled in super-chlorinated water. There is also the option to use a chemical-rinse treatment for further

  17. Mining Pribram in science and technology. Proceedings of Session U - Mineral raw materials treatment

    International Nuclear Information System (INIS)

    Tomasek, J.; Vetejska, K.

    1987-01-01

    The proceedings of session ''Mineral raw materials treatment'' contain 27 papers of which only one deals with the application of nuclear technology, namely, the effect of fast electrons on the magnetic properties of the polymetallic Rudniany ore. (J.B.)

  18. ALTERNATIVE METHODS OF TECHNOLOGICAL PROCESSING TO REDUCE SALT IN MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    E. K. Tunieva

    2017-01-01

    Full Text Available The world trends in table salt reduction in meat products contemplate the use of different methods for preservation of taste and consistency in finished products as well as shelf life prolongation. There are several approaches to a sodium chloride reduction in meat products. The paper presents a review of the foreign studies that give evidence of the possibility to maintain quality of traditional meat products produced with the reduced salt content. The studies in the field of salty taste perception established that a decrease in a salt crystal size to 20 µm enabled reducing an amount of added table salt due to an increase in the salty taste intensity in food products. Investigation of the compatibility of different taste directions is also interesting as one of the approaches to a sodium chloride reduction in food products. The use of water-in-oil-in-water (w/o/w double emulsions allows controlling a release of encapsulated ingredients (salt, which enables enhancement of salty taste. The other alternative method of technological processing of meat raw material for reducing salt in meat products is the use of high pressure processing. This method has several advantages and allows not only an increase in the salty taste intensity, but also formation of a stable emulsion, an increase in water binding capacity of minced meat and extension of shelf-life.

  19. Effect of radiation processing on meat tenderisation

    International Nuclear Information System (INIS)

    Kanatt, Sweetie R.; Chawla, S.P.; Sharma, Arun

    2015-01-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour. - Highlights: • Effect of radiation processing on tenderness of three meat systems was evaluated. • Dose dependant reduction in shear force seen in buffalo meat. • Collagen solubility increased with irradiation

  20. Meat products and consumption culture in the East.

    Science.gov (United States)

    Nam, Ki-Chang; Jo, Cheorun; Lee, Mooha

    2010-09-01

    Food consumption is a basic activity necessary for survival of the human race and evolved as an integral part of mankind's existence. This not only includes food consumption habits and styles but also food preparation methods, tool development for raw materials, harvesting and preservation as well as preparation of food dishes which are influenced by geographical localization, climatic conditions and abundance of the fauna and flora. Food preparation, trade and consumption have become leading factors shaping human behavior and developing a way of doing things that created tradition which has been passed from generation to generation making it unique for almost every human niche in the surface of the globe. Therefore, the success in understanding the culture of other countries or ethnic groups lies in understanding their rituals in food consumption customs. Meat consumption culture in the East has not been well developed by its characteristic environment, religion, history, and main food staples. However, recently, the amount of meat production and consumption of the Eastern countries has grown rapidly by the globalization of food industry and rapid economic growth of the countries. This manuscript introduces meat-based products and consumption culture in Asian countries. However, because the environments and cultures within Asia are too diverse to cover all food cultures, this manuscript focused mainly on three northeast Asian countries including China, Japan, and Korea (Republic of) and some southeast Asian countries including Vietnam and Thailand, which have similar environments and cultural interactions historically but retain their own characteristic food culture.

  1. Antibiotic Resistance Patterns of Enterococci and Occurrence of Vancomycin-Resistant Enterococci in Raw Minced Beef and Pork in Germany

    Science.gov (United States)

    Klein, Günter; Pack, Alexander; Reuter, Gerhard

    1998-01-01

    The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958

  2. Radiation preservation of meat and meat products: A review.

    Science.gov (United States)

    Dempster, J F

    1985-01-01

    The World Health Organisation (WHO) in 1980 clarified the position regarding the medical acceptability of irradiated foods when it said'…no health hazard results from consuming any food irradiated up to a dose of one megarad (1 Mrad)'. This resulted in renewed interest in irradiation as a cost-effective alternative to traditional preservation methods such as canning and freezing. Thus, radurisation (the application of ionising radiation at a dose level which substantially reduces the microbial population) increases the shelf life of poultry, comminuted meat and meat dishes significantly. Low dose irradiation, or radicidation, eliminates parasites such as Trichinae and cysticerci in pork and, very importantly, salmonella organisms in poultry and red meat. Therefore, irradiation has an important rôle to play in public health protection. High dose irradiation, or radappertisation ('cold sterilisation'), uses doses in excess of 1 Mrad and is analogous to retorting as understood in the canning industry. However, it can adversely affect quality in producing 'free radicals' in high protein foods such as meat. To prevent this, special precautions are necessary, e.g. irradiation is conducted at very low temperatures and the product is usually vacuum packed. A further potential use of irradiation is its ability to reduce the quantity of nitrite necessary in cured meats. This may become of practical significance if legislation further reduces the amount of nitrite permitted in these products. Copyright © 1985. Published by Elsevier Ltd.

  3. Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

    Science.gov (United States)

    Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

    2010-05-01

    A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

  4. Electronics

    Science.gov (United States)

    2001-01-01

    International Acer Incorporated, Hsin Chu, Taiwan Aerospace Industrial Development Corporation, Taichung, Taiwan American Institute of Taiwan, Taipei, Taiwan...Singapore and Malaysia .5 - 4 - The largest market for semiconductor products is the high technology consumer electronics industry that consumes up...Singapore, and Malaysia . A new semiconductor facility costs around $3 billion to build and takes about two years to become operational

  5. Snail meat: Significance and consumption

    Directory of Open Access Journals (Sweden)

    Dragićević Olgica

    2005-01-01

    Full Text Available The consumption of snail meat goes back to prehistoric times. Different ancient nations had snails on their menu, but Helices culture as a productive activity was born as a Roman culture. Some of the most economically important edible species are: Helix aspersa (Mtiller Helixpomatia (Linne, Helix iucorum (Linne, Helix aperta (Born, Eobania vermiculata (Miiller. Together with its tasie, snail meat has several advantages over others: quite low lipid rate and calorie values versus rich mineral, essential amino acid and fatty acid content. The composition of snail meat is presented. In addition, the composition of different snail species and the part analyzed (pedal mass and visceral mass is presented. Also, the differences in composition according to the species (snail meat horse/chicken meat, beef, swine meat, fish meat are presented. The French are the world's leading consumers of snails. !n France snails come to market in a variety of ways. Estimated consumption of snails in France is around 40 000 tones/year. Total French imports account for 25% of world imports. France is also the leading exporter of prepared snails, mainly sold as preserved snails and prepared dishes. Snail imports have been much higher than exports (65 tones exported in 2002. vs. 2.700 tones imported. Despite the large consumption, only 3% of snails in France come from production (farming. Italy is in second place in the world consumption of snails, and Spain and Germany are in the third and fourth place. The development of snails consumption in Italy is followed with the same amount of production of snails in the whole biological circle. In 2001, from 24,700 tons, 9,350 tons (37.8% came from production, 6 00 tons (2.4% came from nature, and 14,750 tons (59.70% came from imports (frozen, fresh and prepared snails. In Serbia, at the beginning of 2005, we had over 400 registered farms for snail production.

  6. Improvement of shelf stability and processing properties of meat products by gamma irradiation

    International Nuclear Information System (INIS)

    Byun, M.-W.; Lee, J.-W.; Yook, H.-S.; Lee, K.-H.; Kim, H.-Y.

    2002-01-01

    To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams

  7. Improvement of shelf stability and processing properties of meat products by gamma irradiation

    Science.gov (United States)

    Byun, Myung-Woo; Lee, Ju-Woon; Yook, Hong-Sun; Lee, Kyong-Haeng; Kim, Hee-Yun

    2002-03-01

    To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams.

  8. Detection of thermophilic Campylobacter sp. in raw chicken sausages by methods ISO 10272: 2006 in Curitiba - Parana State - Brazil

    Directory of Open Access Journals (Sweden)

    K. Konell

    2014-12-01

    Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.

  9. Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

    Directory of Open Access Journals (Sweden)

    Diego Gómez

    2015-07-01

    Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

  10. Nutritional and other implications of irradiating meat

    International Nuclear Information System (INIS)

    Stevenson, M.H.

    1994-01-01

    Different methods have been developed to extend the shelf-life of meat and its products ranging from the traditional use of salt to canning, freezing and modified-atmosphere packaging. As well as these more conventional approaches to meat preservation, the use of ionizing radiation has also been extensively studied over many years. The irradiation sources which are permitted for use with food are gamma photons from 6o Co or 137 Cs, high-energy electrons generated by machines, maximum energy 10 MeV and X-rays with a maximum energy of 5 MeV (Codex Alimentarius Commission, 1984). At doses of about 25-50 kGy, irradiation can be used to achieve sterilization and in the 1960s shelf-stable radiation-sterilized meat products were developed to substitute for canned or frozen military rations. Currently, sterile meals are produced for immunocompromized patients using irradiation. With doses below 10 kGy, the process is effective in enhancing food safety through the inactivation of pathogenic microorganisms such as Salmonella and Campylobacter and extending shelf-life by eliminating the micro-organisms responsible for normal spoilage. Following the report of the Food and Agriculture Organization/International Atomic Energy Agency/World Health Organization Joint Expert Committee on the Wholesomeness of Irradiated Food (1981) which concluded that 'irradiation of food up to an overall average dose of 10 kGy produced no toxicological hazard and introduced no special nutritional or microbiological problems', there has been renewed interest in the use of lower doses of irradiation for the preservation of food. In 1991, the UK government introduced new regulations permitting the irradiation of seven categories of food, including chicken, under strictly controlled conditions (UK Government Regulations, 1990) .Currently, thirty-seven countries have approval for the irradiation treatment of a range of foods or food items and of these countries, twenty-six are using the process on a

  11. Alternative of raw material’s suppliers using TOPSIS method in chicken slaughterhouse industry

    Science.gov (United States)

    Sari, R. M.; Rizkya, I.; Syahputri, K.; Anizar; Siregar, I.

    2018-02-01

    Chicken slaughterhouse industry is one of the fastest growing industries that depends on the freshness of raw materials. The raw materials quality arrive at the company depends heavily on the suppliers. Fresh chicken and frozen chicken meat are the main raw materials for this industry. Problems occurred by the suppliers are catering the amount of raw material needs that are not appropriate and also delay during delivery process. This condition causes disruption of the production process in the company. Therefore, it is necessary to determine the best suppliers to supply the main raw materials of fresh and frozen chicken meat on the slaughterhouse chicken industry. This study analyze the supplier’s capability by using TOPSIS method. This method use to find out the best supplier. The TOPSIS method is performed using the principle that chosen alternative must have the shortest distance from the positive solution and furthest from the ideal solution of the geometric point by using the Euclidean distance to determine the relative proximity of the optimum solution alternative. TOPSIS method found the rank of best supplier’s order is supplier A followed by supplier D, supplier B, supplier C, supplier E, supplier F, and supplier G. Based on the rank order obtained from each company, it will assist the company in prioritizing the order to the supplier with the best rank. Total supply from All suppliers are 885,994 kg per month. Based on the results of research, the top five suppliers have been sufficient to meet the needs of the company.

  12. Influence of color on dielectric properties of marinated poultry breast meat.

    Science.gov (United States)

    Samuel, D; Trabelsi, S

    2012-08-01

    The dielectric behavior of foods when exposed to radio-frequency and microwave electric fields is highly influenced by moisture content and the degree of water binding with constituents of the food materials. The ability to correlate specific food quality characteristics with the dielectric properties can lead to the development of rapid, nondestructive techniques for such quality measurements. Water-holding capacity is a critical attribute in meat quality. Up to 50% of raw poultry meat in the United States is marinated with mixtures of water, salts, and phosphates. The objective of this study was to determine if variations in breast meat color would affect the dielectric properties of marinated poultry meat over a broad frequency range from 500 MHz to 50 GHz. Poultry meat was obtained from a local commercial plant in Georgia (USA). Color and pH measurements were taken on the breast filets. Groups of breast filets were sorted into classes of pale and normal before adding marination pickup percentages of 0, 5, 10, and 15. Breast filets were vacuum-tumbled and weighed for pickup percentages. Dielectric properties of the filets were measured with a coaxial open-ended probe on samples equilibrated to 25°C. Samples from pale meat exhibited higher dielectric properties than samples from normal meat. No differences could be observed between samples from pale and normal meat after marination of the samples. Overall, dielectric properties increased as the marination pickup increased (α=0.05). Marination pickup strongly influenced the dielectric loss factor. Differences between samples marinated at different pickup levels were more pronounced at lower frequencies for the dielectric loss factor. As frequency increased, the differences between samples decreased. Differences in dielectric constant between samples were not as consistent as those seen with the dielectric loss factor.

