Detection of horse meat contamination in raw and heat-processed meat products.
Hsieh, Yun-Hwa P; Ofori, Jack A
2014-12-31
Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.
Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A
2010-11-01
The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.
Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland
DEFF Research Database (Denmark)
Scullion, R.; Harrington, C.S.; Madden, R.H.
2006-01-01
A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....
Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran
Directory of Open Access Journals (Sweden)
Mohammad Hossein Sarrafzadeh Zargar
2014-07-01
Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.
Directory of Open Access Journals (Sweden)
Liliana Tudoreanu
2013-11-01
Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio
Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan
2009-08-01
In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.
1998-01-01
The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat
DEFF Research Database (Denmark)
Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud
2006-01-01
Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....
Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein
2012-12-01
Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.
Artificial neural network as the tool in prediction rheological features of raw minced meat
Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko
2012-01-01
Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...
Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia
2014-08-28
Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.
Directory of Open Access Journals (Sweden)
S. N. Depamede
2011-08-01
Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.
Artificial neural network as the tool in prediction rheological features of raw minced meat.
Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta
2012-01-01
The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.
Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z
2013-07-01
The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Naim Deniz Ayaz
2016-08-01
Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.
An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.
Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar
2016-11-01
Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.
Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza
2010-04-01
Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.
The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product
Directory of Open Access Journals (Sweden)
Rini Mastuti
2012-02-01
Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value 7.89, WHC 48.345, and moisture content 75.20%. Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.
Volatiles in raw and cooked meat from lambs fed olive cake and linseed.
Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A
2015-04-01
This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.
Directory of Open Access Journals (Sweden)
Danuser Jürg
2003-12-01
Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other
Directory of Open Access Journals (Sweden)
Marwan Al-Hijazeen
2016-06-01
Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.
IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. M. Bukreev
2013-01-01
Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.
Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.
Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott
2014-02-05
Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.
Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria
Directory of Open Access Journals (Sweden)
Adekunbi Bridget Omotoso
2015-07-01
Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry
Ramírez, E I; Vázquez-Salinas, C; Rodas-Suárez, O R; Pedroche, F F
2000-04-01
A total of 160 meat product samples were collected from commercial outlets in Mexico City to investigate the presence of different species of Yersinia by the 4 degrees C enrichment method after 1, 3, 5, and 7 days of incubation using alkaline treatment and isolating in cefsulodin-Irgasan-novobiocin and MacConkey agars with Tween 80. Overall, Yersinia spp. were isolated from 27% of the samples analyzed, whereas 40% of the raw and only 13% of the precooked samples were contaminated. Although 2,970 colonies showed Yersinia characteristics, only 706 (24%) actually corresponded to this genus: 49% were Yersinia enterocolitica, 25% Yersinia kristensenii, 15% Yersinia intermedia, 9% Yersinia frederiksenii, and 2% Yersinia aldovae; 10% corresponded to biotype 2, 2% to biotype 3, and 4% to biotype 4. The presence of Yersinia in raw and cooked meat products represents a health risk for consumers in Mexico, where further clinical studies are needed to assess the epidemiological importance of this pathogen.
Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth
2017-10-15
The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O
2016-09-24
The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.
Dietary vitamin E affects lipid oxidation and total volatiles of irradiated raw turkey meat
International Nuclear Information System (INIS)
Ahn, D.U.; Sell, J.L.; Jeffery, M.; Jo, C.; Chen, X.; Lee, J.I.
1997-01-01
Breast and leg meat patties, prepared from turkeys fed diets containing 25, 200, 400 or 600 IU of dl-alpha-tocopheryl acetate (TA) per kg diet, were irradiated at 0 or 2.5 kGy with vacuum or loose packaging. The effects of dietary TA on storage stability and production of volatiles in irradiated raw turkey meat were determined. Dietary TA at 200 IU/kg decreased lipid oxidation and reduced total volatiles of raw turkey patties after 7-days of storage. However, the antioxidant effects of dietary TA were more notable when the patties were loosely packaged than when vacuum-packaged. Irradiation increased lipid oxidation of raw turkey meats only when loosely packaged but had limited effects on formation of total volatiles after storage at 4 degrees C for 7 days or longer
Claudiu-Dan Salagean; Dorin Tibulca; Radu Marin
2013-01-01
Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste) in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon) and mix of natural spices - fine grinding variant (1) and coarse grinding variant (3) - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon) + vegetable protein supplements (textured soy protein) + binder (protein + fiber) + add...
Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B
2015-07-01
The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.
Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar
2017-08-01
Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Narayan, Raj; Mendiratta, S K; Mane, B G
2013-04-01
The properties of raw meat and meat curry from spent goat meat in relation with post-mortem handling conditions were evaluated. The conditions evaluated were: cooking of meat within 1-2 h post-slaughter (condition 1); deboning meat storage at 25 ± 2 °C for 5-6 h and cooking (condition 2); post-slaughter storage of carcass at room temperature for 5-6 h, then deboning followed by storage of meat at refrigeration temperature for 5-6 h and cooking (condition 3); deboning and storage of meat at 25 ± 2 °C for 10-12 h and cooking (condition 4). Significant difference was observed in pH values in condition 1 (p meat as compared to the conditions 2, 3 and 4. However, the moisture content of cooked meat was significantly higher (p meat chunks, that is, the mean value was significantly higher (p < 0.01) for condition 2 and significantly lower for condition 1. Sensory scores were significantly higher in condition 1 and significantly lower in condition 2. However, sensory scores for condition 4 were almost similar to the condition 1.
Popp, J; Krischek, C; Janisch, S; Wicke, M; Klein, G
2013-05-01
It has been suggested that the color of turkey breast meat influences both physico-chemical and microbiological properties of raw fermented sausages. In this study, raw fermented sausages were produced with turkey breast meat in 3 different colors (pale, normal, or dark), which were obtained from 2 fast-growing-genetic-line toms at 2 slaughterhouses. Prior to the sausage production, the breast muscles were sorted into color groups according to the lightness values determined at 24 h postmortem. This meat was subsequently processed to raw fermented sausages using 1.5 or 2.5% curing salt (CS). The pale meat had higher lightness, electrical conductivity, and drip loss, whereas the dark meat showed a darker color only. The physico-chemical (pH, water activity), visual (lightness, redness), and microbial (total plate count) properties of the sausages were not influenced by the color of the turkey breast meat. The sausage made with 2.5% CS had lower aw and higher ash and hardness values than the sausages produced with 1.5% CS. In conclusion, processing of differently colored turkey meat to raw fermented sausages does not influence the quality characteristics of the products. Based on these findings, there is no reason for the sausage producer to separate turkey breast muscles by color before producing raw fermented sausages.
Weese, J Scott; Rousseau, J.
2006-01-01
There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.
Directory of Open Access Journals (Sweden)
Francesco Toteda
2010-01-01
Full Text Available This study was carried out in order to examine the chemical and fatty acid composition of raw and cooked meat obtained fromlambs raised under mothers or reared by artificial suckling with acidified milk replacers with or without polyunsaturated fattyacid (PUFA supplementation. Meat samples were taken from twenty Gentile di Puglia male lambs subjected to the followingfeeding treatments: the control group received only maternal milk (MM, n.=6 while two groups were reared by artificial sucklingwith an acidified milk replacer (MR, n.=7 or with an acidified milk replacer supplemented with 10 ml/l of a PUFA enrichedoil (MR+PUFA, n.=7. Lambs were slaughtered at 45 days of age. After 24 hours of refrigeration at 4 °C, the lumbar regionwas dissected from each right half-carcass and split into pieces, one of which was used raw while the other was cooked in aventilated electric oven at 180 °C until an internal temperature of 75 °C was reached. Chemical and fatty acid analysis wereperformed on raw and cooked meat, while only raw meat was assessed for cholesterol. Cooking losses were also evaluated.Meat obtained from MR+PUFA fed lambs contained more fat (Punder mothers increased the total amount of saturated fatty acids (SFA, compared with both the MR group (Pthe MR+PUFA one (Pcomparison with both MR diets. The highest PUFA/SFA ratio of meat was recorded for the MR+PUFA group (0.27, with statisticaldifferences respect to the MR group (0.21; Pmilk produced meat containing more cholesterol than the MR+PUFA group (85.89 vs 76.26 mg/100 g; Pindex of meat was higher following natural rearing in comparison with the MR+PUFA treatment (1.34 vs 1.05;Pand 0.76, respectively; Pparameters evaluated. In conclusion, artificial suckling with acidified milk replacers improves some meat quality features.Supplementation of milk replacers with PUFAs, although in a limited way, may improve the dietetic properties of lamb meat.
Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S
2016-08-01
Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.
Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A
2014-08-01
Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen
2006-01-01
Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.
DEFF Research Database (Denmark)
Meinert, Lene; Tikk, Kaja; Tikk, Meelis
2009-01-01
Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...... the differences in sensory perception of the pan-fried pork chops. Overall, the differences were small....
Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg
2012-01-01
The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.
Jayasena, Dinesh D; Kim, Sun Hyo; Lee, Hyun Jung; Jung, Samooel; Lee, Jun Heon; Park, Hee Bok; Jo, Cheorun
2014-12-01
This study was aimed at comparing the taste-related compound content in the breast and leg meat from 100-d-old Korean native chickens (KNC-100) and 32-d-old commercial broilers (CB-32) and determining the changes in these compounds during cooking. Cocks from certified meat-type commercial broiler (Ross) and Korean native chicken (Woorimatdag) strains were raised under similar standard commercial conditions, and a total of 10 birds from each breed were slaughtered at 32 and 100 d of age, which represents their market ages, respectively. Raw and cooked meat samples were prepared separately from the breast and leg and analyzed. The KNC-100 showed significantly higher concentrations of inosine 5'-monophosphate, reducing sugars, glutamic acid, linoleic acid, arachidonic acid, and docosahexaenoic acid than CB-32 did. Additionally, significantly higher inosine 5'-monophosphate, cysteine, arachidonic acid, and docosahexaenoic acid concentrations were observed in the breast meat, whereas the leg meat had higher concentration of glutamic acid, oleic acid, and linoleic acid (P cooking process, except oleic and linoleic acids. We suggest that the higher levels of taste-related compounds present in KNC-100 meat compared with CB-32 meat may result in the unique taste of the former meat, as has been previously reported. In addition, the results of this study may provide useful information for selection and breeding programs. ©2014 Poultry Science Association Inc.
Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi
2018-01-01
Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.
Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M
2015-04-01
One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.
Directory of Open Access Journals (Sweden)
Claudiu-Dan Salagean
2013-11-01
Full Text Available Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon and mix of natural spices - fine grinding variant (1 and coarse grinding variant (3 - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon + vegetable protein supplements (textured soy protein + binder (protein + fiber + additive mix - fine grinding variant (2 and coarse grinding variant (4 - chopping at the volf through the sieve of 3 - 4 mm. In this respect organoleptic analyzes were performed on appearance (exterior and section, color, smell, texture and taste of the finished product (after roasting, the results highlighting that, in terms of organoleptic, sample 1 obtained the highest score (on a scale of 1-poor to 5-very good quality (average 21.83, followed by sample 3 (average 19.22, the very small difference in the case of sample 2 (average 19.19 and finally, sample 4 (average 18.75. It was noted that sample 1 obtained the highest score (average of all analyzed organoleptic indicators: appearance (4.33, color (4.39, smell (4.67, texture (4.33 and taste (4.11 being favorite by all volunteer subjects who participated at the analysis. The same thing was found in sensory analysis of mici paste in fresh/chilled condition: 65% of subjects preferred variant 1 followed by variant 3 (19.2%, variant 2 (11.5% and finally, variant 4 (3.8%. In terms of economic the highest efficiency was found in 2 (specific consumption 0.73 and 4 (specific consumption 0.77 variants compared to 1 (specific consumption 0.80 and 3 (specific consumption 0.82 variants, which translates into a reduction in the cost of products manufactured in the variants 2 and 4 (with protein supplements and additive mix by about 25-20% (with importance for the manufacturer. Also, thermal processing (roasting revealed the
Devatkal, Suresh K; Naveena, B M
2010-06-01
Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.
Rababah, Taha
The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel
2017-01-01
Omega-3 long-chain (≥C 20 ) polyunsaturated fatty acids (ω3 LC-PUFA) confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL) muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO) was evaluated. Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO): a control diet at 0 mL/kg DM of DCCO (DCCOC); 25 mL/kg DM of DCCO (DCCOM) and 50 mL/kg DCCO (DCCOH). Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Within raw meats: DCCOH supplemented lambs had significantly ( P culinary preparation method can be used as effective management tools to deliver nutritionally improved ω3 LC-PUFA lamb to meat consumers.
Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.
van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M
2018-01-01
Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and
Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz
2012-04-01
The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.
Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus.
Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E; Hanson, Blake M; Smith, Tara C
2017-09-07
The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n = 3347) and contemporaneously from meat products in stores where participants report purchasing meat (n = 913). The staphylococcal protein A (spa) gene was sequenced for all isolates to determine a spa type. Morisita indices and Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) were used to determine the relationship between spa type composition among human samples and meat samples. spa type composition was significantly different between households and meat sampled from their associated grocery stores. spa types found in meat were not significantly different regardless of the store or county in which they were sampled. spa types in people also exhibit high similarity regardless of residential location in urban or rural counties. Such findings suggest meat is not an important source of S. aureus colonization in shoppers.
Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E
2017-09-01
Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.
Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth
2018-02-01
Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Muhlisin
2016-05-01
Full Text Available This study was conducted to observe antioxidant enzyme activity, iron content and lipid oxidation of Korean native chickens and other poultry. The breast and thigh meat of three Korean native chicken breeds including Woorimatdak, Hyunin black and Yeonsan ogye, and three commercial poultry breeds including the broiler, White Leghorn and Pekin duck (Anasplatyrhyncos domesticus were studied. The analyses of the antioxidant enzymes activity, iron content and lipid oxidation were performed in raw and cooked samples. The activity of catalase (CAT in the thigh meat was higher than that of the breast meat of three Korean native chickens and the broiler, respectively. The activity of glutathione peroxidase (GPx in the uncooked thigh meat of three Korean native chickens was higher than that of the breasts. The breast meat of Woorimatdak and Pekin duck had higher superoxide dismutase (SOD activity than the others, while only the thigh meat of Pekin duck had the highest activity. Cooking inactivated CAT and decreased the activity of GPx and SOD. The thigh meat of Woorimatdak, White Leghorn, Yeonsan ogye and Hyunin black contained more total iron than the breast meat of those breeds. The heme-iron lost during cooking ranged from 3.2% to 14.8%. It is noted that the thigh meat had higher thiobarbituric acid reactive substances values than the breast in all chicken breeds. Though Woorimatdak showed higher antioxidant enzyme activity and lower released-iron percentage among Korean native chickens, no differences were found on lipid oxidation. We confirm that the dark meat of poultry exhibited higher antioxidant enzyme activity and contained more iron than the white meat.
Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz
2017-01-01
Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging
International Nuclear Information System (INIS)
Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel
2015-01-01
In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.
Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging
Energy Technology Data Exchange (ETDEWEB)
Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)
2015-12-11
In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.
76 FR 44855 - Common or Usual Name for Raw Meat and Poultry Products Containing Added Solutions
2011-07-27
...'s experience in reviewing labels of meat and poultry products with added solution, the Agency has... or prior to consumption. Therefore, to ensure that labels adequately inform consumers that raw... of identity and that are sold for retail sale, institutional use, or further processing. If retail...
Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire
2016-08-01
Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications
Prevalence of methicillin-resistant Staphylococcus aureus in meat.
de Boer, E; Zwartkruis-Nahuis, J T M; Wit, B; Huijsdens, X W; de Neeling, A J; Bosch, T; van Oosterom, R A A; Vila, A; Heuvelink, A E
2009-08-31
Recently the isolation of methicillin-resistant Staphylococcus aureus (MRSA) strains from several food-producing animals has been reported. During slaughtering of MRSA-positive animals, contamination of carcasses with MRSA may occur and consequently the meat of these animals may get contaminated. The aim of this study was to estimate the prevalence of MRSA in raw meat samples from the retail trade. Samples of raw beef, pork, veal, lamb/mutton, chicken, turkey, fowl and game were collected from the retail trade. A detection method including a two-step enrichment in Mueller-Hinton broth+6.5% NaCl and phenol red mannitol broth containing ceftizoxime and aztreonam, followed by isolation on MRSA ID agar (bioMérieux) was evaluated and subsequently applied for the detection of MRSA in samples of raw meats. MRSA strains were isolated from 264 (11.9%) of 2217 samples analyzed. Isolation percentages for the meat species were: beef (10.6%), veal (15.2%), lamb and mutton (6.2%), pork (10.7%), chicken (16.0%), turkey (35.3%), fowl (3.4%) and game (2.2%). The majority (85%) of the isolated strains belonged to spa-types of pulsed-field gel electrophoresis (PFGE) non-typeable (NT)-MRSA, corresponding to the multilocus sequence type ST398, a type also recently isolated in the Netherlands from pigs. However, a smaller part of these strains were found to be of other ST's, possibly of human origin. Further studies are needed to elucidate transmission routes of MRSA in relation to meat and other foods and to provide the tools for preventing the spread of MRSA. At present the high prevalence of MRSA in meat has not been shown to contribute significantly to the dissemination of MRSA to humans and the possible health hazard for consumers of the presence of MRSA in foods should be further elucidated.
DEFF Research Database (Denmark)
Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard
2004-01-01
, minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...
Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat
Directory of Open Access Journals (Sweden)
Ji-Hee Kim
2016-07-01
Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.
Directory of Open Access Journals (Sweden)
M. Al-Hijazeen
2017-03-01
Full Text Available A study was conducted to investigate the effect of two dietary energy sources, soy bean oil, and sucrose on regulatory mechanisms of meat preservation. Twenty one day-old Hubbard commercial broilers were randomly allocated into two dietary treatment groups with six replicates per treatment, and four broilers per replicate. All birds were coded for the influence of energy source: fat based diet (FD, and sugar based diet (SD. Formulated grower diets were isonitrogenous and isocaloric. The chickens were slaughtered and then boneless, skinless ground chicken tight meat was prepared. Both raw and cooked meats were analyzed for lipid and protein oxidation, and sensory panel evaluation. In addition, meat from the small muscles of the raw thigh was used to evaluate other meat quality characteristics. Proximate analyses showed no significant differences between both dietary treatments on protein, ash and moisture percentage values. Meat samples of the group that was fed FD showed higher significant values of both TBARS and total carbonyl at day 7 of storage time. However, samples of the second group (Fed SD showed lower values of both ultimate pH and water separation % using raw thigh meat. The effect of FD treatment on the meat composition appeared clearly especially on fat percentage content. In addition, meat samples obtained from chickens fed SD showed better significant values of the overall acceptability attribute. According to the current findings, sucrose could be an excellent alternative to oil in dietary broilers which improved the meat preservation bio-system, and post-mortem storage stability.
Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M
1997-06-01
The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.
Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J
2014-03-01
The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian
Irradiation of bovine meat: effect of heme-iron concentration
International Nuclear Information System (INIS)
Mistura, Liliana Perazzini Furtado
2002-01-01
The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)
Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk
2016-01-01
A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100–400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat. PMID:27338486
Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk
2016-06-07
A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100-400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat.
Dalia A. Zahran; Gehan M.A. Kassem
2011-01-01
Nitrite, a curing agent of meat products, is a precursor of carcinogenic N-nitrosamines during processing of meat products or under human stomach conditions, as well as having its own toxicity. To investigate the residual nitrite level in meat products marketed in Egyptian markets, 160 samples of cured cooked (luncheon and frankfurter) and cured raw (oriental sausages and pastirma) meat products (40 sample each) were analyzed for residual nitrite by a spectrophotometric method. Samples were s...
Healthier meat and meat products: Their role as functional foods
Jiménez Colmenero, Francisco; Carballo, José; Cofrades, Susana
2001-01-01
This review deals with the implications of meat and meat products for human health. It analyses the effect of the presence or absence of various factors: fat, fatty acid composition, cholesterol, calorific value, salt, nitrite or lipid oxidation products that can cause health problems. Bearing in mind these considerations, it then describes the strategies used in animal production, treatment of meat raw material and reformulation of meat products to obtain healthier meat and meat products. Fu...
VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.
Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim
2017-01-01
Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.
Ivan F. Gorlov; Oksana B. Gelunova; Tatiana M. Giro; Ekaterina P. Mirzayanova
2014-01-01
Integrated researches aimed to develop technologies and recipes for meat products of “Halal†category using seed fat and Milk Protein-Carbohydrate Concentrate (MPCC) represent a new generation of scientific and practical interest. In this connection, the authors propose technologies and recipes for meat products of “Halal†category, designed on the basis of rational combinatorics of animal and vegetable origin raw materials, that l...
Lead, cadmium and chromium in raw and boiled portions of Norway lobster.
Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele
2014-01-01
Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.
Volatile compounds in meat and meat products
Directory of Open Access Journals (Sweden)
Monika KOSOWSKA
Full Text Available Abstract Meaty flavor is composed of a few hundreds of volatile compounds, only minor part of which are responsible for the characteristic odor. It is developed as a result of multi-directional reactions proceeding between non-volatile precursors contained in raw meat under the influence of temperature. The volatile compounds are generated upon: Maillard reactions, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products as well as upon thiamine degradation. The developed flavor is determined by many factors associated with: raw material (breed, sex, diet and age of animal, conditions and process of slaughter, duration and conditions of meat storage, type of muscle, additives applied and the course of the technological process. The objective of this review article is to draw attention to the issue of volatile compounds characteristic for meat products and factors that affect their synthesis.
Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M
2009-01-01
It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P 800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.
Studies on the quality of duck meat sausages during refrigeration.
Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M
2016-01-01
Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating
Importance of the producer on retail broiler meat product contamination with Campylobacter spp
DEFF Research Database (Denmark)
Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta
2013-01-01
Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...
Directory of Open Access Journals (Sweden)
Milena Alicja Stachelska
2017-01-01
Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.
Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria
DEFF Research Database (Denmark)
Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.
2013-01-01
Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...
Influence of Skin Packaging on Raw Beef Quality: A Review
Directory of Open Access Journals (Sweden)
S. Stella
2018-01-01
Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.
Nutritional quality of raw and processed unripe Carica papaya fruit ...
African Journals Online (AJOL)
the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...
Visciano, Pierina; Perugini, Monia; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Salese, Carmine; Amorena, Michele
2013-12-18
The distribution of total arsenic in different portions of Norway lobster (Nephrops norvegicus L., Crustacea) was studied both in fresh samples and after a boiling process. All individuals (n = 80) were selected of medium standard commercial size (13-15 cm). The highest mean concentrations (26.86 ± 1.57 mg/kg wet weight (ww)) were found in the raw brown meat of the crustacean, probably due to its detoxification role, whereas the lowest mean values (15.97 ± 0.85 mg/kg ww) were in the raw exoskeleton. The raw white meat reported mean values of 16.09 ± 0.61 mg/kg ww. The levels of arsenic contamination detected in the boiled portions showed a significant (p < 0.01) decrease compared to the raw portions, as a consequence of solubilization phenomena. In fact, a large amount of arsenic from raw lobsters was transferred to the corresponding boiling broth. In the most commonly consumed portion, the white meat, only slight losses (7.22%) in total arsenic content were observed compared to the raw portion.
Advancements in meat packaging.
McMillin, Kenneth W
2017-10-01
Packaging of meat provides the same or similar benefits for raw chilled and processed meats as other types of food packaging. Although air-permeable packaging is most prevalent for raw chilled red meat, vacuum and modified atmosphere packaging offer longer shelf life. The major advancements in meat packaging have been in the widely used plastic polymers while biobased materials and their integration into composite packaging are receiving much attention for functionality and sustainability. At this time, active and intelligent packaging are not widely used for antioxidant, antimicrobial, and other functions to stabilize and enhance meat properties although many options are being developed and investigated. The advances being made in nanotechnology will be incorporated into food packaging and presumably into meat packaging when appropriate and useful. Intelligent packaging using sensors for transmission of desired information and prompting of subsequent changes in packaging materials, environments or the products to maintain safety and quality are still in developmental stages. Copyright © 2017 Elsevier Ltd. All rights reserved.
Detection of IgG against Toxocara in Sera of Employees of Meat Industry
Alvarado-Esquivel, Cosme; Hernández-Tinoco, Jesús; Sánchez-Anguiano, Luis Francisco; Ramos-Nevárez, Agar; Cerrillo-Soto, Sandra Margarita; Guido-Arreola, Carlos Alberto; Saenz-Soto, Leandro
2015-01-01
Contact with raw meat could represent a risk for Toxocara infection. We assessed the association of Toxocara infection with an occupation of meat worker though a case-control seroprevalence study of 124 meat workers and 248 subjects without this occupation. Sera of participants was analyzed for the presence of anti-Toxocara IgG antibodies. One (0.8%) of the 124 meat workers, and 5 (2.0%) of the 248 controls were positive for anti-Toxocara IgG antibodies (OR=0.39; 95% CI: 0.04-3.41; P=0.66). The seropositive meat worker was a male aged 28 years old, without vision impairment. None of the work characteristics i.e. frequency of contact with raw meat, use of safety practices, history of splashes at face with blood or raw meat, and injuries with sharp material at work was associated with Toxocara exposure. Seroprevalence of Toxocara infection was significantly higher (P=0.04) in meat workers with consumption of boar meat (1/6: 16.7%) than in those without this consumption (0/117: 0%). We conclude that meat workers do not have a higher risk for Toxocara infection than subjects without this occupation do. The 2% seroprevalence of Toxocara infection found in control subjects might suggest a low seroprevalence of this infection among people with other occupations in Durango City. However, additional case-control studies with larger sample sizes to confirm our results are needed. PMID:26508909
Di Giuseppe, Antonella M A; Giarretta, Nicola; Lippert, Martina; Severino, Valeria; Di Maro, Antimo
2015-02-15
In 2013, following the scandal of the presence of undeclared horse meat in various processed beef products across the Europe, several researches have been undertaken for the safety of consumer health. In this framework, an improved UPLC separation method has been developed to detect the presence of horse myoglobin in raw meat samples. The separation of both horse and beef myoglobins was achieved in only seven minutes. The methodology was improved by preparing mixtures with different composition percentages of horse and beef meat. By using myoglobin as marker, low amounts (0.50mg/0.50g, w/w; ∼0.1%) of horse meat can be detected and quantified in minced raw meat samples with high reproducibility and sensitivity, thus offering a valid alternative to conventional PCR techniques. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Ahmad, F.
2016-01-01
The focus of the study was to analyze the commercially available meat for its heavy metal contents and bacterial contamination. The meat samples were collected from four commercial markets of Lahore, i.e., as Wafaqi Colony (Site I),Township (Site II), G-1 Market (Site III) and Zenith (Site IV), and analyzed for heavy metal [i.e., manganese (Mn), nickel (Ni), chromium (Cr), cadmium (Cd) and copper (Cu)] contents and bacterial contaminants (E. coli, Pseudomonas sp., Bacillus sp. and Salmonella sp.) Atomic absorption spectrophotometery was employed for the detection of the heavy metals and plate count method was used for the detection of bacterial contaminants. The Ni concentration in the Site II sample only and Cd concentration in all meat samples were found above the standard value and the concentration of other metals (Cu, Cr, and Mn) was less than the standard concentrations. Bacterial (E. coli, Pseudomonas sp., Bacillus sp., Salmonella sp. and Staphylococcus sp.) contamination was found in all meat samples; however, the number was a little lower in the Site IV samples. Statistical analysis was done, by one-way ANOVA using SPSS, to compare heavy metal contamination in the meat samples. The results showed distribution of heavy metals in all meat samples there was significant difference of Ni concentration in the meat samples. The measure of antibiotic susceptibility showed that isolated species of bacteria were resistant to lincomycin, streptomycin, tertracyclin, ampicillin, amoxicillin and doxycyclin, but did not survive in the medium containing ofloxacin. (author)
Estrada-Solís, Joaquín; Figueroa-Rodríguez, Katia A; Figueroa-Sandoval, Benjamín; Hernández-Rosas, Francisco; Hernández-Cazares, Aleida S
2016-08-01
Longissimus dorci (LD) samples of different origin (imported and domestic) with pre-treatments (imported meat stored at -18°C for 6months, domestic meat stored at -18°C for 10days, and domestic meat stored at 4°C for 24h) were cooked as barbacoa and frozen using two treatments (air blast and liquid immersion) and then evaluated after 30days of storage. The results showed that the origin and pre-treatment of meat affected L*, a*, instrumental texture and microstructure; that the storage time affected pH, aw, b* and microstructure; and that the freezing treatments did not affect the meat. Overall, the frozen cooked lamb dish barbacoa could present some problems at the conservation stage due to an increase in pH, aw and changes in microstructure; however, the physical traits (color and texture) remained mostly unchanged and depended more on the quality of the raw meat. Copyright © 2016 Elsevier Ltd. All rights reserved.
THE YIELD OF DNA IN THERMAL TERATED DEER MEAT
Directory of Open Access Journals (Sweden)
Jozef Golian
2011-07-01
Full Text Available Residuals of DNA are one of the most important factors for detection, traceability and reverse authentication of deer meat. In this project we isolated DNA from deer processed meat and analysed by electrophoresis. Goal of the study was compute ratio between raw meat and several heat processed deer meat. Samples were prepared by five heat treatment techniques (pan roasted with temperature 180-240°C, fried with 156°C, braised with temperature 100-150°C, boiled in 100.2°C water and autoclaved in different time intervals. The highest amount of residual DNA 1927ng was obtained with two hours boiled sample. The lowest value 89.89ng was obtained with one hour braised sample. In technological adjustments highest amount of DNA and 1927ng, so the total yield of 192.7ng.-l was observed in the sample we cooked for two hours at boiling temperature. doi:10.5219/153
Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel
2017-01-01
This study evaluated omega-3 intramuscular fatty acids in the longissimus thoracis et lumborum of commercially prepared Australian lamb loin chops. Meats, denuded of external fats were cooked by means of conductive dry-heat using a fry grilling hot plate, to a core temperature of 70°C. An untrained consumer panel assessed meat appearance, aroma, tenderness, juiciness, taste and overall liking. Results showed no compositional alterations (P>0.05) to omega-3 fatty acids due to cooking treatment, whereas on absolute terms (mg/100g muscle) omega-3 fatty acids significantly (Pcooked meat at 32.8±2.3mg/100g muscle exceeded the minimum 30mg/100g per edible portion required for the defined Australian classification as 'source' long-chain (≥C 20 ) omega-3 for cooked lamb. A 3.4% intramuscular fat content in the initial raw meat was sufficient to maintain acceptable overall sensory eating quality. Results endorse the application of this cooking method to enable delivery of health beneficial long-chain omega-3 fatty acids of commercially prepared Australian lamb loin chops to consumers without impediments to sensory eating properties. Copyright © 2016 Elsevier Ltd. All rights reserved.
Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products
Juni Sumarmono; Samsu Wasito
2010-01-01
Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thor...
Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis
2014-01-01
On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.