  13. EFFICIENCY OF RAW MATERIAL INVENTORIES IN IMPROVING SUPPLY CHAIN PERFORMANCE of CV. FIVA FOOD

    Directory of Open Access Journals (Sweden)

    Artadi Nugraha

    2016-01-01

    Full Text Available The production and number of processed food industries have slightly increased; as a result, the companies must compete to maximize their profits by conducting their efficient production process. CV. Fiva Food is one of the companies in the field of processed foods, especially in processed meat that has implemented supply chain management. It is necessary for the company to take measurements of its performance and efficiency for the entire supply chain such as procurement of raw materials. The purposes of this study were to analyze the performance of the company's supply chain and determine the most efficient  method of procurement for its raw materials as well as and to provide recommendations for the company to improve its performance of entire supply chain. This study used SCOR in analyzing the performance of supply chain and EOQ and POQ method to be compared with the method that the company uses to determine which method of procurement for raw materials is the most efficient one. The result showed that based on the matrix, the company's performance is unfavorable when it was compared to the benchmark performance of inventory days of supply. In addition, this study showed that the POQ method produces the lowest total inventory cost with savings of Rp6.647.015 for raw materials of MDM whereas EOQ method produced the lowest total inventory cost with savings of Rp222.153,78 for raw materials of FQ85CL. Keywords: performance suppy chain, SCOR, fiva food, EOQ, POQ

  14. Detection of irradiated meat, fish and their products by measuring 2-alkylcyclobutanones levels after frozen storage

    International Nuclear Information System (INIS)

    Obana, H.; Furuta, M.; Tanaka, Y.

    2007-01-01

    2-Alkylcyclobutanones, such as 2-dodecylcyclobutanone and 2-tetradecylcyclobutanone, were analyzed to assess the irradiation history of irradiated meats or fish, and cooked foods with irradiated ingredients, which had been stored frozen for up to one year. The purpose of the study was to show that irradiated meats could be detected even after having been stored in the distribution system. 2-Alkylcyclobutanones showed a small decrease in irradiated raw meats that had been stored frozen for one year. Cooked foods, such as pancake and fried chicken made with irradiated eggs and chicken, respectively, contained detectable levels of 2-alkylcyclobutanones after storage frozen for one year. The 2-alkylcyclobutanones became undetectable in highly dried samples, such as feed for lab animals, during the same period

  15. Thawing of Frozen Tuna Meat

    Science.gov (United States)

    Tanaka, Takeo; Nishiwaki, Kôji; Kakuda, Kitonari; Tomimatsu, Takao

    Frozen southern bluefin tuna meat discolors easily and sometimes contracts when thawed caused by thaw rigor. These phenomenon often become problematic in the transaction or handling of this kind of frozen tuna. Frozen meat blocks of southern Bluefin tuna were thawed separately by air thawing, running water thawing and microwave thawing. Changes occurring during thawing were checked for meat color by met-myoglobin ratio determination and for contract by microscopic observation. Results are as follows : (1) Discoloration scarcely occurred in the process of running water thawing (at 10°C for 50 min, or at 0°C for 6 hr). (2) No contraction was observed during thawing with running water described above and air thawing (at 18-20°C for 6 hr). (3) Discoloration and contraction seemed to be minimized, as to latently contractile blocks, when meat temperature passed through rapidly between -10°C and -5°C, and slowly (for 5-6 hr) between -5°C and -1°C. When the block was originally not contractile, discloration was minimized by rising meat temperature rapidly from -10°C to -l°C.

  16. Effects of high pressure processing on fatty acid composition and volatile compounds in Korean native black goat meat.

    Science.gov (United States)

    Kang, Geunho; Cho, Soohyun; Seong, Pilnam; Park, Beomyoung; Kim, Sangwoo; Kim, Donghun; Kim, Youngjun; Kang, Sunmun; Park, Kyoungmi

    2013-08-01

    This study investigated the effects of high pressure processing (HPP) on fatty acid composition and volatile compounds in Korean native black goat (KNBG) meat. Fatty acid content in KNBG meat was not significantly (p > 0.05) different among the control goats and those subjected HPP. The 9,12-octadecadienoic acid and octadecanoic acid, well-known causes of off-flavors, were detected from meat of some KNBG. A difference between the control and HPP treatment was observed in the discriminated function analysis using an electronic nose. The results suggest that the volatile compounds in KNBG meat were affected by HPP.

  17. Strategies for designing novel functional meat products.

    Science.gov (United States)

    Arihara, Keizo

    2006-09-01

    In recent years, much attention has been paid to physiological functions of foods due to increasing concerns for health. Although there has been limited information of physiological functions of meat until recently, several attractive meat-based bioactive compounds, such as carnosine, anserine, l-carnitine, conjugated linoleic acid, have been studied. Emphasizing these activities is one possible approach for improving the health image of meat and developing functional meat products. This article provides potential benefits of representative meat-based bioactive compounds on human health and an overview of meat-based functional products. Strategies for designing novel functional meat products utilizing bioactive peptides and/or probiotic bacteria, is also discussed. This article focuses particularly on the possibility of meat protein-derived bioactive peptides, such as antihypertensive peptides. There are still some hurdles in developing and marketing novel functional meat products since such products are unconventional and consumers in many countries recognize meat and meat products to be bad for health. Along with accumulation of scientific data, there is an urgent need to inform consumers of the exact functional value of meat and meat products including novel functional foods.

  18. CO2 Capture by Cement Raw Meal

    DEFF Research Database (Denmark)

    Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll

    2013-01-01

    The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....

  19. Photoshop CS3 RAW Transforming your RAW data into works of art

    CERN Document Server

    Aaland, Mikkel

    2008-01-01

    Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n

  20. Power ultrasound in meat processing.

    Science.gov (United States)

    Alarcon-Rojo, A D; Janacua, H; Rodriguez, J C; Paniwnyk, L; Mason, T J

    2015-09-01

    Ultrasound has a wide range of applications in various agricultural sectors. In food processing, it is considered to be an emerging technology with the potential to speed up processes without damaging the quality of foodstuffs. Here we review the reports on the applications of ultrasound specifically with a view to its use in meat processing. Emphasis is placed on the effects on quality and technological properties such as texture, water retention, colour, curing, marinating, cooking yield, freezing, thawing and microbial inhibition. After the literature review it is concluded that ultrasound is a useful tool for the meat industry as it helps in tenderisation, accelerates maturation and mass transfer, reduces cooking energy, increases shelf life of meat without affecting other quality properties, improves functional properties of emulsified products, eases mould cleaning and improves the sterilisation of equipment surfaces. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Spoilage-related activity of Carnobacterium maltaromaticum strains in air-stored and vacuum-packed meat.

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-10-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall.

  2. Spoilage-Related Activity of Carnobacterium maltaromaticum Strains in Air-Stored and Vacuum-Packed Meat ▿ †

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-01-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall. PMID:21784913

  3. 9 CFR 317.308 - Labeling of meat or meat food products with number of servings.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Labeling of meat or meat food products with number of servings. 317.308 Section 317.308 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 317.308 Labeling of meat or meat food products with number of servings. The label of...

  4. 9 CFR 317.300 - Nutrition labeling of meat or meat food products.

    Science.gov (United States)

    2010-01-01

    ... Labeling § 317.300 Nutrition labeling of meat or meat food products. (a) Nutrition labeling shall be... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Nutrition labeling of meat or meat food products. 317.300 Section 317.300 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE...

  5. Will novel protein foods beat meat? : consumer acceptance of meat substitutes - a multidisciplinary research approach

    NARCIS (Netherlands)

    Hoek, A.C.

    2010-01-01

    Meat production places a heavy burden on the environment and therefore options are sought to reduce meat consumption. One option is to let new meat substitutes take the place of meat on the plate. This can only succeed when these products are acceptable to consumers. The thesis investigated which

  6. The Efficacy of the clay meat ball as a method of traditional meat ...

    African Journals Online (AJOL)

    Keywords: meat ball, protein, mineral content. This work was carried out to determine the effectiveness of the use of clay meat balls (an African traditional method of preserving meat) in extending the shelf life of meat over a period of months against microbial (bacterial and fungal) spoilage and contamination without ...

  7. Characterization of silica quartz as raw material in photovoltaic applications

    Energy Technology Data Exchange (ETDEWEB)

    Boussaa, S. Anas, E-mail: sabiha.anas@gmail.com; Kheloufi, A.; Kefaifi, A.; Kerkar, F. [Division croissance cristalline et procédés métallurgiques CCPM Centre de recherche en technologie des semi-conducteurs pour l’énergétique (C.R.T.S.E) 02 Bd Frantz Fanon BP. 140 Alger 7 merveilles, Alger 16200 (Algeria); Zaourar, N. Boutarek [Laboratoire des technologies des matériaux, USTHB, B.P. 32 El Alia, Bab Ezzouar, Alger, Algérie 16111 (Algeria)

    2016-07-25

    Raw materials are essential for the functioning of modern societies, and access to these raw materials is vital to the world economy. Sustainable development, both globally level, raises important new challenges associated with access and efficient use of raw materials. High purity quartz, is consider as a critical raw material and it is a rare commodity that only forms under geological conditions where a narrow set of chemical and physical parameters is fulfilled. When identified and following special beneficiation techniques, high purity quartz obtains very attractive prices and is applied in high technology sectors that currently are under rapid expansion such as photovoltaic solar cells, silicon metal - oxide wafers in the semiconductor industry and long distance optical fibers that are used in communication networks. Crystalline silicon remains the principal material for photovoltaic technology. Metallurgical silicon is produced industrially by the reduction of silica with carbon in an electric arc furnace at temperatures higher than 2000 °C in the hottest parts, by a reaction that can be written ideally as: SiO{sub 2} + 2C = Si + 2CO. The aim of this study has been to test experimental methods for investigating the various physical and chemical proprieties of Hoggar quartz with different techniques: X Ray Fluorescence, infra-red spectroscopy, Scanning Electron Microscopy, Optic Microscopy, Carbon Analyzer and Vickers Hardness. The results show finally that the quartz has got good result in purity but need enrichment for the photovoltaic application.

  8. BIOTECHNOLOGIES OF MEAT PRODUCTS MANUFACTURE. CURRENT STATE

    OpenAIRE

    Bal-Prilipko L. V.; Leonova B. I.

    2014-01-01

    The analysis of literature and patents related to the possibilities of biotechnology for optimizing the domestic meat processing plants was the aim of the article. The analysis of the results of the use of biotechnological methods in the meat processing industry is given. The prospects for their implementation are evaluated. The main development strategy of technological meat processing to develop the methods of obtaining high quality and safe meat products is highlighted. Targeted use of spe...

  9. Detection of 2-dodecylcyclobutanone in radiation- sterilized chicken meat stored for several years

    International Nuclear Information System (INIS)

    Victoria, A.; Crone, J.; Hamilton, J.T.G.; Stevenson, M.H.

    1992-01-01

    Results are presented indicating a linear relationship between irradiation dose (10–60 kGy) and the quantity of 2-dodecylcyclobutanone produced in irradiated frozen (-46°C) chicken meat. 2-Dodecylcyclobutanone was found in chicken meat sterilized (at -40°C) by gamma and electron beam irradiation 12 years previously and used for toxicity clearance. After freeze-drying the irradiated chicken samples still contained 2-dodecylcyclobutanone indicating that it was present in the diets tested. The compound was not detected in chicken meat sterilized by thermal processing 13 years ago. In addition, there was evidence that 2-tetradecylcyclobutanone was also present in the irradiation sterilized samples

  10. Goat Meat Consumer Preferences: Implications for Goat Meat Marketing in Metropolitan Nashville, Tennessee Area

    OpenAIRE

    Ekanem, Enefiok; Mafuyai-Ekanem, Mary; Tagegne, Fisseha; Singh, Surendra; Favors, Delicia

    2013-01-01

    Goat meat has become an increasingly good source of protein for meat eaters in the global marketplace. Goat meat constitutes about 63% of all red meat consumed worldwide. It is the main source of animal protein in many North African, Middle Eastern nations, Southeast Asia, the Caribbean, and other tropical regions. This notwithstanding, goat meat is yet to take such prominence in the U.S. diet. Despite the acknowledgement of the meat as lean, tasty and less fatty than other meats (USDA 2001),...

  11. Taste-active compound levels in Korean native chicken meat: The effects of bird age and the cooking process.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Kim, Hyun Joo; Yong, Hae In; Nam, Ki Chang; Jo, Cheorun

    2015-08-01

    The effects of bird age and the cooking process on the levels of several taste-active compounds, including inosine 5'-monophosphate (IMP), glutamic acid, cysteine, reducing sugars, as well as oleic, linoleic, arachidonic, and docosahexaenoic acids (DHA), in the breast and leg meats from a certified meat-type commercial Korean native chicken (KNC) strain (Woorimatdag) were investigated. KNC cocks were raised under similar standard conditions at a commercial chicken farm, and breast and leg meats from birds of various ages (10, 11, 12, 13, and 14 wk; 10 birds/age group) were obtained. After raw and cooked meat samples were prepared, they were analyzed for the aforementioned taste-active compounds. Compared to the leg meat, KNC breast meat had higher levels of IMP, arachidonic acid, and DHA, but lower levels of the other taste-active compounds (P cooking process (P cooking process. This information could be useful for selection and breeding programs, and for popularizing native chicken meat. © 2015 Poultry Science Association Inc.

  12. Identification of fraud (with pig stuffs) in chicken-processed meat through information of mitochondrial cytochrome b.

    Science.gov (United States)

    Yacoub, Haitham A; Sadek, Mahmoud A

    2017-11-01

    This study was conducted to find out the fraud in chicken-processed meat ingredients to protect consumers from commercial adulteration and authentication through a reliable way: direct amplification of conserved segment of cytochrome b gene of mitochondrial DNA, in addition, using species-specific primer assay for a certain cytochrome b. The results reported that chicken-processed meats were identified as a chicken meat based on amplification of conserved cytochrome b gene of mtDNA, while different fragments sizes were produced after the application of species-specific primer as follows: 227, 157, 274, 331, 389 and 439 bp for raw meat of chicken, goat, cattle, sheep, pig and horse, respectively. The results revealed that all chicken meat products are produced with 227 bp in size. While, an adulteration with pork stuffs was observed in some of the chicken meat products using a species-specific primer of cytochrome b gene, namely, chicken luncheon and chicken burger. This study represents a reliable technique that could be used to provide a promising solution for identifying the commercial adulteration and substitutions in processed meat in retail markets.

  13. Radioecological studies of {sup 137}Cs in limnological ecosystems. Biochemical states of {sup 137}Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    Energy Technology Data Exchange (ETDEWEB)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Institute of Public Health, Urawa (Japan); Izumo, Yoshiro; Nakamura, Fumio

    1997-07-01

    Biochemical states of {sup 137}Cs accumulated in killifish`s (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of {sup 137}Cs radioactivity in the killifish`s raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish`s control raw meat mixed with {sup 137}Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to {sup 137}CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD{sub 280nm} in the samples were different from those of each radioactive peak. It was so suggested that {sup 137}Cs accumulated in the killifish`s meat was shown not to be binding to protein`s composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with {sup 137}Cs in samples and ammonium phosphomolybdate, {sup 137}Cs in the NPNC fraction of the killifish`s meat was not almost different from those of each control and {sup 137}CsCl solution. (author)

  14. In the elderly, meat protein assimilation from rare meat is lower than that from meat that is well done.

    Science.gov (United States)

    Buffière, Caroline; Gaudichon, Claire; Hafnaoui, Noureddine; Migné, Carole; Scislowsky, Valérie; Khodorova, Nadezda; Mosoni, Laurent; Blot, Adeline; Boirie, Yves; Dardevet, Dominique; Santé-Lhoutellier, Véronique; Rémond, Didier

    2017-11-01

    Background: Meat cooking conditions in in vitro and in vivo models have been shown to influence the rate of protein digestion, which is known to affect postprandial protein metabolism in the elderly. Objective: The present study was conducted to demonstrate the effect of cooking conditions on meat protein assimilation in the elderly. We used a single-meal protocol to assess the meat protein absorption rate and estimate postprandial meat protein utilization in elderly subjects. Design: The study recruited 10 elderly volunteers aged 70-82 y. Each received, on 2 separate occasions, a test meal exclusively composed of intrinsically 15 N-labeled bovine meat (30 g protein), cooked at 55°C for 5 min [rare meat (RM)] or at 90°C for 30 min [fully cooked meat (FCM)], and minced. Whole-body fluxes of leucine, before and after the meal, were determined with the use of a [1- 13 C]leucine intravenous infusion. Meat protein absorption was recorded with the use of 15 N enrichment of amino acids. Results: Postprandial time course observations showed a lower concentration in the plasma of indispensable amino acids ( P meat leucine in the plasma ( P meat nitrogen to plasma amino acid nitrogen ( P meat amino acids with RM than with FCM. This was associated with decreased postprandial whole-body protein synthesis with RM than with FCM (40% compared with 56% of leucine intake, respectively; P meat cooking conditions have little effect on postprandial protein utilization in young adults, the present work showed that the bioavailability and assimilation of meat amino acids in the elderly is lower when meat is poorly cooked. In view to preventing sarcopenia, elderly subjects should be advised to favor the consumption of well-cooked meat. This trial was registered at clinicaltrials.gov as NCT02157805. © 2017 American Society for Nutrition.

  15. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  16. 9 CFR 319.261 - Meat loaf.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat loaf. 319.261 Section 319.261... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  17. 9 CFR 319.500 - Meat pies.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat pies. 319.500 Section 319.500... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Meat Food Entree Products, Pies, and...

  18. Breeding for meat quality in pigs

    NARCIS (Netherlands)

    Hovenier, R.

    1993-01-01

    The aim of this study was to investigate the possibilities of improving pig meat quality by selection. Therefore, literature is reviewed to determine the meat quality traits to be used and genetic parameters of those meat quality traits are calculated. A method is described to obtain

  19. 9 CFR 319.304 - Meat stews.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat stews. 319.304 Section 319.304... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Canned, Frozen, or Dehydrated Meat Food...

  20. 9 CFR 319.260 - Luncheon meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Luncheon meat. 319.260 Section 319.260... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  1. Meat consumption, diabetes and its complications

    NARCIS (Netherlands)

    Feskens, E.J.M.; Sluik, D.; Woudenbergh, van G.J.

    2013-01-01

    Several prospective studies have reported that risk of type 2 diabetes (T2DM) is elevated in meat consumers, especially when processed meats are consumed. Elevated risks of coronary heart disease (CHD) and stroke in meat consumers have also been reported. In this overview, the evidence regarding

  2. Raw Pea (Pisum sativum, raw Faba bean (Vicia faba var. minor and raw Lupin (Lupinus albus var. multitalia as alternative protein sources in broiler diets

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The ban of the meat and bone meal for entering animal diets and the concern of transgenic feeds poses a challenge toanimal nutritionists in Europe. The challenge is to find homegrown protein-rich feedstuffs, making sure no antinutritionalfactors are present which could interfere in the animals’ performance. The raw Pea (Pisum sativum (RP, raw Fababean (Vicia faba, variety minor (RFb and raw Lupin (Lupinus albus, variety multitalia (RL were evaluated as alternativeprotein sources into broiler diets. Six hundred thirty 1d-old Ross male chicks, Marek vaccinated, were randomlyassigned to seven dietary treatments (5 pens per treatment/18 birds per pen. Chicks were floor housed, ad libitum fedisocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the basediet (control diet was corn (48.7%, 56.6% and 57%, solvent-extracted soybean meal (42.8%, 37.3% and 33.4%, cornoil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The RP, RFb and RL entered diets in substitution of the soybeanand corn according to the cost optimization (P100, Fb100 and L100, respectively for RP, RFb and RL and at half of theoptimized quantity (RP50, RFb50 and RL50, respectively for RP, RFb and RL. The amount used as fed basis for the higherlevel of inclusion were: P100: 350 g/kg for all diets; Fb100: 480 g/kg (1-10d-old and 500 g/kg (11-42d-old; L100:360 g/kg (1-10d-old and 300 g/kg (11-42d-old. The average daily gain (ADG were lower (P compared to the control group. Over the whole period of growth, the RFb group had similar ADG compared to the controlgroup and for both levels of inclusion, whereas reduced (P (P growth. Birds performance was improved (P and breast and leg quarter cuts. The RFb and RL could represent valuable protein feeds in broilers diet formulation.

  3. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity.

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane

    2016-07-01

    Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake

  4. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine

    2016-01-01

    ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in

  5. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  6. Data extraction from proteomics raw data

    DEFF Research Database (Denmark)

    Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael

    2012-01-01

    In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...

  7. Meat, dairy, and cancer1234

    Science.gov (United States)

    Abid, Zaynah; Cross, Amanda J; Sinha, Rashmi

    2014-01-01

    In 2007 the World Cancer Research Fund and American Institute for Cancer Research (WCRF/AICR) report judged that the evidence for an association between red and processed meat consumption and colorectal cancer was convincing. In addition, the effect of other animal products on cancer risk has been studied, and the WCRF/AICR report concluded that milk probably decreases the risk of colorectal cancer but diets high in calcium probably increase the risk of prostate cancer, whereas there was limited evidence for an association between milk and bladder cancer and insufficient evidence for other cancers. There are several potential mechanisms relating meat to cancer, including heterocyclic amines, polycyclic aromatic hydrocarbons, N-nitroso compounds, and heme iron. Although the evidence in favor of a link between red and processed meat and colorectal cancer is convincing, the relations with other cancers are unclear. In this review, we summarize cohort studies conducted by the National Cancer Institute on meat and dairy intake in relation to cancer since the 2007 WCRF/AICR report. We also report the findings of meta-analyses published since 2007. PMID:24847855

  8. Clostridium difficile in Retail Meats

    Centers for Disease Control (CDC) Podcasts

    Clostridium difficile is a common cause of diarrhea in healthcare settings but little is known about what causes cases in the community. In this podcast, CDC's Dr. L. Clifford McDonald discusses two papers in the May 2009 edition of Emerging Infectious Diseases that explore whether the organism could be found in meat samples purchased in grocery stores in Arizona and Canada.

  9. High pressure processing of meat

    DEFF Research Database (Denmark)

    Grossi, Alberto; Christensen, Mette; Ertbjerg, Per

    the rheological properties of pork meat batters by inducing formation of protein gels. HP induced protein gels are suggested to be formed by high molecular weight myofibrillar protein aggregates and by peptides formed by lysosomal enzyme-induced cleavage of myofibrillar proteins. Perspectives: The data presented...

  10. Fetal programming in meat production.

    Science.gov (United States)

    Du, Min; Wang, Bo; Fu, Xing; Yang, Qiyuan; Zhu, Mei-Jun

    2015-11-01

    Nutrient fluctuations during the fetal stage affects fetal development, which has long-term impacts on the production efficiency and quality of meat. During the early development, a pool of mesenchymal progenitor cells proliferate and then diverge into either myogenic or adipogenic/fibrogenic lineages. Myogenic progenitor cells further develop into muscle fibers and satellite cells, while adipogenic/fibrogenic lineage cells develop into adipocytes, fibroblasts and resident fibro-adipogenic progenitor cells. Enhancing the proliferation and myogenic commitment of progenitor cells during fetal development enhances muscle growth and lean production in offspring. On the other hand, promoting the adipogenic differentiation of adipogenic/fibrogenic progenitor cells inside the muscle increases intramuscular adipocytes and reduces connective tissue, which improves meat marbling and tenderness. Available studies in mammalian livestock, including cattle, sheep and pigs, clearly show the link between maternal nutrition and the quantity and quality of meat production. Similarly, chicken muscle fibers develop before hatching and, thus, egg and yolk sizes and hatching temperature affect long-term growth performance and meat production of chicken. On the contrary, because fishes are able to generate new muscle fibers lifelong, the impact of early nutrition on fish growth performance is expected to be minor, which requires further studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Meeting the demand for meat?

    NARCIS (Netherlands)

    Yates-Doerr, E.

    2012-01-01

    Renewed fears expressed by the United Nations about worldwide population growth have coincided with international concerns about the increased consumption of meat. This article, which draws upon long-term fieldwork in the Guatemalan highlands and ongoing scientific research in the Netherlands,

  12. Toxinotyping and antimicrobial susceptibility of enterotoxigenic Clostridium perfringens isolates from mutton, beef and chicken meat.

    Science.gov (United States)

    Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair

    2015-08-01

    A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.

  13. Prevalence and Antibiotic Susceptibility of Campylobacter species Isolated From Chicken and Beef Meat

    Directory of Open Access Journals (Sweden)

    Hossein Dabiri

    2014-05-01

    Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.

  14. [Control of toxicity of Sarcocystis fayeri in horsemeat by freezing treatment and prevention of food poisoning caused by raw consumption of horsemeat].

    Science.gov (United States)

    Harada, Seiya; Furukawa, Masato; Tokuoka, Eisuke; Matsumoto, Kazutoshi; Yahiro, Shunsuke; Miyasaka, Jiro; Saito, Morihiro; Kamata, Yoichi; Watanabe, Maiko; Irikura, Daisuke; Matsumoto, Hiroshi; Sugita-Konishi, Yoshiko

    2013-01-01

    More than 27 outbreaks per year of food poisoning caused by consuming horse meat were reported in Kumamoto Prefecture (including Kumamoto City) from January 2009 to September 2011. It was found that the causative agent of the outbreaks was a protein with a molecular weight of 15 kDa that had originated from bradyzoites of Sarcocystis fayeri parasitizing the horse meat. Rabit ileal loop tests showed that pepsin treatment of homogenates of frozen horse meat containing the cysts of S. fayeri induced loss of toxicity, presumably by digestion of the proteinous causative agent(s). Slices of horse meat containing the cysts were frozen at below -20°C for various periods. The cysts were collected after thawing the slices, then treated in an artificial stomach juice containing pepsin. The bradyzoites of the cysts kept at -20°C for 48 hr or more completely disappeared. Simultaneously, the 15 kDa protein also disappeared in the frozen cysts. After notifying the public and recommending freezing treatment of horse meat, no subsequent cases of food poisoning were reported. This indicates that freezing of horse meat is effective to prevent the occurrence of food poisoning caused by consuming raw horse meat containing S. fayeri.

  15. Salmonella in meats, water, fruit and vegetables as disclosed from testing undertaken by Food Business Operators in Ireland from 2005 to 2009

    Directory of Open Access Journals (Sweden)

    Duggan Sharon

    2012-09-01

    Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.

  16. Effect of radiation processing on meat tenderisation

    Science.gov (United States)

    Kanatt, Sweetie R.; Chawla, S. P.; Sharma, Arun

    2015-06-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour.