Franchin,Paulo R.; Ogliari,Paulo J.; Andrade,Dalton F.; Chiapinoto,Maura; Lemos,Giovana; Rebelatto,Marina; Silva,Ivair G. da; Batista,Cleide R.V.
2006-01-01
A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV) method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762) and raw pork meat (n = 566). The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and oth...
Significance of authenticity in meat and meat products in Iran
Directory of Open Access Journals (Sweden)
Tahereh Rezazadeh
2014-06-01
Full Text Available The Authenticity of meat products is very important for religious and health reasons in Iran. According to legislation in Iran, the consumption and importation of pork, horse, donkey and cat products should be banned. Therefore, the identification of meat products cannot be judged solely by its appearance. This issue led to the authenticity of bovine, sheep, pig, horse, donkey, chicken and soya (Glycine max in raw and processed meat products.In this study, specific primers were designed for the identification of pig ( base pair, donkey (325 base pair, chicken (391 base pair, sheep (499 base pair, horse (607 base pair, soya (707 base pair and bovine (853 base pair by Polymerase chain reaction. Following PCR, expected,, , 499,, and base pair fragments were detectable in pig, donkey, chicken, sheep, horse, soya and bovine, respectively. This protocol can be used for identification of raw and processed meat products in various animal species for replication to regulatory obligations for meat species safety in Iran.
Das, Amaresh; Spackman, Erica; Thomas, Colleen; Swayne, David E; Suarez, David L
2008-03-01
The Asian H5N1 highly pathogenic avian influenza (HPAI) virus causes a systemic disease with high mortality of poultry and is potentially zoonotic. In both chickens and ducks, the virus has been demonstrated to replicate in both cardiac and skeletal muscle cells. Experimentally, H5N1 HPAI virus has been transmitted to chickens through the consumption of raw infected meat. In this study, we investigated virus replication in cardiac and skeletal muscle and in the trachea of chickens after experimental intranasal inoculation with the H5N1 HPAI virus. The virus was detected in tissues by real-time reverse transcription-polymerase chain reaction (RRT-PCR) and virus isolation, and in the trachea by RRT-PCR and a commercial avian influenza (AI) viral antigen detection test. A modified RNA extraction protocol was developed for rapid detection of the virus in tissues by RRT-PCR. The H5N1 HPAI virus was sporadically detected in meat and the tracheas of infected birds without any clinical sign of disease as early as 6 hr postinfection (PI), and was detected in all samples tested at 24 hr PI and later. No differences in sensitivity were seen between virus isolation and RRT-PCR in meat samples. The AI viral antigen detection test on tracheal swabs was a useful method for identifying infected chickens when they were sick or dead, but was less sensitive in detecting infected birds when they were preclinical. This study provides data indicating that preslaughter tracheal swab testing can identify birds infected with HPAI among the daily mortality and prevent infected flocks from being sent to processing plants. In addition, the modified RNA extraction and RRT-PCR test on meat samples provide a rapid and sensitive method of identifying HPAI virus in illegal contraband or domestic meat samples.
Gomółka-Pawlicka, M; Uradziński, J; Wiszniewska, A
2004-01-01
The present study was aimed at determining the influence of 15 strains of lactic acid bacteria on the growth of 2 Staphylococcus aureus strains in vitro as well as in meat and raw sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus sp. strains and, partly, methodological approach. The study also considered water activity (a(w)) and pH of the products investigated. The results obtained are demonstrated in 5 diagrams. It was found that among 15 strains of Lactobacillus aureus investigated only one strain, Lactobacillus helveticus T 78, showed antagonistic effect on studied strains of Staphylococcus aureus both in vitro as well as in meat and raw sausages. Five other strains of Lactobacillus spp. displayed the antagonistic effect in vitro only. The temperature and incubation time of sausages, but also the type of sausage stuffing were found to have a distinct or slight influence, respectively, on the antagonistic interaction between the bacteria. However, this phenomenon was affected by neither a(w) nor pH.
Effect of conventional cooking methods on lipid oxidation indices in lamb meat
Directory of Open Access Journals (Sweden)
A Pourkhalili
2012-05-01
Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p
Molecular assay to fraud identification of meat products.
Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim
2014-01-01
Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.
Is meat quality from Longissimus lumborum samples correlated with other cuts in horse meat?
De Palo, Pasquale; Maggiolino, Aristide; Centoducati, Pasquale; Milella, Paola; Calzaretti, Giovanna; Tateo, Alessandra
2016-03-01
The present work aims to investigate if the variation of each parameter in Longissimus lumborum muscle could correspond to the same or to a similar variation of the parameter in the other muscles. The work presents results of Pearson's correlations between Longissimus lumborum samples and other muscle samples, such as Biceps femoris, Rectus femoris, Semimembranosus, Supraspinatus and Semitendinosus in horse meat. A total of 27 male IHDH (Italian Heavy Draught Horse) breed foals were employed. They were slaughtered at 11 months of age and the above-mentioned muscles were sampled. The Longissimus lumborum muscle showed to be representative of other muscles and of the whole carcass for some chemical parameters (moisture, protein and ash) and for some fatty acids profile patterns such as C12:0, C14:0, total monounsaturated fatty acid and polyunsaturated fatty acid, but poor correlations were recorded for intramuscular fat concentration, rheological and colorimetric parameters. Although almost all the qualitative parameters in meat are affected by the anatomical site and by the muscle, the Longissimus lumborum is often not representative in horse meat with regard to modifications of this parameters. © 2015 Japanese Society of Animal Science.
Directory of Open Access Journals (Sweden)
Diego Gómez
2015-07-01
Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.
Directory of Open Access Journals (Sweden)
K. Shirzadegan
2014-07-01
Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.
Directory of Open Access Journals (Sweden)
Aaron Ross Flakemore
2017-08-01
Full Text Available Abstract Background Omega-3 long-chain (≥C20 polyunsaturated fatty acids (ω3 LC-PUFA confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO was evaluated. Methods Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO: a control diet at 0 mL/kg DM of DCCO (DCCOC; 25 mL/kg DM of DCCO (DCCOM and 50 mL/kg DCCO (DCCOH. Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Results Within raw meats: DCCOH supplemented lambs had significantly (P < 0.05 higher concentrations of eicosapentaenoic (EPA, 20:5ω3 and EPA + docosahexaenoic (DHA, 22:6ω3 acids than those supplemented with DCCOM or DCCOC; Dorset sired lambs contained significantly (P < 0.05 more EPA and EPA + DHA than other sire breeds; diet and sire breed interactions were significant (P < 0.05 in affecting EPA and EPA + DHA concentrations. In cooked meat, ω3 LC-PUFA concentrations in DCCOM (32 mg/100 g, DCCOH (38 mg/100 g, Dorset (36 mg/100 g, White Suffolk (32 mg/100 g, ewes (32 mg/100 g and wethers (33 mg/100 g, all exceeded the minimum content of 30 mg/100 g of edible cooked portion of EPA + DHA for Australian defined ‘source’ level ω3 LC-PUFA classification. Conclusion These results present that combinations of dietary degummed crude canola oil, sheep genetics and culinary preparation method can be used as
Soybean and lactose in meat products and preparations sampled at retail
Directory of Open Access Journals (Sweden)
Filomena Piccolo
2016-06-01
Full Text Available Food allergies and intolerances have increased during the last decades and regulatory authorities have taken different measures to prevent and manage consumers’ adverse reactions, including correct labelling of foods. Aim of this work was to search for soybean and lactose in meat products and meat preparations taken from retail in some provinces of Campania Region (Southern Italy and to evaluate the food labels compliance with Regulation (EU n.1169/2011. Soybean and lactose were searched using commercial kits in n. 58 samples of meat products produced in or distributed by 19 establishments, and in n. 55 samples of meat products and n. 8 of meat preparations produced in 21 plants. All samples were selected on the basis of the absence of any information on the labels about the presence of the two searched allergens, with the exception of n. 5 samples tested for lactose. Traces of soybean were detected in 50 out of the 58 examined samples, at concentrations up to 0.93 mg kg–1. Only two samples contained levels above the detection limit of 0.31 mg kg–1. Lactose levels ranging from 0.11 to 2.95 g/100 g, i.e. above the detection limit, were found in all the tested samples (n. 63. The results of the present research underline the need for careful controls and planning by operators as part of the self-control plans, and deserve attention from the competent authorities considering not only the consumers’ health but also the great attention media pay to regulations providing consumers with information on food.
MODERN TECHNOLOGY OF FERMENTED MEAT PRODUCTS
Directory of Open Access Journals (Sweden)
L. V. Antipova
2015-01-01
Full Text Available Summary. New trends of meat industry development, on the example of sausages are shown. The detailed description of indicators of quality of meat raw materials, auxiliary materials and their influence on the processes of tissue and microbial fermentation in the process of ripening raw sausages. Measures for improving the quality control of meat raw materials, auxiliary materials, as well as the processing conditions in all stages of production of smoked products are suggested. The modern technology of production of raw sausages with starter cultures and complex products, allowing better standardization process is considered. Questions of chemistry of color formation, the formation of taste and flavor, textures and the suppression of undesired microflora in foods in general, and in particular the raw sausage are thoroughly covered. Ideas about factors affecting the formation of color in sausages are given. It is pointed out that the susceptibility to oxidation of nitrosilmioglobin is directly related to the fat oxidation in the whole redox potential. Trends in the market of raw sausages are shown. Requirements used in the meat industry to starting cultures are shown. Recommendations on the rational use of starter cultures, and other functional additives in technology of uncooked fermented products, which are used to improve the quality and ensure a high level of product safety are given. The characteristic of the innovative series of starter cultures Protect, its species belonging and qualitative composition, providing a unique protection system in the process of ripening and storage of smoked products is given. The properties are proved on the example of smoked poultry sausage.
Polycyclic aromatic hydrocarbons in air samples of meat smokehouses
DEFF Research Database (Denmark)
Hansen, Åse Marie; Olsen, I L; Poulsen, O M
1992-01-01
In a screening programme nine Danish meat smokehouses were randomly selected for measurements on concentration of airborne polycyclic aromatic hydrocarbons (PAH). A total of 23 stationary air samples were collected during the entire working period of the kiln either above the kiln doors or approx......In a screening programme nine Danish meat smokehouses were randomly selected for measurements on concentration of airborne polycyclic aromatic hydrocarbons (PAH). A total of 23 stationary air samples were collected during the entire working period of the kiln either above the kiln doors...
Tenacity of Alaria alata mesocercariae in homemade German meat products.
González-Fuentes, Hiromi; Hamedy, Ahmad; von Borell, Eberhard; Luecker, Ernst; Riehn, Katharina
2014-04-17
A renewed interest in the pathogenic potential of Alaria alata mesocercariae emerged over the last 10years as a result of increased findings of this parasite in feral pigs during official examination for Trichinella spp. Cases of food associated human alariosis in North America suggest that a risk associated with the consumption of traditional raw cured products from infected wild boar meat cannot be neglected because the commonly applied preservation techniques may not necessarily kill the mesocercariae. In addition, changes in consumer behavior and new preparation methods for game meat (e.g. pink roasting and grilling) may increase the risk for food-associated parasitic infections. Thus, there is a strong need for the evaluation of the tenacity of A. alata mesocercariae against different physical and chemical influences as pertaining to common preservation and preparation techniques. Against this backdrop the aim of our work was a sound analysis of the survivability of A. alata mesocercariae during curing, fermentation, cold smoking and drying in raw cured meat products. Eighty three samples of traditional German meat products were prepared from naturally infected game meat and partly spiked with additional vital mesocercariae to achieve an adequate dose of infection. The resultant products were examined chronologically for dead and viable A. alata mesocercariae with the Alaria mesocercariae migration technique. After 24h of production, vital A. alata mesocercariae were still found in raw type sausages but no vital parasites were detected in the final products. Based on these results a possible risk for the consumer for an infection with A. alata mesocercariae through the consumption of contaminated raw cured products can be largely ruled out if the respective food technological procedures are carried out properly. However, a risk for the consumer cannot be excluded in cases of very early consumption of these products. Copyright © 2014 Elsevier B.V. All rights
Jayasena, Dinesh D; Jung, Samooel; Bae, Young Sik; Kim, Sun Hyo; Lee, Soo Kee; Lee, Jun Heon; Jo, Cheorun
2014-07-01
This study aimed to examine the effect of bird age on the contents of endogenous bioactive compounds, including carnosine, anserine, creatine, betaine, and carnitine, in meat from a certified meat-type commercial Korean native chicken strain (KNC; Woorimatdag). Additionally, the effects of the meat type (breast or leg meat) and the state of the meat (raw or cooked) were examined. Cocks of KNC were raised under similar standard commercial conditions at a commercial chicken farm. At various ages (10, 11, 12, 13, and 14 wk), breast and leg meats from a total of 10 birds from each age group were obtained. Raw and cooked meat samples were then prepared separately and analyzed for bioactive compounds. The age of the KNC had a significant effect only on the betaine content. The breast meat of KNC had higher amounts of carnosine and anserine but had lower amounts of betaine and carnitine than the leg meat (P cooking (P cooking, whereas breast meat showed almost complete retention of betaine and carnitine. The results of this study provide useful and rare information regarding the presence, amounts, and determinants of endogenous bioactive compounds in KNC meat, which can be useful for selection and breeding programs, and also for popularizing indigenous chicken meat. © 2014 Poultry Science Association Inc.
Directory of Open Access Journals (Sweden)
Karol Račka
2015-05-01
The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.
International Nuclear Information System (INIS)
Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki; Izumo, Yoshiro; Nakamura, Fumio.
1997-01-01
Biochemical states of 137 Cs accumulated in killifish's (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of 137 Cs radioactivity in the killifish's raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish's control raw meat mixed with 137 Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to 137 CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD 280nm in the samples were different from those of each radioactive peak. It was so suggested that 137 Cs accumulated in the killifish's meat was shown not to be binding to protein's composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with 137 Cs in samples and ammonium phosphomolybdate, 137 Cs in the NPNC fraction of the killifish's meat was not almost different from those of each control and 137 CsCl solution. (author)
Thapaliya, Dipendra; Forshey, Brett M; Kadariya, Jhalka; Quick, Megan K; Farina, Sarah; O' Brien, Ashley; Nair, Rajeshwari; Nworie, Amos; Hanson, Blake; Kates, Ashley; Wardyn, Shylo; Smith, Tara C
2017-08-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of infectious disease morbidity and mortality. Previous studies have confirmed the presence of S. aureus, including MRSA, on raw meat products. We investigated the prevalence and molecular epidemiology of S. aureus and MRSA in commercially-distributed antibiotic-free and conventional raw meat products (n = 3290) purchased in 8 Iowa retail stores weekly for a period of one year. Isolates were characterized using spa typing, and PCR was used to detect the presence of the Panton-Valentine leukocidin (PVL) and mecA genes. Quantitation of S. aureus on meat products was carried out one week per month. The prevalence of S. aureus on meat samples was 27.8% (913/3290). Compared to antibiotic-free meat samples, higher prevalence of both MRSA and methicillin-susceptible S. aureus (MSSA) were found in conventional meat samples. Among the S. aureus isolates, 18 were PVL-positive (1.9%) and 41 (4.5%) carried mecA. Phenotypic oxacillin resistance was observed for 17.1% (41/239) of the isolates tested, while 23% (55/239) were multi-drug resistant. A total of 132 spa types were detected from 913 contaminated meat samples. Overall, t002 was the most common spa type identified (137; 15.0%). The number of colony-forming units (CFU) per 10 g meat ranged from 2 to 517 (median: 8 CFU per 10 g of meat; mean: 28) with the highest bacterial load observed on turkey samples. These data reinforce the need to consider meat products as potential vehicles of S. aureus transmission from farm into human households, and the potential need for public health intervention programs pre and post-slaughter in meat processing facilities. Copyright © 2017 Elsevier Ltd. All rights reserved.
Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products
Directory of Open Access Journals (Sweden)
Juni Sumarmono
2010-01-01
Full Text Available Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thoroughly and ground using a 5 mm diameter grinding plate. The ground meat was divided into 4 batches (group of treatments; one batch was treated with iced tap water (M1, one batch with 0.1% NaCl solution (M2, one batch with 0.5% NaHCO3 solution (M3, and one batch was left as is as control (M4. Variables measured were water holding capacity (WHC, pH, emulsion capacity and stability of the meat; and firmness and tenderness of the meat gel. Results showed that M1 meat has significantly higher WHC (less percentage of free water than control (M4, whereas M2 and M3 meat has similar WHC to control. Processing caused the ground duck meat to have significantly higher pH than control. The highest meat pH was observed in M3, followed by M2, M1 and control. Processing duck meat with iced tap water, NaCl or NaHCO3 produced significantly more tender meat gel compared to untreated meat (as is. Tenderness of meat gel of M3 was the most tender followed by M2 and M1. Similar results for meat gel firmness were observed. No significant differences were observed in term of emulsion capacity (expressed as ml oil/gr protein and ml oil/gr fresh meat, emulsion stability (expressed as ml oil and total liquid released per 100 gr emulsion, and cooking recovery (%. The study reported in this paper offers simple processing technologies to improve functional characteristics of spent duck meat to be use as raw material for the production of emulsion type meat products. (Animal Production 12
USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION
Directory of Open Access Journals (Sweden)
A. K. Kakimov
2016-01-01
Full Text Available In this paper, the results of the experimental research on developing the technology of a protein complex based on the meat-bone paste and protein-fat-blood emulsion are shown. The technological scheme of meat-bone paste production on the basis of complex grinding meat-bone raw material to bone particle size of 100 ∙10–6 m and further processing of bone particles using reagent, cheese whey, with pH 4,3 is presented. When studying the nutritive and biological value of the protein complex, it was established that the protein complex consisting of the food component from bone and protein-fat-blood emulsion could be used instead of the basic raw material in meat product production. The comparative analysis of the nutritive value of the protein complex and horse meat demonstrated the following results: the amino acid composition of the protein complex showed a balance of the essential amino acids and the high content of the essential amino acids which limit the biological value: lysine, leucine and threonine. The high content of polyunsaturated fatty acids was observed, which justified the biological value of the protein complex.
Neumayerová, Helena; Juránková, Jana; Saláková, Alena; Gallas, Leo; Kovařčík, Kamil; Koudela, Břetislav
2014-05-01
Ingestion of raw or undercooked meat is a potential source of human toxoplasmosis. The aim of this study was to determine the viability of Toxoplasma gondii cysts in vacuum packed (VP) goat meat and in dry fermented sausages (DFS), and evaluate certain physical and chemical parameters, like water activity (aw), pH value, content of salt, dry matter and fat. A portion of muscle tissue from experimentally infected animals was used for production of VP meat with or without addition of 2.5% curing salt, and stored at 4 °C or at -20 °C. Results of bioassay showed that, samples of vacuum packed Toxoplasma positive meat without salt addition were alive after six weeks at 4 °C. Incubation at -20 °C supported the viability after 3 h, but not after 4 h. After 7 days in 2.5% of curing salt, samples of T. gondii VP goat meat were still viable, but not after 14 days at 4 °C. All the DFS samples were not positive for infective cysts which mean that, they do not pose a risk of T. gondii transmission. These data suggest that vacuum packaging increases the survival of T. gondii cysts. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bhoomika
2016-09-01
Full Text Available Aim: To assess the prevalence of antimicrobial resistance producing extended-spectrum β-lactamases (ESBL (blaTEM, blaSHV, and blaCTX-M genes in Escherichia coli isolated from chicken meat, chevon meat, raw milk, and human urine and stool samples collected from tribal districts of Chhattisgarh, viz., Jagdalpur, Dantewada, Kondagaon, and Kanker. Materials and Methods: A total of 330 samples, comprising 98 chicken meat, 82 chevon meat, 90 raw milk, and 60 human urine and stool samples, were processed for isolation of E. coli. Isolates were confirmed biochemically and further tested against commonly used antibiotics to know their resistant pattern. The resistant isolates were tested for ESBL production by phenotypic method followed by characterization with molecular method using multiplex-polymerase chain reaction technique. Results: Overall 57.87% (191/330 samples were found positive for E. coli, which include 66.32% (65/98 chicken meat, 46.34% (38/82 chevon meat, 81.11% (73/90 raw milk, and 25% (15/60 human urine and stool samples. Isolates showed the highest resistance against cefotaxime (41.36% followed by oxytetracycline (34.03%, ampicillin (29.31%, cephalexin (24.60%, cefixime (16.75%, and ceftazidime (13.08%. Phenotypic method detected 10.99% (21/191 isolates as presumptive ESBL producers, however, molecular method detected 3.66% (7/191, 2.09% (4/191, and 0.00% (0/191 prevalence of blaTEM, blaCTX-M, and blaSHV, respectively. Conclusion: The present study indicates a high prevalence of E. coli in raw chicken meat, chevon meat, and milk due to poor hygienic practices. The antibiotic susceptibility test detected the presence of the resistance pattern against ESBL in E. coli isolated from raw chicken meat, chevon meat, milk, and also in human clinical samples is of great concern. The appearance of E. coli in the human food chain is alarming and requires adaptation of hygienic practices and stipulate use of antibiotics.
SELECTION OF MICROORGANISMS FOR FERMENTATION OF MEAT MATERIALS
Directory of Open Access Journals (Sweden)
Danylenko S. G.
2014-08-01
Full Text Available Principal criteria for the selection of microorganisms with a wide range of biological and technological properties for fermentation of raw meats are considered. Attention is paid to the main groups of microorganisms such as Micrococсus, Staphylococcus, Lactobacillus, Bifidobacterium and Propionibacterium which are promising for creation of bacterial preparations. To create bacterial preparations, the basic criteria of selection for microorganisms were determined as follows: the ability of microorganisms to be developed within the specific ecological niche (raw meat materials and their influence on flavor characteristics of the final product under the conditions of intensification of production technologies of meat products. Methods used for search and retrieval of technologically promising strains from different natural sources (fresh meats, minced meats, meat, dairy and sour-milk products, vegetables, fruit, brines and mixtures for salting are considered.
Assessment of levels of bacterial contamination of large wild game meat in Europe.
Membré, Jeanne-Marie; Laroche, Michel; Magras, Catherine
2011-08-01
The variations in prevalence and levels of pathogens and fecal contamination indicators in large wild game meat were studied to assess their potential impact on consumers. This analysis was based on hazard analysis, data generation and statistical analysis. A total of 2919 meat samples from three species (red deer, roe deer, wild boar) were collected at French game meat traders' facilities using two sampling protocols. Information was gathered on the types of meat cuts (forequarter or haunch; first sampling protocol) or type of retail-ready meat (stewing meat or roasting meat; second protocol), and also on the meat storage conditions (frozen or chilled), country of origin (eight countries) and shooting season (autumn, winter, spring). The samples were analyzed in both protocols for detection and enumeration of Escherichia coli, coagulase+staphylococci and Clostridium perfringens. In addition, detection and enumeration of thermotolerant coliforms and Listeria monocytogenes were performed for samples collected in the first and second protocols, respectively. The levels of bacterial contamination of the raw meat were determined by performing statistical analysis involving probabilistic techniques and Bayesian inference. C. perfringens was found in the highest numbers for the three indicators of microbial quality, hygiene and good handling, and L. monocytogenes in the lowest. Differences in contamination levels between game species and between meats distributed as chilled or frozen products were not significant. These results might be included in quantitative exposure assessments. Copyright © 2011 Elsevier Ltd. All rights reserved.
Biochemical and microstructural characteristics of meat samples ...
African Journals Online (AJOL)
This study was conducted to compare the efficiency of different plant proteases for changing biochemical and microstructural characteristics in muscle foods. The meat samples from chicken, giant catfish, pork and beef were treated with four types of proteolytic enzymes: Calotropis procera latex proteases, papaya latex ...
Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food
International Nuclear Information System (INIS)
Lari, L; Dudkiewicz, A
2014-01-01
Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility
Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food
Lari, L.; Dudkiewicz, A.
2014-06-01
Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility.
Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D
2008-10-01
The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.
Directory of Open Access Journals (Sweden)
Geser Nadine
2012-03-01
Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.
LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.
Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B
2017-01-01
Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.
Physicochemical properties of meat of ducks of mulberries in modern technologies of meat products
Directory of Open Access Journals (Sweden)
R. F. Galin
2017-01-01
Full Text Available The article presents the results of studying the chemical composition of mullards duck meat in comparison with the ducks of the Beijingg white breed and musk ducks. The chemical analysis results allow us to note the high moisture content for mullard duck meat. The low fat content for white and red mullard duck meat opens up wide opportunities for the development of an assortment of meat products with a functional orientation. The limited amino acids are determined. The total number of essential amino acids in the mullard duck meat is higher than in musk (by 1.02 g / 100 g protein and Beijingg (by 0.86 g / 100 g protein, which indicates a higher biological value. The limiting amino acid is methionine and cysteine. The article presents the results of the raw material aroma assessment using the "MAG 8" - "electronic nose" analyzer. The content of easily volatile compounds in the equilibrium gas phase for samples of muscle and fat tissue from ducks of different breeding was compared and evaluated. The most informative in the matrix are sensors with films of polydiethylene glycol succinate, polyvinylpyrrolidone, polyethylene glycol PEG-2000, 18-crown-6, trioctylphosphine oxidase, which show maximum sensitivity to polar and nitrogen-containing compounds, aromatic hydrocarbons. This is explained by the fact that the easily volatile fraction of both meat and fat of the samples under study is represented by a variety of organic compounds of different concentrations. Such a variety of substances can be perceived by tasters as "a noticeable smell, difficult". In accordance with the results obtained, we concluded that the aroma of muscle and fat tissue of mulard ducks is more intense, more saturated than the Beijingg duck. The obtained data on the chemical composition indicate possible dietary properties of meat of ducks of mullards. The rich, pronounced aroma of muscle and fatty tissue causes high organoleptic parameters of the finished product, which is
Radiation decontamination of meat lyophylized products
International Nuclear Information System (INIS)
Migdal, W.; Owczarczyk, H.B.
2002-01-01
There is an increasing demand for a powder soups and sauces composed with lyophylizated meat. Technology of lyophylization is not always accompanied by thermal treatment of raw materials. That is the reason the meat lyophylization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment
Nutritional value and fatty acid composition of some traditional Argentinean meat sausages
Mara Cristina Romero; Ana María Romero; Mirtha Marina Doval; Maria Alicia Judis
2013-01-01
The aim of this work was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat) of meat products elaborated in the northeast of Argentina, analyzing fatty acids composition, PUFA/SFA ratio, n-6/n-3 relation, and CLA content. Thirty traditional meat products from different processes were used. Samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage), chorizos (raw sausage), chorizo ahumado (cooked and smoked s...
Directory of Open Access Journals (Sweden)
Duggan Sharon
2012-09-01
Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.
INFLUENCE OF AUTOLYTIC TRANSFORMATIONS ON ELECTROPHYSICAL PROPERTIES OF GOAT MEAT
Directory of Open Access Journals (Sweden)
L. V. Antipova
2014-01-01
Full Text Available Functional foods represented an important element of a balanced, healthy diet. They play an important role in improving the structure of the diet of the population, are a means of prevention, correction and prevention of early transition premorbid conditions and various diseases. Meat and meat products based on it can be considered as a promising raw material for functional foods. Goat has certain dietary properties and can be used in manufacturing, but the production of high-grade products from goat meat, capable of long-term storage is not well developed. The chemical composition of the new raw meat - goat meat, on the example of the longissimus muscle of back is rich in protein, moisture, ash, and low-fat compared with other types of raw meat, which lets you create based on goat meat sector wide functional meat products. Therefore investigated the possibility of using goat meat in the production technology of functional foods. Showing the prospects for the development of goat in Russia. Investigated character of autolysis goat meat electro-physical methods and histological analysis. In the process of autolysis of goat meat are changing the electrical properties of raw meat, which are correlated with the morphological characteristics. Basic autolytic changes occurring in muscle tissue in the early stages of ripening, were reduced to a small extent the political process involving varying degrees of muscle structure in the early stages. In the later stages of maturation revealed changing widespread. Revealed that autolysis has characteristic periods and develops within 12 hours, further changes are irreversible. Shows the change in pH, carbohydrate fractions in the longissimus muscle of back goat. Results of the study of dynamics of change in pH, carbohydrate fractions in the longissimus muscle of back goat show compliance with the laws of classical autolysis noted in other sources, but differ in the time period. Defined stages of autolysis in
Krishnan, K R; Sharma, N
1990-01-01
Ready-to-eat emulsion-type buffalo meat sausages were developed by using a combination of 80% meat components with 20% pork back fat. The meat components were constituted of 70 parts buffalo skeletal meat and 30 parts offal meat (rumen meat and heart meat in equal proportions). The emulsion stability, cooking losses of emulsions and sausages, composition of cooked sausages, eating quality of sausages and the microscopic characteristics of the raw emulsion and cooked sausages were studied. The light microscope micrograph of the raw emulsion showed uniformly well distributed fat globules embedded in a dense protein gel. The cooked emulsion also showed uniformly sized fat globules well distributed in a fine, compact, coagulated protein gel, which retained their original spherical shape. Good quality emulsion-type sausages could be produced having a high emulsion stability (0·87 ± 0·07 ml fat release/100 g emulsion); a low emulsion cooking loss (9·60 ± 0·60%) and a low sausage cooking loss (8·83 ± 0·48%). The overall acceptability of sausages was also high. Copyright © 1990. Published by Elsevier Ltd.
PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS
Directory of Open Access Journals (Sweden)
A. B. Lisitsyn
2016-01-01
Full Text Available Abstract Use of the prediction technologies is one of the directions of the research work carried out both in Russia and abroad. Meat processing is accompanied by the complex physico-chemical, biochemical and mechanical processes. To predict the behavior of meat raw material during the technological processing, a complex of physico-technological and structural-mechanical indicators, which objectively reflects its quality, is used. Among these indicators are pH value, water binding and fat holding capacities, water activity, adhesiveness, viscosity, plasticity and so on. The paper demonstrates the influence of animal proteins (beef and pork on the physico-chemical and functional properties before and after thermal treatment of minced meat made from meat raw material with different content of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence parameters linking the quantitative resultant and factor variables were obtained using the regression analysis, and the degree of the correlation with the experimental data was assessed. The maximum allowable levels of meat raw material replacement with animal proteins (beef and pork were established by the methods of mathematical programming. Use of the information technologies will significantly reduce the costs of the experimental search and substantiation of the optimal level of replacement of meat raw material with animal proteins (beef, pork, and will also allow establishing a relationship of product quality indicators with quantity and quality of minced meat ingredients.
Xiao, S; Zhang, W G; Lee, E J; Ma, C W; Ahn, D U
2011-06-01
This study was designed to evaluate the effects of dietary treatment, packaging, and irradiation singly or in combination on the oxidative stability of broiler chicken thigh meat. A total of 120 four-week-old chickens were divided into 12 pens (10 birds/pen), and 4 pens of broilers were randomly assigned to a control oxidized diet (5% oxidized oil) or an antioxidant-added diet [500 IU of vitamin E + 200 mg/kg of butylated hydroxyanisole (BHA)] and fed for 2 wk. After slaughter, thigh meats were separated, ground, packaged in either oxygen-permeable or oxygen-impermeable vacuum bags, and irradiated at 0 or 3 kGy. Lipid oxidation (TBA-reactive substances), protein oxidation (carbonyl), and color of the meat were measured at 1, 4, and 7 d of refrigerated storage. The lipid and protein oxidation of thigh meats from birds fed the diet supplemented with antioxidants (vitamin E + BHA) was significantly lower than the lipid and protein oxidation of birds fed the control diet, whereas the lipid and protein oxidation of broilers fed the oxidized oil diet was higher than that of birds fed the control diet. Vacuum packaging slowed, but irradiation accelerated, the lipid and protein oxidation of thigh meat during storage. Dietary antioxidants (vitamin E + BHA) and irradiation treatments showed a stronger effect on lipid oxidation than on protein oxidation. A significant correlation between lipid and protein oxidation in meat was found during storage. Dietary supplementation of vitamin E + BHA and the irradiation treatment increased the lightness and redness of thigh meat, respectively. It is suggested that appropriate use of dietary antioxidants in combination with packaging could be effective in minimizing oxidative changes in irradiated raw chicken thigh meat.
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine
2016-01-01
ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in
Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane
2016-07-01
Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake
Influence of color on dielectric properties of marinated poultry breast meat.
Samuel, D; Trabelsi, S
2012-08-01
The dielectric behavior of foods when exposed to radio-frequency and microwave electric fields is highly influenced by moisture content and the degree of water binding with constituents of the food materials. The ability to correlate specific food quality characteristics with the dielectric properties can lead to the development of rapid, nondestructive techniques for such quality measurements. Water-holding capacity is a critical attribute in meat quality. Up to 50% of raw poultry meat in the United States is marinated with mixtures of water, salts, and phosphates. The objective of this study was to determine if variations in breast meat color would affect the dielectric properties of marinated poultry meat over a broad frequency range from 500 MHz to 50 GHz. Poultry meat was obtained from a local commercial plant in Georgia (USA). Color and pH measurements were taken on the breast filets. Groups of breast filets were sorted into classes of pale and normal before adding marination pickup percentages of 0, 5, 10, and 15. Breast filets were vacuum-tumbled and weighed for pickup percentages. Dielectric properties of the filets were measured with a coaxial open-ended probe on samples equilibrated to 25°C. Samples from pale meat exhibited higher dielectric properties than samples from normal meat. No differences could be observed between samples from pale and normal meat after marination of the samples. Overall, dielectric properties increased as the marination pickup increased (α=0.05). Marination pickup strongly influenced the dielectric loss factor. Differences between samples marinated at different pickup levels were more pronounced at lower frequencies for the dielectric loss factor. As frequency increased, the differences between samples decreased. Differences in dielectric constant between samples were not as consistent as those seen with the dielectric loss factor.
Energy Technology Data Exchange (ETDEWEB)
Mistura, Liliana Perazzini Furtado
2002-07-01
The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)
Energy Technology Data Exchange (ETDEWEB)
Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Institute of Public Health, Urawa (Japan); Izumo, Yoshiro; Nakamura, Fumio
1997-07-01
Biochemical states of {sup 137}Cs accumulated in killifish`s (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of {sup 137}Cs radioactivity in the killifish`s raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish`s control raw meat mixed with {sup 137}Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to {sup 137}CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD{sub 280nm} in the samples were different from those of each radioactive peak. It was so suggested that {sup 137}Cs accumulated in the killifish`s meat was shown not to be binding to protein`s composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with {sup 137}Cs in samples and ammonium phosphomolybdate, {sup 137}Cs in the NPNC fraction of the killifish`s meat was not almost different from those of each control and {sup 137}CsCl solution. (author)
Use of artificial intelligence in the production of high quality minced meat
Kapovsky, B. R.; Pchelkina, V. A.; Plyasheshnik, P. I.; Dydykin, A. S.; Lazarev, A. A.
2017-09-01
A design for an automatic line for minced meat production according to new production technology based on an innovative meat milling method is proposed. This method allows the necessary degree of raw material comminution at the stage of raw material preparation to be obtained, which leads to production intensification due to the traditional meat mass comminution equipment being unnecessary. To ensure consistent quality of the product obtained, the use of on-line automatic control of the technological process for minced meat production is envisaged. This system has been developed using artificial intelligence methods and technologies. The system is trainable during the operation process, adapts to changes in processed raw material characteristics and to external impacts that affect the system operation, and manufactures meat shavings with minimal dispersion of the typical particle size. The control system includes equipment for express analysis of the chemical composition of the minced meat and its temperature after comminution. In this case, the minced meat production process can be controlled strictly as a function of time, which excludes subjective factors for assessing the degree of finished product readiness. This will allow finished meat products with consistent, targeted high quality to be produced.
Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma
2018-04-24
Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.
CLOSTRIDIUM PERFRINGENS IN MEAT AND MEAT PRODUCTS.
HALL, H E; ANGELOTTI, R
1965-05-01
A total of 262 specimens of meat and meat dishes were examined for the presence of Clostridium perfringens. Of this total, 161 were raw, unprocessed beef, veal, lamb, pork, or chicken; 101 were processed meats and meat dishes. C. perfringens was isolated from 113 (43.1%) of these specimens. The highest percentage of contamination (82%) was found in veal cuts, and the lowest (4.7%) in sliced sandwich meats and spreads. Only 2 of the 113 isolates were shown to produce heat-resistant spores, which indicates a very low incidence (0.8%) of contamination. These findings indicate that outbreaks of C. perfringens food-borne disease in the Cincinnati area are caused principally by the contamination of the food with vegetative cells or spores of the organism after cooking. Studies of the effects of various holding temperatures on the growth of C. perfringens indicated that, in the range of 5 to 15 C, no multiplication would occur, but that viable cells would still be present at the end of a 5-day holding period. Extremely rapid growth occurred at temperatures around 45 C, and complete inhibition of growth was accomplished between 49 and 52 C.
Hyldgaard, Morten; Meyer, Rikke L; Peng, Min; Hibberd, Ashley A; Fischer, Jana; Sigmundsson, Arnar; Mygind, Tina
2015-12-23
Proliferation of microbial population on fresh poultry meat over time elicits spoilage when reaching unacceptable levels, during which process slime production, microorganism colony formation, negative organoleptic impact and meat structure change are observed. Spoilage organisms in raw meat, especially Gram-negative bacteria can be difficult to combat due to their cell wall composition. In this study, the natural antimicrobial agents ε-poly-L-lysine (ε-PL) and isoeugenol were tested individually and in combinations for their activities against a selection of Gram-negative strains in vitro. All combinations resulted in additive interactions between ε-PL and isoeugenol towards the bacteria tested. The killing efficiency of different ratios of the two antimicrobial agents was further evaluated in vitro against Pseudomonas putida. Subsequently, the most efficient ratio was applied to a raw turkey meat model system which was incubated for 96 h at spoilage temperature. Half of the samples were challenged with P. putida, and the bacterial load and microbial community composition was followed over time. CFU counts revealed that the antimicrobial blend was able to lower the amount of viable Pseudomonas spp. by one log compared to untreated samples of challenged turkey meat, while the single compounds had no effect on the population. However, the compounds had no effect on Pseudomonas spp. CFU in unchallenged meat. Next-generation sequencing offered culture-independent insight into population diversity and changes in microbial composition of the meat during spoilage and in response to antimicrobial treatment. Spoilage of unchallenged turkey meat resulted in decreasing species diversity over time, regardless of whether the samples received antimicrobial treatment. The microbiota composition of untreated unchallenged meat progressed from a Pseudomonas spp. to a Pseudomonas spp., Photobacterium spp., and Brochothrix thermosphacta dominated food matrix on the expense of low
Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.
van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M
2018-01-13
Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and parasitic pathogens in Dutch commercial RMBDs. We analysed 35 commercial frozen RMBDs from eight different brands. Escherichia coli serotype O157:H7 was isolated from eight products (23 per cent) and extended-spectrum beta-lactamases-producing E coli was found in 28 products (80 per cent). Listeria monocytogenes was present in 19 products (54 per cent), other Listeria species in 15 products (43 per cent) and Salmonella species in seven products (20 per cent). Concerning parasites, four products (11 per cent) contained Sarcocystis cruzi and another four (11 per cent) S tenella In two products (6 per cent) Toxoplasma gondii was found. The results of this study demonstrate the presence of potential zoonotic pathogens in frozen RMBDs that may be a possible source of bacterial infections in pet animals and if transmitted pose a risk for human beings. If non-frozen meat is fed, parasitic infections are also possible. Pet owners should therefore be informed about the risks associated with feeding their animals RMBDs. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Study on natural radionuclide activities in meat samples consumed in Sao Paulo City, Brazil
International Nuclear Information System (INIS)
Rosa, Mychelle M.L.; Taddei, Maria HelenaT.
2015-01-01
Consumption of food is usually the most important route by which natural and artificial radionuclides can enter the human body. An assessment of radionuclide levels in different foods and diets is therefore important to estimate the intake of these radionuclides by man. The contamination by radionuclides can occur via the food chain (soil, root, plant and animal), with emphasis to the long half-life radionuclides, which can also have their transfer through the animal meat. The inclusion of meat in human nutrition is important because it is an excellent source of high quality protein, nutrient related to construction and cell regeneration. This work aims the determination of natural radionuclides ( 234 U, 235 U, 238 U, 228 Th, 230 Th, 232 Th, 226 Ra, 228 Ra, and 210 Pb) in meat samples. Five groups of samples were analyzed, such as cattle meat (beef), fish, pork, poultry, and processed meat, after radiochemical separation followed by alpha or alpha beta spectrophotometry, and total count quantification. The determination of these radionuclides is very important because they are products of the natural decay series of 238 U and 232 Th, being easily found in meat samples. (author)
Eosinophilic meningitis risk associated with raw Ampullarium canaliculatus snails consumption
Directory of Open Access Journals (Sweden)
Jiun-Jye Wang
2011-05-01
Full Text Available In Taiwan, Angiostrongylus cantonensis infection has been reported in foreign laborers who had consumed raw Ampullarium canaliculatus snails. This study analyzed three foreign laborers who had contracted enzyme-linked immunosorbent assay-confirmed A cantonensis infection while working in Taiwan. All three workers had consumed either roasted snails or raw snails flavored with seasoning while drinking wine. This study investigated possible risk factors for A cantonensis, including naturally occurring A cantonensis in A canaliculatus snails, viability of third-stage A cantonensis larvae in raw seasoned snails and in roasted snails, infectivity of larvae, and effects of alcohol while consuming snails. Positive infection rates in snails from five different irrigation canals in south Taiwan ranged from 12.3% to 29.4% and the average number of motile larvae per infected snail ranged from 36 to 65. The number of motile and coiled larvae in snail meat after 120 minutes seasoning was 93 (27.7% and 233 (69.3%, respectively. After 20 minutes of roasting, most larvae in the snail meat were dead. The infectivities of motile and coiled larvae from snail meat after 60 minutes seasoning were 53.2% and 33.2%, respectively, and those from snail meat after 5 minutes roasting were 33.2% and 7.0%, respectively. Eating Taiwan A canaliculatus snails raw is extremely risky given their high infection rates and infection intensities. Even after 120 minutes seasoning or after 20 minutes roasting, snail meat should be considered unsafe for human consumption. Finally, experimental rodent studies indicated that consuming alcohol while ingesting larvae does not significantly reduced infectivity.
Effects of meat juice on biofilm formation of Campylobacter and Salmonella.
Li, Jiaqi; Feng, Jinsong; Ma, Lina; de la Fuente Núñez, César; Gölz, Greta; Lu, Xiaonan
2017-07-17
Campylobacter and Salmonella are leading causes of foodborne illnesses worldwide, vastly harboured by raw meat as their common food reservoir. Both microbes are prevalent in meat processing environments in the form of biofilms that contribute to cross-contamination and foodborne infection. This study applied raw meat juice (chicken juice and pork juice) as a minimally processed food model to study its effects on bacterial biofilm formation. Meat juice was collected during the freeze-thaw process of raw meat and sterilized by filtration. In 96-well polystyrene plates and glass chambers, supplementation of over 25% meat juice (v/v) in laboratory media led to an increase in biofilm formation of Campylobacter and Salmonella. During the initial attachment stage of biofilm development, more bacterial cells were present on surfaces treated with meat juice residues compared to control surfaces. Meat juice particulates on abiotic surfaces facilitated biofilm formation of Campylobacter and Salmonella under both static and flow conditions, with the latter being assessed using a microfluidic platform. Further, the deficiency in biofilm formation of selected Campylobacter and Salmonella mutant strains was restored in the presence of meat juice particulates. These results suggested that meat juice residues on the abiotic surfaces might act as a surface conditioner to support initial attachment and biofilm formation of Campylobacter and Salmonella. This study sheds light on a possible survival mechanism of Campylobacter and Salmonella in meat processing environments, and indicates that thorough cleaning of meat residues during meat production and handling is critical to reduce the bacterial load of Campylobacter and Salmonella. Copyright © 2017 Elsevier B.V. All rights reserved.
Study on natural radionuclide activities in meat samples consumed in Sao Paulo City, Brazil
Energy Technology Data Exchange (ETDEWEB)
Rosa, Mychelle M.L.; Taddei, Maria HelenaT. [Comissao Nacional de Energia Nuclear (LAPOC/CNEN), Pocos de Caldas, MG (Brazil). Laboratorio de Pocos de Caldas; Avegliano, Roseane P.; Maihara, Vera A., E-mail: mychelle@cnen.gov.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2015-07-01
Consumption of food is usually the most important route by which natural and artificial radionuclides can enter the human body. An assessment of radionuclide levels in different foods and diets is therefore important to estimate the intake of these radionuclides by man. The contamination by radionuclides can occur via the food chain (soil, root, plant and animal), with emphasis to the long half-life radionuclides, which can also have their transfer through the animal meat. The inclusion of meat in human nutrition is important because it is an excellent source of high quality protein, nutrient related to construction and cell regeneration. This work aims the determination of natural radionuclides ({sup 234}U, {sup 235}U, {sup 238}U, {sup 228}Th, {sup 230}Th, {sup 232}Th, {sup 226}Ra, {sup 228}Ra, and {sup 210}Pb) in meat samples. Five groups of samples were analyzed, such as cattle meat (beef), fish, pork, poultry, and processed meat, after radiochemical separation followed by alpha or alpha beta spectrophotometry, and total count quantification. The determination of these radionuclides is very important because they are products of the natural decay series of {sup 238}U and {sup 232}Th, being easily found in meat samples. (author)
Myoglobin chemistry and meat color.
Suman, Surendranath P; Joseph, Poulson
2013-01-01
Consumers rely heavily on fresh meat color as an indicator of wholesomeness at the point of sale, whereas cooked color is exploited as an indicator of doneness at the point of consumption. Deviations from the bright cherry-red color of fresh meat lead to product rejection and revenue loss. Myoglobin is the sarcoplasmic heme protein primarily responsible for the meat color, and the chemistry of myoglobin is species specific. The mechanistic interactions between myoglobin and multiple extrinsic and intrinsic factors govern the color of raw as well as cooked meats. The objective of this review is to provide an overview of the current research in meat color and how the findings are applied in the meat industry. Characterizing the fundamental basis of myoglobin's interactions with biomolecules in postmortem skeletal muscles is necessary to interpret the chemistry of meat color phenomena and to engineer innovative processing strategies to minimize meat discoloration-induced revenue loss to the agricultural economy.
Antimicrobial Edible Films and Coatings for Meat and Meat Products Preservation
Directory of Open Access Journals (Sweden)
Irais Sánchez-Ortega
2014-01-01
Full Text Available Animal origin foods are widely distributed and consumed around the world due to their high nutrients availability but may also provide a suitable environment for growth of pathogenic and spoilage microorganisms. Nowadays consumers demand high quality food with an extended shelf life without chemical additives. Edible films and coatings (EFC added with natural antimicrobials are a promising preservation technology for raw and processed meats because they provide good barrier against spoilage and pathogenic microorganisms. This review gathers updated research reported over the last ten years related to antimicrobial EFC applied to meat and meat products. In addition, the films gas barrier properties contribute to extended shelf life because physicochemical changes, such as color, texture, and moisture, may be significantly minimized. The effectiveness showed by different types of antimicrobial EFC depends on meat source, polymer used, film barrier properties, target microorganism, antimicrobial substance properties, and storage conditions. The perspective of this technology includes tailoring of coating procedures to meet industry requirements and shelf life increase of meat and meat products to ensure quality and safety without changes in sensory characteristics.
Chemistry in the kitchen. Making ground meat more healthful.
Small, D M; Oliva, C; Tercyak, A
1991-01-10
The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and
Comparison of quality attributes of buffalo meat curry at different storage temperature.
Kandeepan, Gurunathan; Anjaneyulu, Anne Seet Ram; Kondaiah, Napa; Mendiratta, Sanjod Kumar
2011-01-01
The product quality of curry is determined by the food animal source, raw materials and the method of processing. Moreover the scientific information on processing and quality of traditional buffalo meat curry from different groups of buffaloes is not available. This study was undertaken to develop processed curry from different buffalo groups and to compare its quality during storage at ambient and refrigeration temperature. The meat samples were collected from the longissimus dorsi muscle of the carcasses from each group of buffaloes slaughtered according to the traditional halal method. Buffalo meat curry was prepared in a pressure cooker with the standardized formulation. This final product was subjected to evaluation of quality and shelf life. To evaluate the effect of different groups of meat samples on the quality of curry, product yield, pH, proximate composition, water activity (aw), thiobarbituric acid reactive substances (TBARS), calorific value, sensory attributes and microbiological assay were determined The energy of meat curry from young buffaloes was significantly lower than the meat curry from spent animal groups. The overall acceptability of curry decreased significantly during 3 days ambient storage compared to refrigeration storage. Scientific processing by adopting good manufacturing practices and suitable packaging helped greatly to improve the shelf life of the ambient temperature stored buffalo meat curry. Buffalo meat curry from young male group showed better product characteristics and overall acceptability scores than spent buffalo group.
Determination of radioactivity in meat samples
International Nuclear Information System (INIS)
Malik, G.M.; Atta, M.A.; Shafiq, M.; Zafar, M.S.
1993-01-01
The presence of radionuclides in edibles can create harmful effects in the human body. It is, therefore, essential that the radioactivity must be searched in the food stuff specially in those items which are available near the nuclear installations. The radioactivity in the meat samples obtained from the surroundings of PINSTECH (Pakistan Institute of Nuclear Science and Technology), PINSTECH Complex has been determined using high resolution Ge(Li) gamma ray spectrometer and a low level beta counting system. The results show that the measured values of the radioactivity are below the maximum permissible levels. (author)
Metronidazole resistance in Campylobacter jejuni from poultry meat
DEFF Research Database (Denmark)
Andersen, Sigrid Rita; Shukri, Naseer Mahmoud; Boel, Jeppe
2006-01-01
The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution with a signific......The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution...
Rašeta, M.; Mrdović, B.; Janković, V.; Bečkei, Z.; Lakićević, B.; Vidanović, D.; Polaček, V.
2017-09-01
This study aimed to determine Salmonella spp. prevalence in meat products, meat preparations and minced meat. Over a period of three years, a total of 300 samples were taken (100 RTE meat products, 100 meat preparations and 100 minced meat) and examined for the presence of Salmonella spp. Sampling was carried out at the warehouses of the food manufacturers. Salmonella spp. were not detected in RTE meat products, while 7% of semi-finished meat products (fresh sausages, grill meat formed and unformed) contained Salmonella, as did 18% of minced meats (minced pork II category, minced beef II category, mixed minced meat). The 25 Salmonella isolates obtained were examined for antibiotic resistance by the disk diffusion test, according to the NCCLS and CLSI guidelines. Isolates showed resistance to ampicillin and nalidixic acid (80%), tetracycline (72%), cefotaxime/clavulanic acid (48%), but not to gentamicin (8%) or trimethoprim/sulfamethoxazole (0%).
A Potential Use of 3-D Scanning to Evaluate the Chemical Composition of Pork Meat.
Adamczak, Lech; Chmiel, Marta; Florowski, Tomasz; Pietrzak, Dorota; Witkowski, Marcin; Barczak, Tomasz
2015-07-01
The aim of this study was to determine the possibility of 3-D scanning method in chemical composition evaluation of pork meat. The sampling material comprised neck muscles (1000 g each) obtained from 20 pork carcasses. The volumetric estimation process of the elements was conducted on the basis of point cloud collected using 3-D scanner. Knowing the weight of neck muscles, their density was calculated which was subsequently correlated with the content of basic chemical components of the pork meat (water, protein and fat content, determined by standard methods). The significant correlations (P ≤ 0.05) between meat density and water (r = 0.5213), protein (r = 0.5887), and fat (r = -0.6601) content were obtained. Based on the obtained results it seems likely to employ the 3-D scanning method to compute the meat chemical composition. The use of the 3-D scanning method in industrial practice will allow to evaluate the chemical composition of meat in online mode on a dressing and fabrication line and in a rapid, noninvasive manner. The control of the raw material using the 3-D scanning will allow to make visual assessment more objective and will enable optimal standardization of meat batches prior to processing stage. It will ensure not only the repeatability of product quality characteristics, but also optimal use of raw material-lean and fat meat. The knowledge of chemical composition of meat is essential due to legal requirements associated with mandatory nutrition facts labels on food products. © 2015 Institute of Food Technologists®
Advances in ingredient and processing systems for meat and meat products.
Weiss, Jochen; Gibis, Monika; Schuh, Valerie; Salminen, Hanna
2010-09-01
Changes in consumer demand of meat products as well as increased global competition are causing an unprecedented spur in processing and ingredient system developments within the meat manufacturing sector. Consumers demand healthier meat products that are low in salt, fat, cholesterol, nitrites and calories in general and contain in addition health-promoting bioactive components such as for example carotenoids, unsaturated fatty acids, sterols, and fibers. On the other hand, consumers expect these novel meat products with altered formulations to taste, look and smell the same way as their traditionally formulated and processed counterparts. At the same time, competition is forcing the meat processing industry to use the increasingly expensive raw material "meat" more efficiently and produce products at lower costs. With these changes in mind, this article presents a review of novel ingredient systems and processing approaches that are emerging to create high quality, affordable meat products not only in batch mode but also in large-scale continuous processes. Fat replacers, fat profile modification and cholesterol reduction techniques, new texture modifiers and alternative antioxidant and antimicrobial systems are being discussed. Modern processing equipment to establish continuously operating product manufacturing lines and that allow new meat product structures to be created and novel ingredients to be effectively utilized including vacuum fillers, grinders and fine dispersers, and slicers is reviewed in the context of structure creation in meat products. Finally, trends in future developments of ingredient and processing systems for meat products are highlighted.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Some technological aspects of combined processing of meat by heat and ionizing radiations
International Nuclear Information System (INIS)
Gel'fand, S.Yu.; Nomenotskaya, N.F.; Mozul', M.Ya.
1974-01-01
The paper discusses the use of ionizing radiation to prolong the storage life of meat and meat products. Irradiating raw meat with doses of 0.4-0.6 Mrad increased storage life up to two months at low above-zero C temperatures. The difficulty of inhibiting autolytic processes during storage of irradiated raw meat led to searches for combined methods of meat treatment. A series of experiments was staged with pre-irradiation heating of meat up to 75, 77, and 80 0 C in order to see how cathepsin activity is affected by the duration and temperature of heating in the case of combined treatment. To increase the resistance of meat products to microbial damage, tests were carried out in which meat was exposed to short-term but intensive heat by immersing it in hot (130-160 0 C) vegetable oil (frying grease). The results are presented in the form of tables and diagrams. (E.T.)
Unraveling the chemical identity of meat pigments.
Pegg, R B; Shahidi, F
1997-10-01
This review examines the chemistry of nitrite curing of meat and meat products as it relates to the development of cured meat color and provides a detailed account of how nitrite-free processed meats could be prepared using the preformed cooked cured-meat pigment (CCMP). Thus, a chemical description of meat color, both raw and cooked, and characterization of nitrosylheme pigments follows. Based on electron paramagnetic resonance (EPR), visible and infrared spectroscopic studies, evidence has been provided to support the hypothesis that the chemical structure of the preformed CCMP is identical to that of the pigment prepared in situ after thermal processing of nitrite-cured meat and is in fact a mononitrosylheme complex. An appendix, which describes the basic principles of EPR spectroscopy used in the context of this review, is attached.
Directory of Open Access Journals (Sweden)
Alvarado Pavel Espinoza
2017-08-01
Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.
Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus
Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E.; Hanson, Blake M.; Smith, Tara C.
2017-01-01
The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n?=?3347) and contemporaneously from meat produc...
Effect of comminution method and raw binder system in restructured beef.
Boles, J A; Shand, P J
1998-07-01
The effect of particle size, method of particle size reduction (grinding, flaking, slicing) and alginate or Fibrimex(™) binding systems on processing properties of restructured beef were investigated. The size of semimembranosus muscles was reduced with a meat slicer, grinder or flaker (Comitrol) through machine openings that were 2, 4 and 8 mm in size. Bind of meat pieces in raw and cooked beef steakettes were measured. Sensory evaluation to determine the effect of method of size reduction on texture of beef steakettes was done only on steakettes manufactured with alginate. Beef steakettes manufactured with the alginate binding system had significantly (p meat for the manufacture of restructured beef steakettes resulted in a higher raw bind than did either grinding or flaking the meat. Significant (p meat was sliced than when it was ground or flaked. However, when Fibrimex was used, bind was stronger when sliced meat was used. The alginate system resulted in higher binds for cooked product when particle size was smaller but with the Fibrimex system bind was higher when particle sizes were larger. A consumer panel on alginate restructured steakettes showed no preference for the texture produced by the different methods of particle size reduction.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair
2015-08-01
A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.
High pressure processing of meat: effects on ultrastructure and protein digestibility.
Kaur, Lovedeep; Astruc, Thierry; Vénien, Annie; Loison, Olivier; Cui, Jian; Irastorza, Marion; Boland, Mike
2016-05-18
The effects of high pressure processing (HPP, at 175 and 600 MPa) on the ultrastructure and in vitro protein digestion of bovine longissimus dorsi muscle meat were studied. HPP caused a significant change in the visual appearance and texture of the meat subjected to HPP at 600 MPa so that it appeared similar to cooked meat, unlike the meat subjected to HPP at 175 MPa that showed no significant visible change in the colour and texture compared to the raw meat. The muscles were subjected to digestion under simulated gastric conditions for 1 h and then under simulated small-intestinal conditions for a further 2 h. The digests were analysed using gel electrophoresis (SDS-PAGE) and ninhydrin assay for amino N. The effect of the acid conditions of the stomach alone was also investigated. Reduced SDS-PAGE results showed that pepsin-digested (60 min) HPP meats showed fewer proteins or peptides of high molecular weight than the pepsin-digested untreated meat, suggesting more breakdown of the parent proteins in HPP-treated meats. This effect was more pronounced in the muscles treated at 600 MPa. These results are in accordance with microscopy results, which showed greater changes in the myofibrillar structure after simulated gastric digestion of the sample processed at 600 MPa than at 175 MPa. Transmission electron microscopy also showed the presence of protein aggregates in the former sample, resulting probably from protein denaturation of sarcoplasmic proteins, in the subcellular space and between myofibrils; along with cell contraction (similar to that caused by heating) in the former.
Effect of storage conditions on the biogenic amine content in wild boar meat
Directory of Open Access Journals (Sweden)
Zdeňka Hutařová
2014-01-01
Full Text Available Hygienic quality of game meat depends on many factors during and after hunting. Freshness of meat is connected with the concentration of biogenic amines which is related to meat spoilage. The aim of this study was to assess changes in concentration of biogenic amines in raw meat of wild boar (n = 20, mean age 1–2 years during storage at different temperatures. Carcases of wild boars hunted in winter 2012 in hunting districts of south Moravia were stored unskinned during 21 days at various temperatures (0, 7 and 15 °C. Concentrations of biogenic amines (putrescine, cadaverine, tyramine, tryptamine, phenylethylamine, histamine, spermine and spermidine were determined in the shoulder and leg muscles by high-performance liquid chromatography in combination with triple quadrupole tandem mass spectrometry. Good hygienic quality was maintained when wild boar carcasses were stored for a maximum of 14 days at 0 °C (content of biogenic amines in 3 meat samples exceed the limit of 5 mg/kg on day 21 of storage or a maximum of 7 days at 7 °C (content of biogenic amines in 4 meat samples exceed the limit of 5 mg/kg on day 14 of storage. The temperature of 15 °C should be considered as unsuitable storage temperature if good hygienic quality of game meat during storage is to be guaranteed (content of biogenic amines in 2 meat samples exceed the limit of 5 mg/kg already on day 7 of storage. The study brings new information about the biogenic amine content and its changes in wild boar meat during the storage period of 21 days.
RAW CHICKEN LEG AND BREAST SENSORY EVALUATION
Directory of Open Access Journals (Sweden)
Octavian Baston
2010-01-01
Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.
Production of crispy bread snacks containing chicken meat and chicken meat powder
Directory of Open Access Journals (Sweden)
HULYA CAKMAK
Full Text Available ABSTRACT Chicken meat in two different forms (chicken meat and chicken meat powder were added into white flour and whole wheat blend baguette bread formulations for protein enrichment and finally developing new and healthy snacks. The chicken meat and powder levels were 10% for white flour baguette, and 15% for whole wheat blend. The dried baguette samples were packaged under 100% N2, and physical, chemical, microbiological and sensorial properties were evaluated during 3 months of storage. Protein content of chicken meat powder added samples were found statistically higher than chicken meat added samples. Hardness of the snacks was significantly affected from type of chicken meat, such as values were higher for chicken meat added samples than chicken meat powder added samples. Lipid oxidation of the snacks was determined by TBA analysis, and TBA value for whole wheat mixture snack with 15% of chicken meat was the highest among all during storage. The highest overall acceptance score was obtained from white flour snack with 10% chicken meat. There was no coliform bacteria detected during storage and the results of yeast-mold count and aerobic plate count of snacks remained between the quantitative ranges.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Dos Santos, Luis Fernando; Jakabi, Miyoko; de Melo Franco, Bernadette Dora Gombossy
2017-08-01
Meat products may be vehicles of bacterial pathogens to humans, and Salmonella spp., Campylobacter spp., and Shiga toxin-producing Escherichia coli (STEC) are the most relevant. The aim of this study was to generate data on prevalence of these three pathogens in 552 samples of meat products (hot dogs, pork sausages, raw ground beef, and raw chicken legs) sold at retail in the city of Sao Paulo, Brazil. Salmonella spp. was detected in 5.8% (32/552) of samples, comprising pork sausages 62.5% (20/32) and chicken legs 37.5% (12/32). The counts of Salmonella spp. were low, ranging from Salmonella Typhimurium (28.1%), Salmonella I 4,[5],12:i:- (15.6%), Salmonella Enteritidis (12.5%), Salmonella Derby, and Salmonella Brandenburg (9.4%). Campylobacter spp. was detected in 33 samples (6.0%), comprising chicken legs (82%) and ground beef (18%). All samples were negative for STEC. These results suggest that meat products when subjected to inadequate cooking and/or cross-contamination with other products ready for consumption can lead to occurrence of outbreaks, highlighting the risks associated with them.