  17. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  18. Radiation sterilization of some cosmetic raw materials and preparations

    International Nuclear Information System (INIS)

    Achmatowicz-Szmajke, T.; Bryl-Sandelewska, T.; Galazka, M.

    1979-01-01

    The problem of microbiological purity of cosmetic preparations is discussed. Some results obtained on the influence of ionizing radiation on organoleptic and physicochemical properties of some cosmetic raw materials and final products are reported. The samples of raw materials and the final products were irradiated with a 10 MeV electron beam from an LAE 13/9 linear accelerator located in INR. The doses delivered to the materials were 0.5 - 2.3 Mrad (5-23 kGy). Immediately after irradiation, organoleptic estimations were made and over the next few days physicochemical investigations were performed. Non-irradiated samples were investigated together with irradiated ones. (T.I.)

  19. Nutritional evaluation of lowering consumption of meat and meat products in the Nordic context

    DEFF Research Database (Denmark)

    Tetens, Inge; Hoppe, Camilla; Frost Andersen, Lene

    The World Cancer Research Fund (WCRF) recommended in 2007 that consumer intake of red meat is minimized and processed meat eliminated. The recommendation was based on a systematic review of the available literature on the association between meat consumption and cancer. The recommendation...... to individuals was to ingest less than 500 grams of red meat per weeks, and very little - if anything - processed meats. In a new study, National Food Institute has assessed the nutritional consequences from living the recommendations of the WCRF, in Norway, Sweden, Finland and Denmark. The current consumption...... of meat in the Nordic countries is not far from the level WCRF has proposed on an individual level. The study also shows that it will have no significant nutritional consequences to reduce the intake of meat to the recommended, neither when it comes to red meat nor processed meat....

  20. Of Meat and Men: Sex Differences in Implicit and Explicit Attitudes Toward Meat

    Directory of Open Access Journals (Sweden)

    Hamish J. Love

    2018-04-01

    Full Text Available Modern attitudes to meat in both men and women reflect a strong meat-masculinity association. Sex differences in the relationship between meat and masculinity have not been previously explored. In the current study we used two IATs (implicit association tasks, a visual search task, and a questionnaire to measure implicit and explicit attitudes toward meat in men and women. Men exhibited stronger implicit associations between meat and healthiness than did women, but both sexes associated meat more strongly with ‘healthy’ than ‘unhealthy’ concepts. As ‘healthy’ was operationalized in the current study using terms such as “virile” and “powerful,” this suggests that a meat-strength/power association may mediate the meat-masculinity link readily observed across western cultures. The sex difference was not related to explicit attitudes to meat, nor was it attributable to a variety of other factors, such as a generally more positive disposition toward meat in men than women. Men also exhibited an attention bias toward meats, compared to non-meat foods, while females exhibited more caution when searching for non-meat foods, compared to meat. These biases were not related to implicit attitudes, but did tend to increase with increasing hunger levels. Potential ultimate explanations for these differences, including sex differences in bio-physiological needs and receptivity to social signals are discussed.

  1. Effect of direct adding oregano essential oil (Origanum syriacum L.) on quality and stability of chicken meat patties

    OpenAIRE

    AL-HIJAZEEN, Marwan

    2017-01-01

    Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1) control (no additive); (2) 100 ppm oregano essential oil (OE); (3) 150 ppm OE; (4) 300 ppm L-ascorbic acid (E-300); (5) 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320) for both breast and thigh meat respectively, and 6) 150 ppm Sodium nitrite (E-250), wer...

  2. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P. [All-Russia Research Institute of Preservation Technology (Russian Federation); Egorkin, A. V.; Chasovskikh, A. V. [Research Institute of Technical Physics and Automation (Russian Federation); Pavlov, Yu. S., E-mail: rad05@bk.ru [Frumkin Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences (Russian Federation); Prokopenko, A. V., E-mail: pav14@mail.ru [National Research Nuclear University (Moscow Engineering Physics Institute) (Russian Federation); Strokova, N. E. [Moscow State University (Russian Federation); Artem’ev, S. A. [Russian Research Institute of Baking Industry (Russian Federation); Polyakova, S. P. [Russian Research Institute of Confectionery Industry (Russian Federation)

    2016-12-15

    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  3. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    International Nuclear Information System (INIS)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P.; Egorkin, A. V.; Chasovskikh, A. V.; Pavlov, Yu. S.; Prokopenko, A. V.; Strokova, N. E.; Artem’ev, S. A.; Polyakova, S. P.

    2016-01-01

    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  4. Organic beef production by Maremmana breed: qualitative meat characteristics

    OpenAIRE

    Mele, Prof. Marcello; Morbidini, Prof. Luciano; Cozza, Dr. Francesca; Pauselli, Prof. Mariano; Pollicardo, Dr. Alice

    2008-01-01

    Meat quality of Maremmana young bulls and steers was evaluated during three consecutive years, according to an extension service experimental program. Cooking loss values of meat samples were lower in meat from steers, whereas shear force values were higher. Meat from steers was darker than meat from young bulls, as a consequence of a low level of Lightness and a high level of Chroma. Meat chemical composition showed a higher content of intramuscular fat in steer meat, which showed also a low...

  5. Control of salmonella in meat and meat products by irradiation

    International Nuclear Information System (INIS)

    Dempster, J.F.

    1985-01-01

    This paper highlights the importance of food irradiation in the protection of the public against food poisoning from eating meat or meat products contaminated with salmonella. Salmonella infections are increasing at an alarming rate (2000 in 1952 to 12000 reported cases in 1982 in England and Wales alone). Dr. Dempster reports that 50% of the chicken carcasses examined by workers in America were found to be salmonella contaminated. Use of irradiation in conjunction with mild refrigeration can extend the shelf-life of vacuum packed chicken by a factor of three. Important legislation now under discussion in the U.S.A. is likely to extend the applicability of food irradiation rapidly in the near future

  6. Remediation of raw sewage water by ionizing radiation

    International Nuclear Information System (INIS)

    El-Motaium, R.A.; Laroussi, B.F.

    2007-01-01

    Raw sewage water has been used for irrigation in many countries in the world including Egypt. Although the reuse of sewage water for irrigation has become essential, this practice could represent a hazard to the environment and human health. Radiation treatment was applied to test its effect on the remediation of raw sewage water collected from the inlet of El-Gabal El-Asfar Waste Water Treatment Plant, north east of Cairo city. Different doses of gamma radiation and electron beam ( 0.5, 1.0, 1.5, 2.0, 2.5 KGy) were tested for their effects on raw sewage water properties. The parameters tested were total Coliform, BOD, COD, TSS, ph, EC, heavy metals, NH 4 and NO 3 . The data showed an inverse relationship between radiation dose and total Coliform, BOD, COD and TSS. This result proved true for both kinds of radiations. However, the effect of gamma radiation was more pronounced than the electron beam at the same dose. The lethal doses for total Coliform were 1.5 KGy and 3.0 KGy for gamma radiation and electron beam, respectively. Regarding ammonium and nitrate ions, there was a reduction in their content as the radiation dose increased. The reduction was 20% for NH 4 and 21% for NO 3 at 2.5 KGy dose using gamma or electron beam, respectively. The total heavy metals levels were 40.0, 5.8, 55.9, 0.55, 32.2 and 16.4 ppb for Ni, Co, Cu, Cd, Pb and Zn. The soluble fraction were 19.5, 3.3, 8.3, 0.02, 0.50, 3.1 ppb representing 49%, 58%, 15%, 3%, 1.6% and 19% of the total Ni, Co, Cu, Cd, Pb and Zn, respectively. In general, there was a tendency for reduction of the soluble fractions of heavy metals as the radiation dose increased

  7. Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.

    Science.gov (United States)

    Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander

    2016-01-01

    Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.

  8. Immunofluorescent determination of wheat protein in meat products

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2014-02-01

    Full Text Available In food industry nowadays, there are various plant-origin protein additives which are meant for production of meat products. Among the most frequent additives of this type there are different kinds of flour, starch, fiber, and plant-origin proteins. Their usage at present is limited by the existing legislation not to prevent consumer deception but also for reasons of possible influence on consumer health. Therefore, this problem is paid a lot of attention not only in the Czech Republic but also all over the world. The main risk is seen in the impossibility to choose a suitable foodstuff for an individual prone to allergic reactions. Potential allergens are also often plant-origin raw materials which are added into foodstuffs for their technological qualities and low price. Wheat is widely cultivated cereal as well as an important source of proteins. After ingestion or inhalation, wheat proteins may cause adverse reactions. These adverse effects include a wide range of disorders which are dependent on the method of contact with wheat protein. These adverse effects can then take the form of various clinical manifestations, such as celiac disease, T-cell mediated inflammatory bowel disease, dermatitis, skin rash, breathing difficulties, allergy to pollen or to wheat flour or food allergy to foodstuffs containing gluten. The only possible protection against adverse immune reactions for those with food allergies is strictly excluding the allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. In order to avoid misleading consumers and also to protect allergic consumers, analytical methods applicable to all types of foodstuffs have been developed. Unfortunately, detection of allergens in

  9. Raw materials policy: implications for Germany

    Energy Technology Data Exchange (ETDEWEB)

    Gaertner, E

    1978-04-01

    The contribution characterizes the situation of the national mining industry in 1977, deals with international raw materials policies within the framework of the North-South dialogue and with the policies of the western industrial countries, points out the dangers of worldwide state-controlled raw materials policies and calls for a) the political risk of enterprise cooperation with developing countries to be covered and b) double taxation to be avoided. Finally, the problems of securing the Federal Republic of Germany's raw materials supplies on a long-term basis are portrayed.

  10. Characteristics and consumer acceptance of healthier meat and meat product formulations-a review.

    Science.gov (United States)

    Hathwar, Swapna C; Rai, Amit Kumar; Modi, Vinod Kumar; Narayan, Bhaskar

    2012-12-01

    Awareness of health and nutrition has led to the development of "functional foods" which is a new approach to achieve healthier status thus reducing the risk of diseases. Meat has been highly exploited as a functional ingredient/food in recent years wherein meat has either been modified or incorporated into non meat products. Changing consumer demand has influenced the market for all types of meat. The development and marketing the functional foods can be, however, very challenging compared to the foods that conventionally have a high health image. This review gives the overall perception about importance of using meat/meat products as a functional food.

  11. [Proximal chemical composition and functional properties of fresh meat of crab claws (Homalaspis plana)].

    Science.gov (United States)

    Abugoch, L; Barrios, J; Guarda, A

    1996-12-01

    The research of alternative technological processes is being necessary in order to obtain a better utilization of hydrobiologic resources and food products, with higher added value. Crab (Homolaspis plana) is a crustacean found along the Chilean coast, whose flesh is exported as a frozen product. The resource crab is scantly studied in Chile and could became an excellent raw material for "delicatessen" products, with a high market value. The proximal composition, through the protein, fat, moisture and ashes content was determined. The non nitrogen extract was calculated by difference. The functional properties (water retention, emulsifying and gel-forming capacities) of fresh crab claws meat without additives were measured. The proximal composition for the claw meat was: 79,34 +/- 1.12% moisture, 16.75 +/- 1.29% protein, 1.86 +/- 0.11% ashes, 0.11 +/- 0.01 fat % and 1.93 +/- 1.07% N.N.E. In relation with the emulsifying capacity, claw meat was able to emulsify 2,259.03 +/- 73.04 g vegetal oil/g protein. The water retention was 154.49 +/- 6.85% representing the increase in mass percent; and the force of the gel formed in claw meat was 195.3 +/- 17.16 g-force x cm. According to these results, the claw crab is an attractive food, with a high protein and low fat content. Crab meat showed an excellent emulsifying capacity and water retention, so it can be used as a good raw material for the development of smearing products. In the case of gel-like products, further studies will be required, in order to optimize the conditions in which a stronger gel could be obtained.

  12. Developments and competitiveness of Mozambican chicken meat industry

    Directory of Open Access Journals (Sweden)

    Carlos Alberto de Oliveira

    2015-12-01

    Full Text Available Mozambican poultry industry might be an option to facilitate people's access to animal protein, as well as to reduce the dependence on imports of the product, bringing jobs and income forth. This study aimed to characterize and to analyze the competitiveness of poultry industry in Mozambique. Porter’s Five Forces Model, which focuses on the five strengths that shape business competition, was applied. The results show a low level of competition within the industry, a limited supply of raw material and the fact that national products are commodities and competes with strong foreign participants. Domestic demand for chicken meat is increasing, but buyers base their decision mainly on price. Challenges include establishment of governance structure and policies for poultry sector and consumer welfare. Another alternative to improve the poultry industry in Mozambique is to promote technical cooperation with other countries, such as Brazil, in order to acquire specific structures for chicken production, genetic material and adequate nutrition.

  13. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  14. Raw oysters can be a risk for infections

    Directory of Open Access Journals (Sweden)

    Regine Helena Silva dos Fernandes Vieira

    Full Text Available The aims of this study were to count and identify sucrose positive and negative vibrios isolated from cultivated Crassostrea rhizophorae oysters during their growing cycle. Every month for 12 months, 10 to 18 oysters were collected for study. Collections occurred at the Center for Studies of Coastal Aquaculture (CSCA, which is associated with the Institute of Marine Science, Labomar, located in Euzebio, Ceará, Brazil. Approximately 150 oysters and their intervalvular liquor were studied. Vibrio Standard Plates Counts (SPC from oyster meat and their intervalvular liquor varied from 25 to 59,000,000 CFU/g. For most of the 12 months of the oysters' life, it was possible to identify Vibrio parahaemolyticus. Vibrio carchariae was identified in four collections. Among other isolated species, the most important, considering public health risks, was V. vulnificus, although only one strain was confirmed. We concluded that retail purchased oysters should never be eaten raw or undercooked because many species of the genus Vibrio are known to be pathogenic to humans and live naturally on and in shellfish throughout their life cycle.