D'Evoli, L; Salvatore, P; Lucarini, M; Nicoli, S; Aguzzi, A; Gabrielli, P; Lombardi-Boccia, G
2009-01-01
The present study provides a picture of the compositional figure and nutritive value of meat-based dishes typical of Italian culinary tradition. Recipes specific for a bovine meat cut (top-side) were selected among the most widespread ones in Italy: in pan, pizzaiola, cutlet, meat ball, and escalope. The total fat and cholesterol content varied depending on the ingredients utilized (extra-virgin olive oil, parmesan, egg). Meat-based dishes that utilized extra-virgin olive oil showed a significant reduction in palmitic and stearic acids and a parallel increase in oleic acid compared with raw meat; furthermore, the ratio among saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids shifted in favour of monounsaturated fatty acids. B vitamins were affected at different extent by heating; by contrast, vitamin E content increased because of the new sources of this vitamin, which masked losses due to heating. Ingredients (parmesan, discretionary salt) induced significant increases in the calcium and sodium concentrations compared with raw meat. The total iron content did not show marked differences in most of the meat-based dishes compared with raw meat; by contrast, losses in the heme-iron concentration were detected depending on the severity of heating treatments. Our findings suggest that heme iron, because of its important health aspects, might be a useful index of the nutritional quality of cooked meats.
Halal authenticity issues in meat and meat products.
Nakyinsige, Khadijah; Man, Yaakob Bin Che; Sazili, Awis Qurni
2012-07-01
In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pfeiler, Tamara M; Egloff, Boris
2018-02-01
The vast amount of meat consumed in the Western world is critically discussed with regard to negative health consequences, environmental impact, and ethical concerns for animals, emphasizing the need to extend knowledge regarding the correlates of meat consumption in the general population. In the present article, we conducted two studies examining the associations between meat consumption and personality traits, political attitudes, and environmental attitudes in two large German representative samples (N total = 8,879, aged 18-96 years). Cross-sectional data on frequency of meat consumption, socio-demographics, personality traits, and political and environmental attitudes were collected via self-reports. In both studies, male sex, younger age, and lower educational attainment were significantly positively related to meat consumption. In Study 1, results of the partial correlations and the hierarchical regression analysis controlling for socio-demographics showed that the personality traits of openness and agreeableness, as well as conservative political and social views, explained unique variance in meat consumption. In Study 2, partial correlations and hierarchical regression analyses showed that openness, agreeableness, and conscientiousness were all uniquely negatively related to meat consumption. Moreover, these analyses documented that people scoring high in right-wing attitudes and low in pro-environmental attitudes reported more overall meat consumption. Taken together, these two studies provided evidence that socio-demographics, personality traits, and attitudes are indeed related to how much meat is consumed. Implications and future prospects for the study of individual differences in meat consumption are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Quality, functionality, and shelf life of fermented meat and meat products: A review.
Kumar, Pavan; Chatli, M K; Verma, Akhilesh K; Mehta, Nitin; Malav, O P; Kumar, Devendra; Sharma, Neelesh
2017-09-02
Fermentation of meat is a traditional preservation method used widely for improving quality and shelf life of fermented meat products. Fermentation of meat causes a number of physical, biochemical, and microbial changes, which eventually impart functional properties, sensory characteristics, and nutritional aspects to these products and inhibit the growth of various pathogenic and spoilage microorganisms. These changes include acidification (carbohydrate catabolism), solubilization and gelation of myofibrillar and sarcoplasmic proteins of muscle, degradation of proteins and lipids, reduction of nitrate into nitrite, formation of nitrosomyoglobin, and dehydration. Dry-fermented sausages are increasingly being used as carrier of probiotics. The production of biogenic amines during fermentation can be controlled by selecting proper starter cultures and other preventive measures such as quality of raw materials, hygienic measures, temperature, etc.
Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie
2018-02-01
Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.
Baburina, M. I.; Ivankin, A. N.; Stanovova, I. A.
2017-09-01
The process of chemical biotechnological processing of collagen-containing raw materials into functional components of feeds for effective pig rearing was studied. Protein components of feeds were obtained as a result of hydrolysis in the presence of lactic acid of the animal collagen from secondary raw materials, which comprised subcutaneous collagen (cuticle), skin and veined mass with tendons from cattle. For comparison, a method is described for preparing protein components of feeds by cultivating Lactobacillus plantarum. Analysis of the kinetic data of the conversion of a high-molecular collagen protein to an aminolyte polypeptide mixture showed the advantage of microbiological synthesis in obtaining a protein for feeds. Feed formulations have been developed to include the components obtained, and which result in high quality pork suitable for the production of quality meat products.
Influence of the marinating type on the morphological and sensory properties of horse meat.
Vlahova-Vangelova, Dessislava B; Abjanova, Sholpan; Dragoev, Stefan G
2014-01-01
The aim of this study was to explore the influence of acid, alkaline and water-oil marinating on morphological changes and sensory properties of horse meat (m. Longissimus dorsi). Nine samples (C - control stored in air, AL - alkaline marinated in 2% polyphosphates and 2% sodium chloride brine solution, AC - acid marinated in 2% sodium lactate and 2% sodium chloride brine solution, WO - marinated in water-oil emulsion (50/50) contained and 2% sodium chloride and SC - marinated in 2% sodium chloride brine solution) were examined. After 24 h and 48 h of marinating changes in morphology of marinated meat, pH and sensory properties of raw and roasted samples were established. It was determined that sensory properties (aroma, flavor and tenderness) after roasting were classified as follows: AL48 > AL24 > AC24 > AC48 > SC48 > SC24 > WO24 > WO48 > С. Meat tenderness in AL48, AL24, AC24 and AC48 showed better results due to stronger morphological changes in connective and muscle tissues. Alkaline solutions were more suitable for horse meat marinating compared to acid solutions and the possible reason for strong action of alkaline solutions was lower internal meat pH. Alkaline marinating should be conducted for 24 h because after 48 h the meat acquires a soft and unusually tender texture. Water-oil marinating was not appropriate for horse meat.
DEFF Research Database (Denmark)
Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask
2005-01-01
The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...
Influence radurization on the sensory properties of broiler meat
International Nuclear Information System (INIS)
Zabielski, J.; Fiszer, W.; Mroz, J.; Niewiarowicz, A.
1981-01-01
The sensory properties of normal, PSE and DFD chicken carcasses have been investigated. Raw carcasses treated with 2,5 kGy and 5,0 kGy could be distinguished from non-irradiated by its appearance and slight irradiation odour, however all samples were in the acceptable range. The broiler carcasses after 14 days of storage in 4+-1 degC had received sensory acceptance ratings comparable with fresh, non-irradiated samples. Due to unpalatable odour, the shelf-life of radurized PSE carcasses was limited to 14 days in comparison with 21 days for normal and DFD type broiler meat. (author)
Guo, Miao; Buchanan, Robert L; Dubey, Jitender P; Hill, Dolores E; Lambertini, Elisabetta; Ying, Yuqing; Gamble, H Ray; Jones, Jeffrey L; Pradhan, Abani K
2015-12-01
Toxoplasma gondii is a global protozoan parasite capable of infecting most warm-blooded animals. Although healthy adult humans generally have no symptoms, severe illness does occur in certain groups, including congenitally infected fetuses and newborns, immunocompromised individuals including transplant patients. Epidemiological studies have demonstrated that consumption of raw or undercooked meat products is one of the major sources of infection with T. gondii. The goal of this study was to develop a framework to qualitatively estimate the exposure risk to T. gondii from various meat products consumed in the United States. Risk estimates of various meats were analyzed by a farm-to-retail qualitative assessment that included evaluation of farm, abattoir, storage and transportation, meat processing, packaging, and retail modules. It was found that exposure risks associated with meats from free-range chickens, nonconfinement-raised pigs, goats, and lamb are higher than those from confinement-raised pigs, cattle, and caged chickens. For fresh meat products, risk at the retail level was similar to that at the farm level unless meats had been frozen or moisture enhanced. Our results showed that meat processing, such as salting, freezing, commercial hot air drying, long fermentation times, hot smoking, and cooking, are able to reduce T. gondii levels in meat products. whereas nitrite and/or nitrate, spice, low pH, and cold storage have no effect on the viability of T. gondii tissue cysts. Raw-fermented sausage, cured raw meat, meat that is not hot-air dried, and fresh processed meat were associated with higher exposure risks compared with cooked meat and frozen meat. This study provides a reference for meat management control programs to determine critical control points and serves as the foundation for future quantitative risk assessments.
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
Tayel, Ahmed A; Ibrahim, Sami I A; Al-Saman, Mahmoud A; Moussa, Shaaban H
2014-08-01
Raw and processed meat contaminated with pathogenic microorganisms is a continuing worldwide problem facing health and industry overseers. Fungal chitosan was extracted, purified and characterized from Aspergillus brasiliensis (niger) ATCC 16404 grown in date syrup (dips) and applied as a potential meat biopreservative. The main features of produced chitosan were a deacetylation degree of 81.3%, a molecular weight of 31,000Da, 96% solubility in 1% acetic acid solution and a harmonized IR-spectrum to standard commercial chitosan. The application of fungal chitosan, as a natural and safe biopreservative for minced meat, was conducted in comparison with potassium sorbate, as a commercial meat preservative. Treated meat samples with 0.02% chitosan was the least trials in microbial contents, i.e. total count, coliforms, β-glucuronidase-positive Escherichia coli, Enterobacteriaceae, yeasts and molds, Staphylococcus aureus and coagulase positive staphylococci. The antimicrobial activity of fungal chitosan was considerably greater than that of potassium sorbate or their combination at 0.01% from each. Sensory characteristics, e.g. color, odor and texture, of treated meat with chitosan, were higher than those of control and potassium sorbate treated samples. Fungal chitosan, however, could be recommended as a powerful, natural and eco-friendly alternative for meat preservation and overall quality maintenance. Copyright © 2014 Elsevier B.V. All rights reserved.
Klein, Günter; Pack, Alexander; Reuter, Gerhard
1998-01-01
The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958
Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo
2011-10-01
One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall.
Trichinellosis acquired in Nunavut, Canada in September 2009: meat from grizzly bear suspected.
Houzé, S; Ancelle, T; Matra, R; Boceno, C; Carlier, Y; Gajadhar, A A; Dupouy-Camet, J
2009-11-05
Five cases of trichinellosis with onset of symptoms in September 2009, were reported in France, and were probably linked to the consumption of meat from a grizzly bear in Cambridge Bay in Nunavut, Canada. Travellers should be aware of the risks of eating raw or rare meat products in arctic regions, particularly game meat such as bear or walrus meat.
Jayasena, Dinesh D; Jung, Samooel; Kim, Hyun Joo; Yong, Hae In; Nam, Ki Chang; Jo, Cheorun
2015-08-01
The effects of bird age and the cooking process on the levels of several taste-active compounds, including inosine 5'-monophosphate (IMP), glutamic acid, cysteine, reducing sugars, as well as oleic, linoleic, arachidonic, and docosahexaenoic acids (DHA), in the breast and leg meats from a certified meat-type commercial Korean native chicken (KNC) strain (Woorimatdag) were investigated. KNC cocks were raised under similar standard conditions at a commercial chicken farm, and breast and leg meats from birds of various ages (10, 11, 12, 13, and 14 wk; 10 birds/age group) were obtained. After raw and cooked meat samples were prepared, they were analyzed for the aforementioned taste-active compounds. Compared to the leg meat, KNC breast meat had higher levels of IMP, arachidonic acid, and DHA, but lower levels of the other taste-active compounds (P cooking process (P cooking process. This information could be useful for selection and breeding programs, and for popularizing native chicken meat. © 2015 Poultry Science Association Inc.
Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P
1997-10-01
Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.
Energy Technology Data Exchange (ETDEWEB)
Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)
2005-01-15
A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)
The radioactivity of meat samples between 1977 and 1982
International Nuclear Information System (INIS)
Zalabai, Bela
1983-01-01
90 Sr and 137 Cs from atmospheric nuclear explosions can get into the organizations of domestic animals via fodder. Radiological tests of meat samples revealed a load maximum last time in 1976. The regular tests of pork and beef samples between 1977 and 1982 in Hungary showed no significant differences in their radiocesium contents. The change of strontium activity in bones, however, lasts longer than that of cesium. According to the measurements, the strontium activity in swine bones was almost one order lower than that in cattle bones. (Sz.J.)
Mohamed, Hussein Mh; Emara, Mohamed Mt; Nouman, Taha M
2016-07-01
The camel is an excellent source of high quality meat and camel meat might be a potential alternative for beef. This study aimed to manipulate the raw camel meat for the production of stable and acceptable emulsion sausage, as well as to study the effect of cooking at different core temperatures on the tenderness, sensory quality and microstructure of produced sausage. Increasing the cooking temperature of sausages resulted in reduction of the shear force values from 2.67 kgf after cooking at 85 °C to 1.57 kgf after cooking at 105 °C. The sensory scores of sausages have been improved by increasing the cooking core temperature of meat batter. The light and scanning electron microscope micrographs revealed solubilisation of the high quantity of connective tissue of camel meat. High emulsion stability values for the camel meat batter associated with high values of water-holding capacity for raw camel meat and meat batter have been recorded. Stable and acceptable camel meat emulsion can be developed from camel meat. Increasing the cooking core temperature of meat batter improved the quality of produced sausages. Therefore, camel meat emulsion sausages might be a potential alternative for beef particularly in Asian and African countries. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Jaja, Ishmael Festus; Green, Ezekiel; Muchenje, Voster
2018-04-21
Foodborne disease (FBD) is a global public health concern, and foods from animal sources have been associated with outbreaks of food-related illness. In this study, animal carcasses from the two abattoirs (HT1 and HT2) in the formal meat sector (FMS) and slaughter points in the informal meat sector (INMS) were examined at two stages of slaughter (before washing and after washing) for aerobic colony counts (ACC) and total viable count (TCC), as well as Escherichia coli and Staphylococcus aureus count. At each stage, carcasses were sampled by swabbing at the neck, brisket, flank, and rump. ACC for beef, mutton, and pork carcasses at HT1 and HT2 before washing were between 2.5⁻5.8, 2.2⁻4.7, and 2.7⁻3.7 mean log CFU/cm², respectively, and TCC count before washing was highest on the neck of cattle (6.3 ± 2.4) and after washing was highest on the perineal of sheep (5.7 ± 6.9). In the INMS, TCC count was highest on the brisket (6.9 ± 3.2) and in the neck (5.5 ± 2.4). Higher ACC values of 6.2⁻6.7 mean log CFU/cm² were obtained in the INMS. The highest count for E. coli (4.2 mean log CFU/cm²) after washing was in the neck, while the highest count for S. aureus (4.0 mean log CFU/cm²) was in the flank. All bacteria count in the INMS exceeded acceptable limits, and washing did not significantly reduce microbial load in meat in the FMS and INMS. Bacteria count in the FMS and INMS exceeded acceptable standards. However, meat processed in the INMS poses a more significant risk of FBD to consumers.
Study on the meat isotopic composition for origin identification
Directory of Open Access Journals (Sweden)
Irina Chernukha
2018-03-01
Full Text Available Russian consumer and governmental authorities are equally concerned to know where food products come from. This requires more accurate and specialized methods for the evaluation of geographical location. The following methods are used: chemometrics, histological and histochemical, genomic and proteomic, microbiological, immunochemical and mass spectrometric. Method of stable isotope analysis is becoming increasingly promising nowadays for the identification of meat and meat products' place of origin. The isotope ratios of the four elements - carbon, nitrogen, oxygen and hydrogen, are mainly determined. The method is successfully used to identify a country of origin of wines, juices and water. The aim of the research was to study the stable isotope ratios for pork and beef samples purchased in Moscow supermarkets (Russian Federation. The country of production of meat samples was determined according to specifications and/or labels. The geography of countries of meat samples origin includes Europe, both America continents and Australia. Databases collected by the All-Russian Scientific Research Institute of the Brewing, Non-Alcoholic and Wine Industrywere used for the analysis and interpretation of the results. Values of 13С/12С, δ13С, 18О/16О, δ18О, 2Н/1Н, δ2Н for 30 pork and beef samples from 13 countries were obtained. Differences in stable isotope ratios were found depending on place of origin. The data correlated with the oxygen isotope characteristics for wine, which were in the range from 2.5 to 4.5 ppm. According to the 13С/12С, δ13С results, the assumption was made about a false indication of the region for the beef sample. Despite the fact that beef was labeled as a product of Lithuania, the region of origin was most probably defined as Germany. The studies carried out showed the possibility to identify the region of raw meat origin by the stable isotope ratio.
Garedew, Legesse; Hagos, Zenabu; Zegeye, Bidir; Addis, Zelalem
2016-01-01
Food borne pathogens are major causes of deaths, illnesses and billions of dollars of expenses. The burden of food borne illness is worsened by the ever increasing rate of antimicrobial resistance microbes. Shigella, a bacterial pathogen associated with food, is reported to account for higher prevalence rates of food borne illness in different settings. A cross-sectional study was conducted from February 10 to June 30, 2013, at the butcher houses of Gondar town in the Northwest of Ethiopia to assess the prevalence and antimicrobial susceptibility pattern of Shigella. Cattle raw meat and swab samples from selected critical control points, including knives, chopping boards, and the hands and noses of butchers, were collected and analyzed. The identification of Shigella was carried out using colony characteristics, the Gram reaction, and biochemical tests. Antimicrobial susceptibility testing was performed using the Kirby-Bauer disc diffusion method. The overall hygienic status of the butcher shops was also assessed using a checklist. An observational analysis revealed that the sanitary condition of the butcher shops and their premises was poor. Of 306 samples screened, 10.5% were positive for Shigella. Approximately 7.4% of meat samples and 10.2% of swab samples were contaminated with Shigella. Out of the total Shigella isolates, 90.6%, 46.9%, 18.8% and 9.4% were resistant to ampicillin, amoxicillin, ceftriaxone and tetracycline, respectively. A multidrug resistance pattern was recorded in 27.8% of the isolates. In conclusion, the safety of meat sold at Gondar butchers houses was poor. The identified Shigella isolates showed high levels of drug resistance and multidrug resistance patterns for commonly used antimicrobials in veterinary and human medicine. Practicing wise use of antimicrobials and strict sanitary interventions at different critical control points is strongly recommended, in addition to further in-depth studies to prevent unprecedented consequences from
Effect of Selected Alternative Fuels and Raw Materials on the Cement Clinker Quality
Directory of Open Access Journals (Sweden)
Strigáč Július
2015-11-01
Full Text Available The article deals with the study of the effects of alternative fuels and raw materials on the cement clinker quality. The clinker quality was expressed by the content of two principal minerals alite C3S and belite C2S. The additions of alternative fuels ashes and raw materials, in principle, always increased the belite content and conversely reduced the amount of alite. The alternative fuels with high ash content were used such as the meat-bone meal, sewage sludge from sewage treatment plants and paper sludge and the used alternative raw materials were metallurgical slags - granulated blastfurnace slag, air cooled blastfurnace slag and demetallized steel slag, fluidized bed combustion fly ash and waste glass. Meat-bone meal, sewage sludge from sewage treatment plants and paper sludge were evaluated as moderately suitable alternative fuels which can be added in the amounts of 2.8 wt. % addition of meat-bone meals ash, 3.64 wt. % addition of sewage sludge ash and 3.8 wt. % addition of paper sludge ash to the cement raw mixture. Demetallised steel slag is suitable for production of special sulphate resistant cement clinker for CEM I –SR cement with addition up to 5 wt. %. Granulated blastfurnace slag is a suitable alternative raw material with addition 4 wt. %. Air cooled blastfurnace slag is a suitable alternative raw material with addition 4.2 wt. %. Waste glass is not very appropriate alternative raw material with addition only 1.16 wt. %. Fluidized bed combustion fly ash appears not to be equally appropriate alternative raw material for cement clinker burning with less potential utilization in the cement industry and with addition 3.41 wt. %, which forms undesired anhydrite CaSO4 in the cement clinker.
International Nuclear Information System (INIS)
Obana, H.; Furuta, M.; Tanaka, Y.
2007-01-01
2-Alkylcyclobutanones, such as 2-dodecylcyclobutanone and 2-tetradecylcyclobutanone, were analyzed to assess the irradiation history of irradiated meats or fish, and cooked foods with irradiated ingredients, which had been stored frozen for up to one year. The purpose of the study was to show that irradiated meats could be detected even after having been stored in the distribution system. 2-Alkylcyclobutanones showed a small decrease in irradiated raw meats that had been stored frozen for one year. Cooked foods, such as pancake and fried chicken made with irradiated eggs and chicken, respectively, contained detectable levels of 2-alkylcyclobutanones after storage frozen for one year. The 2-alkylcyclobutanones became undetectable in highly dried samples, such as feed for lab animals, during the same period
9 CFR 317.344 - Identification of major cuts of meat products.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Identification of major cuts of meat... AND VOLUNTARY INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.344 Identification of major cuts of meat products. The major cuts of single-ingredient, raw...
Louis, Elan D; Zheng, Wei; Jiang, Wendy; Bogen, Kenneth T; Keating, Garrett A
2007-06-01
Harmane, one of the heterocyclic amines (HCAs), is a potent neurotoxin linked to human diseases. Dietary exposure, especially in cooked meats, is the major source of exogenous exposure for humans. However, knowledge of harmane concentrations in cooked meat samples is limited. Our goals were to (1) quantify the concentration of harmane in different types of cooked meat samples, (2) compare its concentration to that of other more well-understood HCAs, and (3) examine the relationship between harmane concentration and level of doneness. Thirty barbecued/grilled meat samples (8 beef steak, 12 hamburger, 10 chicken) were analyzed for harmane and four other HCAs (2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine [PhIP], amino-3,8-dimethylimidazo[4,5-f]quinoxaline [MeIQx], 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline [DiMeIQx], and 2-amino-1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine [IFP]). Mean (+/- SD) harmane concentration was 5.63 (+/- 6.63) ng/g; harmane concentration was highest in chicken (8.48 +/- 9.86 ng/g) and lowest in beef steak (3.80 +/- 3.6 ng/g). Harmane concentration was higher than that of the other HCAs and significantly correlated with PhIP concentration. Harmane concentration was associated with meat doneness in samples of cooked beef steak and hamburger, although the correlation between meat doneness and concentration was greater for PhIP than for harmane. Evidence indicates that harmane was detectable in nanograms per gram quantities in cooked meat (especially chicken) and, moreover, was more abundant than other HCAs. There was some correlation between meat doneness and harmane concentration, although this correlation was less robust than that observed for PhIP. Data such as these may be used to improve estimation of human dietary exposure to this neurotoxin.
Louis, Elan D.; Zheng, Wei; Jiang, Wendy; Bogen, Kenneth T.; Keating, Garrett A.
2016-01-01
Harmane, one of the heterocyclic amines (HCAs), is a potent neurotoxin linked to human diseases. Dietary exposure, especially in cooked meats, is the major source of exogenous exposure for humans. However, knowledge of harmane concentrations in cooked meat samples is limited. Our goals were to (1) quantify the concentration of harmane in different types of cooked meat samples, (2) compare its concentration to that of other more well-understood HCAs, and (3) examine the relationship between harmane concentration and level of doneness. Thirty barbecued/grilled meat samples (8 beef steak, 12 hamburger, 10 chicken) were analyzed for harmane and four other HCAs (2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine [PhIP], amino-3,8-dimethylimidazo[4,5-f]quinoxaline [MeIQx], 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline [DiMeIQx], and 2-amino-1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine [IFP]). Mean (± SD) harmane concentration was 5.63 (± 6.63) ng/g; harmane concentration was highest in chicken (8.48 ± 9.86 ng/g) and lowest in beef steak (3.80 ± 3.6 ng/g). Harmane concentration was higher than that of the other HCAs and significantly correlated with PhIP concentration. Harmane concentration was associated with meat doneness in samples of cooked beef steak and hamburger, although the correlation between meat doneness and concentration was greater for PhIP than for harmane. Evidence indicates that harmane was detectable in nanograms per gram quantities in cooked meat (especially chicken) and, moreover, was more abundant than other HCAs. There was some correlation between meat doneness and harmane concentration, although this correlation was less robust than that observed for PhIP. Data such as these may be used to improve estimation of human dietary exposure to this neurotoxin. PMID:17497412
Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia
DEFF Research Database (Denmark)
Derra, F. A.; Karlsmose, Susanne; Monga, D. P.
2013-01-01
Background. Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. Objective. The objective...... of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Methods. Two hundred forty food samples were purchased...
Schlegelová, J; Babák, V; Holasová, M; Dendis, M
2008-01-01
Isolates from the "farm to fork" samples (182 isolates from 2779 samples) were examined genotypically (icaAB genes) and phenotypically (in vitro biofilm formation, typical growth on Congo red agar; CRA) with the aim to assess the risk of penetration of virulent strains of Staphylococcus epidermidis into the food chain. The contamination of meat and milk products was significantly higher in comparison with raw materials. Contamination of contact surfaces in the meat-processing plants was significantly lower than that of contact surfaces in the dairy plants. The ica genes (which precondition the biofilm formation) were concurrently detected in 20 isolates that also showed a typical growth on CRA. Two ica operon-negative isolates produced biofilm in vitro but perhaps by an ica-independent mechanism. The surfaces in the dairy plants and the milk products were more frequently contaminated with ica operon-positive strains (2.3 and 1.2 % samples) than the other sample types (0-0.6 % samples).
Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo
2011-01-01
One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall. PMID:21784913
Meat spoilage during distribution.
Nychas, George-John E; Skandamis, Panos N; Tassou, Chrysoula C; Koutsoumanis, Konstantinos P
2008-01-01
Meat spoilage during distribution can be considered as an ecological phenomenon that encompasses the changes of the available substrata (e.g., low molecular compounds), during the prevailing of a particular microbial association, the so-called specific spoilage organisms (SSO). In fact, spoilage of meat depends on an even smaller fraction of SSO, called ephemeral spoilage organisms (ESO). These ESO are the consequence of factors that dynamically persist or imposed during, e.g., processing, transportation and storage in the market. Meanwhile spoilage is a subjective judgment by the consumer, which may be influenced by cultural and economic considerations and background as well as by the sensory acuity of the individual and the intensity of the change. Indeed, when spoilage progresses, most consumers would agree that gross discoloration, strong off-odors, and the development of slime would constitute the main qualitative criteria for meat rejection. On the other hand, meat industry needs rapid analytical methods or tools for quantification of these indicators to determine the type of processing needed for their raw material and to predict remaining shelf life of their products. The need of an objective evaluation of meat spoilage is of great importance. The use of metabolomics as a potential tool for the evaluation of meat spoilage can be of great importance. The microbial association of meat should be monitored in parallel with the estimation of changes occurring in the production and/or assimilation of certain compounds would allow us to evaluate spoilage found or produced during the storage of meat under different temperatures as well as packaging conditions.
SAG2 locus genotyping of Toxoplasma gondii in meat products of ...
African Journals Online (AJOL)
Toxoplasmosis is an infection caused by Toxoplasma gondii, an intracellular obligate parasite. Its transmission is usually attributed to ingestion of undercooked or raw meat. The aim of this study was the detection and genotyping of T. gondii in meat products using the molecular method in East Azerbaijan. DNA was ...
2011-12-09
.... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...
Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC
Directory of Open Access Journals (Sweden)
afshin Nazari
2007-10-01
Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC
Perez, T I; Zuidhof, M J; Renema, R A; Curtis, J M; Ren, Y; Betti, M
2010-03-01
The influence of vitamin E and selenomethionine (SeMet) on lipid oxidation in frozen-raw and cooked omega-3 enriched dark chicken meat was evaluated. Feed was supplemented with 2 levels of vitamin E (250 and 50 IU/kg of feed) and selenium (0.1 mg of sodium selenite/kg of feed and 0.3 mg of SeMet/kg of feed). An extruded linseed product was used as the alpha-linolenic acid source. Fatty acid (FA) profile, oxysterols, and thiobarbituric reactive acid substances (TBARs) were analyzed in frozen-raw, boiled, pan-fried, and roasted meat. After 6 mo of storage, oxysterols in frozen-raw meat remained stable with either high or low levels of dietary antioxidants. During cooking, high levels of vitamin E reduced oxysterol formation, whereas high levels of SeMet were inconsistent and even increased oxysterols during roasting. TBARs in frozen-raw meat stored for 6 mo were inhibited by high levels of either antioxidant. Conversely, no protective effect during cooking was observed at this time of storage. After 12 mo at -30 degrees C no antioxidant protection was observed.
Meat quality characteristics of DurocxYorkshire, DurocxYorkshirexwild boar and wild boar
Directory of Open Access Journals (Sweden)
Ivanović Snežana D.
2013-01-01
Full Text Available Chemical composition, pH value, fatty acids profile, cholesterol content, color and sensory analysis of pork meat from Duroc x Yorkshire (D x Y, Duroc x Yorkshire x wild boar (D x Y x WB crossbreeds and wild boars (WB was investigated. Samples for all tests were taken from m. longissimus dorsi. Chemical composition and pH value were tested by ISO methods. Fatty acid and cholesterol determination was performed by gas chromatography technique with external standard method. Color was determined instrumentally using the thristimulus colourimeter. The overall sensoric quality (appearance, texture and smell of samples of raw meat was evaluated. In evaluation of results the scoring system was used. In chemical composition (moisture, fat, protein, ash and pH values statistically significant difference was noted (p<0,05 between each of the examined groups. Also, among all the examined groups statistically significant difference (p<0,05 was found for fatty acids and cholesterol content. Measurment of the color of meat from all three groups showed that the L*, a * b *, Chroma and Hue angle were also statistically significantly different (p<0,01.
Content of ochratoxin A in paired kidney and meat samples from healthy Danish slaughter pigs
DEFF Research Database (Denmark)
Jørgensen, Kevin; Petersen, Annette
2002-01-01
In 1999, paired samples of kidney and meat were taken from 300 healthy Danish pigs and analysed for ochratoxin A. The concentrations of ochratoxin A in kidney ranged from 0 to 15 mug kg(-1) (mean 0.50 mug kg(-1), median 0.18 mug kg(-1)) and in meat from 0 to 2.9 mug kg(-1) (mean 0.12 mug kg(-1......), median 0.03 mug kg(-1)). The data together with the Danish control data show that today the pig industry in Denmark has no problem keeping the content of ochratoxin A in pig at very low levels even in years with wet harvest conditions. The mean ratio 'content in meat/content in kidney' for paired samples...... was 39%. For kidney samples > 1.0 mug kg(-1), the mean ratio was 22%. The Danish control system for ochratoxin A in pig kidney established in 1978 can be regarded as a success because the levels in pig have been reduced substantially, and hence for the consumer the contribution from pig products...
Directory of Open Access Journals (Sweden)
K. Konell
2014-12-01
Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.
Methods and approaches to prediction in the meat industry
Directory of Open Access Journals (Sweden)
A. B. Lisitsyn
2016-01-01
Full Text Available The modern stage of the agro-industrial complex is characterized by an increasing complexity, intensification of technological processes of complex processing of materials of animal origin also the need for a systematic analysis of the variety of determining factors and relationships between them, complexity of the objective function of product quality and severe restrictions on technological regimes. One of the main tasks that face the employees of the enterprises of the agro-industrial complex, which are engaged in processing biotechnological raw materials, is the further organizational improvement of work at all stages of the food chain, besides an increase in the production volume. The meat industry as a part of the agro-industrial complex has to use the biological raw materials with maximum efficiency, while reducing and even eliminating losses at all stages of processing; rationally use raw material when selecting a type of processing products; steadily increase quality, biological and food value of products; broaden the assortment of manufactured products in order to satisfy increasing consumer requirements and extend the market for their realization in the conditions of uncertainty of external environment, due to the uneven receipt of raw materials, variations in its properties and parameters, limited time sales and fluctuations in demand for products. The challenges facing the meat industry cannot be solved without changes to the strategy for scientific and technological development of the industry. To achieve these tasks, it is necessary to use the prediction as a method of constant improvement of all technological processes and their performance under the rational and optimal regimes, while constantly controlling quality of raw material, semi-prepared products and finished products at all stages of the technological processing by the physico-chemical, physico-mechanical (rheological, microbiological and organoleptic methods. The paper
Schmidt, Heinar; Scheier, Rico; Hopkins, David L
2013-01-01
A prototype handheld Raman system was used as a rapid non-invasive optical device to measure raw sheep meat to estimate cooked meat tenderness and cooking loss. Raman measurements were conducted on m. longissimus thoracis et lumborum samples from two sheep flocks from two different origins which had been aged for five days at 3-4°C before deep freezing and further analysis. The Raman data of 140 samples were correlated with shear force and cooking loss data using PLS regression. Both sample origins could be discriminated and separate correlation models yielded better correlations than the joint correlation model. For shear force, R(2)=0.79 and R(2)=0.86 were obtained for the two sites. Results for cooking loss were comparable: separate models yielded R(2)=0.79 and R(2)=0.83 for the two sites. The results show the potential usefulness of Raman spectra which can be recorded during meat processing for the prediction of quality traits such as tenderness and cooking loss. Copyright © 2012 Elsevier Ltd. All rights reserved.
Effect of irradiated pork on physicochemical properties of meat emulsions
Choi, Yun-Sang; Sung, Jung-Min; Jeong, Tae-Jun; Hwang, Ko-Eun; Song, Dong-Heon; Ham, Youn-Kyung; Kim, Hyun-Wook; Kim, Young-Boong; Kim, Cheon-Jei
2016-02-01
The effect of pork irradiated with doses up to 10 kGy on meat emulsions formulated with carboxy methyl cellulose (CMC) was investigated. Raw pork was vacuums packaged at a thickness of 2.0 cm and irradiated by X-ray linear accelerator (15 kW, 5 MeV). The emulsion had higher lightness, myofibrillar protein solubility, total protein solubility, and apparent viscosity with increasing doses, whereas cooking loss, total expressible fluid separation, and hardness decreased. There were no significant differences in fat separation, sarcoplasmic protein solubility, springiness, and cohesiveness. Our results indicated that it is treatment by ionizing radiation which causes the effects the physicochemical properties of the final raw meat product.
40 CFR 90.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... probe may not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe must be... the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to the HC... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 89.412 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... the exhaust pipe shall be as small as practical in order to minimize heat loss from the probe. (2) The... sample transport system from the engine exhaust pipe to the HC analyzer and the NOX analyzer must be... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
40 CFR 91.414 - Raw gaseous exhaust sampling and analytical system description.
2010-07-01
... shall not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe shall be as... internally to the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...
Liao, Kuoyao; Cai, Jingyi; Shi, Zhujun; Tian, Gang; Yan, Dong; Chen, Delin
2017-06-01
This study was conducted to investigate the effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits, in order to determine appropriate rabbit feed processing methods and processing parameters. In Exp. 1, an orthogonal design was adopted. Barrel temperature, material moisture content and feed rate were selected as test factors, and acid detergent fiber (ADF) content was selected as an evaluation index to research the optimum extrusion parameters. In Exp. 2, a two-factor design was adopted. Four kinds of rabbit feeds were processed and raw material extrusion adopted optimum extrusion parameters of Exp. 1. A total of 40 healthy and 42-day-old rabbits with similar weight were used in a randomized design, which consisted of 4 groups and 10 replicates in each group (1 rabbits in each replicate). The adaptation period lasted for 7 d, and the digestion trial lasted for 4 d. The results showed as follows: 1) ADF was significantly affected by barrel temperature ( P digestibility of dry matter and total energy ( P digestibility of crude fiber (CF), ADF and NDF ( P digestibility of rabbit feed. Thus, using extrusion and steam conditioning technology at the same time in the weaning rabbits feed processing can improve the pellet quality and nutrient apparent digestibility of rabbit feed.
NEW MEAT PRODUCTS WITH IMMUNOMODULATORY EFFECT CREATION METHOD
Directory of Open Access Journals (Sweden)
I. V. Kaltovich
2016-01-01
Full Text Available New meat products with immunomodulatory effect creation method reflecting differential characteristics of technological stages of manufacture of those types of meat products, including issues on the selection of primary and secondary raw materials, guidelines for development of formulations and production technologies, legislative requirements towards its labeling, etc, has been developed for the first time. A list of prospective meat raw materials for the manufacture of products with immunomodulatory effect was established: beef, pork, rabbit meat, broiler chicken meat, turkey, veal, ostrich meat, which have high content of protein (14,3– 21,7%, low content of fat (1,2–16,1%, excluding pork (33,3%, high levels of minimum amino-acid score (90,0–104,0%, protein quality indicator(0,91–1,64, essential amino acid index (1,16-1,25, coefficient of utility of amino acid content (0,72–0,86 and close to optimum fatty acid content, and also contain a great number of vitamins and minerals which play a significant role for immunity improvement. It was determined that the following functional ingredients are recommended to use: amino acids (valine, leucine, isoleucine, methionine, threonine, arginine, tryptophan, lysine, histidin, phenylalanyl, vitamins and provitamins (C,E, beta-carotene, B vitamins(Bc, B12, PP, etc., P(bioflavonoid complex, H, K, minerals (calcium, magnesium, iron, cuprum, zinc, manganese, selenium, polyunsaturated fatty acids omega-3 and omega-6, pseudo-vitamins (L-carnitin, coenzyme Q10, polysaccharides and peptides naturally occurring(squalen, B-Carotene, ginger, shiitake mushrooms, probiotics and prebiotics, glutathione, indole and lycopienes, bioflavonoids, L-arginine, N-acetylcysteine, gel from seaweed «Lamifaren». The use of the developed meat products with immunomodulatory effect creation method by process engineers of meat processing factories will allow them to form a single scientifically grounded approach during the
Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy.
Jakes, W; Gerdova, A; Defernez, M; Watson, A D; McCallum, C; Limer, E; Colquhoun, I J; Williamson, D C; Kemsley, E K
2015-05-15
This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz (1)H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional "authentic" beef region (p=0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze-thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz (1)H NMR represents a feasible high-throughput approach for screening raw meat. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Detection of Salmonella in Meat
DEFF Research Database (Denmark)
Löfström, Charlotta; Hansen, Flemming; Mansdal, Susanne
2012-01-01
Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective of this study was to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab samples...... obtained (SP, SE, and AC were 100, 95, and 97%, respectively). This test is under implementation by the Danish meat industry, and can be useful for screening of large number of samples in the meat production, especially for fast release of minced meat with a short shelf life....
Directory of Open Access Journals (Sweden)
Ilona Kołodziejska
2013-01-01
Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.
Meat and Meat Product Consumption among Infants in Latvia
Directory of Open Access Journals (Sweden)
Širina Inga
2017-12-01
Full Text Available Meat consumption during the first year of life is especially important to provide necessary iron requirements. The aim of the study was to assess meat and meat product consumption of Latvian infants during their first year of life, in relation to different factors. Data were collected by interview method using two types of questionnaires: food frequency questionnaires and food diary. The study included a representative sample of infants and toddlers from all regions of Latvia with a target sample of 560 participants. The study included 266 infants: 127 girls, 139 boys, aged from 0 to 12 month. Data were summarised using the Excel software and analysed using the SPSS software. For data analysis two age groups were created: 0–5.9 months and 6–12 months. Consumption was analysed by two parameters: frequency and amount per feeding. Meat products were defined as offal products, sausages, and meat in baby food. Meat was mainly consumed after 6 months of age and by 73% of infants (n = 107. Meat from baby food was consumed only after 6 months and by 23% (n = 34. Sausages and offal products were consumed after 6 months of age. Sausages were consumed by 18% (n = 28 and offal products by 11% (n = 16 of infants. Meat consumption for the majority of infants was introduced after 6 months and was in accordance with recommendations.
The quality evaluation of frankfurter-type sausages from hand and mechanically deboned turkey meat.
Radomyski, T; Niewiarowicz, A
1987-03-01
A quality evaluation was made of frankfurter-type sausages made from hand and mechanically deboned meat from various parts of turkey carcasses. The results led to the conclusions that despite some differences in objective measurements of the sausage quality, mechanically deboned turkey meat can be considered as an exclusive meat raw material for the production of frankfurter-type sausages. The quality of sausages from mechanically deboned turkey meat from wings and frames with skin was the least satisfactory.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
QUALITY CONTROL OF SOME TRADITIONAL MEAT PRODUCTS
Directory of Open Access Journals (Sweden)
S. DOBRINAS
2014-03-01
Full Text Available In this paper, we present the characterization of six traditional meat products: smoked file, smoked bacon, pork sausages, sausage prepared from swine’s entrails, pork pastrami, sheep sausages. Organoleptic tests (the aspect and shape, the aspect of freshly cut in the section, smell, taste and consistency, physico-chemical and microbiological determinations (NTG, Salmonella, Listeria monocytogenes and Escherichia coli were performed. These analyzes are a part of quality control that must be done in order to obtain a certificate from the Ministry of Agriculture for a traditional product. After identification of H2S and starch and according to fat oxidation degree it was concluded that analyzed samples didn’t contain counterfeiters and all parameters analyzed are within the maximum limits allowed by law. Considering all the procedures for manufacturing, characteristics of raw and auxiliary materials, organoleptic properties of final products analyzed in this study, it can be concluded that analyzed meat specialties meet the requirements of Ministry Order no. 690/28.09.2004 for the traditional products certification.
Evaluation of induced color changes in chicken breast meat during simulation of pink color defect.
Holownia, K; Chinnan, M S; Reynolds, A E; Koehler, P E
2003-06-01
The objective of the study was to establish a pink threshold and simulate the pink defect in cooked chicken breast meat with treatment combinations that would induce significant changes in the color of raw and cooked meat. The subjective pink threshold used in judging pink discoloration was established at a* = 3.8. Samples of three color groups (normal, lighter than normal, and darker than normal) of boneless, skinless chicken breast muscles were selected based on instrumental color values. The in situ changes were induced using sodium chloride, sodium tripolyphosphate, sodium erythorbate, and sodium nitrite at two levels: present and not present. Fillets in all treatments were subjected to individual injections, followed by tumbling, cooking, and chilling. Samples were analyzed for color [lightness (L*), red/green axis (a*), yellow/blue axis (b*)] and reflectance spectra. Simulation of the pink defect was achieved in eight of the 16 treatment combinations when sodium nitrite was present and in an additional two treatment combinations when it was absent. Pinking in cooked samples was affected (P meat color. Results confirmed that it was possible to simulate the undesired pinking in cooked chicken white meat when in situ conditions were induced by sodium chloride, sodium tripolyphosphate, and sodium nitrite. The continuation of the simulation study can aid in developing alternative processing methods to eliminate potential pink defects.
International Nuclear Information System (INIS)
Harsojo; Banati, D.; Ito, H.
1997-01-01
Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C
Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2013-12-01
Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.
Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy
Jakes, W.; Gerdova, A.; Defernez, M.; Watson, A.D.; McCallum, C.; Limer, E.; Colquhoun, I.J.; Williamson, D.C.; Kemsley, E.K.
2015-01-01
This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz 1H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional “authentic” beef region (p = 0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze–thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz 1H NMR represents a feasible high-throughput approach for screening raw meat. PMID:25577043
Hoorfar, J.; Hansen, F.; Christensen, J.; Mansdal, S.; Josefsen, M. H.
2016-01-01
ABSTRACT Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella, and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases meat, consisting of a 3-h enrichment in standard buffered peptone water and a real-time PCR-compatible sample preparation method based on filtration, centrifugation, and enzymatic digestion, followed by fast-cycling real-time PCR detection. The method was validated in an unpaired comparative study against the Nordic Committee on Food Analysis (NMKL) reference culture method 187. Pork meat samples (n = 140) were either artificially contaminated with Salmonella at 0, 1 to 10, or 10 to 100 CFU/25 g of meat or naturally contaminated. Cohen's kappa for the degree of agreement between the rapid method and the reference was 0.64, and the relative accuracy, sensitivity, and specificity for the rapid method were 81.4, 95.1, and 97.9%, respectively. The 50% limit of detections (LOD50s) were 8.8 CFU/25 g for the rapid method and 7.7 CFU/25 g for the reference method. Implementation of this method will enable faster release of Salmonella low-risk meat, providing savings for meat producers, and it will help contribute to improved food safety. IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. PMID:27986726
STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT
Directory of Open Access Journals (Sweden)
DANIELA IANIłCHI
2008-10-01
Full Text Available Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some factors belonging to the intrinsic quality of meat, animal slaughter methods, technological operations applied to the meat, and the auxiliary materials used.
Paris, A; Bonardi, S; Bacci, C; Boni, E; Salmi, F; Bassi, L; Brindani, F
2010-06-01
The aim of the study was to evaluate the sensitivity of two m-PCR methods for the quantitative determination of E. coli O157:H7 in foodstuffs. Genomic serotyping was carried out on bacterial cultures, and the necessary time was optimized to increase the resolution of the method. Subsequently, artificial contamination trials using meat were conducted to assess method accuracy in foodstuffs and pursue the genetic typing of pathogens. Measurement thresholds were shown to range between 10(5) and 10(6) CFU/mL, but were reduced by four logarithmic cycles in 80% of samples. Relative to the meat contamination trials, serotypes were identified after 24 hours, corresponding to 10 CFU/mL inoculum, with higher rates seen when m-TSB was used for enrichment. Inoculated samples were found to contain three virulence factors (hlyA, eaeA, and stx1).
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
Vitamin D-3 and 25-hydroxyvitamin D-3 in raw and cooked pork cuts
DEFF Research Database (Denmark)
Clausen, Ina; Jakobsen, Jette; Leth, Torben
2003-01-01
The contents of vitamin D-3 and its metabolically active metabolite 25-hydroxyvitamin D-3 (25OHD(3)) were examined by HPLC in different parts of four common raw pork cuts (loin boneless, leg inside, thin belly, neck) and in cooked meat (loin boneless). In whole raw pork cuts, varying in fat content......, and that rind, despite its limited fat content, has a high concentration of vitamin D-3 and 25OHD(3). Cooking increased vitamin D-3 and 25OHD(3) calculated per 100 g of tissue in all parts and in the whole cut (in whole cuts in raw and cooked meat, respectively: vitamin D-3: 0.15 (0.08-0.24) mug/100 g and 0...... 25OHD(3) contributes significantly to vitamin D activity. Food databases should include concentrations of both vitamin D and 25OHD(3). (C) 2003 Elsevier Ltd. All rights reserved....
Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha
2015-01-01
Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.
Update on the bird-egg syndrome and genuine poultry meat allergy.
Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines
Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to sensitization to serum albumins present in many tissues including muscle tissue and egg yolk (Gal d 5). Primary sensitization to serum albumin may happen via the respiratory tract through exposure to pet birds (mainly in adults) or within the context of egg allergy in early childhood. Due to the heat lability of serum albumins, reactions are often limited to the skin upon contact with raw meat. Symptoms from meat ingestion are rare and mostly mild, whereas systemic reactions are common after ingestion of raw or soft-boiled egg yolk. Primary poultry meat allergy is mainly seen in adolescents and young adults, though hypersensitivity may have started already at (pre)school age. Egg allergy is usually absent. Typical symptoms of primary poultry meat allergy include OAS (±dyspnea), gastrointestinal complaints, urticaria and angioedema. Severe anaphylaxis with cardiovascular symptoms is rare. Chicken and turkey meat are highly cross-reactive and responsible for most reactions, while duck and goose meat causes milder or no symptoms. Soups, sausages, and ham represent relevant allergen sources, too. Patients with poultry meat allergy unexpectedly often suffer from concomitant allergy to fish and possibly shrimp. Serum specific IgE against fish and shrimp is found in respectively 60 and 40 % of sera, suggestive of cross-reactive allergens in these foods. The allergens thus far recognized in genuine poultry meat are LMW proteins of 5-25 kDa. One of them has been identified as
Journey length and high temperatures: effects on rabbit welfare and meat quality.
Liste, G; María, G A; Buil, T; García-Belenguer, S; Chacón, G; Olleta, J L; Sañudo, C; Villarroel, M
2006-02-01
The transport of domestic animals by road can increase levels of stress and decrease meat quality, especially in unfavourable climates. The purpose of this study was to investigate the effect of journey duration and vertical position on the transport truck on some physiological indicators of stress and on instrumental meat quality parameters in commercial rabbits. In the summer months (June and July, 2003), 78 rabbits were subjected to either long (7 h) (LJ) or short (1 h) (SJ) journeys (3 replicates each, n = 6) between the farm and an abattoir in northern Spain. The position (top, middle, or bottom) occupied by the rabbits on the Multi-Floor cage Rolling Stand (MFRS) of the transport truck was recorded. Blood samples were collected at sticking and meat pH was measured at 24 h post-mortem (pH24). At 48 h post-mortem, samples of the M. longissimus dorsi were used to determine water-holding capacity (WHC) and instrumental tenderness using an INSTRON machine. The levels of corticosterone, glucose, lactate, and creatine kinase were slightly higher in LJ than in SJ samples, but the difference was not statistically significant (p MFRS showed higher levels (p < or = 0.05) of glucose and creatine kinase (middle), and corticosterone (bottom) than the rabbits located at the top floor. The pH 24 and WHC values of the SJ and LJ rabbits did not differ significantly. Journey length had a significant effect (p < or = 0.01) on meat tenderness. The meat from rabbits subjected to LJ had higher values of maximum stress and total toughness than did the SJ rabbits (p < or = 0.05). There were similar differences (p < or = 0.05) between LJ and SJ rabbits in their stress values of compression at 20% and 40% (measures of the tenderness of raw meat). In hot weather, the position on the transport truck appeared to have a greater effect on rabbit welfare than the duration of the journey.
Gilani, A; Razavilar, V; Rokni, N; Rahimi, E
2017-01-01
Although Helicobacter pylori has a significant impact on the occurrence of severe clinical syndromes, its exact ways of transmission and origin have not been identified. According to the results of some previously published articles, foods with animal origins play a substantial role in the transmission of H. pylori to humans. The present investigation was carried out to study the vacuolating cytotoxin A ( vacA ) and cytotoxin associated gene A ( cagA ) genotypes status and antibiotic resistance properties of H. pylori strains recovered from minced-meat and hamburger samples. A total of 150 meat product samples were collected from supermarkets. All samples were cultured and the susceptive colonies were then subjected to nested-PCR, PCR-based genotyping and disk diffusion methods. 11 out of 150 samples (7.33%) were positive for H. pylori . All the isolates were further identified using the nested-PCR assay. Prevalence of H. pylori in hamburger and minced-meat samples was 1.42% and 12.5%, respectively. S1a , m1a and cagA were the most commonly detected genotypes. The most commonly detected combined genotypes in the H. pylori strains of minced-meat were s1am1a (10%), s1am1b (10%) and s2m1a (10%). Helicobacter pylori strains of meat products harbored the highest levels of resistance against ampicillin (90.90%), erythromycin (72.72%), amoxicillin (72.72%), trimethoprim (63.63%), tetracycline (63.63%), and clarithromycin (63.63%). Hamburger and minced-meat samples may be the sources of virulent and resistant strains of H. pylori . Meat products are possible sources of resistant and virulent strains of H. pylori similar to those vacA and cagA genotypes. Using healthy raw materials and observation of personal hygiene can reduce the risk of H. pylori in meat products.
International Nuclear Information System (INIS)
Kasviki, K.; Stamatelatos, I.E.; Yannakopoulou, E.; Papadopoulou, P.; Kalef-Ezra, J.
2007-01-01
A prompt gamma neutron activation analysis (PGNAA) facility has been developed for the determination of nitrogen and thus total protein in large volume biological samples or the whole body of small animals. In the present work, the accuracy of nitrogen determination by PGNAA in phantoms of known composition as well as in four raw ground meat samples of about 1 kg mass was examined. Dumas combustion and Kjeldahl techniques were also used for the assessment of nitrogen concentration in the meat samples. No statistically significant differences were found between the concentrations assessed by the three techniques. The results of this work demonstrate the applicability of PGNAA for the assessment of total protein in biological samples of 0.25-1.5 kg mass, such as a meat sample or the body of small animal even in vivo with an equivalent radiation dose of about 40 mSv
Energy Technology Data Exchange (ETDEWEB)
Kasviki, K. [Institute of Nuclear Technology and Radiation Protection, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece); Medical Physics Laboratory, Medical School, University of Ioannina, Ioannina 45110 (Greece); Stamatelatos, I.E. [Institute of Nuclear Technology and Radiation Protection, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece)], E-mail: ion@ipta.demokritos.gr; Yannakopoulou, E. [Institute of Physical Chemistry, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece); Papadopoulou, P. [Institute of Technology of Agricultural Products, NAGREF, Lycovrissi, Attikis 14123 (Greece); Kalef-Ezra, J. [Medical Physics Laboratory, Medical School, University of Ioannina, Ioannina 45110 (Greece)
2007-10-15
A prompt gamma neutron activation analysis (PGNAA) facility has been developed for the determination of nitrogen and thus total protein in large volume biological samples or the whole body of small animals. In the present work, the accuracy of nitrogen determination by PGNAA in phantoms of known composition as well as in four raw ground meat samples of about 1 kg mass was examined. Dumas combustion and Kjeldahl techniques were also used for the assessment of nitrogen concentration in the meat samples. No statistically significant differences were found between the concentrations assessed by the three techniques. The results of this work demonstrate the applicability of PGNAA for the assessment of total protein in biological samples of 0.25-1.5 kg mass, such as a meat sample or the body of small animal even in vivo with an equivalent radiation dose of about 40 mSv.
Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.
2014-01-01
The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using
Directory of Open Access Journals (Sweden)
Valeria Velasco
Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA
Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong
2018-04-01
The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.
Huang, Huiting; Gao, Lirong; Zheng, Minghui; Li, Jingguang; Zhang, Lei; Wu, Yongning; Wang, Runhua; Xia, Dan; Qiao, Lin; Cui, Lili; Su, Guijin; Liu, Wenbin; Liu, Guorui
2018-02-01
Food intake is one of the main pathways of human exposure to chlorinated paraffins (CPs). This study assessed the dietary exposure for the general Chinese population to short-chain chlorinated paraffin (SCCPs) and medium-chain chlorinated paraffins (MCCPs) through meat and meat products. Twenty samples of meat and meat products from 20 Chinese provinces were collected in 2011. As the sampling sites covered about two-thirds of the Chinese population, the meat samples were considered to be representative of the true characteristics of CPs contamination in Chinese meat products. The concentrations of SCCPs and MCCPs in the meat samples were measured using the comprehensive two-dimensional gas chromatography electron capture negative ionization high-resolution time-of-flight mass spectrometry method. Forty-eight SCCP and MCCP homolog groups were detected in the meat samples. The mean SCCP and MCCP concentrations in all meat samples were 129 ± 4.1 ng g -1 wet weight and 5.7 ± 0.59 ng g -1 wet weight, respectively. The concentrations of SCCPs and MCCPs varied in samples from different provinces. The geographical distribution of CP concentrations was similar to the distribution of CPs manufacturing plants in China. The most abundant groups of SCCPs in all samples were C 10-11 Cl 6-7 , and the most abundant groups of MCCPs in most samples were C 14 Cl 7-8 . The possible sources of SCCPs and MCCPs in meat and meat products might be CP-42 and CP-52. The 50th percentile estimated daily intakes of SCCPs and MCCPs through meat consumption for a "standard" Chinese adult male were 0.13 and 0.0047 μg kg -1 bw d -1 , respectively, both much lower than the tolerable daily intakes (TDIs) for SCCPs and MCCPs. This preliminary risk assessment has indicated that the indirect exposure of SCCPs and MCCPs through meat consumption does not pose significant risk to human health in China. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ruiz-Capillas, C; Aller-Guiote, P; Carballo, J; Colmenero, F Jiménez
2006-12-27
Changes in biogenic amine formation and nitrite depletion in meat batters as affected by pressure-temperature combinations (300 MPa/30 min/7, 20, and 40 degrees C), cooking process (70 degrees C/30 min), and storage (54 days/2 degrees C) were studied. Changes in residual nitrite concentration in raw meat batters were conditioned by the temperature and not by the pressure applied. Cooking process decreased (P nitrite concentration in all samples. High-pressure processing and cooking treatment increased (P nitrite concentration decreased with pressure processing, no effect was observed with the heating process of meat batters. High-pressure processing conditions had no effect on the rate of residual nitrite loss throughout the storage. The application of high pressure decreased (P processing conditions, generally, throughout storage biogenic amine levels did not change or increased, although quantitatively this effect was not very important.
Adesokan, H K; Raji, A O Q
2014-03-01
Food-borne disease outbreaks remain a major global health challenge and cross-contamination from raw meat due to poor handling is a major cause in developing countries. Adequate knowledge of meat handlers is important in limiting these outbreaks. This study evaluated and compared the safe meat-handling knowledge, attitudes and practices (KAP) of private (PMPP) and government meat processing plants' (GMPP) workers in south-western Nigeria. This cross sectional study comprised 190 meat handlers (PMPP = 55; GMPP = 135). Data concerning their safe meat-handling knowledge, attitudes and practices as well as their socio-demographic characteristics, such as age, gender and work experience were collected. A significant association was observed between the type of meat processing plants and their knowledge (p = 0.000), attitudes (p = 0.000) and practices (p = 0.000) of safe meat-handling. Meat handlers in the GMPP were respectively, about 17 times (OR = 0.060, 95% CI: 0.018-0.203), 57 times (OR = 0.019, 95% CI: 0.007-0.054) and 111 times (OR = 0.009, 95% CI: 0.001- 0.067) less likely to obtain good knowledge, attitude and practice level of safe meat-handling than those from PMPP. Further, KAP levels were significantly associated with age group, education and work experience (p < 0.05). Study findings suggest the need for future policy in food industry in developing countries to accommodate increased involvement of private sector for improved food safety and quality delivery. Public health education on safe food handling and hygiene should be on the front burner among food handlers in general.
International Nuclear Information System (INIS)
Pakkong, P.; Phaopeng, N.; Tumnoi, Y.
2014-01-01
Cs-137 radioactivity was determined in the oyster (Crassostrea belcheri) meat samples which were collected on October 2010 and August 2011. The seawater samples were collected in 3 different provinces of the Lower Gulf of Thailand. The oyster meat samples were prepared as oven dried at 80±C. The seawater samples were prepared with AMP precipitation technique. The results of Cs-137 radioactivity in oyster meat samples in October 2010 were 3.179±2.2929, 3.1797±2.2929 and 3.1797±2.2929 mBq/kg-ww respectively and in August 2011 were 2.5437±2.2029, 1.9078±2.1091 and 3.1797±2.2929 mBq/kg-ww respectively. The Minimum Detectable Activity (MDA) of oyster meat samples were estimated to be 10.4723 mBq/kg-ww. Statistic calculation of critical limit (Lc) values of 2.9634mBq/kg-ww was used to confirm the value of Cs-137 radioactivity in oyster meat samples. The Cs-137 radioactivity in seawater samples which had been collected on October 2010 were 4.7806±0.1113, 3.7161±0.0868 and 3.19330.0745 mBq/L, respectively and the average of MDA was 0.4562 mBq/L, on March 2011 were 3.2213±0.0756, 2.7824±0.0653 and 1.9566±0.0462 mBq/L respectively and the average of MDA was 0.3142 mBq/L. The third collection of seawater samples on August 2011 after Fukushima Daiichi crisis accident were 4.9673±0.1155, 3.8469±0.0897 and 3.5294±0.0826 mBq/L respectively and the average of MDA was 0.4793 mBq/L) The results from calculation of radiation dose assessment for general public consumption were found lower than the accepted value (1 mSv/y).
Husak, R L; Sebranek, J G; Bregendahl, K
2008-11-01
The objective of this survey was to investigate qualitative and quantitative properties of meat from organic, free-range, and conventional broilers as currently provided to consumers. Fifteen broilers from 4 suppliers of each type were evaluated for raw meat yield, cooked meat yield, proximate composition, pH, color, lipid oxidation, fatty acid composition, and sensory attributes. Organic broilers yielded more dark (thigh) meat (P free-range or conventional, when compared on a raw-meat basis, but conventional and free-range broilers yielded more (P free-range or conventional. Organic breast and thigh meat was less yellow (P free-range or conventional. Fatty acid analysis showed that organic breasts and thighs were lower (P free-range and conventional broilers. Shear force measurements were less (P free-range and organic broilers. Sensory panel results indicated that thighs from conventional broilers were more tender (P free-range and organic broilers, whereas other sensory properties did not differ. At the time of the study, March through May of 2006, the average retail prices for US broilers were USD 3.19, USD 2.78, and USD 1.29 per pound (USD 7.03, USD 6.13, and USD 2.84/kg) for organic, free-range, and conventional, respectively. Whereas a difference in the fatty acid composition was the largest difference observed between retail broilers in this survey, it is important to note that diets and production environments within the study were not controlled. It is apparent that the market prices for broilers at the time of this study are not fully reflected in the quantitative and qualitative measurements included in this study. It appears that consumers may be placing significant value on more intangible attributes associated with broilers marketed as organic and free-range chicken than on those attributes measured in this study.