  15. Concentrations of environmental organic contaminants in meat and meat products and human dietary exposure: A review.

    Science.gov (United States)

    Domingo, José L

    2017-09-01

    Meat and meat products is one of the most relevant food groups in an important number of human diets. Recently, the IARC, based on results of a number of epidemiological studies, classified the consumptions of red meat and processed meat as "probably carcinogenic to humans" and as "carcinogenic to humans", respectively. It was suggested that the substances responsible of the potential carcinogenicity would be mainly generated during meat processing, such as curing and smoking, or when meat is heated at high temperatures. However, the exposure to environmental pollutants through meat consumption was not discussed. The purpose of the present paper was to review recent studies reporting the concentrations of PCDD/Fs, DL-PCBs and PAHs in meat and meat products, as well as the human exposure to these pollutants through the diet. It is concluded that the health risks derived from exposure to carcinogenic environmental contaminants must be considered in the context of each specific diet, which besides meat and meat products, includes other foodstuffs containing also chemical pollutants, some of them with carcinogenic potential. Anyhow, meat and meat products are not the main food group responsible of the dietary exposure to carcinogenic (or probably carcinogenic) environmental organic pollutants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Quality quantification model of basic raw materials

    Directory of Open Access Journals (Sweden)

    Š. Vilamová

    2016-07-01

    Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.

  17. raw data collected from Malvern Instrument

    Data.gov (United States)

    U.S. Environmental Protection Agency — These are raw data/image files from the Malvern Zetasizer Instrument. This dataset is associated with the following publication: Buse, H., J. Hoelle, C. Muhlen, and...

  18. Annual report 1997. Energies and raw materials

    International Nuclear Information System (INIS)

    1997-01-01

    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  19. Aluminium reprocessing with local mineral raw material

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.

    2002-01-01

    With the purpose of utilization of ice sediment, receiving from mud fields solutions and flotation tails and at using local aluminium and fluorine-containing raw material was elaborated fundamental technologic scheme presented in this chapter of book

  20. Meat-based enteral nutrition

    Science.gov (United States)

    Derevitskay, O. K.; Dydykin, A. S.

    2017-09-01

    Enteral nutrition is widely used in hospitals as a means of nutritional support and therapy for different diseases. Enteral nutrition must fulfil the energy needs of the body, be balanced by the nutrient composition and meet patient’s nutritional needs. Meat is a source of full-value animal protein, vitamins and minerals. On the basis of this research, recipes and technology for a meat-based enteral nutrition product were developed. The product is a ready-to-eat sterilised mixture in the form of a liquid homogeneous mass, which is of full value in terms of composition and enriched with vitamins and minerals, consists of particles with a size of not more than 0.3 mm and has the modified fat composition and rheological characteristics that are necessary for passage through enteral feeding tubes. The study presents experimental data on the content of the main macro- and micro-nutrients in the developed product. The new product is characterised by a balanced fatty acid composition, which plays an important role in correction of lipid metabolism disorders and protein-energy deficiency, and it is capable of satisfying patients’ daily requirements for vitamins and the main macro- and microelements when consuming 1500-2000 ml. Meat-based enteral nutrition can be used in diets as a standard mixture for effective correction of the energy and anabolic requirements of the body and support of the nutritional status of patients, including those with operated stomach syndrome.

  1. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  2. Effect of storage and cooking on the fatty acid profile of omega-3 enriched eggs and pork meat marketed in Belgium.

    Science.gov (United States)

    Douny, Caroline; El Khoury, Rawad; Delmelle, Julien; Brose, François; Degand, Guy; Moula, Nassim; Farnir, Frédéric; Clinquart, Antoine; Maghuin-Rogister, Guy; Scippo, Marie-Louise

    2015-03-01

    The fatty acids (FA) profile was determined in n-3 enriched (Columbus™) Belgian eggs and pork in order to evaluate to what extent the n-3 fatty acids, which are very sensitive to oxidation, are resistant to storage or cooking. In standard eggs or pork, no change of the fatty acid profile was observed after storage or cooking without culinary fat, as well as in Columbus™ eggs and pork after storage. Some cooking processes (eggs in custard and meat in oven) induced a slight significant loss of n-3 fatty acids in Columbus™ eggs or pork (11.1% in fat from eggs cooked in custard vs. 15.3% in raw Columbus™ eggs and 11.0% in fat from oven cooked meat vs. 11.6% in raw Columbus™ meat). As expected, when Columbus™ pork is cooked with culinary fat, its fatty acid profile is modified according to the nature of the fat used.

  3. Plastic raw materials in Neolithic pottery production

    Directory of Open Access Journals (Sweden)

    Alexander A. Bobrinsky

    2012-12-01

    Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.

  4. Price stabilization for raw jute in Bangladesh

    OpenAIRE

    Takamasa Akiyama; Varangis, Panos

    1991-01-01

    Fluctuating prices for raw jute have been viewed as contributing to economic problems in the jute subsector. Price fluctuations were thought to reduce the jute farmers'welfare and there has been concern about the costs of parastatals'stocking operations in attempts to stabilize jute prices and incomes. The authors examine these fluctuations and analyze policies that might reduce them. They find that price fluctuations for raw jute reduce farmers'welfare only slightly because farmers'activitie...

  5. The Influence of Moderate Pressure and Subzero Temperature on the Shelf Life of Minced Cod, Salmon, Pork and Beef Meat

    Directory of Open Access Journals (Sweden)

    Ilona Kołodziejska

    2013-01-01

    Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.

  6. Isolation of Toxoplasma gondii from horse meat in Egypt.

    Science.gov (United States)

    Shaapan, R M; Ghazy, A A

    2007-01-01

    Portions of heart, liver, skeletal and diaphragmatic muscles obtained from 150 slaughtered horses at Giza-Zoo abattoir were used for bioassays in mice and cats. T. gondii tachyzoites were isolated successfully from the peritoneal exudates of the inoculated mice 6-8 days post inoculation with pooled horse tissues. Whereas, T. gondii tissue cysts containing bradyzoites were detected in the impression smears of mice brain on the 45th days or more post infection. The oocysts were detected in feces of cats 3-6 days post feeding on horse tissues containing tissue cysts. The oocysts became sporulated within 3-5 days in 2.5% Potassium dichromate. A total of 79 out of 150 horse meat samples were found to be infected with an incidence rate of 52.6 %. This is the first trial for isolation of T. gondii infective stages from horses in Egypt. Moreover, this study pointed out to the high infection rate of T. gondii in horse meat which may be considered as an important source of infection to wild zoo-animals in Egypt and humans in some countries if consumed raw or insufficiently cooked.

  7. The complete raw workflow guide how to get the most from your raw images in Adobe Camera Raw, Lightroom, Photoshop, and Elements

    CERN Document Server

    Andrews, Philip

    2007-01-01

    One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl

  8. The Ethics of Producing In Vitro Meat.

    Science.gov (United States)

    Schaefer, G Owen; Savulescu, Julian

    2014-05-01

    The prospect of consumable meat produced in a laboratory setting without the need to raise and slaughter animals is both realistic and exciting. Not only could such in vitro meat become popular due to potential cost savings, but it also avoids many of the ethical and environmental problems with traditional meat productions. However, as with any new technology, in vitro meat is likely to face some detractors. We examine in detail three potential objections: 1) in vitro meat is disrespectful, either to nature or to animals; 2) it will reduce the number of happy animals in the world; and 3) it will open the door to cannibalism. While each objection has some attraction, we ultimately find that all can be overcome. The upshot is that in vitro meat production is generally permissible and, especially for ethical vegetarians, worth promoting.

  9. Meat and colo-rectal cancer.

    Science.gov (United States)

    Hill, M J

    1999-05-01

    In early epidemiological studies of diet and cancer the stress was on the search for causal factors. Population (ecological) studies tended to show a strong correlation between meat intake, particularly red meat, and the risk of colo-rectal cancer. They also tended to show meat to be strongly inversely correlated with cancers of the stomach and oesophagus and liver. Early case-control studies tended to support the postulated role for red meat in colo-rectal carcinogenesis, although more recent case-control studies, particularly those from Europe, have tended to show no relationship. The cohort studies in general failed to detect any relationship between meat intake and colo-rectal cancer risk. The available evidence points to the intake of protective factors such as vegetables and whole-grain cereals being the main determinants of colo-rectal cancer risk, with meat intake only coincidentally related.

  10. Introducing the new meat. Problems and prospects

    Directory of Open Access Journals (Sweden)

    Stellan Welin

    2013-05-01

    Full Text Available Cultured meat, or in vitro meat, is one of the ideas that are being proposed to help solve the problems associated with the ever-growing global meat consumption. The prospect may bring benefit for the environment, climate, and animal ethics, but has also generated doubts and criticism. A discussion of the possible environmental benefit and of animal ethics issues in relation to cultured meat production will be given. A perceived 'unnaturalness' of cultured meat may be one of the strongest barriers for public acceptance. This will be discussed and rejected. As to our relations with nature and animals, it is plausible that cultured meat will lead to improvement rather than to deterioration. The issue of public acceptance and some of the problems of introducing this new product on the market will also be discussed.http://dx.doi.org/10.5324/eip.v7i1.1788

  11. ISMRM Raw data format: A proposed standard for MRI raw datasets

    DEFF Research Database (Denmark)

    Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas

    2016-01-01

    programming languages (C++, MATLAB, Python). Results Images were obtained by reconstructing the raw data from all vendors. The source code, raw data, and images comprising this work are shared online, serving as an example of an image reconstruction project following a paradigm of reproducible research......Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB......, and Python. Converters for Bruker, General Electric, Philips, and Siemens proprietary file formats were implemented in C++. Raw data were collected using magnetic resonance imaging scanners from four vendors, converted to ISMRM Raw Data format, and reconstructed using software implemented in three...

  12. Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia

    DEFF Research Database (Denmark)

    Derra, F. A.; Karlsmose, Susanne; Monga, D. P.

    2013-01-01

    Background. Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. Objective. The objective...... of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Methods. Two hundred forty food samples were purchased...

  13. Levels of inclusion in cassava bagasse chicken feed of slow growth: physical and chemical characteristics of meat

    Directory of Open Access Journals (Sweden)

    Aline Ferreira Amorim

    2015-06-01

    Full Text Available The purpose of this study the effect of inclusion levels (0, 10, 20 and 30% of cassava bagasse (BM to the diet on the physical and chemical parameters of raw and cooked meat thigh , drumstick and breast of chicken was to evaluate cutting hillbilly kind of lineage Label rouge® slaughtered at 84 days of age . Analyzes were performed in the laboratory of Animal Nutrition , Universidade Federal do Tocantins – UFT, Escola de Medicina Veterinária e Zootecnia , Campus Araguaína . Forty chicken carcasses, which were divided into half-carcases, half-carcases and 10 for analysis of the chemical composition of raw meat and the other 10 half-carcasses for analysis of chemical composition of cooked meat , they are included in these analyzes the crude protein (CP, ether extract ( EE, dry matter (DM and ash (CZ, with base on the percentage of dry matter, in addition to gross energy (GE and cooking losses. Analyzes were also conducted of the physical attributes of meat (color, pH and texture other 20 half-carcasses. The inclusion of BM in the diet of broilers caipira type cut and cooking affected (P <0.05 the chemical characteristics of meat. Observed in thigh meat linear reduction in the deposition of CZ and linear increase in deposition of PB. Drumstick meat in CP content increased up to the level of 17.22% inclusion of BM corresponding to the deposition of 84.21% CP; and lower levels of EE (19.21% was found in the estimated level of 21.33% inclusion of BM. In breast meat was observed deposition of 29.56% with 2.35% DM inclusion of BM deposition and 88.56% to 13.46% of CP inclusion of BM. However the physical characteristics of meat were not influenced by the levels of inclusion of BM. It is recommended, with base on the chemical composition of the meat, to use up the 20% level of inclusion of BM.

  14. Safety criteria for the acquisition of meat in Brazilian University restaurants

    Directory of Open Access Journals (Sweden)

    Marizete Oliveira de Mesquita

    2014-03-01

    Full Text Available The present study's objective was to analyze the procedures aimed at guaranteeing sanitary conditions when acquiring meat. The study was conducted with university restaurants of the Federal Institutions of Higher Education (IFES located in the five regions of Brazil. Data were collected using a questionnaire and an evaluation list, which was available online to restaurant professionals. The results showed that restaurants chose one or two types of meat, the most frequent of which were beef and chicken. In restaurants managed by the IFES, the acquisition of raw material occurred by bidding. For vendor selection, the restaurants required product registration with the Inspection Service and requested regulation of the supplier by the Health Surveillance. Monitoring was carried out through a technical visit to the supplier and a review of the past records of the supplier. A higher percentage of restaurants in the Southeast region met appropriate sanitary and hygienic criteria for the receipt of meat, followed by the South, Midwest, Northeast and North. We conclude that restaurants meet most of the safety criteria set in the legislation. However, some weaknesses are evident in the physical and functional structure, the system of transportation of raw material and the records of control measures at the place of reception.