Directory of Open Access Journals (Sweden)
Bahador Hajimohammadi
2014-11-01
Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.
Hong, Go-Eun; Kim, Ji-Han; Ahn, Su-Jin; Lee, Chi-Ho
2015-01-01
This study was performed to investigate the changes in meat quality characteristics of the sous vide cooked chicken breast during refrigerated storage at 4℃ for 14 d between before and after sous-vide cooking. Cooking loss and shear force were significantly increased, whereas expressible drip was significantly decreased along with reduction in the water holding capacity in both of two groups. Redness of meat juice was significantly (p<0.05) increased during storage, and considerably increased in the refrigerated samples after sous-vide cooked at the 7 to 10 d. The thiobarbituric acid reactive substances (TBARS) was significantly increased and was higher in the refrigerator stored chicken breast samples after sous-vide cooking. The volatile basic nitrogen (VBN) value was significantly increased in both groups, but the VBN value of the stored raw meat sample before sous-vide cooking was increased at an early storage, while the VBN value of the stored sample after sous-vide cooking was increased gradually in this study. Total viable counts and coliform counts were significantly decreased during storage, and coliforms were not detected after 7 d of storage in both groups. Salmonella spp. was not detected during the whole studied period. The outcome of this research can provide preliminary data that could be used to apply for further study of chicken breast using sous-vide cooking method that could be attractive to consumers.
Radiation decontamination of meat lyophilized products
International Nuclear Information System (INIS)
Owczarczyk, H.B.; Migdal, W.
2002-01-01
There is an increasing demand for powder soups and sauces compose with lyophilized products. Technology of lyophilization is not always accompanied by thermal treatment of raw materials. That is the reason the products lyophilization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment. (author)
International Nuclear Information System (INIS)
Brito, Poliana de Paula
2012-01-01
The Mechanically Deboned chicken meat (MDCM) is used in traditional meat products, in greater proportion in those emulsified, replacing meat raw materials more expensive. The raw material can have high MDCM the microbial load, as a result of contamination during processing or failure during the evisceration. The irradiation process is accepted as one of the most effective technologies when compared to conventional techniques of preservation, to reduce contamination of pathogens and spoilage. However, little information is available about the use and effects of different dose rates of ionizing radiation processing. Irradiation causes chemical changes in food, a major cause of deterioration of quality of raw or cooked meat products during refrigerated storage, frozen. The objective of this study was to evaluate the effects of different dose rates of ionizing radiation on the production of Thiobarbituric Acid Reactive Substances (TBARS), color, microbiological and sensory characteristics of mechanically deboned chicken added or without added antioxidants, during the cold storage and evaluation of functional properties. The results showed that among the tested dose rates using cobalt-60 source, dose rate of 4.04 kGy.h-1 was the best for processing MDCM. Furthermore, the use of the combination of rosemary antioxidant and α-tocopherol were able to reduce lipid oxidation generated by irradiation of the samples, showed a synergistic effect to the processing with ionizing radiation in reduction of psychrotrophic bacteria count and contributed to a better sensory quality. The use of radiation in the processing FDMI did not adversely affect the functional properties studied. (author)
Healthy n-6/n-3 fatty acid composition from five European game meat species remains after cooking.
Valencak, Teresa G; Gamsjäger, Lisa; Ohrnberger, Sarah; Culbert, Nicole J; Ruf, Thomas
2015-06-27
Intensive farming of livestock along with recent food scandals and consumer deception have increased awareness about risks for human nutrition. In parallel, the demand for meat obtained under more natural conditions from animals that can freely forage has largely increased. Interestingly, the consumption of game meat has not become more common despite its excellent quality and content of polyunsaturated fatty acids (PUFAs). We addressed the question if game meat fatty acid composition is modified through kitchen preparation. By analysing muscle fatty acid (FA) composition (polar and total lipids) of five European game species in a raw and a processed state, we aimed to quantify the proportion of PUFA that are oxidised and hydrogenated during processing. All game meat species originated from local hunters and free-living individuals. To mimic a realistic situation a professional chef prepared the meat samples with gentle use of heat in a standardised way. Expectedly, the overall content of polyunsaturated fatty acids declined during the cooking process but the decrease size was cooking does not substantially alter its favourable fatty acid composition. Further research is needed to elucidate species-specific differences and the role of habitat quality and locomotion for tissue composition.
Detection of neuronal tissue in meat using tissue specific DNA modifications
Directory of Open Access Journals (Sweden)
Harris N.
2004-01-01
Full Text Available A method has been developed to differentiate between non-muscle tissues such as liver, kidney and heart and that of muscle in meat samples using tissue specific DNA detection. Only muscle tissue is considered meat from the point of view of labelling (Food Labelling [Amendment] (England Regulations 2003 and Quantitative Ingredient Declaration (QUID, and also certain parts of the carcass are prohibited to be used in raw meat products (Meat Products [England] Regulations 2003. Included in the prohibited offal are brain and spinal cord. The described methodology has therefore been developed primarily to enforce labelling rules but also to contribute to the enforcement of BSE legislation on the detection of Central Nervous System (CNS tissue. The latter requires the removal of Specified Risk Material (SRM, such as bovine and ovine brain and spinal cord, from the food chain. Current methodologies for detection of CNS tissue include histological examination, analysis of cholesterol content and immunodetection. These can potentially be time consuming, less applicable to processed samples and may not be readily adapted to high throughput sample analysis. The objective of this work was therefore to develop a DNAbased detection assay that exploits the sensitivity and specificity of PCR and is potentially applicable to more highly processed food samples. For neuronal tissue, the DNA target selected was the promoter for Glial Fibrillary Acidic Protein (GFAP, a gene whose expression is restricted to astroglial cells within CNS tissue. The promoter fragments from both cattle and sheep have been isolated and key differences in the methylation patterns of certain CpG dinucleotides in the sequences from bovine and sheep brain and spinal cord and the corresponding skeletal muscle identified. These have been used to design a PCR assay exploiting Methylation Specific PCR (MSP to specifically amplify the neuronal tissue derived sequence and therefore identify the
Domínguez, Rubén; Gómez, María; Fonseca, Sonia; Lorenzo, José M
2014-06-01
The influence of four different cooking methods (roasting, grilling, microwaving and frying) on cooking loss, lipid oxidation and volatile profile of foal meat was studied. Cooking loss were significantly (Pcooking methods increased TBARs content, since high temperature during cooking causes increased oxidation in foal steaks, this increase was significantly (Pcooking methods led to increased total volatile compounds (between 366.7 and 633.1AU×10(6)/g dry matter) compared to raw steaks (216.4AU×10(6)/g dry matter). The roasted steaks showed the highest volatile content, indicating that increased cooking temperature increases the formation of volatile compounds. Aldehydes were the most abundant compounds in cooked samples, with amounts of 217.2, 364.5, 283.5 and 409.1AU×10(6)/g dry matter in grilled, microwaved, fried and roasted samples, respectively, whereas esters were the most abundant compounds in raw samples, with mean amounts of 98.8AU×10(6)/g dry matter. Copyright © 2014 Elsevier Ltd. All rights reserved.
Grau, A; Guardiola, F; Grimpa, S; Barroeta, A C; Codony, R
2001-11-01
We used factorial design to ascertain the influence of dietary fat source (linseed, sunflower and oxidized sunflower oils, and beef tallow) and the dietary supplementation with alpha-tocopheryl acetate (alpha-TA) (225 mg/kg of feed) and ascorbic acid (AA) (110 mg/kg) on dark chicken meat oxidation (lipid hydroperoxide and TBA values and cholesterol oxidation product content). alpha-TA greatly protected ground and vacuum-packaged raw or cooked meat from fatty acid and cholesterol oxidation after 0, 3.5, or 7 mo of storage at -20 C. In contrast, AA provided no protection, and no synergism between alpha-TA and AA was observed. Polyunsaturated fatty acid-enriched diets (those containing linseed, sunflower, or oxidized sunflower oils) increased meat susceptibility to oxidation. Cooking always involved more oxidation, especially in samples from linseed oil diets. The values of all the oxidative parameters showed a highly significant negative correlation with the alpha-tocopherol content of meat.
Filgueras, Renata S; Gatellier, Philippe; Ferreira, Claude; Zambiazi, Rui C; Santé-Lhoutellier, Véronique
2011-09-01
The nutritional value of proteins was investigated after the storage and cooking of rhea M. Gastrocnemius pars interna. Oxidation of basic and aromatic amino acids, surface hydrophobicity and aggregation state of proteins, were determined in raw and cooked meat. In addition, myofibrillar proteins were exposed in vitro to proteases of the digestive tract. Cooking markedly affected the protein surface hydrophobicity. The BBP bound content was three times greater in cooked than in fresh rhea meat. A small increment in tryptophan content after cooking was observed. Storage influenced Schiff bases formation indicating the presence of protein-aldehyde adducts after cooking. High content of Schiff bases was found after cooking of samples stored for 5 days, demonstrating a probable implication of free amino groups, most likely from lysine. Cooking decreased the myofibrillar protein susceptibility to pepsin activity. After cooking, the proteolysis rate by pancreatic enzymes increased. Our findings support the importance of protein aggregation in the nutritional value of meat proteins. Copyright © 2011 Elsevier Ltd. All rights reserved.
High Seroprevalence of Leptospira Exposure in Meat Workers in Northern Mexico: A Case-Control Study
Alvarado-Esquivel, Cosme; Hernandez-Tinoco, Jesus; Sanchez-Anguiano, Luis Francisco; Ramos-Nevarez, Agar; Cerrillo-Soto, Sandra Margarita; Saenz-Soto, Leandro; Martinez-Ramirez, Lucio
2016-01-01
Background The seroepidemiology of Leptospira infection in workers occupationally exposed to raw meat has been poorly studied. This work aimed to determine the association between Leptospira exposure and the occupation of meat worker, and to determine the seroprevalence association with socio-demographic, work, clinical and behavioral characteristics of the meat workers studied. Methods We performed a case-control study in 124 meat workers and 124 age- and gender-matched control subjects in Durango City, Mexico. Sera of cases and controls were analyzed for anti-Leptospira IgG antibodies using a commercially available enzyme immunoassay. Data of meat workers were obtained with the aid of a questionnaire. The association of Leptospira exposure with the characteristics of meat workers was analyzed by bivariate and multivariate analyses. Results Anti-Leptospira IgG antibodies were found in 22 (17.7%) of 124 meat workers and in eight (6.5%) of 124 controls (OR = 3.12; 95% CI: 1.33 - 7.33; P = 0.006). Seroprevalence of Leptospira infection was similar between male butchers (17.6%) and female butchers (18.2%) (P = 1.00). Multivariate analysis of socio-demographic, work and behavioral variables showed that Leptospira exposure was associated with duration in the activity, rural residence, and consumption of snake meat and unwashed raw fruits. Conclusions This is the first case-control study of the association of Leptospira exposure with the occupation of meat worker. Results indicate that meat workers represent a risk group for Leptospira exposure. Risk factors for Leptospira exposure found in this study may help in the design of optimal preventive measures against Leptospira infection. PMID:26858797
Microbiological investigation of halal butchery products and butchers' premises.
Little, C; Gillespie, I; de Louvois, J; Mitchell, R
1999-06-01
Halal butchers' premises were investigated as they had not been represented in a recent study of butchery products and butchers' premises conducted by the Local Authorities Coordinating Body on Food and Trading Standards and the PHLS. This study examined 183 raw prepared meats and 212 environmental samples from 105 halal butcher premises. Only raw meats were prepared on 97 of the premises visited; and the types of meat prepared on the remaining eight premises was not specified. Four halal butchers sold cooked meats prepared elsewhere. Salmonella spp. and Campylobacter spp. were detected in 12 (7%) and 52 (28%) of the 183 raw meat products, respectively. Five raw prepared meats (3%) contained both salmonella and campylobacter. Vero cytotoxin producing Escherichia coli O157 was isolated from a raw meat product that also contained campylobacter. No cooked meat products were available for collection. The physical separation of raw and unwrapped cooked meat products in premises that prepared raw and sold cooked meats was not recorded. Apron cloths were the most heavily contaminated environmental samples examined; hygiene indicator microorganisms indicated an increased risk of cross contamination. Managers in 85 premises had received no food hygiene training and 88 premises had no hazard analysis system in place. Improvements are needed to reduce the risk of cross contamination.
Directory of Open Access Journals (Sweden)
Paulo R. Franchin
2006-12-01
Full Text Available A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762 and raw pork meat (n = 566. The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and others deboned raw fresh pork meat. The BAX® System detected 134 Salmonella-positive samples in chicken carcasses and 145 samples in pork meat, while the MSRV method isolated 142 and 144 Salmonella-positive samples, respectively. No significant difference was observed between the two methods for chicken carcasses and pork meat, according to McNemar test at the 5% level.Um estudo foi realizado com o objetivo de comparar o procedimento analítico de detecção de Salmonella com o Sistema BAX® automatizado, baseado na Reação em Cadeia da Polimerase (PCR com o método de Rappaport-Vassiliadis em Agar Semi-Sólido modificado (MSRV para detecção de Salmonella em amostras de carcaças de frango naturalmente contaminadas (n=762 e retalhos de carne suía (n=566. O Sistema BAX® detectou 134 amostras positivas para Salmonella em carcaças de frango e 145 amostras positivas para Salmonella em retalhos de carne suína, enquanto o MSRV detectou 142 e 144 amostras positivas respectivamente. Não houve diferença estatisticamente significativa entre os dois métodos, segundo McNemar ao nível de significância de 5%.
Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products
Directory of Open Access Journals (Sweden)
Monique Zagorec
2017-09-01
Full Text Available Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage.
Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products
Zagorec, Monique; Champomier-Vergès, Marie-Christine
2017-01-01
Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage. PMID:28878171
VARIATION IN MEAT COMPOSITION VISCOSITY DURING THE MIXING PROCESS
Directory of Open Access Journals (Sweden)
DANIELA IANIłCHI
2008-10-01
Full Text Available Animal raw material processing is directly influenced by the physical and chemical characteristics of the materials which also influence their water holding capacity. The various combinations and status of the raw materials used in the food industry determine specific behaviours that may influence the processing equipment performance and construction. The study on meat composition viscosity depending upon the added components, temperature and mixing time length, has shown that viscosity is increasing with lower added water percentage, lower mixing temperature and higher mixing time length.
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Study on Influence of Different Types of Meat on the Quality of Meat Products
Directory of Open Access Journals (Sweden)
Melinda Nagy
2015-11-01
Full Text Available Meat species in processed food products have been gaining an increasing interest mainly due to public health, economic and legal concerns, but also due to religious reasons. In the recent years there was an increasing demand for healthier meat products. Formulation of healthier meat products based on processing strategies is one of the most important current approaches to the development of potential meat-based functional foods. The main objective of the study was to characterize different type of meat and to use that to obtain a meat product-smoked sausage. The physico-chemical analyses highlighted the moisture content (drying-oven at 105 ºC, protein (Kjeldahl method and fat (Soxhlet method content and sodium chloride content (Mohr method of the meat and the final product. Sensory analyses of the samples as well as control sample were evaluated by 17 untrained panellists using a 9 point hedonic scale. Following this study, it was noted an improvement of organoleptic characteristics (texture and appearance as well as physico-chemical and sensorial properties of the new product compared with the limits stipulated.
Directory of Open Access Journals (Sweden)
Rodrigo Vera
2016-06-01
Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.
Arroyo, Cristina; Eslami, Sara; Brunton, Nigel P; Arimi, Joshua M; Noci, Francesco; Lyng, James G
2015-05-01
Pulsed electric fields (PEF) is a novel nonthermal technology that has the potential to cause physical disruption to muscle tissue which in turn could alter the sensorial aspects of meat in both a positive (e.g., enhanced tenderization) and a negative way (e.g., off-flavor development). If there is a risk of off-flavor development it should be identified prior to embarking on an extensive investigation on PEF in meat tenderization and turkey meat was chosen for this purpose as it is particularly prone to oxidation. The objective of this study was to investigate the effect of various PEF treatments on the quality attributes of turkey breast meat. Turkey breast meat obtained 1 d postslaughter was treated in a batch PEF chamber with increasing electric field strength up to 3 kV/cm and analyzed for lipid oxidation by thiobarbituric acid reactive substances assay (TBARS) with up to 5 d storage at 4°C in aerobic conditions. In a separate experiment, turkey breast meat samples were exposed to PEF under various combinations of pulse number, frequency, and voltage. Following PEF treatments weight loss, cook loss, lipid oxidation, texture, and color were assessed by instrumental methods. A sensory analysis was also performed to determine consumer acceptability for color, texture, and odor of the samples. Lipid oxidation in all PEF-treated samples progressed at the same rate with storage as the untreated samples and was not found to be significantly different to the control. Under the conditions examined PEF treatments did not induce differences in instrumentally measured weight loss, cook loss, lipid oxidation, texture, and color (raw and cooked) either on fresh or frozen samples. However, the sensory evaluation suggested that panelists could detect slight differences between the PEF-treated samples and the controls in terms of texture and odor. © 2015 Poultry Science Association Inc.
Directory of Open Access Journals (Sweden)
Marwan AL-HIJAZEEN
2017-09-01
Full Text Available Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1 control (no additive; (2 100 ppm oregano essential oil (OE; (3 150 ppm OE; (4 300 ppm L-ascorbic acid (E-300; (5 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320 for both breast and thigh meat respectively, and 6 150 ppm Sodium nitrite (E-250, were prepared using ground chicken meat. Generally, OE at level of 150 ppm was the most effective decreasing TBARS, and total carbonyl values compared to the other treatments. Furthermore, it showed better color values (L* and a* in term of meat color stability. However, OE and E-250 also showed the highest significant values among the other treatments. Sensory evaluation results showed that adding OE at level of 150 ppm and 100 ppm were the best values maintaining meat storage stability. Therefore, it can be recommended that OE at level of 150 ppm could be an excellent replacement to the synthetic antioxidant in the future of uncured, natural fresh meat products, and raw meat prepared for processing.
The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).
Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş
2007-03-01
This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.
STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT
DANIELA IANIłCHI; CARMEN NICOLAE; CRISTIANA DIACONESCU; GABRIELA MALOS; I. G. MALOS
2008-01-01
Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some...
Bañón, S; Vila, R; Price, A; Ferrandini, E; Garrido, M D
2006-02-01
The effects of a diet with goat milk "GM" or milk replacer "MR" on the meat quality and fat composition of suckling Murciano-Granadina kids were studied. MR consisted of powdered skimmed milk, coconut oil and fat, and cereal products and by-products. Raw meat quality (moisture, protein, lipids, ash, collagen, cholesterol, haem pigments, CIELab colour, pH and water retention capacity), fatty acid "FA" composition and eating quality of cooked meat (odour, flavour and texture) were determined. Diet had only a slight effect on raw meat quality but had a pronounced effect on fatty acid composition and eating quality of cooked meat. MR diet increased the water/protein proportion in the muscle. The saturated/unsaturated FA ratio in GM and MR fat was 0.94 and 2.27, respectively. The major FA in GM and MR fat were C16:0 and C18:1, respectively. Short-chain C4-C12 hardly accumulated in the adipose tissue of suckling kid, increasing the relative percentages of C14-C20. This effect was more pronounced in MR fat, due to the fact that MR contained more short-chain fatty acids than GM. MR diet gave cooked meat a more intense characteristic goat meat odour and flavour, more tenderness and more juiciness than the natural suckling diet. This fact could be related to differences in meat and fat composition.
Fachmann, M S R; Löfström, C; Hoorfar, J; Hansen, F; Christensen, J; Mansdal, S; Josefsen, M H
2017-03-01
Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella , and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. Copyright © 2017 American Society for Microbiology.
Data for in-depth characterisation of the lamb meat proteome from longissimus lumborum
Directory of Open Access Journals (Sweden)
Tzer-Yang Yu
2015-06-01
Full Text Available This Data article provides Supplementary data related to the research article titled “In-depth characterisation of the lamb meat proteome from longissimus lumborum” by Yu et al. [1]. This research article reports the proteome catalogue of the 48 h post-mortem lamb longissimus lumborum. A list of 388 ovine-specific proteins were identified and characterised after separating the samples into sarcoplasmic, myofibrillar and insoluble fractions, followed by an in-depth shotgun proteomic evaluation and bioinformatic analysis. The detailed list of identified proteins, the annotated MS/MS spectra corresponding to the proteins identified by a single peptide-spectrum match, the raw Gene Ontology annotation data and other miscellaneous files, as will be described below, were contained in this Data article. We hope the data presented here will contribute to the current knowledge of the global protein composition of lamb skeletal muscle/meat.
Directory of Open Access Journals (Sweden)
Giuseppe Carrabs
2014-05-01
Full Text Available Gentile di maiale is a typical meat product prepared in some traditional plants of Latina Province (Central Italy. It is obtained from dehydration, salting, smoking and ripening of swine rectum. Aim of this study was to evaluate the influence of the traditional smoking process on polycyclic aromatic hydrocarbons (PAHs content by means of high-performance liquid chromatographic/fluorescence detection. Polycyclic aromatic hydrocarbons detected in 8 samples of raw material (swine rectum and samples of smoked gentile were: benzo[a]anthracene, chrisene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a] pyrene, benzo[a,h]anthracene. Their residues were detected in all samples of finished product. European Regulation 835/2011 established two levels of PAHs content in meat products. According to first levels, in force until September 2014, only 2 out of 8 samples exceeded legal limit. According to the subsequent, more restrictive, limits all samples would be non-compliant. An improvement and a standardisation of traditional smoking procedures are recommended.
Cold chain management in meat storage, distribution and retail: A review
Nastasijević, I.; Lakićević, B.; Petrović, Z.
2017-09-01
Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP), active packaging, wireless sensors, supported with the software-based cold chain database (CCD).
Rabbit meat processing: historical perspective to future directions
Directory of Open Access Journals (Sweden)
Massimiliano Petracci
2013-12-01
Full Text Available In past centuries, because rabbits are relatively small, animals slaughtered for consumption were generally eaten immediately. However, since a single rabbit would offer little more product than could be consumed at one sitting, little effort was devoted to developing preserved rabbit products (such as salted or dried meat, sausages, etc.. For this reason, although there is a rich history of recipes using rabbit meat in the Mediterranean area, there are few traditional further-processed products. Nowadays, even though the processing industry is pushing more and more towards the introduction of more attractive products (i.e. ready meals, ready-to-cook, etc. for consumers with little time for meal preparation, most rabbit meat worldwide is still sold as whole carcass or cut-up parts. This review analyses the main strength and weakness factors regarding the use of rabbit meat to manufacture further processed products. Bearing in mind these considerations, it then describes the more promising processing technologies for raw meat materials to obtain added-value products (marinated, formed, emulsified, coated, etc. by exploiting rabbit meat’s intrinsic characteristics, such as high protein/low fat content coupled with a balanced n-6 to n-3 PUFA ratio, low cholesterol and heme-iron content. Major trends in meat product formulation (modulation of lipid content and composition, use of novel antioxidants and salt reduction are also discussed by highlighting strategies to provide healthier meat products meeting current nutritional needs. Finally, major packaging solutions for rabbit meat and meat products (ordinary and modified atmosphere, vacuum are considered.
Directory of Open Access Journals (Sweden)
Hossein Dabiri
2014-05-01
Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.
Feng, Xianchao; Li, Chenyi; Ullah, Niamat; Hackman, Robert M; Chen, Lin; Zhou, Guanghong
2015-12-30
The stability of cured meat products is increased by the protection of its proteins from oxidation by sodium nitrite (NaNO2) during processing. This study investigated the effects of NaNO2 (0, 50, 100, 200, and 400 mg/kg) on the physiochemical and structural characteristics of myofibrillar protein (MP) in raw and cooked ham. The NaNO2 showed a dose-dependent antioxidant effect, by inhibiting carbonyl formation, dityrosine formation, and denaturation of MP, and a nitrosative effect, through the formation of 3-Nitrotyrosine (3-NT). The 3-NT content within MP of raw ham had distinct negative correlations with sulfhydryl content and surface hydrophobicity. The 3-NT content within MP of cooked ham had significantly negative correlations with carbonyl, sulfhydryl content and turbidity and had significantly positive correlations with disulfide content. These results indicated that 3-NT may be a potential marker for protein oxidation in raw and cooked cured meat products.
Directory of Open Access Journals (Sweden)
Amaranta Traversa
2013-02-01
Full Text Available In the period 2006-2011 six public catering establishments (3 canteens and 3 cafeterias were monitored, trough audit and sampling, in order to verify the application of good manufacturing and hygiene practices during food production, handling and serving. The compliance to microbiological food safety criteria (Listeria monocytogenes and Salmonella spp. and process hygiene criteria were investigated using ISO standards for microbiological analyses. A total of 612 samples were collected: 192 food samples and 288 environmental swab samples from canteens; 33 food samples and 99 swab samples from cafeterias. Regarding food safety, two samples were in disagreement with criteria fixed in EU Regulation as Listeria monocytogenes was isolated from a turkey breast in a canteen and from a sandwich in a cafeteria. Regarding process hygiene criteria, as no microbiological limits are legally defined for catering services, for this study limits were fixed according to the quality standards of tender, scientific literature and laboratory experience. 23.4% foodstuffs and 8.7% swabs resulted non-compliant in canteens; 48.5% foodstuffs and 6.1% swabs resulted non-compliant in cafeterias. The count of coagulase-positive staphylococci (CPS was higher of the fixed limits in raw turkey meat and in cooked spinach: the presence among CPS of S. aureus was confirmed, strains were not able to produce enterotoxins. The most common non-compliance in hygiene criteria was represented by aerobic colony count (60.7% of total non-compliance in canteens and 75.0% in cafeterias and coliform bacteria (20.3% in canteens and 25.0% in cafeterias. Nine raw foods or raw readyto- eat food samples were non-compliant for both coliform bacteria and aerobic count; one sample (raw turkey meat was non-compliant for CPS and aerobic count but resulted to be compliant after cooking. Auditing and sampling are the most effective tools to improve food quality standard and to enhance food business
Effect of radiation processing on meat tenderisation
International Nuclear Information System (INIS)
Kanatt, Sweetie R.; Chawla, S.P.; Sharma, Arun
2015-01-01
The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour. - Highlights: • Effect of radiation processing on tenderness of three meat systems was evaluated. • Dose dependant reduction in shear force seen in buffalo meat. • Collagen solubility increased with irradiation
Directory of Open Access Journals (Sweden)
Junan Ren
Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.
Effect of radiation processing on meat tenderisation
Kanatt, Sweetie R.; Chawla, S. P.; Sharma, Arun
2015-06-01
The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour.
On-chip sample preparation for complete blood count from raw blood.
Nguyen, John; Wei, Yuan; Zheng, Yi; Wang, Chen; Sun, Yu
2015-03-21
This paper describes a monolithic microfluidic device capable of on-chip sample preparation for both RBC and WBC measurements from whole blood. For the first time, on-chip sample processing (e.g. dilution, lysis, and filtration) and downstream single cell measurement were fully integrated to enable sample preparation and single cell analysis from whole blood on a single device. The device consists of two parallel sub-systems that perform sample processing and electrical measurements for measuring RBC and WBC parameters. The system provides a modular environment capable of handling solutions of various viscosities by adjusting the length of channels and precisely controlling mixing ratios, and features a new 'offset' filter configuration for increased duration of device operation. RBC concentration, mean corpuscular volume (MCV), cell distribution width, WBC concentration and differential are determined by electrical impedance measurement. Experimental characterization of over 100,000 cells from 10 patient blood samples validated the system's capability for performing on-chip raw blood processing and measurement.
Development of Rabbit Meat Products Fortified With n-3 Polyunsaturated Fatty Acids
Directory of Open Access Journals (Sweden)
Massimiliano Petracci
2009-10-01
Full Text Available Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a “functional food” by including n-3 polyunsaturated fatty acids (n-3 PUFA, conjugated linoleic acid (CLA, vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA for n-3 PUFA.
Development of rabbit meat products fortified with n-3 polyunsaturated fatty acids.
Petracci, Massimiliano; Bianchi, Maurizio; Cavani, Claudio
2009-02-01
Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a "functional food" by including n-3 polyunsaturated fatty acids (n-3 PUFA), conjugated linoleic acid (CLA), vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA) for n-3 PUFA.
Impact of rearing conditions on the microbiological quality of raw retail poultry meat.
Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene
2013-08-01
There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Karol Račka
2015-05-01
Full Text Available Introduction and objective. The aims of the study were: 1 to detect antibodies against T[i]oxoplasma gondii[/i] from wild boar meat; 1 establish seroprevalence of toxoplasmosis in the wild boar population; 3 establish risk factors concerned in higher possible seroprevalence; 4 to estimate the usefulness of meat juice for detection of [i]T. gondii[/i] antibodies in wild boar. Material and methods. Diaphragm meat juice samples from 656 wild boar ([i]Sus scrofa[/i] were collected during the hunting seasons between September 2008 – October 2010 from 9 districts of the Czech Republic. The samples were stratified per age category into 2 groups: piglets (n = 279 and yearlings together with adults (n = 377. The in-house ELISA test was used for the detection of antibodies against [i]T. gondii [/i]from the meat juice samples. Results. Antibodies against [i]T. gondii [/i]were detected by in-house ELISA in 260 of 656 wild boars (40% with 26% prevalence in piglets (72/279 and 50% prevalence in yearlings and adults (188/377. The district total seroprevalences ranged between 32% – 59%, with a significantly higher prevalence in the district of Havlíčkův Brod (59%. Statistically significant differences (p-value < 0.05 were found between 2 age categories, and between 9 districts, with a significant variability in the district of Havlíčkův Brod. Seroprevalence correlated positively with farm density, but without any statistical significance. Conclusion. The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.
Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert
2006-11-01
The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.
Traceability of Plant Diet Contents in Raw Cow Milk Samples
Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego
2009-01-01
The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982
A cluster of three cases of trichinellosis linked to bear meat consumption in the Arctic.
Dupouy-Camet, Jean; Yera, Hélène; Dahane, Naïma; Bouthry, Elise; Kapel, Christian M O
2016-05-01
We report here three cases of trichinellosis due to polar bear meat consumption in East Greenland. In the past 20 years, 31 cases of trichinellosis have been reported in French travellers to the Arctic (North Quebec, Nunavut and Greenland) who consumed undercooked meat from black, brown, or polar bears. If local communities are increasingly becoming aware of the risk of trichinellosis, travellers visiting regions where bear meat is consumed should be informed of the risk of eating raw or non-heat-processed meats. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.
Alternative of raw material’s suppliers using TOPSIS method in chicken slaughterhouse industry
Sari, R. M.; Rizkya, I.; Syahputri, K.; Anizar; Siregar, I.