  15. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  16. The development of meat pate with increased the food and biological values with germinated grains lentils

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2016-01-01

    Full Text Available One of the important technological trends in food production, balanced on the chemical and amino acid composition is the development of methods for enrichment product protein, vitamins and minerals. The solution to this problem has long been used a method of enrichment of vegetable raw materials to create a nutrient and healthy products available to different social groups. In theory justified the choice of research object – lentils, which have a number of advantages in food systems. Analyzed method of increasing the biological value of the object in the process of germination grains and marked improvement the balance of amino acid composition. Designed meat pate with using germination grains and investigated its main functional-technological (FTC, organoleptic properties and digestibility. In determining, the functional-technological characteristics revealed an increase in FTC-indicators, such as water binding, water holding, fat holding, and emulsifying ability when you add germination lentils. According to the results of organoleptic evaluation revealed improvement in the consistency of meat pate, when replacing 50% of raw meat, germination lentils, and in appearance, color, smell and taste, control and test products are almost identical. The digestibility of the paste was 97%. Proposed different options of using germination grains of lentils to create a products for public and preventive nutrition.

  17. Ochratoxin A reduction in meat sausages using processing methods practiced in households.

    Science.gov (United States)

    Pleadin, Jelka; Perši, Nina; Kovačević, Dragan; Vulić, Ana; Frece, Jadranka; Markov, Ksenija

    2014-01-01

    The aim of this study was to investigate the possibilities of ochratoxin A (OTA) reduction in home-made meat products. Meat sausages (n = 50) produced from raw materials coming from pigs exposed to OTA-contaminated feed, were subject to common heat processes practiced in households (cooking, frying and baking). Concentrations of OTA in pre- and post-processed products were quantified using a validated immunoassay method, enzyme-linked immunosorbent assay, and confirmed using a high-performance liquid chromatography with fluorescence detection. In line with the differences in recipes used and the degree of OTA accumulation in raw materials, OTA concentrations established in Mediterranean and roast sausages were lower than those found in liver and blood sausages. Baking of contaminated sausages at the temperatures of 190-220°C (for 60 min) resulted in significant reduction of OTA levels (75.8%), while 30-min cooking (at 100°C) and frying (at 170°C) proved to be significantly less effective (e.g. yielding OTA reductions of 7.4% and 12.6%, respectively). The results pointed out that despite high OTA stability, heat processes are capable of reducing its concentration in home-made meat products, depending on the processing modality used.

  18. Effects of gamma irradiation on raw materials and perfumes

    International Nuclear Information System (INIS)

    Guillot, M.; Pelpel, A.

    1983-01-01

    In order to enlight the strange problem of apparent perfume stability observed in manufactured talc powders sterilized by gamma rays, investigations were made on samples of odorant substances (raw materials, essential oils, or elaborated mixtures). As a rule, no immediate adulteration of olfactive caracteristics resulted at once from gamma irradiation. In several cases, a stabilizing effect appeared immediately and remained effective after long storage in various conditions (of temperature, or light, or oxygen exposure). This unexpected effect seems to be in accordance with previous experiments on gamma or electron irradiations of mixtures of organic molecules, reported in litterature: a mutual inhibition was observed to take place [fr

  19. Flavour Chemistry of Chicken Meat: A Review

    OpenAIRE

    Jayasena, Dinesh D.; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun

    2013-01-01

    Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds res...

  20. MEAT GOAT DEMOGRAPHICS AND NICHE MARKETING

    OpenAIRE

    Jeffrey Fisher; Richard Stock; David A. Mangione; Larry A. Nye

    2009-01-01

    Six focus groups were conducted with each having ten people who attend different Islamic Centers in Ohio. The objective of the focus groups was to understand Halal meat purchase patterns and consumption patterns of the Moslem population with special attention to goat. The Ohio State University Extension personnel are utilizing these results to work with meat goat producers to understand and meet the requirements of the Halal meat market.  Participants discussed the Zabiha approach to slaught...

  1. Benevolent technotopias and hitherto unimaginable meats: Tracing the promises of in vitro meat

    OpenAIRE

    Jönsson, Erik

    2016-01-01

    Today, in vitro (Latin: in glass) meat researchers strive to overhaul meat production technologies by producing meat outside animal bodies, primarily by culturing cells. In the process, meat should become healthier, more environmentally friendly and kinder to animals. In this article, I scrutinize (and problematize) this promissory discourse by examining the world that proponents envision alongside the world from which promises emerge. First, I trace the increasing number of publications stri...

  2. Characteristics and consumer acceptance of healthier meat and meat product formulations—a review

    OpenAIRE

    Hathwar, Swapna C.; Rai, Amit Kumar; Modi, Vinod Kumar; Narayan, Bhaskar

    2011-01-01

    Awareness of health and nutrition has led to the development of “functional foods” which is a new approach to achieve healthier status thus reducing the risk of diseases. Meat has been highly exploited as a functional ingredient/food in recent years wherein meat has either been modified or incorporated into non meat products. Changing consumer demand has influenced the market for all types of meat. The development and marketing the functional foods can be, however, very challenging compared t...

  3. An Insight of Meat Industry in Pakistan with Special Reference to Halal Meat: A Comprehensive Review

    OpenAIRE

    Sohaib, Muhammad; Jamil, Faraz

    2017-01-01

    Livestock is considered central component in agricultural sector of Pakistan, provides employment to more than 8 million families. Meat and meat products holds pivotal significance in meeting dietary requirements serving as major protein source and provide essential vitamins and minerals. Globally, consumer demand is increasing for healthy, hygienic and safe meat and meat products due to growing population, income level and food choices. As, food choices are mainly influenced by region, relig...

  4. 9 CFR 311.38 - Meat and meat byproducts from livestock which have been exposed to radiation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat and meat byproducts from... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DISPOSAL OF DISEASED OR OTHERWISE ADULTERATED CARCASSES AND PARTS § 311.38 Meat and meat byproducts from livestock which have been...

  5. Environmental impacts of cultured meat production.

    Science.gov (United States)

    Tuomisto, Hanna L; de Mattos, M Joost Teixeira

    2011-07-15

    Cultured meat (i.e., meat produced in vitro using tissue engineering techniques) is being developed as a potentially healthier and more efficient alternative to conventional meat. Life cycle assessment (LCA) research method was used for assessing environmental impacts of large-scale cultured meat production. Cyanobacteria hydrolysate was assumed to be used as the nutrient and energy source for muscle cell growth. The results showed that production of 1000 kg cultured meat requires 26-33 GJ energy, 367-521 m(3) water, 190-230 m(2) land, and emits 1900-2240 kg CO(2)-eq GHG emissions. In comparison to conventionally produced European meat, cultured meat involves approximately 7-45% lower energy use (only poultry has lower energy use), 78-96% lower GHG emissions, 99% lower land use, and 82-96% lower water use depending on the product compared. Despite high uncertainty, it is concluded that the overall environmental impacts of cultured meat production are substantially lower than those of conventionally produced meat.

  6. Improvement of organic meat products nutrition

    OpenAIRE

    Žilytė, Eglė

    2016-01-01

    The aim of the research: to improve the food value indicators of cold-smoked organic meat and implement the quality requirements, which are raised for a national meat products of the company X. To answer the purpose it has been created a new recipe for cold-smoked sausage and cold-smoked minced sausage by using the produced meat in the farm X. It has been evaluated the compliance of the national products quality with the index of food value of improved cold-smoked meat products. It has bee...

  7. Longissimus muscle transcriptome profiles related to carcass and meat quality traits in fresh meat Pietrain carcasses

    NARCIS (Netherlands)

    Pas, te M.F.W.; Keuning, E.; Hulsegge, B.; Hoving-Bolink, A.H.; Evans, G.; Mulder, H.A.

    2010-01-01

    High quality pork is consumed as fresh meat while other carcasses are used in the processing industry. Meat quality is determined measuring technical muscle parameters. The objective of this research was to investigate the molecular regulatory mechanisms underlying meat quality differences of pork

  8. 9 CFR 319.761 - Potted meat food product and deviled meat food product.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  9. Meat consumption, meat cooking and risk of lung cancer among Uruguayan men.

    Science.gov (United States)

    De Stefani, Eduardo; Ronco, Alvaro L; Boffetta, Paolo; Deneo-Pellegrini, Hugo; Acosta, Gisele; Mendilaharsu, María

    2010-01-01

    A case-control study was conducted in Uruguay, including 876 male cases of lung cancer and 876 male hospitalized controls, frequency matched for age (ten-year intervals), residence and hospital. The following explanatory variables were included in the study: fried red meat, barbecued red meat, boiled red meat, and salted red meat. These items were log transformed and energy-adjusted by the residuals method. The following potential confounders were included into the models: age, residence, hospital, education, family history of lung cancer, body mass index, smoking index, alcohol drinking, mate consumption, total energy intake, non-meat fatty foods and total fruits. The main objective was to estimate the odds ratios associated with lung cancer risk. Whereas fried meat, barbecued meat, and salted meat were positively associated with risk (OR of the highest quartile of salted meat versus the lowest, 2.90, 95 % CI 1.99-4.25, p-value for trend<0.0001), boiled red meat was mainly protective. We conclude that salted meat was the main risk factor. The mechanisms could be related to the content of N-nitroso compounds in salted meat.

  10. 9 CFR 319.311 - Chow mein vegetables with meat, and chop suey vegetables with meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chow mein vegetables with meat, and chop suey vegetables with meat. 319.311 Section 319.311 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  11. An Insight of Meat Industry in Pakistan with Special Reference to Halal Meat: A Comprehensive Review.

    Science.gov (United States)

    Sohaib, Muhammad; Jamil, Faraz

    2017-01-01

    Livestock is considered central component in agricultural sector of Pakistan, provides employment to more than 8 million families. Meat and meat products holds pivotal significance in meeting dietary requirements serving as major protein source and provide essential vitamins and minerals. Globally, consumer demand is increasing for healthy, hygienic and safe meat and meat products due to growing population, income level and food choices. As, food choices are mainly influenced by region, religion and economic level. However, religion is one of the major factor to influence the food choices. In this context, halal foods a growing trend, trade estimated to cross USD $ 3 trillion and among this, meat sector contribute about US$ 600 billion. Halal meat and allied products is requirement from Muslims but it is also accepted by non-Muslims due to safe and hygienic nature, nutritious value and superior quality. Pakistan meat industry is vibrant and has seen rigorous developments during last decade as government also showed interest to boost livestock production and processing facilities to meet increasing local and global demand. The industry has potential to grow owing to its natural animal rearing capability, muslim majority country (96% of total population), improvisation of market and consumer preference towards halal meat. Current review debates Pakistan meat industry scenario, production trend, global trade as well as future potential with respect to modernization, processing, distribution and trade. The data presented here is useful for meat producers, processors and people involved in export of Pakistani meat and meat based products.

  12. Consumers' motivational associations favoring free-range meat or less meat

    NARCIS (Netherlands)

    de Boer, J.; Boersema, J.J.; Aiking, H.

    2009-01-01

    The present paper analyzed the motivational orientations of consumers who choose to eat (1) small portions of meat or (2) ethically distinctive meat, such as free-range meat, in relation to the motivational orientations of their opposites. Going beyond the conventional approach to consumer behavior,

  13. Dietary Brazilian red pepper essential oil on pork meat quality and lipid oxidation

    Directory of Open Access Journals (Sweden)

    Franz Dias Gois

    Full Text Available ABSTRACT: The purpose of this study was to evaluate the effects of feeding pigs with diets containing increasing levels of Brazilian red pepper essential oil ( Schinus terebinthifolius Raddi on the physical attributes, fatty acid profile and oxidative stability of precooked meat. Seventy-two weanling pigs (5.7±0.8kg were allotted in a completely randomized block design experiment with four treatments, six replicates per treatment, and three animals per experimental unit (pen. Animals were fed with a basal diet supplemented with 0, 500, 1,000, or 1,500mg kg-1 Brazilian red pepper essential oil during the 35-d experimental period. At the end of the experiment, one animal per experimental unit (16.4±2.2kg was slaughtered to sample Longissimus dorsi muscle for analysis. Dietary supplementation of Brazilian red pepper had no effect (P>0.05 on pork meat color, pH, cooking loss and shear force. Inclusion of essential oil in the diet provided a linear increase (P<0.05 of the saturated fatty acids content of L. dorsi, especially myristic (C14:0 and stearic (C18:0 fatty acids. Utilization of essential oil in pig diets reduced significantly the production of secondary lipid oxidation compounds measured as TBARS in raw pork meat (P<0.001 and immediately after cooking (P<0.001. However, during 8-d storage assay, the addition of essential oil in the diet did not protect pork meat lipids from oxidation. Therefore, Brazilian red pepper added to pig diets increased the saturated fatty acids content and reduced lipid oxidation in fresh meat and short-term heat treatment without affecting pork meat physical attributes.

  14. Journey length and high temperatures: effects on rabbit welfare and meat quality.

    Science.gov (United States)

    Liste, G; María, G A; Buil, T; García-Belenguer, S; Chacón, G; Olleta, J L; Sañudo, C; Villarroel, M

    2006-02-01

    The transport of domestic animals by road can increase levels of stress and decrease meat quality, especially in unfavourable climates. The purpose of this study was to investigate the effect of journey duration and vertical position on the transport truck on some physiological indicators of stress and on instrumental meat quality parameters in commercial rabbits. In the summer months (June and July, 2003), 78 rabbits were subjected to either long (7 h) (LJ) or short (1 h) (SJ) journeys (3 replicates each, n = 6) between the farm and an abattoir in northern Spain. The position (top, middle, or bottom) occupied by the rabbits on the Multi-Floor cage Rolling Stand (MFRS) of the transport truck was recorded. Blood samples were collected at sticking and meat pH was measured at 24 h post-mortem (pH24). At 48 h post-mortem, samples of the M. longissimus dorsi were used to determine water-holding capacity (WHC) and instrumental tenderness using an INSTRON machine. The levels of corticosterone, glucose, lactate, and creatine kinase were slightly higher in LJ than in SJ samples, but the difference was not statistically significant (p MFRS showed higher levels (p < or = 0.05) of glucose and creatine kinase (middle), and corticosterone (bottom) than the rabbits located at the top floor. The pH 24 and WHC values of the SJ and LJ rabbits did not differ significantly. Journey length had a significant effect (p < or = 0.01) on meat tenderness. The meat from rabbits subjected to LJ had higher values of maximum stress and total toughness than did the SJ rabbits (p < or = 0.05). There were similar differences (p < or = 0.05) between LJ and SJ rabbits in their stress values of compression at 20% and 40% (measures of the tenderness of raw meat). In hot weather, the position on the transport truck appeared to have a greater effect on rabbit welfare than the duration of the journey.

  15. Radappertization of chicken and pork meat by irradiation

    International Nuclear Information System (INIS)

    Luna C, P.C.

    1992-05-01

    In this report the benefits that presents the irradiation process in the conservation of meat products, as the chicken, head meat and pig meat are analysed, also the implications that it brings in health and economical aspects. (Author)

  16. Biogenic amine formation and nitrite reactions in meat batter as affected by high-pressure processing and chilled storage.

    Science.gov (United States)

    Ruiz-Capillas, C; Aller-Guiote, P; Carballo, J; Colmenero, F Jiménez

    2006-12-27

    Changes in biogenic amine formation and nitrite depletion in meat batters as affected by pressure-temperature combinations (300 MPa/30 min/7, 20, and 40 degrees C), cooking process (70 degrees C/30 min), and storage (54 days/2 degrees C) were studied. Changes in residual nitrite concentration in raw meat batters were conditioned by the temperature and not by the pressure applied. Cooking process decreased (P nitrite concentration in all samples. High-pressure processing and cooking treatment increased (P nitrite concentration decreased with pressure processing, no effect was observed with the heating process of meat batters. High-pressure processing conditions had no effect on the rate of residual nitrite loss throughout the storage. The application of high pressure decreased (P processing conditions, generally, throughout storage biogenic amine levels did not change or increased, although quantitatively this effect was not very important.

  17. Electrical Impedance Spectroscopy for Quality Assessment of Meat and Fish: A Review on Basic Principles, Measurement Methods, and Recent Advances

    Directory of Open Access Journals (Sweden)

    Xin Zhao

    2017-01-01

    Full Text Available Electrical impedance spectroscopy (EIS, as an effective analytical technique for electrochemical system, has shown a wide application for food quality and safety assessment recently. Individual differences of livestock cause high variation in quality of raw meat and fish and their commercialized products. Therefore, in order to obtain the definite quality information and ensure the quality of each product, a fast and on-line detection technology is demanded to be developed to monitor product processing. EIS has advantages of being fast, nondestructive, inexpensive, and easily implemented and shows potential to develop on-line detecting instrument to replace traditional methods to realize time, cost, skilled persons saving and further quality grading. This review outlines the fundamental theories and two common measurement methods of EIS applied to biological tissue, summarizes its application specifically for quality assessment of meat and fish, and discusses challenges and future trends of EIS technology applied for meat and fish quality assessment.

  18. Radiation sensitivity of foodborne pathogens in meat byproducts with different packaging

    International Nuclear Information System (INIS)

    Yong, Hae In; Kim, Hyun-Joo; Nam, Ki Chang; Kwon, Joong Ho; Jo, Cheorun

    2015-01-01

    The aim of this study was to determine radiation sensitivity of Escherichia coli O157:H7 and Listeria monocytogenes in edible meat byproducts. Seven beef byproducts (heart, liver, lung, lumen, omasum, large intestine, and small intestine) and four pork byproducts (heart, large intestine, liver, and small intestine) were used. Electron beam irradiation significantly reduced the numbers of pathogenic microorganisms in meat byproducts and no viable cells were detected in both aerobically- and vacuum-packaged samples irradiated at 4 kGy. Meat byproducts packed under vacuum had higher D 10 value than the ones packed aerobically. No significant difference was observed between the D 10 values of E. coli O157:H7 and L. monocytogenes inoculated in either aerobically or vacuum packaged samples. These results suggest that low-dose electron beam irradiation can significantly decrease microbial numbers and reduce the risk of meat byproduct contamination by the foodborne pathogens. - Highlights: • Radiation sensitivities of pathogens in meat byproduct were tested. • Electron beam irradiation of 3 or 4 kGy reduced pathogens by> 9 log • The D 10 values were lower in the aerobic-packaging than under vacuum condition

  19. Meet meat: An explorative study on meat and cultured meat as seen by Chinese, Ethiopians and Dutch

    NARCIS (Netherlands)

    Bekker, G.A.; Tobi, H.; Fischer, A.R.

    2017-01-01

    In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries

  20. Use of Atmospheric Pressure Cold Plasma for Meat Industry

    OpenAIRE

    Lee, Juri; Lee, Cheol Woo; Yong, Hae In; Lee, Hyun Jung; Jo, Cheorun; Jung, Samooel

    2017-01-01

    Novel, effective methods to control and prevent spoilage and contamination by pathogenic microorganisms in meat and meat products are in constant demand. Non-thermal pasteurization is an ideal method for the preservation of meat and meat products because it does not use heat during the pasteurization process. Atmospheric pressure cold plasma (APCP) is a new technology for the non-thermal pasteurization of meat and meat products. Several recent studies have shown that APCP treatment reduces th...

  1. Factors that predict consumer acceptance of enriched processed meats

    OpenAIRE

    Shan, Liran Christine; Henchion, Maeve; De Brún, Aoife; Murrin, Celine; Wall, Patrick G.; Monahan, Frank J.

    2017-01-01

    The study aimed to understand predictors of consumers' purchase intention towards processed meat based functional foods (i.e. enriched processed meat). A cross-sectional survey was conducted with 486 processed meat consumers in spring 2016. Results showed that processed meats were perceived differently in healthiness, with sausage-type products perceived less healthy than cured meat products. Consumers were in general more uncertain than positive about enriched processed meat but differences ...

  2. Improving the raw management in Ukraine

    Energy Technology Data Exchange (ETDEWEB)

    Jung, H.G.; Koever, M. [NUKEM Technologies GmbH, Alzenau (Germany)

    2013-07-01

    In Ukraine 13 VVER-1000 and 2 VVER-440 reactor units generate about 50 % of the country's energy production. By contrast, when looking at the large volume of radioactive waste of all categories, which is produced by these nuclear power plants (NPP), the radioactive waste (RAW) management - onsite of NPP, towards interim storage as well as towards final disposal - is still not adequately developed. Currently all operational waste of Ukrainian NPP is incompletely treated/conditioned and stored onsite, though insufficient storage capacity is available at the NPP. As no effective Ukraine-wide strategy is yet established to manage RAW beyond NPP a serious situation could arise, which even leads to constrained temporary shut-down of reactor units, threatening the energy supply of whole the country. In addition large quantities of RAW, partly badly sorted, derive from decommissioning of the shut-down Chernobyl NPP. Also other sources of RAW contribute to the whole volume, which has to be managed in Ukraine, as research reactors, reprocessing of spent nuclear fuel and other nuclear facilities and applications. Nevertheless, operational and shut-down NPP in Ukraine are by far the largest producers. To support Ukraine in managing their radioactive waste NUKEM Technologies GmbH was appointed to provide technical support for the improvement of the current situation in cooperation with responsible Ukrainian experts towards a targeted, comprehensive and effective RAW management. (orig.)

  3. ACTIVE PACKAGING SYSTEM FOR MEAT AND MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    Adriana Pavelková

    2012-10-01

    Full Text Available In the recent past, food packaging was used to enable marketing of products and to provide passive protection against environmental contaminations or influences that affect the shelf life of the products. However, unlike traditional packaging, which must be totally inert, active packaging is designed to interact with the contents and/or the surrounding environment. Interest in the use of active packaging systems for meat and meat products has increased in recent years. Active packaging systems are developed with the goal of extending shelf life for foods and increasing the period of time that the food is high quality. Developments in active packaging have led to advances in many areas, including delayed oxidation and controlled respiration rate, microbial growth, and moisture migration. Active packaging technologies include some physical, chemical, or biological action which changes interactions between a package, product, and/or headspace of the package in order to get a desired outcome. Active packaging systems discussed include oxygen scavengers, carbon dioxide scavengers and emitters, moisture control agents, flavour/odour absorbers and releasers  and antimicrobial packaging technologies. Active packaging is typically found in two types of systems; sachets and pads which are placed inside of packages, and active ingredients that are incorporated directly into packaging materials.  Recognition of the benefits of active packaging technologies by the food industry, development of economically viable packaging systems and increased consumer acceptance is necessary for commercial realisation of these packaging technologies.doi:10.5219/205

  4. Survey of the parasite Toxoplasma gondii in human consumed ovine meat in Tunis City.

    Directory of Open Access Journals (Sweden)

    Sonia Boughattas

    Full Text Available Toxoplasmosis has been recognized as parasitic zoonosis with the highest human incidence. The human infection by the parasite can lead to severe clinical manifestations in congenital toxoplasmosis and immunocompromised patients. Contamination occurs mainly by foodborne ways especially consumption of raw or undercooked meat. In contrast to other foodborne infections, toxoplasmosis is a chronic infection which would make its economic and social impact much higher than even previously anticipated. Ovine meat was advanced as a major risk factor, so we investigated its parasite survey, under natural conditions. Serological MAT technique and touchdown PCR approaches were used for prevalence determination of the parasite in slaughtered sheep intended to human consumption in Tunis City. The genotyping was carried by SNPs analysis of SAG3 marker. Anti-Toxoplasma antibodies were present in 38.2% of young sheep and in 73.6% of adult sheep. Molecular detection revealed the contamination of 50% of ewes' tissue. Sequencing and SNPs analysis enabled unambiguous typing of meat isolates and revealed the presence of mixed strains as those previously identified from clinical samples in the same area. Our findings conclude that slaughtered sheep are highly infected, suggesting them as a major risk factor of Toxoplasma gondii transmission by meat consumption. Special aware should target consequently this factor when recommendations have to be established by the health care commanders.

  5. Understanding critical factors for the quality and shelf-life of MAP fresh meat: a review.

    Science.gov (United States)

    Singh, Preeti; Wani, Ali Abas; Saengerlaub, Sven; Langowski, Horst-Christian

    2011-02-01

    Due to increased demands for greater stringency in relation to hygiene and safety issues associated with fresh food products, coupled with ever-increasing demands by retailers for cost-effective extensions to product shelf-lives and the requirement to meet consumer expectations in relation to convenience and quality, the food packaging industry has rapidly developed to meet and satisfy expectations. One of the areas of research that has shown promise, and had success, is modified atmosphere packaging (MAP). The success of MAP-fresh meat depends on many factors including good initial product quality, good hygiene from the source plants, correct packaging material selection, the appropriate gas mix for the product, reliable packaging equipment, and maintenance of controlled temperatures and humidity levels. Advances in plastic materials and equipment have propelled advances in MAP, but other technological and logistical considerations are needed for successful MAP systems for raw chilled meat. Although several parameters critical for the quality of MA packed meat have been studied and each found to be crucial, understanding of the interactions between the parameters is needed. This review was undertaken to present the most comprehensive and current overview of the widely available, scattered information about the various integrated critical factors responsible for the quality and shelf life of MA packed meat with an interest to stimulate further research to optimize different quality parameters.

  6. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

    Science.gov (United States)

    Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

    2015-06-15

    Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Evaluation of induced color changes in chicken breast meat during simulation of pink color defect.

    Science.gov (United States)

    Holownia, K; Chinnan, M S; Reynolds, A E; Koehler, P E

    2003-06-01

    The objective of the study was to establish a pink threshold and simulate the pink defect in cooked chicken breast meat with treatment combinations that would induce significant changes in the color of raw and cooked meat. The subjective pink threshold used in judging pink discoloration was established at a* = 3.8. Samples of three color groups (normal, lighter than normal, and darker than normal) of boneless, skinless chicken breast muscles were selected based on instrumental color values. The in situ changes were induced using sodium chloride, sodium tripolyphosphate, sodium erythorbate, and sodium nitrite at two levels: present and not present. Fillets in all treatments were subjected to individual injections, followed by tumbling, cooking, and chilling. Samples were analyzed for color [lightness (L*), red/green axis (a*), yellow/blue axis (b*)] and reflectance spectra. Simulation of the pink defect was achieved in eight of the 16 treatment combinations when sodium nitrite was present and in an additional two treatment combinations when it was absent. Pinking in cooked samples was affected (P meat color. Results confirmed that it was possible to simulate the undesired pinking in cooked chicken white meat when in situ conditions were induced by sodium chloride, sodium tripolyphosphate, and sodium nitrite. The continuation of the simulation study can aid in developing alternative processing methods to eliminate potential pink defects.