2018-02-01
Chicken slaughterhouse industry is one of the fastest growing industries that depends on the freshness of raw materials. The raw materials quality arrive at the company depends heavily on the suppliers. Fresh chicken and frozen chicken meat are the main raw materials for this industry. Problems occurred by the suppliers are catering the amount of raw material needs that are not appropriate and also delay during delivery process. This condition causes disruption of the production process in the company. Therefore, it is necessary to determine the best suppliers to supply the main raw materials of fresh and frozen chicken meat on the slaughterhouse chicken industry. This study analyze the supplier’s capability by using TOPSIS method. This method use to find out the best supplier. The TOPSIS method is performed using the principle that chosen alternative must have the shortest distance from the positive solution and furthest from the ideal solution of the geometric point by using the Euclidean distance to determine the relative proximity of the optimum solution alternative. TOPSIS method found the rank of best supplier’s order is supplier A followed by supplier D, supplier B, supplier C, supplier E, supplier F, and supplier G. Based on the rank order obtained from each company, it will assist the company in prioritizing the order to the supplier with the best rank. Total supply from All suppliers are 885,994 kg per month. Based on the results of research, the top five suppliers have been sufficient to meet the needs of the company.
Wahyuni, T. H.; Ginting, N.; Yunilas; Hasnudi; Mirwandono, E.; Siregar, G. A.; Sinaga, I. G.; Sembiring, I.
2018-02-01
Coconut waste (CW) could be applied for animal feed while its nutrition quality were low. This study aims to investigate fermented CW effect on meat quality of Rex rabbit which feed by fermented CW either by Aspergillus niger or Tape Yeast. This research was conducted in rabbit farm Brastagi, using 24 male Rex rabbits with initial weight 1012 ± 126.67 gram in July-October 2016. The design used was complete randomized design : 6 treatment 4 replications. Treatment were T1 (unfermented 10%); T2 (unfermented 20%); T3 (a.niger fermentation 10%); T4 (a niger fermentation 20%); T5 (tape yeast fermentation 10%) and T6 (tape yeast fermentation 20%). The parameters were pH, meat texture either raw or cooked, water content, fat content, protein content of meat and cooking loss. The results showed that effect of treatment was not significantly different (P>0.05) on pH and raw meat texture, but significantly different (Pmeat cooked and meat fat content and very significantly different effect ( P> 0,01) on cooking loss, water content and protein content of meat. The conclusion of this research was the utilization of fermented CW by Aspergillius niger and Tape Yeast improved the quality of Rex rabbit meat
Microbial analysis of meat and meat products sold in fast food ...
African Journals Online (AJOL)
The present study was carried out to investigate the rate of microbial contamination of ready-to-eat meat and meat products sold in different fast food restaurants in Aba. This study was carried out between June and August, 2015. Samples were collected aseptically from five fast food restaurants using sterile polythene bags.
Dietary Brazilian red pepper essential oil on pork meat quality and lipid oxidation
Directory of Open Access Journals (Sweden)
Franz Dias Gois
Full Text Available ABSTRACT: The purpose of this study was to evaluate the effects of feeding pigs with diets containing increasing levels of Brazilian red pepper essential oil ( Schinus terebinthifolius Raddi on the physical attributes, fatty acid profile and oxidative stability of precooked meat. Seventy-two weanling pigs (5.7±0.8kg were allotted in a completely randomized block design experiment with four treatments, six replicates per treatment, and three animals per experimental unit (pen. Animals were fed with a basal diet supplemented with 0, 500, 1,000, or 1,500mg kg-1 Brazilian red pepper essential oil during the 35-d experimental period. At the end of the experiment, one animal per experimental unit (16.4±2.2kg was slaughtered to sample Longissimus dorsi muscle for analysis. Dietary supplementation of Brazilian red pepper had no effect (P>0.05 on pork meat color, pH, cooking loss and shear force. Inclusion of essential oil in the diet provided a linear increase (P<0.05 of the saturated fatty acids content of L. dorsi, especially myristic (C14:0 and stearic (C18:0 fatty acids. Utilization of essential oil in pig diets reduced significantly the production of secondary lipid oxidation compounds measured as TBARS in raw pork meat (P<0.001 and immediately after cooking (P<0.001. However, during 8-d storage assay, the addition of essential oil in the diet did not protect pork meat lipids from oxidation. Therefore, Brazilian red pepper added to pig diets increased the saturated fatty acids content and reduced lipid oxidation in fresh meat and short-term heat treatment without affecting pork meat physical attributes.
COLD CHAIN MANAGEMENT IN MEAT SUPPLY: «OLD» AND NOVEL STRATEGIES
Directory of Open Access Journals (Sweden)
I. Nastasijevic
2017-01-01
Full Text Available Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP, active packaging, wireless sensors, supported with the software-based cold chain database (CCD.
Isolation of Toxoplasma gondii from horse meat in Egypt.
Shaapan, R M; Ghazy, A A
2007-01-01
Portions of heart, liver, skeletal and diaphragmatic muscles obtained from 150 slaughtered horses at Giza-Zoo abattoir were used for bioassays in mice and cats. T. gondii tachyzoites were isolated successfully from the peritoneal exudates of the inoculated mice 6-8 days post inoculation with pooled horse tissues. Whereas, T. gondii tissue cysts containing bradyzoites were detected in the impression smears of mice brain on the 45th days or more post infection. The oocysts were detected in feces of cats 3-6 days post feeding on horse tissues containing tissue cysts. The oocysts became sporulated within 3-5 days in 2.5% Potassium dichromate. A total of 79 out of 150 horse meat samples were found to be infected with an incidence rate of 52.6 %. This is the first trial for isolation of T. gondii infective stages from horses in Egypt. Moreover, this study pointed out to the high infection rate of T. gondii in horse meat which may be considered as an important source of infection to wild zoo-animals in Egypt and humans in some countries if consumed raw or insufficiently cooked.
Study of the combined effect of spices and marination on beef meat vacuum packaged
Directory of Open Access Journals (Sweden)
DANIELA ISTRATI
2011-12-01
Full Text Available Fresh beef slices were marinated by immersion in marinades based on dry red wine, lime-tree honey, salt, spices and seasoning plants as thyme (Thymus vulgaris, marjoram (Majorana hortensis, garlic (Allium sativum and horseradish (Armoracia rusticana. Control samples were represented by raw meat without marination treatment but stored in the same conditions as marinated samples. After marination, meat pieces were packed under vacuum and stored at refrigeration temperature of 4°C for 12 days. The influence of the combined effect of spices and marination on beef stability was evaluated by monitoring pH evolution, degree of lipid oxidation and by microbiological analysis. For control samples, a mean increase of 0.47 log CFU/g of total mesophilic aerobic bacteria was observed during the 48 h of storage, but for the samples marinated with the addition of spices was observed a decrease of 0.57 log CFU/g. The growth of LAB in control samples was generally limited and did not exceed 5 log CFU/g. During storage at 4°C, marination with the addition in the base marinade (wine, honey, garlic, pepper and salt of thyme, marjoram and horseradish separately inhibited the growth of LAB while marination with the addition in the base marinade of thyme, marjoram and horseradish together resulted in significantly lower levels of LAB. All marination treatments resulted in significantly lower TBA and POV values at the end of storage compared to the control. Marination with dry red wine, lime-tree honey, thyme marjoram, garlic, and horseradish can evidently control total mesophilic aerobic bacteria, lactic acid bacteria and oxidation of beef meat.
Evaluation of Technological Quality of Meat Produced from Nsukka ...
African Journals Online (AJOL)
The technological quality of raw meat from Nsukka local abattoir was evaluated by analyzing the proximate composition, water holding capacity, pH, Napole yield and sensory colour and texture of longissimus dorsi [LD] and psoas major [PM] of beef and pork. Results show that moisture [71.36 – 72.76%], protein [21.37 ...
Flavonoids in the development of functional meat products: A review
Directory of Open Access Journals (Sweden)
Pramod K. Singh
2013-06-01
Full Text Available Flavonoids or bioflavonoids are unique low molecular weight ubiquitous polyphenolic compounds produced by plants during their metabolic activities as a secondary metabolites and responsible for major organoleptic characteristics and health benefits of plant derived foods. The flavonoids are potent antioxidants agents and protect the cells by scavenging and inhibiting the production and initiation of free radicals, superoxide anions and lipid peroxy radicals. Besides potent antioxidant capacity, flavonoids also shows antimicrobial, antimutagenic, antidiabetic, antithrombosis, antirheumatic, antiatherosclerotic, antiallergic, anti-inflammatory, antiulcers and hepatoprotectives and better termed as neutraceuticals. The antioxidant capacity of meat is very low and this can be increased by adding flavonoids in meat during processing in the form of plant parts rich in flavonoids such as seeds, fruit skin or peel, bark and flower as raw or in extract form without comprising the sensory attributes of meat and meat products. [Vet World 2013; 6(8.000: 573-578
Yoottana Polpara; Thanyaporn Sornprasitt; Saowakon Wattanachant
2008-01-01
The quality characteristics of three groups of goat meat obtained from one year and three years old Anglonubian crossed native, and culled Saanen crossed native were investigated. Significant differences in fat, ash and total collagen content, were observed among groups of goat meat (P
PLATONOW, N; BEAUREGARD, M
1965-03-01
Chickens were fed a ration containing 30 per cent of toxic groundnut meal for up to six weeks. The concentration of aflatoxin (toxic metabolites of Aspergillus flavus) in the above ration was 3.06 p.p.m. At the end of 2nd, 4th or 6th week the birds were killed. The meat was removed from the bones and put through a meat grinder. The livers of three groups were pooled together. Three control groups of birds kept on commercial pellets were treated similarly. Female ferrets, two years of age, were used in the present study. They were divided into four groups. The first three groups were given for one month meat from chickens fed the toxic ration for 2, 4, and 6 weeks, respectively. Each of these three groups contained one control ferret that was fed with the meat of chickens fed a commercial ration for a similar period of time. One half of the 4th group was fed pooled liver from intoxicated birds and one half was fed liver from control birds. No significant changes in the ferret tissues were observed as a consequence of feeding them with the meat or liver from the chickens chronically poisoned with toxic groundnut meal.
Nachman, Keeve E; Baron, Patrick A; Raber, Georg; Francesconi, Kevin A; Navas-Acien, Ana; Love, David C
2013-07-01
Inorganic arsenic (iAs) causes cancer and possibly other adverse health outcomes. Arsenic-based drugs are permitted in poultry production; however, the contribution of chicken consumption to iAs intake is unknown. We sought to characterize the arsenic species profile in chicken meat and estimate bladder and lung cancer risk associated with consuming chicken produced with arsenic-based drugs. Conventional, antibiotic-free, and organic chicken samples were collected from grocery stores in 10 U.S. metropolitan areas from December 2010 through June 2011. We tested 116 raw and 142 cooked chicken samples for total arsenic, and we determined arsenic species in 65 raw and 78 cooked samples that contained total arsenic at ≥ 10 µg/kg dry weight. The geometric mean (GM) of total arsenic in cooked chicken meat samples was 3.0 µg/kg (95% CI: 2.5, 3.6). Among the 78 cooked samples that were speciated, iAs concentrations were higher in conventional samples (GM = 1.8 µg/kg; 95% CI: 1.4, 2.3) than in antibiotic-free (GM = 0.7 µg/kg; 95% CI: 0.5, 1.0) or organic (GM = 0.6 µg/kg; 95% CI: 0.5, 0.8) samples. Roxarsone was detected in 20 of 40 conventional samples, 1 of 13 antibiotic-free samples, and none of the 25 organic samples. iAs concentrations in roxarsone-positive samples (GM = 2.3 µg/kg; 95% CI: 1.7, 3.1) were significantly higher than those in roxarsone-negative samples (GM = 0.8 µg/kg; 95% CI: 0.7, 1.0). Cooking increased iAs and decreased roxarsone concentrations. We estimated that consumers of conventional chicken would ingest an additional 0.11 µg/day iAs (in an 82-g serving) compared with consumers of organic chicken. Assuming lifetime exposure and a proposed cancer slope factor of 25.7 per milligram per kilogram of body weight per day, this increase in arsenic exposure could result in 3.7 additional lifetime bladder and lung cancer cases per 100,000 exposed persons. Conventional chicken meat had higher iAs concentrations than did conventional antibiotic
Maćkiw, Elżbieta; Rzewuska, Katarzyna; Stoś, Katarzyna; Jarosz, Mirosław; Korsak, Dorota
2011-06-01
In 2007 and 2008, a monitoring study was carried out in Poland to examine the occurrence of thermotolerant Campylobacter spp. in raw and cooked chicken products available on the retail market. A total of 912 samples were tested: 443 samples of raw chicken meat, 146 samples of giblets, and 323 ready-to-eat poultry products (150 samples of spit-roasted chicken, 56 samples of smoked chicken, and 117 samples of pâté and cold meats). A high level of contamination of raw chicken meat (51.7% of samples) and chicken giblets (47.3% of samples) was detected. However, thermotolerant Campylobacter spp. were found in only 1.2% of the ready-to-eat poultry products.
Nutritional value and fatty acid composition of some traditional Argentinean meat sausages
Directory of Open Access Journals (Sweden)
Mara Cristina Romero
2013-03-01
Full Text Available The aim of this study was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat of some meat products produced in the northeastern Argentina, analyzing fatty acids composition, polyunsaturated/saturated fatty acid ratio PUFA/SFA ratio (polyunsaturated/ saturated fatty acids, n-6/n-3 ratio, and CLA (conjugated linoleic acid content. Thirty traditional meat products produced by different processes were used. The samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage, chorizos (raw sausage, chorizo ahumado (cooked and smoked sausage, and morcilla (cooked sausage. From the results obtained it can be said that the total carbohydrate contents of the salamín studied were slightly lower; fat content of raw chorizo was significantly lower, and protein content of chorizo ahumado was significantly higher than those comparison from databases from other regions of Argentina, USA, and Spain. Except for chorizo, which has a value lower than 0.4, the PUFA/SFA-stearic ratio of the other products were a little higher than those reported by other researchers. CLA (Conjugated linoleic acid contents between 0.03% and 0.19% were detected. The results obtained indicate that salamín produced in northeastern Argentina, Chaco state, shows high protein and PUFA (Polyunsaturated fatty acids contents, and low atherogenic and thrombogenic indexes, which makes it a more healthful product than those of similar composition produced in other countries.
Randall, L P; Lodge, M P; Elviss, N C; Lemma, F L; Hopkins, K L; Teale, C J; Woodford, N
2017-01-16
We determined the prevalence and types of extended-spectrum β-lactamase (ESBL)-producing and carbapenem-resistant Escherichia coli in raw retail beef, chicken, pork, fruit and vegetables in five UK regions in 2013-14. Raw meat (n=397), and fruit and vegetable samples (n=400) were purchased from retail stores in London, East Anglia, North West England, Scotland and Wales. Samples were tested for the presence of ESBL-producing E. coli by plating enriched samples on CHROMagar CTX and CHROMagar ESBL, for AmpC-type E. coli by plating on "CHROMagar FOX" (CHROMagar ECC+16mg/L cefoxitin), and for carbapenem-resistant E. coli by plating on CHROMagar KPC. Additionally, pre-enrichment counts were performed on the above agars, and on CHROMagar ECC. Isolates of interest were characterised by MALDI-ToF to confirm identification, by PCR for bla CIT, bla CTX-M, bla OXA , bla SHV and bla TEM genes; ESBL or bla CIT genes were sequenced. Only 1.9% and 2.5% of beef and pork samples, respectively were positive for ESBL-producing E. coli after enrichment compared with 65.4% of chicken samples. 85.6% positive samples from chicken meat carried bla CTX-M-1 ; bla CTX-M-15 was not detected. None of the fruits or vegetables yielded ESBL-producing E. coli and none of the meat, fruit or vegetable samples yielded carbapenem-resistant E. coli. Retail chicken was more frequently a source of ESBL-producing E. coli than were beef, pork, fruit or vegetables. None of the foodstuffs yielded E. coli with CTX-M-15 ESBL, which dominates in human clinical isolates in the UK, and none yielded carbapenem-resistant E. coli. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
[Evaluation of the quality of poultry meat and its processing for vacuum packaging].
Swiderski, F; Russel, S; Waszkiewicz-Robak, B; Cholewińska, E
1997-01-01
The aim of study was to evaluate the quality of poultry meat, roasted and smoked chicken and poultry pie packing under low and high vacuum. All investigated products were stored at +4 degrees C and evaluated by microbiological analysis. It was showed that packing under low and high vacuum inhibited development of aerobic microorganisms, proteolytic bacteria, yeasts and moulds. Vacuum-packaged storage of poultry meat and its products stimulated activity of anaerobic, nonsporeforming bacteria. The fast spoilage of fresh poultry meat was observed both under vacuum and conventional storage. The microbiology quality of poultry products depended on technology of production and microbiological quality of raw material.
Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.
Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A
2011-11-01
To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.
Detection of Enterotoxigenic Clostridium perfringens in Meat Samples by Using Molecular Methods▿
Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A.
2011-01-01
To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >103 cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates. PMID:21890671
Survey of the parasite Toxoplasma gondii in human consumed ovine meat in Tunis City.
Directory of Open Access Journals (Sweden)
Sonia Boughattas
Full Text Available Toxoplasmosis has been recognized as parasitic zoonosis with the highest human incidence. The human infection by the parasite can lead to severe clinical manifestations in congenital toxoplasmosis and immunocompromised patients. Contamination occurs mainly by foodborne ways especially consumption of raw or undercooked meat. In contrast to other foodborne infections, toxoplasmosis is a chronic infection which would make its economic and social impact much higher than even previously anticipated. Ovine meat was advanced as a major risk factor, so we investigated its parasite survey, under natural conditions. Serological MAT technique and touchdown PCR approaches were used for prevalence determination of the parasite in slaughtered sheep intended to human consumption in Tunis City. The genotyping was carried by SNPs analysis of SAG3 marker. Anti-Toxoplasma antibodies were present in 38.2% of young sheep and in 73.6% of adult sheep. Molecular detection revealed the contamination of 50% of ewes' tissue. Sequencing and SNPs analysis enabled unambiguous typing of meat isolates and revealed the presence of mixed strains as those previously identified from clinical samples in the same area. Our findings conclude that slaughtered sheep are highly infected, suggesting them as a major risk factor of Toxoplasma gondii transmission by meat consumption. Special aware should target consequently this factor when recommendations have to be established by the health care commanders.
Rapid measurement of meat spoilage using fluorescence spectroscopy
Wu, Binlin; Dahlberg, Kevin; Gao, Xin; Smith, Jason; Bailin, Jacob
2017-02-01
Food spoilage is mainly caused by microorganisms, such as bacteria. In this study, we measure the autofluorescence in meat samples longitudinally over a week in an attempt to develop a method to rapidly detect meat spoilage using fluorescence spectroscopy. Meat food is a biological tissue, which contains intrinsic fluorophores, such as tryptophan, collagen, nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) etc. As meat spoils, it undergoes various morphological and chemical changes. The concentrations of the native fluorophores present in a sample may change. In particular, the changes in NADH and FAD are associated with microbial metabolism, which is the most important process of the bacteria in food spoilage. Such changes may be revealed by fluorescence spectroscopy and used to indicate the status of meat spoilage. Therefore, such native fluorophores may be unique, reliable and nonsubjective indicators for detection of spoiled meat. The results of the study show that the relative concentrations of all above fluorophores change as the meat samples kept in room temperature ( 19° C) spoil. The changes become more rapidly after about two days. For the meat samples kept in a freezer ( -12° C), the changes are much less or even unnoticeable over a-week-long storage.
Safety criteria for the acquisition of meat in Brazilian University restaurants
Directory of Open Access Journals (Sweden)
Marizete Oliveira de Mesquita
2014-03-01
Full Text Available The present study's objective was to analyze the procedures aimed at guaranteeing sanitary conditions when acquiring meat. The study was conducted with university restaurants of the Federal Institutions of Higher Education (IFES located in the five regions of Brazil. Data were collected using a questionnaire and an evaluation list, which was available online to restaurant professionals. The results showed that restaurants chose one or two types of meat, the most frequent of which were beef and chicken. In restaurants managed by the IFES, the acquisition of raw material occurred by bidding. For vendor selection, the restaurants required product registration with the Inspection Service and requested regulation of the supplier by the Health Surveillance. Monitoring was carried out through a technical visit to the supplier and a review of the past records of the supplier. A higher percentage of restaurants in the Southeast region met appropriate sanitary and hygienic criteria for the receipt of meat, followed by the South, Midwest, Northeast and North. We conclude that restaurants meet most of the safety criteria set in the legislation. However, some weaknesses are evident in the physical and functional structure, the system of transportation of raw material and the records of control measures at the place of reception.
Directory of Open Access Journals (Sweden)
Ivan Manga
2015-05-01
Full Text Available A meat paste production line and its microbial parameters have been evaluated in single Czech company. The raw meat paste samples before heat treatment were tested positively for the presence of three staphylococci species: Staphylococcus aureus, Staphylococcus haemolyticus and Staphylococcus epidermidis. Subsequent microbial analysis of meat paste components and ingredients (fresh meat, water, spices, equipment identified only the spices used as positive for S. aureus (coriander, cinnamon, badian, mustard – (10 - 40 cfu/g and S. haemolyticus strains (juniper, ginger. The collection of sixteen collected strains (S. aureus (n = 4, S. haemolyticus (n = 4, S. epidermidis (n = 8 has been typed with the rep-PCR method utilising (GTG5 primer. Analysis of the fingerprints using the unweighted pair-group method using arithmetic averages (UPGMA clustering method revealed presence of eleven strain clusters with similarity lower than 90%: two fingerprint clusters of S. aureus, three individual clusters characteristic for S. haemolyticus and six different S. epidermidis specific clusters. The S. aureus strains from different types of spice were identical, resp. very similar. Molecular tracking composed from the rep-PCR analysis of acquired isolates and comparison among all collected fingerprints confirmed the spices to be the source of both S. aureus and S. haemolyticus strains identified in raw meat paste. The additional rep-PCR analysis of the S. epidermidis collection confirmed usability and performance of this method. The antibiotic susceptibility to fourteen individual antibiotics has been examined among the collected staphylococci strains. The predominant erythromycin resistance (68.8% was followed with the resistance to amoxicillin/clavulanic acid (56.2%. Other resistances observed were less frequent (clindamycin – 12.5%, oxacillin – 6.3%, tetracycline – 6.3%, sulphamethoxazole-trimethoprim – 6.3%, chloramphenicol – 6.3%, novobiocin – 6
Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.
Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S
2018-06-01
Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.
Park, J-H; Kim, H-S; Yim, J-H; Kim, Y-J; Kim, D-H; Chon, J-W; Kim, H; Om, A-S; Seo, K-H
2017-08-01
Salmonella contamination in chicken samples can cause major health problems in humans. However, not only the effects of antibiotic treatment during growth but also the impacts of the poultry slaughter line on the prevalence of Salmonellae in final chicken meat sold to consumers are unknown. In this study, we compared the isolation rates and antimicrobial resistance of Salmonellae among antibiotic-free, conventional, conventional Korean native retail chicken meat samples, and clonal divergence of Salmonella isolates by multilocus sequence typing. In addition, the distribution of extended-spectrum β-lactamase (ESBL) genes in ESBL-producing Salmonella isolates was analyzed. A total of 72 retail chicken meat samples (n = 24 antibiotic-free broiler [AFB] chickens, n = 24 conventional broiler [CB] chickens, and n = 24 conventional Korean native [CK] chickens) was collected from local retail markets in Seoul, South Korea. The isolation rates of Salmonellae were 66.6% in AFB chickens, 45.8% in CB chickens, and 25% in CK chickens. By analyzing the minimum inhibitory concentrations of β-lactam antibiotics with the disc-diffusion test, we found that 81.2% of Salmonella isolates from AFB chickens, 63.6% of isolates from CB chickens, and 50% of isolates from CK chickens were ESBL producers; all ESBL-positive isolates had the CTX-M-15 genotype. Interestingly, all ESBL-producing Salmonellae were revealed as ST16 by multilocus sequence typing and had the genetic platform of blaCTX-M gene (IS26-ISEcp1-blaCTX-M-15-IS903), which was first reported in Salmonellae around the world. The Salmonella ST33 strain (S. Hadar) isolated in this study has never been reported in South Korea. In conclusion, our findings showed that antibiotic-free retail chicken meat products were also largely contaminated with ESBL-producing Salmonellae and that their ESBL genes and genetic platforms were the same as those isolated from conventional retail chicken meat products. © 2017 Poultry Science
“Fish, chicken, lean meat and eggs can be eaten daily”: a food ...
African Journals Online (AJOL)
2013-04-09
Apr 9, 2013 ... meat and eggs, constitute high-quantity and high-quality protein, as they contain essential ... Food (per 100 g, raw, edible portion). Fat. SFAs. MUFAs. PUFAs n-3 .... milk.27 The naturally present fibres, phytates, oxalates and.
Consumer attitudes to meat eating.
Richardson, N J; Macfie, H J; Shepherd, R
1994-01-01
This study reports on current meat consumption in the UK and the factors that are percieved by the subjects to be influential in their choice of diet. A random sample of individuals from the population (n-1018) were questioned on their consumption and attitudes towards meat by a postal survey. The study revealed that 28·3% of the population considered themselves to be reducing meat consumption; attitudes found to be determinant in changes in the consumption of meat were healthiness, taste and concerns over additives. Hypothetical future events were found to affect people's estimated meat-eating. Knowledge of meat-related information was investigated with specific reference to the respondents' trust in the various sources used; food package labels were found to be an influential source of meat-related information. Copyright © 1993. Published by Elsevier Ltd.
Van Hecke, Thomas; Vossen, Els; Hemeryck, Lieselot Y; Vanden Bussche, Julie; Vanhaecke, Lynn; De Smet, Stefaan
2015-11-15
Uncured and nitrite-cured pork were subjected, raw, cooked (65 °C, 15 min) or overcooked (90 °C, 30 min), to an in vitro digestion model, which includes mouth, stomach, duodenum, and colon phases. Heating of uncured meat resulted in a pronounced increase in lipid and protein oxidation products throughout digestion. Nitrite-curing had an antioxidant effect during digestion, but this effect disappeared when the meat was overcooked, resulting in up to ninefold higher 4-hydroxy-2-nonenal concentrations compared with digested nitrite-cured raw and cooked pork. Colonic digesta contained significantly higher concentrations of the NOC-specific DNA adduct O(6)-carboxy-methylguanine when pork underwent a more intense heating procedure, independent of nitrite-curing, depending strongly on the fecal inoculum used. Since processed meats are usually nitrite-cured, the present study suggests that overcooking processed meat is likely to result in the formation of genotoxic compounds during digestion and should, therefore, be avoided. Copyright © 2015 Elsevier Ltd. All rights reserved.
Preservation of crab meat by gamma irradiation
International Nuclear Information System (INIS)
Loaharanu, P.; Prompubesara, C.; Kraisorn, K.; Noochpramool, K.
1972-01-01
Fresh crab meat from swimming crab (Portunus pelagicus, Linn.) was irradiated at doses of 0.075, 0.15 and 0.25 Mrad and held at 3 0 C. The storage life of non-irradiated crab meat was approximately 7 days compared with 14 days for crab meat irradiated at 0.075 Mrad and 28 days for samples receiving 0.15 or 0.25 Mrad treatment. Total aerobic count, trimethylamine nitrogen, total volatile basic nitrogen, and ammonia contents were used as objective indices of freshness in comparison with sensory evaluation of the crab meat. All objective indices correlated well with the sensory judgement of the samples. The crab meat used in the study was heavily contaminated with microorganisms. Irradiation at 0.15 and 0.25 Mrad reduced approximately 2 log cycles in the total count. Acinetobacter (Achromobacter) was predominated in irradiated crab meat, especially after prolonged storage. High coagulase positive staphylococci count was detected in only non-irradiated crab meat
Landi, Nicola; Ragucci, Sara; Di Giuseppe, Antonella Ma; Russo, Rosita; Poerio, Elia; Severino, Valeria; Di Maro, Antimo
2018-04-10
Meat from birds is a rich source of proteins for the human diet. In this framework, Eurasian woodcock (Scolopax rusticola L.), a medium-small wading bird hunted as game in many Eurasian countries, is considered one of the best meats for culinary purposes. Since the nutritional composition of Eurasian woodcock meat has not yet been reported, we decided to determine the nutritional profile of S. rusticola meat. Macronutrient components (proteins, lipids and fatty acids) were determined, as well as free and total amino acids, and compared with those of the common pheasant. Eurasian woodcock meat contains high levels of proteins and essential amino acids. The levels of unsaturated fatty acids represent a great contribution to the total lipid amount. Among polyunsaturated fatty acids, linoleic acid (C18:2, n-6) is the major essential fatty acid. Finally, we report the characterization of myoglobin (Mb) from Eurasian woodcock. The data revealed that meat from this bird could be a good source of quality raw proteins because of its amino acid composition, and it had a low lipid content. On the other hand, Mb characterization might be of benefit to the meat industry, by providing useful information for the determination of species-specific differences in meat from birds. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Elimination of Escherichia coli O157:H7 in meats by gamma irradiation
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.
1993-01-01
Undercooked and raw meat has been linked to outbreaks of hemorrhagic diarrhea due to the presence of Escherichia coli O157:H7; therefore, treatment with ionizing radiation was investigated as a potential method for the elimination of this organism. Response-surface methods were used to study the effects of irradiation dose (0 to 2.0 kGy), temperature (-20 to +20 degrees C), and atmosphere (air and vacuum) on E. coli O157:H7 in mechanically deboned chicken meat. Differences in irradiation dose and temperature significantly affected the results. Ninety percent of the viable E. coli in chicken meat was eliminated by doses of 0.27 kGy at +5 degrees C and 0.42 kGy at -5 degrees C. Small, but significant, differences in radiation resistance by E. coli were found when finely ground lean beef rather than chicken was the substrate. Unlike nonirradiated samples, no measurable verotoxin was found in finely ground lean beef which had been inoculated with 10(4.8) CFU of E. coli O157:H7 per g, irradiated at a minimum dose of 1.5 kGy, and temperature abused at 35 degrees C for 20 h. Irradiation is an effective method to control this food-borne pathogen
International Nuclear Information System (INIS)
Tin Tin Myaing; Saleha, A.A.; Arifah, A.K.; Raha, A.R.