  8. The use and control of nitrate and nitrite for the processing of meat products.

    Science.gov (United States)

    Honikel, Karl-Otto

    2008-01-01

    Nitrate and nitrite are used for the purpose of curing meat products. In most countries the use of both substances, usually added as potassium or sodium salts, is limited. Either the ingoing or the residual amounts are regulated by laws. The effective substance is nitrite acting primarily as an inhibitor for some microorganisms. Nitrite added to a batter of meat is partially oxidized to nitrate by sequestering oxygen - thus it acts as an antioxidant - a part of nitrite is bound to myoglobin, forming the heat stable NO-myoglobin, a part is bound to proteins or other substances in meat. Nitrate may be reduced to nitrite in raw meat products by microorganisms. As oxidation and reduction may occur the concentrations of nitrite plus nitrate in a product has to be controlled and measured especially if the residual amounts are regulated. This sum of both compounds is important for the human body. Intake of nitrate with food leads to its absorption over the digestive tract into the blood. In the oral cavity nitrate appears again where it is reduced to nitrite. With the saliva the nitrite is mixed with food, having the same effect as nitrite in a batter (inhibiting growth of some pathogenic microorganisms) and swallowed. In the stomach nitrite can eventually form carcinogenic nitrosamines in the acidic environment.

  9. Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

    International Nuclear Information System (INIS)

    Harsojo; Banati, D.; Ito, H.

    1997-01-01

    Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

  10. Development of hazard analysis by critical control points (HACCP) procedures to control organic chemical hazards in the agricultural production of raw food commodities.

    Science.gov (United States)

    Ropkins, Karl; Ferguson, Andrew; Beck, Angus J

    2003-01-01

    Hazard Analysis by Critical Control Points (HACCP) is a systematic approach to the identification, assessment, and control of hazards in the food chain. Effective HACCP requires the consideration of all chemical microbiological, and physical hazards. However, current procedures focus primarily on microbiological and physical hazards, while chemical aspects of HACCP have received relatively little attention. In this article we discuss the application of HACCP to organic chemical contaminants and the problems that are likely to be encountered in agriculture. We also present generic templates for the development of organic chemical contaminant HACCP procedures for selected raw food commodities, that is, cereal crops,raw meats, and milk.

  11. Performance of food safety management systems in poultry meat preparation processing plants in relation to Campylobacter spp. contamination.

    Science.gov (United States)

    Sampers, Imca; Jacxsens, Liesbeth; Luning, Pieternel A; Marcelis, Willem J; Dumoulin, Ann; Uyttendaele, Mieke

    2010-08-01

    A diagnostic instrument comprising a combined assessment of core control and assurance activities and a microbial assessment instrument were used to measure the performance of current food safety management systems (FSMSs) of two poultry meat preparation companies. The high risk status of the company's contextual factors, i.e., starting from raw materials (poultry carcasses) with possible high numbers and prevalence of pathogens such as Campylobacter spp., requires advanced core control and assurance activities in the FSMS to guarantee food safety. The level of the core FSMS activities differed between the companies, and this difference was reflected in overall microbial quality (mesophilic aerobic count), presence of hygiene indicators (Enterobacteriaceae, Staphylococcus aureus, and Escherichia coli), and contamination with pathogens such as Salmonella, Listeria monocytogenes, and Campylobacter spp. The food safety output expressed as a microbial safety profile was related to the variability in the prevalence and contamination levels of Campylobacter spp. in poultry meat preparations found in a Belgian nationwide study. Although a poultry meat processing company could have an advanced FSMS in place and a good microbial profile (i.e., lower prevalence of pathogens, lower microbial numbers, and less variability in microbial contamination), these positive factors might not guarantee pathogen-free products. Contamination could be attributed to the inability to apply effective interventions to reduce or eliminate pathogens in the production chain of (raw) poultry meat preparations.

  12. Effects of electrical stimulation on meat quality of lamb and goat meat.

    Science.gov (United States)

    Cetin, Omer; Bingol, Enver Baris; Colak, Hilal; Hampikyan, Hamparsun

    2012-01-01

    Effect of various voltage of electrical stimulation (ES) on meat quality of lamb and goat was investigated by using a total of 36 animals at 3-5 years old. Constant 50 Hz frequency and 50, 100, and 250 V, 90 sec of ES were administered to 1/2 carcasses and were examined according their textural, physicochemical, and sensorial characteristics. ES decreased the pH values of lamb and goat meat, and accelerated the rigor mortis (P goat meat, and tenderness was improved depending on voltage range used (P goat meat compared with the control groups (P meat quality of lamb and goat, in contrast to undesirable consumer preferences.

  13. Effect of dietary plant extract on meat quality and sensory parameters of meat from Equidae.

    Science.gov (United States)

    Rossi, Raffaella; Ratti, Sabrina; Pastorelli, Grazia; Maghin, Federica; Martemucci, Giovanni; Casamassima, Donato; D'Alessandro, Angela Gabriella; Corino, Carlo

    2017-11-01

    Plant extracts as Lippia spp. have been proven antioxidant properties. Recent studies have been shown that dietary supplementation with plant extracts is able to enhance meat quality parameters. Studies regarding meat quality in Equidae are limited. The effect of dietary plant extract (PE), containing verbascoside, on meat quality, oxidative stability and sensory parameters of Longissimus Lumborum (LL) muscle in Equidae was studied. Dietary treatment did not affect (P > 0.05) pH, colour indices and chemical parameters of muscle in both donkey and horse. Dietary PE improved (P meat and to affect the sensory attributes of Equidae meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  14. Clostridium difficile in Retail Meats

    Centers for Disease Control (CDC) Podcasts

    2009-04-16

    Clostridium difficile is a common cause of diarrhea in healthcare settings but little is known about what causes cases in the community. In this podcast, CDC's Dr. L. Clifford McDonald discusses two papers in the May 2009 edition of Emerging Infectious Diseases that explore whether the organism could be found in meat samples purchased in grocery stores in Arizona and Canada.  Created: 4/16/2009 by Emerging Infectious Diseases.   Date Released: 4/16/2009.

  15. Ethanol is a strategic raw material

    Directory of Open Access Journals (Sweden)

    Baras Josip K.

    2002-01-01

    Full Text Available The first part of this review article considers general data about ethanol as an industrial product, its qualities and uses. It is emphasized that, if produced from biomass as a renewable raw material, its perspectives as a chemical raw material and energent are brilliant. Starchy grains, such as corn, must be used as the main raw materials for ethanol production. The production of bioethanol by the enzyme-catalyzed conversion of starch followed by (yeast fermentation, distillation is the process of choice. If used as a motor fuel, anhydrous ethanol can be directly blended with gasoline or converted into an oxygenator such as ETBE. Finally, bioethanol production in Yugoslavia and the possibilities for its further development are discussed.

  16. PERSPECTIVE NONMETALLIC RAW MATERIALS AND THEIR UTILIZATION

    Directory of Open Access Journals (Sweden)

    Havelka Jaroslav

    1997-10-01

    Full Text Available It is the existence of the domestic base of raw materials and stable or growing markets that are a precondition for the prospectiveness industrial minerals. Traditional and non-traditional prospective nonmetal-liferous raw materials can be distinguished. The main trends in new industrial applications of industrial minerals are being stated. In the Czech Republic, the following may be ranked among the traditional prospective nonme-talliferous raw materials: kaoline, refractory clays, ceramic and expandable clays, glass and foundry sands, li-mestones, building stones, gypsum, cast basalt, bentonite, diatomite, feldspars, graphite. Alkali rocks, industrial garnets, flaky mica, wollastonite and yet unmined staurolite, minerals of the sillimanite group and others belong to the non-traditional prospective industrial minerals.

  17. Production of crispy bread snacks containing chicken meat and chicken meat powder

    Directory of Open Access Journals (Sweden)

    HULYA CAKMAK

    Full Text Available ABSTRACT Chicken meat in two different forms (chicken meat and chicken meat powder were added into white flour and whole wheat blend baguette bread formulations for protein enrichment and finally developing new and healthy snacks. The chicken meat and powder levels were 10% for white flour baguette, and 15% for whole wheat blend. The dried baguette samples were packaged under 100% N2, and physical, chemical, microbiological and sensorial properties were evaluated during 3 months of storage. Protein content of chicken meat powder added samples were found statistically higher than chicken meat added samples. Hardness of the snacks was significantly affected from type of chicken meat, such as values were higher for chicken meat added samples than chicken meat powder added samples. Lipid oxidation of the snacks was determined by TBA analysis, and TBA value for whole wheat mixture snack with 15% of chicken meat was the highest among all during storage. The highest overall acceptance score was obtained from white flour snack with 10% chicken meat. There was no coliform bacteria detected during storage and the results of yeast-mold count and aerobic plate count of snacks remained between the quantitative ranges.

  18. Prospects and challenges of radiation processing of meats and meat products in India

    International Nuclear Information System (INIS)

    Chander, Ramesh

    2014-01-01

    In India goat, lamb and chicken meat are widely preferred, while, bovine meat and pork are consumed only by a small segment of the population. Meats in the country are mainly marketed fresh or in frozen state. Recently chilled poultry has been introduced in Indian market. In addition to fresh meats, several other ready to eat or ready to cook meat products like chicken chilly, chicken tikka, mutton shammi kababs, mutton seekh kababs etc are available in urban Indian market. These products are marketed only in the frozen state and have limited market due to expensive and inadequate freezing facilities. Major share of domestic fresh meat and poultry market is by unorganized sector and only a few corporate houses like Godrej and Venkey's are marketing poultry products. The time has come to benefit from radiation processing for safe, chilled meat and poultry in India. Shelf-stable, nutritious meat and meat products can also be produced by the process. Radiation processing of these foods will be of great economic and health significance and give boost to exports. This radiation processing can meet the needs of services of convenient and ready-to-eat meat and meat products

  19. Effects of the Dietary Supplementation of Sucupira (Pterodon Emarginatus Vog. and Copaiba (Copaifera Langsdorffii Resinoils on Chicken Breast and Thigh Meat Quality and Oxidative Stability

    Directory of Open Access Journals (Sweden)

    CB de Lima

    2015-12-01

    Full Text Available ABSTRACT An experiment was conducted to evaluate the addition of the oil resins ofsucupira (Pterodon emarginatus Vog. and copaiba (Copaifera langsdorffii to broiler diets on chicken meat composition, quality, and lipid peroxidation. 350 one-d-old broiler chicks were submitted to seven treatments, consisting of the diets supplemented with copaiba (COP or sucupira (SUC resin oils at three different concentrations (500, 900, and 1300 ppm plus a negative control diet (CONT. At 37 days of age, 10 birds per treatment were selected according to the average weight of the experimental unit and slaughtered to collect breast and thigh meat, which was stored at 4°C for 24 hours to evaluate pH, color (L*, a*, b*, cooking weight loss (CWL, and shear force (SF. Raw meat was vacuum packed and stored frozen until lipid peroxidation analysis. Meat samples were pooled to prepare pre-cooked meatballs (30 ± 0.5g, stored under refrigeration (eight days, and analyzed every two days for TBARS concentration. Results were analyzed using the PROC GLM and MIXED procedures (SAS statistical software. Plant oils increased (p<0.05 breast meat humidity (HU and crude protein (CP levels and reduced (p<0.05 total lipid (TLC and ash (AS levels when compared with the CONT treatment. Plant oils increased (p<0.05 thigh meat HU when compared with the CONT. High COP dietary levels reduced (p<0.05 breast meat CWL, and increased (p<0.05 thigh meat L* values when compared to CONT, except for SUC500 and SUC900. The dietary inclusion of plant oil resins showed a pro-oxidant effect (p<0.01 on breast meat when compared with the CONT. Low SUC dietary supplementation levels significantly reduced (p<0.01 the concentration of secondary oxidation products in thigh meat.

  20. Data for in-depth characterisation of the lamb meat proteome from longissimus lumborum

    Directory of Open Access Journals (Sweden)

    Tzer-Yang Yu

    2015-06-01

    Full Text Available This Data article provides Supplementary data related to the research article titled “In-depth characterisation of the lamb meat proteome from longissimus lumborum” by Yu et al. [1]. This research article reports the proteome catalogue of the 48 h post-mortem lamb longissimus lumborum. A list of 388 ovine-specific proteins were identified and characterised after separating the samples into sarcoplasmic, myofibrillar and insoluble fractions, followed by an in-depth shotgun proteomic evaluation and bioinformatic analysis. The detailed list of identified proteins, the annotated MS/MS spectra corresponding to the proteins identified by a single peptide-spectrum match, the raw Gene Ontology annotation data and other miscellaneous files, as will be described below, were contained in this Data article. We hope the data presented here will contribute to the current knowledge of the global protein composition of lamb skeletal muscle/meat.