2005-01-01
Escherichia coli isolates from 131 raw chicken meat samples were tested for susceptibility to 12 antibiotics. Plasmids were isolated from many samples and their DNA molecular weight calculated. An 81.7% plasmid occurrence rate was observed among the isolates, ranging from 0 to 8 in number and with sizes from 1.2 to 118.6 MDa. Plasmids were detected in 93.8% of E. coIi isolates resistant to all 12 antibiotics, and in 90.5% of E. coli isolates resistant to 11. Three (2.8%) isolates harboured 8 plasmids and were resistant to all 12 antibiotics. Antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and it is postulated that E. coli with a high number of plasmids possesses wider resistance to antibiotics. (author)
de Boer, Joop; Schösler, Hanna; Aiking, Harry
2017-06-01
This study provides insight into differences and similarities in the mindset and motivation of four dietary groups (young self-declared vegetarians, low, medium and high meat-eaters) to support the development of strategies for a general transition to a less meat-based diet. The paper highlights the value of the identity concept for our understanding of both vegetarians and meat eaters. The analysis involves a comparison of the four dietary groups focusing on the strength and the profile of their food-related motivation and their reasons for and against frequent meat eating. To check for the generalizability of the results, the analyses were performed in two samples of adults (aged 18-35) in the Netherlands (native Dutch, n = 357, and second generation Chinese Dutch, n = 350). In both samples, the vegetarians had the same level of food-related motivation as the other groups, but a different motivational profile and distinctive, taste- and animal-welfare related reasons to justify their abstinence from eating meat. The low and medium meat-eaters often considered health a reason to eat meat as well as to moderate meat eating, plus they liked to vary their meals. In these aspects they were different from both the vegetarians and the high meat-eaters. The findings are relevant for (non) governmental organizations that aim to influence dietary choices, as well as for businesses that operate in the market of meat substitutes. Copyright © 2017 Elsevier Ltd. All rights reserved.
MARKET CHOICES FOR BROILER CHICKEN MEAT IN THE OPINION
Directory of Open Access Journals (Sweden)
Anna Augustyńska-Prejsnar
2014-09-01
Full Text Available Recently there has, been growing a increase in consumption of poultry meat in Poland. The most important material for slaughter poultry are broilers. Among factors that influence rising demand for poultry meat are: low price, availability of raw materials and promotional campaigns of safe nutrition. Its nutritional and sensory value makes it a choice product. University students are a specific group that has aroused the interest of nutritionists. The students’ lifestyle is characterised by high active social life and intense responsibilities, which ought to be augmented with a carefully chosen diet. The youth do not only have significant impact on the family purchasing decisions but display a strong purchasing power due to financial resources at their disposal and would in the future become mature and rational consumers. The article lists factors that determine purchasing needs, reasons for choice of markets and the consumption frequency of broiler meat. The feeling of lack of other products coupled with current sales promotions were, in the opinion of the students surveyed, often responsible for the decision to purchase of broiler chicken meat. Low price and the ease of preparation were also key reasons for the choice of this meat product. Responding students noted that skinless chicken breast fillet was most commonly consumed.
Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A
2014-10-21
In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.
Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M
2016-01-01
Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.
Ochratoxin A reduction in meat sausages using processing methods practiced in households.
Pleadin, Jelka; Perši, Nina; Kovačević, Dragan; Vulić, Ana; Frece, Jadranka; Markov, Ksenija
2014-01-01
The aim of this study was to investigate the possibilities of ochratoxin A (OTA) reduction in home-made meat products. Meat sausages (n = 50) produced from raw materials coming from pigs exposed to OTA-contaminated feed, were subject to common heat processes practiced in households (cooking, frying and baking). Concentrations of OTA in pre- and post-processed products were quantified using a validated immunoassay method, enzyme-linked immunosorbent assay, and confirmed using a high-performance liquid chromatography with fluorescence detection. In line with the differences in recipes used and the degree of OTA accumulation in raw materials, OTA concentrations established in Mediterranean and roast sausages were lower than those found in liver and blood sausages. Baking of contaminated sausages at the temperatures of 190-220°C (for 60 min) resulted in significant reduction of OTA levels (75.8%), while 30-min cooking (at 100°C) and frying (at 170°C) proved to be significantly less effective (e.g. yielding OTA reductions of 7.4% and 12.6%, respectively). The results pointed out that despite high OTA stability, heat processes are capable of reducing its concentration in home-made meat products, depending on the processing modality used.
International Nuclear Information System (INIS)
Paul, P.; Chawla, S.P.; Kanatt, S.R.
1998-01-01
The effects were studied of low dose gamma irradiation in combination with other treatments (acetic acid and a sodium tripolyphosphate dip for buffalo meat; a hot water dip for lamb meat; ascorbic acid for chicken and curing for meat products) on the shelf-life of prepacked meats at chilled and ambient temperatures in terms of the microbiological, chemical and sensory qualities. Meats irradiated at 2.5 kGy had a shelf-life of 4 weeks at 0-3 deg. C, 2 weeks at 7-10 deg. C and 42 h at 28-30 deg. C, and showed a remarkable improvement in the microbiological quality. irradiation resulted in the reduction/elimination of microorganisms of public health significance, e.g. Enterobacteriaceae, Salmonella, staphylococci and faecal coliforms. In contrast, the corresponding control samples had a shelf-life of less than 2 weeks at 0-3 deg. C, 1 week at 7-10 deg. C and 18 h at ambient temperature (28-30 deg. C). A high level of microorganisms such as Enterobacteriaceae, staphylococci, Salmonella and sulphite reducing Clostridia were detected in the control samples during storage. A combination of acetic acid/hot water pretreatment and irradiation further improved the microbiological quality of the meats, while a pretreatment of sodium tripolyphosphate enhanced the retention of colour and the juiciness of the meat samples. The effects were observed at all the storage temperatures. For the meat products, a low dose of irradiation reduced the total viable counts by 1-2 log cycles, and also eliminated Enterobacteriaceae, staphylococci and Salmonella throughout the storage period. The irradiated meat products had a shelf-life of 2 weeks at 0-3 deg. C and 24 h at 28-30 deg. C, while the non-irradiated meat products had a shelf-life of 1 week at 0-3 deg. C and 18 h at 28-30 deg. C. (author)
Improvement of shelf stability and processing properties of meat products by gamma irradiation
International Nuclear Information System (INIS)
Byun, M.-W.; Lee, J.-W.; Yook, H.-S.; Lee, K.-H.; Kim, H.-Y.
2002-01-01
To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams
Improvement of shelf stability and processing properties of meat products by gamma irradiation
Byun, Myung-Woo; Lee, Ju-Woon; Yook, Hong-Sun; Lee, Kyong-Haeng; Kim, Hee-Yun
2002-03-01
To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams.
Jira, Wolfgang; Schwägele, Fredi
2017-12-15
A sensitive HPLC-MS/MS method for the simultaneous detection of microbial transglutaminase (TG) from Streptomyces mobaraensis, and bovine and porcine fibrinogen/thrombin in restructured meat was developed using tryptic marker peptides of TG (five markers), and bovine and porcine fibrinogen (six markers each). Meat binding experiments with beef and pork were performed using a technical TG mixture (Activa, Ajinomoto), and bovine and porcine plasmapowder FG (PPFG; Sonac B.V.). The method developed allows the simultaneous detection of the use of these cold-set binders in raw and heated samples. The peak areas of the fibrinogen marker peptides were increased by a factor of about 100, compared to blank values originating from the occurrence of residual blood in meat, using a concentration of 0.6% bovine and porcine PPFG. A differentiation between the use of blood plasma powder and PPFG using the ratios of fibrinogen to serotransferrin peptide peak areas seems to be possible. Copyright © 2017 Elsevier Ltd. All rights reserved.
Meat and Fish Entree Item Production Guides Prepared for Walter Reed Army Medical Center
1977-04-01
diced Salt 0.41 Vinegar, cider 0.32 Sugar, granulated 0.27 Paprika 0.13 Garlic, dehydrated 0.05 granular Pepper, black, ground 0!01 ARROZ CON...table pans. ARROZ CON POI.l.O Ingredients Percent Pounds Grans Procedure TarALs 100.00 2$708 NarES: 1. Reheating: Reheat in a convection oven at...yield from raw weigpt-~to cooked edible (boned) meat. Edible weight of chicken equals 12 lb {5443 g). 68 ARROZ CON POLLO Meat 1. Bacon - NSN
Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R
2010-05-01
A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.
Bacteriological and genetic assessment of game meat from Japanese wild boars.
Naya, Yuka; Horiuchi, Motohiro; Ishiguro, Naotaka; Shinagawa, Morikazu
2003-01-15
Bacterial tests were used to assess bacterial contamination of game meat from Japanese wild boars. The bacterial contamination of wild boar meat was less than that of domestic pork, as determined by aerobic plate counts (APC) and coliform counts. None of the meat examined in this study was contaminated by Salmonella or E. coli O-157. To detect adulteration by domestic pig meat or European wild boar meat, 46 samples of game meat sold as Japanese wild boar were examined genetically. A total of 17 samples showed genetic haplotypes of European and Asian domestic pigs in the D-loop of mitochondrial DNA (mtDNA), and 16 samples showed nuclear glucosephosphate isomerase-processed pseudogene (GPIP) genotypes of European domestic pigs. The European GPIP genotypes of these samples were confirmed by PCR-RFLP analysis. These results indicate that some game meat sold as Japanese wild boar is adulterated by cross-breeding between pigs and wild boars or by contamination with meat from domestic pigs or European wild boars.
Development and validation of a rapid test system for detection of pork meat and collagen residues.
Masiri, J; Benoit, L; Barrios-Lopez, B; Thienes, C; Meshgi, M; Agapov, A; Dobritsa, A; Nadala, C; Samadpour, M
2016-11-01
Mislabeling, contamination, and economic adulteration of meat products with undeclared pork tissues are illegal under regulations promulgated by numerous regulatory agencies. Nonetheless, analysis of the European meat industry has revealed pervasive meat adulteration, necessitating more extensive application of meat authentication testing. As existing methods for meat speciation require specialized equipment and/or training, we developed a detection system based on a lateral flow device (LFD) assay format capable of rapidly (~35min) identifying porcine residues derived from raw meat, cooked meat, and gelatin down to 0.01%, 1.0%, and 2.5% contamination, respectively. Specificity analysis revealed no cross-reactivity with meat derived from chicken, turkey, horse, beef, lamb, or goat. Comparison with a commercial ELISA kit and PCR method revealed similar if not improved sensitivity, with the added feature that the LFD-based system required considerably less time to perform. Accordingly, this test system should aid the food industry and food control authorities in monitoring for adulteration with pork. Copyright © 2016 Elsevier Ltd. All rights reserved.
Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.
Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E
2016-05-01
We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.
Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.
2016-01-01
The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169
Directory of Open Access Journals (Sweden)
S.M. Azwai
2016-03-01
Full Text Available The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk. Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6% yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS with culture characteristics of Vibrio spp. More than half (n=27 of processed seafood samples (n=46 yielded colonies on TCBS, while only 44.6% of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 х104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 х104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9% were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.
Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M
2016-01-01
The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.
Toxoplasma gondii in horse meat intended for human consumption in Romania.
Paştiu, Anamaria Ioana; Györke, Adriana; Kalmár, Zsuzsa; Bolfă, Pompei; Rosenthal, Benjamin Martin; Oltean, Miruna; Villena, Isabelle; Spînu, Marina; Cozma, Vasile
2015-09-15
The prevalence of Toxoplasma gondii, an economically important zoonotic protozoan, was investigated in horses slaughtered for export and human consumption in the North of Romania. Pairs of samples, sera and heart tissues, were collected from 82 slaughtered horses. Examination of horse sera by ELISA at a dilution of 1:10, and by modified agglutination test (MAT) at a dilution of 1:6, revealed that 32 (39%) and 31(37.8%) horses, respectively, had antibodies against T. gondii. Using polymerase chain reaction (PCR) analysis, T. gondii DNA was not found in any heart sample collected from horses. By bioassay in mice, we obtained viable isolates of T. gondii from two of ten horses determined to be strongly positive by serological assay/ELISA. The prevalence estimated in horses highlighted the potential risk for human contamination by consumption of raw or undercooked meat. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Aline Ferreira Amorim
2015-06-01
Full Text Available The purpose of this study the effect of inclusion levels (0, 10, 20 and 30% of cassava bagasse (BM to the diet on the physical and chemical parameters of raw and cooked meat thigh , drumstick and breast of chicken was to evaluate cutting hillbilly kind of lineage Label rouge® slaughtered at 84 days of age . Analyzes were performed in the laboratory of Animal Nutrition , Universidade Federal do Tocantins – UFT, Escola de Medicina Veterinária e Zootecnia , Campus Araguaína . Forty chicken carcasses, which were divided into half-carcases, half-carcases and 10 for analysis of the chemical composition of raw meat and the other 10 half-carcasses for analysis of chemical composition of cooked meat , they are included in these analyzes the crude protein (CP, ether extract ( EE, dry matter (DM and ash (CZ, with base on the percentage of dry matter, in addition to gross energy (GE and cooking losses. Analyzes were also conducted of the physical attributes of meat (color, pH and texture other 20 half-carcasses. The inclusion of BM in the diet of broilers caipira type cut and cooking affected (P <0.05 the chemical characteristics of meat. Observed in thigh meat linear reduction in the deposition of CZ and linear increase in deposition of PB. Drumstick meat in CP content increased up to the level of 17.22% inclusion of BM corresponding to the deposition of 84.21% CP; and lower levels of EE (19.21% was found in the estimated level of 21.33% inclusion of BM. In breast meat was observed deposition of 29.56% with 2.35% DM inclusion of BM deposition and 88.56% to 13.46% of CP inclusion of BM. However the physical characteristics of meat were not influenced by the levels of inclusion of BM. It is recommended, with base on the chemical composition of the meat, to use up the 20% level of inclusion of BM.
The Effects of Cooking Process and Meat Inclusion on Pet Food Flavor and Texture Characteristics
Koppel, Kadri; Gibson, Michael; Alavi, Sajid; Aldrich, Greg
2014-01-01
Simple Summary The results of this research indicate that processing (baked vs. extruded) plays an important role in determining pet food product texture. In addition, raw ingredients (fresh meat vs. meal-based) did not consistently affect product sensory characteristics. These results may help pet food technologists better understand factors that affect palatability. Abstract The pet food industry is an important portion of the food and feed industries in the US. The objectives of this study were (1) to determine cooking method (baking or extrusion), meat inclusion (0 or 20%), and extrusion thermal to mechanical energy ratios (low, medium, and high) effects on sensory and volatile properties of pet foods, and (2) to determine associations among sensory and volatile characteristics of baked and extruded pet foods. Descriptive sensory analysis and gas chromatography-mass spectrometry were used to analyze the pet food samples. It was found that baked samples were lighter in color (2.0–2.6 baked vs. 3.5–4.3 extruded, color intensity scale 0–15), and had lower levels of attributes that indicated rancidity (i.e., fishy flavor; 0.3–0.6 baked, 0.6–1.5 extruded, scale 0–15), whereas extruded pet foods were more cohesive in mass, more friable, hard, and crisp, but less powdery than baked samples. Fresh meat inclusion tended to decrease bitterness and increase fishy flavor and cohesiveness of pet foods. High thermal to mechanical energy ratio during extrusion resulted in less musty and more porous kibbles. The main volatile compounds included aldehydes, such as hexanal and heptanal, ketones, and alcohols. Extruded samples did not contain methylpyrazine, while baked samples did not contain 2-butyl furan. Future studies should consider evaluating the relationship between sensory results and animal palatability for these types of foods. PMID:26480040
Combination treatment of gamma radiation and paraben in controlling spoilage of poultry meat
International Nuclear Information System (INIS)
Shiralkar, N.D.; Rege, D.V.
1977-01-01
With a view of controlling spoilage, combination treatment of poultry meat with gamma radiation and a chemical preservative has been investigated. Raw poultry pieces of about 25 g. weight were dipped in 0.1% propyl-paraben solution for two hours and were given a 0.1 Mrad dose from 60 Co gamma radiation. It was found that paraben was not affected by irradiation. The flavour evaluation scores indicated the shelf-life of poultry meat was prolonged by a couple of days as compared to untreated controls in refrigerated storage. (M.G.B.)
Ulbin-Figlewicz, Natalia; Jarmoluk, Andrzej
2016-06-01
The effect of low-pressure plasma on quality attributes of meat is an important aspect, which must be considered before application in food. The aim of this study was to determine the color, fatty acid composition, lipid oxidation expressed as thiobarbituric acid reactive substances and total antioxidant capacity of raw pork samples exposed to helium low-pressure plasma treatment (20 kPa) for 0, 2, 5, and 10 min during the storage period. The thiobarbituric acid reactive substance concentrations of all plasma-treated samples during storage were in the range from 0.26 to 0.61 mg malondialdehyde/kg. Exposure time caused significant changes only in total color difference, hue angle, and chroma after 10 min of treatment. Ferric reducing ability of plasma values of meat samples decreased from 1.93 to 1.40 mmol Trolox Eq/kg after 14 days of storage. The storage period significantly affected proportion of polyunsaturated fatty acids, with an increase about 3% after 14 days of refrigeration storage while the content of saturated fatty acids was at the same level. Helium low-pressure plasma does not induce oxidative processes. Application of this decontamination technique while maintaining product quality is possible in food industry. © The Author(s) 2015.
Authentication of Meat Species in Sucuk by Multiplex PCR
Directory of Open Access Journals (Sweden)
Osman İrfan İLHAK
2015-01-01
Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.
Design and testing of small scale fish meat bone separator useful for fish processing.
Ali Muhammed, M; Manjunatha, N; Murthy, K Venkatesh; Bhaskar, N
2015-06-01
The present study relates to the food processing machinery and, more specifically machine for producing boneless comminuted meat from raw fish fillet. This machine is of belt and drum type meat bone separator designed for small scale fish processing in a continuous mode. The basic principal involved in this machine is compression force. The electric geared motor consists of 1HP and the conveyor belt has a linear velocity of 19 to 22 m min(-1), which was sufficient to debone the fish effectively. During the meat bone separation trials an efficiency up to 75 % on dressed fish weight basis was observed and with a capacity to separate 70 kg h(-1) of meat from fish at the machine speed of 25 rpm. During the trials, it was demonstrated that there was no significant change in the proximate composition of comminuted fish meat when compared to unprocessed fish meat. This design has a greater emphasis on hygiene, provision for cleaning-in-place (CIP) and gives cost effective need and reliability for small scale industries to produce fish meat in turn used for their value added products.
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A
2014-12-01
Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.
Directory of Open Access Journals (Sweden)
Simone Belluco
Full Text Available Toxoplasma gondii is one of the most widespread parasites in humans and can cause severe illness in immunocompromised individuals. However, its role in healthy people is probably under-appreciated. The complex epidemiology of this protozoan recognizes several infection routes but consumption of contaminated food is likely to be the predominant one. Among food, consumption of raw and undercooked meat is a relevant route of transmission, but the role of different meat producing animal species and meats thereof is controversial.The aim of the present work is to summarize and analyse literature data reporting prevalence estimates of T. gondii in meat animals/meats.We searched Medline, Web of Science, Science Direct (last update 31/03/2015.Relevant papers should report data from primary studies dealing with the prevalence of T. gondii in meat from livestock species as obtained through direct detection methods. Meta-analysis and meta-regression were performed.Of 1915 papers screened, 69 papers were included, dealing mainly with cattle, pigs and sheep. Pooled prevalences, based on random-effect models, were 2.6% (CI95 [0.5-5.8] for cattle, 12.3% (CI95 [7.6-17.8] for pigs and 14.7% (CI95 [8.9-21.5] for sheep. Due to the high heterogeneity observed, univariable and multivariable meta-regression models were fitted showing that the geographic area for cattle (p = 0.032, the farming type for pigs (p = 0.0004 and the sample composition for sheep (p = 0.03 had significant effects on the prevalences of Toxoplasma detected/estimated. Moreover, the role of different animal species was dependent on the geographic location of animals' origin.Limitations were due mainly to a possible publication bias.The present work confirms the role of meat, including beef, as T. gondii sources, and highlights the need for a control system for this parasite to be implemented along the meat production chain. Moreover, consumer knowledge should be strengthened in order to reduce
Effect of probiotics on broiler meat quality | Kabir | African Journal of ...
African Journals Online (AJOL)
The study was carried out on “Hubbard Isa Starbo” broilers to evaluate the raw meat quality of both probiotics and conventional fed broilers in pre-freezing condition and ... The groups C and D were taken as control birds and were fed with commercial ration and the groups A and B as experimental birds which were fed with ...
Affective Beliefs Influence the Experience of Eating Meat
Anderson, Eric C.; Barrett, Lisa Feldman
2016-01-01
People believe they experience the world objectively, but research continually demonstrates that beliefs influence perception. Emerging research indicates that beliefs influence the experience of eating. In three studies, we test whether beliefs about how animals are raised can influence the experience of eating meat. Samples of meat were paired with descriptions of animals raised on factory farms or raised on humane farms. Importantly, the meat samples in both conditions were identical. Howe...
Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C
2009-02-28
Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.
Organic beef production by Maremmana breed: qualitative meat characteristics
Mele, Prof. Marcello; Morbidini, Prof. Luciano; Cozza, Dr. Francesca; Pauselli, Prof. Mariano; Pollicardo, Dr. Alice
2008-01-01
Meat quality of Maremmana young bulls and steers was evaluated during three consecutive years, according to an extension service experimental program. Cooking loss values of meat samples were lower in meat from steers, whereas shear force values were higher. Meat from steers was darker than meat from young bulls, as a consequence of a low level of Lightness and a high level of Chroma. Meat chemical composition showed a higher content of intramuscular fat in steer meat, which showed also a low...
Abugoch, L; Barrios, J; Guarda, A
1996-12-01
The research of alternative technological processes is being necessary in order to obtain a better utilization of hydrobiologic resources and food products, with higher added value. Crab (Homolaspis plana) is a crustacean found along the Chilean coast, whose flesh is exported as a frozen product. The resource crab is scantly studied in Chile and could became an excellent raw material for "delicatessen" products, with a high market value. The proximal composition, through the protein, fat, moisture and ashes content was determined. The non nitrogen extract was calculated by difference. The functional properties (water retention, emulsifying and gel-forming capacities) of fresh crab claws meat without additives were measured. The proximal composition for the claw meat was: 79,34 +/- 1.12% moisture, 16.75 +/- 1.29% protein, 1.86 +/- 0.11% ashes, 0.11 +/- 0.01 fat % and 1.93 +/- 1.07% N.N.E. In relation with the emulsifying capacity, claw meat was able to emulsify 2,259.03 +/- 73.04 g vegetal oil/g protein. The water retention was 154.49 +/- 6.85% representing the increase in mass percent; and the force of the gel formed in claw meat was 195.3 +/- 17.16 g-force x cm. According to these results, the claw crab is an attractive food, with a high protein and low fat content. Crab meat showed an excellent emulsifying capacity and water retention, so it can be used as a good raw material for the development of smearing products. In the case of gel-like products, further studies will be required, in order to optimize the conditions in which a stronger gel could be obtained.
Magnetic Stirrer Method for the Detection of Trichinella Larvae in Muscle Samples.
Mayer-Scholl, Anne; Pozio, Edoardo; Gayda, Jennifer; Thaben, Nora; Bahn, Peter; Nöckler, Karsten
2017-03-03
Trichinellosis is a debilitating disease in humans and is caused by the consumption of raw or undercooked meat of animals infected with the nematode larvae of the genus Trichinella. The most important sources of human infections worldwide are game meat and pork or pork products. In many countries, the prevention of human trichinellosis is based on the identification of infected animals by means of the artificial digestion of muscle samples from susceptible animal carcasses. There are several methods based on the digestion of meat but the magnetic stirrer method is considered the gold standard. This method allows the detection of Trichinella larvae by microscopy after the enzymatic digestion of muscle samples and subsequent filtration and sedimentation steps. Although this method does not require special and expensive equipment, internal controls cannot be used. Therefore, stringent quality management should be applied throughout the test. The aim of the present work is to provide detailed handling instructions and critical control points of the method to analysts, based on the experience of the European Union Reference Laboratory for Parasites and the National Reference Laboratory of Germany for Trichinella.
[Characterization and nutritional value of a food artisan: the meat pie of Murcia].
Ruiz-Cano, Domingo; Pérez-Llamas, Francisca; López-Jiménez, José Ángel; González-Silvera, Daniel; Frutos, Maria José; Zamora, Salvador
2013-01-01
The main aims of this study are to describe the characteristics of the meat pie, a typical product of the regional gastronomy of Murcia and to determine its nutritional and energy values, fatty acid profile and fat quality. There were studied 24 samples of Murcia's meat pie from the six best-selling retail establishments in this Region (four units per establishment).The moisture, protein, fat, carbohydrates, fibre and minerals, contents and the energy value, fatty acid profile and fat quality were analyzed using the Official Analysis Methods of Foods. All analyses were performed by triplicate. The average weight of this product was 192.3 ± 11.8 g, with three differentiated parts (base, filling and pastry lid). All ingredients were natural raw materials: wheat flour, lard, ground beef, sliced boiled egg and chorizo, water and spices (salt, pepper, garlic, paprika and nutmeg). Most of its organoleptic attributes are due to the type and amount of fat or lard. The combination of the other ingredients and the particular formulation of the spices are also responsible of other attributes. Due to its protein content (11.0%), this meat pie can replace other meat dishes, and be incorporated into a balanced diet. However, it is necessary to take into account its fat and energy contents (17.3 g and 317 kcal/100 g, respectively). Unlike many common pastry products, it contains no trans fatty acids. The results of the research show that the studied product remains, at present, an artisan food, and offer reliable information that it is representative of the energy and nutritional values of the Murcia's meat pie, a typical product of the gastronomy of the Region of Murcia. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.
Lahou, Evy; Jacxsens, Liesbeth; Van Landeghem, Filip; Uyttendaele, Mieke
2014-08-01
Food service operations are confronted with a diverse range of raw materials and served meals. The implementation of a microbial sampling plan in the framework of verification of suppliers and their own production process (functionality of their prerequisite and HACCP program), demands selection of food products and sampling frequencies. However, these are often selected without a well described scientifically underpinned sampling plan. Therefore, an approach on how to set-up a focused sampling plan, enabled by a microbial risk categorization of food products, for both incoming raw materials and meals served to the consumers is presented. The sampling plan was implemented as a case study during a one-year period in an institutional food service operation to test the feasibility of the chosen approach. This resulted in 123 samples of raw materials and 87 samples of meal servings (focused on high risk categorized food products) which were analyzed for spoilage bacteria, hygiene indicators and food borne pathogens. Although sampling plans are intrinsically limited in assessing the quality and safety of sampled foods, it was shown to be useful to reveal major non-compliances and opportunities to improve the food safety management system in place. Points of attention deduced in the case study were control of Listeria monocytogenes in raw meat spread and raw fish as well as overall microbial quality of served sandwiches and salads. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kottawattage S. A. Kottawatta
2017-11-01
Full Text Available Broiler meat can become contaminated with Campylobacter of intestinal origin during processing. The present study aimed to identify the prevalence of Campylobacter in broiler flocks and meat contamination at retail shops, and determine the influence of semi-automated and wet market processing on Campylobacter contamination of neck skin samples. Samples were collected from semi-automated plants (n = 102 and wet markets (n = 25. From each batch of broilers, pooled caecal samples and neck skin samples were tested for Campylobacter. Broiler meat purchased from retail outlets (n = 37 was also tested. The prevalence of Campylobacter colonized broiler flocks was 67%. The contamination of meat at retail was 59%. Both semi-automated and wet market processing resulted to contaminate the broiler neck skins to the levels of 27.4% and 48%, respectively. When Campylobacter-free broiler flocks were processed in semi-automated facilities 15% (5/33 of neck skin samples became contaminated by the end of processing whereas 25% (2/8 became contaminated after wet market processing. Characterization of isolates revealed a higher proportion of C. coli compared to C. jejuni. Higher proportions of isolates were resistant to important antimicrobials. This study shows the importance of Campylobacter in poultry industry in Sri Lanka and the need for controlling antimicrobial resistance.
Kottawatta, Kottawattage S A; Van Bergen, Marcel A P; Abeynayake, Preeni; Wagenaar, Jaap A; Veldman, Kees T; Kalupahana, Ruwani S
2017-11-29
Broiler meat can become contaminated with Campylobacter of intestinal origin during processing. The present study aimed to identify the prevalence of Campylobacter in broiler flocks and meat contamination at retail shops, and determine the influence of semi-automated and wet market processing on Campylobacter contamination of neck skin samples. Samples were collected from semi-automated plants ( n = 102) and wet markets ( n = 25). From each batch of broilers, pooled caecal samples and neck skin samples were tested for Campylobacter . Broiler meat purchased from retail outlets ( n = 37) was also tested. The prevalence of Campylobacter colonized broiler flocks was 67%. The contamination of meat at retail was 59%. Both semi-automated and wet market processing resulted to contaminate the broiler neck skins to the levels of 27.4% and 48%, respectively. When Campylobacter -free broiler flocks were processed in semi-automated facilities 15% (5/33) of neck skin samples became contaminated by the end of processing whereas 25% (2/8) became contaminated after wet market processing. Characterization of isolates revealed a higher proportion of C. coli compared to C. jejuni . Higher proportions of isolates were resistant to important antimicrobials. This study shows the importance of Campylobacter in poultry industry in Sri Lanka and the need for controlling antimicrobial resistance.
ALTERNATIVE METHODS OF TECHNOLOGICAL PROCESSING TO REDUCE SALT IN MEAT PRODUCTS
Directory of Open Access Journals (Sweden)
E. K. Tunieva
2017-01-01
Full Text Available The world trends in table salt reduction in meat products contemplate the use of different methods for preservation of taste and consistency in finished products as well as shelf life prolongation. There are several approaches to a sodium chloride reduction in meat products. The paper presents a review of the foreign studies that give evidence of the possibility to maintain quality of traditional meat products produced with the reduced salt content. The studies in the field of salty taste perception established that a decrease in a salt crystal size to 20 µm enabled reducing an amount of added table salt due to an increase in the salty taste intensity in food products. Investigation of the compatibility of different taste directions is also interesting as one of the approaches to a sodium chloride reduction in food products. The use of water-in-oil-in-water (w/o/w double emulsions allows controlling a release of encapsulated ingredients (salt, which enables enhancement of salty taste. The other alternative method of technological processing of meat raw material for reducing salt in meat products is the use of high pressure processing. This method has several advantages and allows not only an increase in the salty taste intensity, but also formation of a stable emulsion, an increase in water binding capacity of minced meat and extension of shelf-life.
DEFF Research Database (Denmark)
Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke
2013-01-01
Using novel X-ray techniques, based on grating-interferometry, new imaging modalities can be obtained simultaneously with absorption computed tomography (CT). These modalities, called phase contrast and dark field imaging, measure the electron density and the diffusion length of the sample....... Enhanced contrast capabilities of this X-ray technique makes studies on materials with similar attenuation properties possible. In this paper the focus is set on processing grating-based X-ray tomograms of meat emulsions to quantitatively measure micro-structural changes due to heat treatment. The emulsion...... samples were imaged both in a raw and cooked state. Additionally, different fat types were used in the emulsions in order to compare micro-structural differences when either pork fat or sunflower oil was used. From the reconstructed tomograms the different ingredients in the emulsions were segmented using...
Ahmed, Imtiaz; Hughes, Denise; Jenson, Ian; Karalis, Tass
2009-03-01
Testing of beef destined for use in ground beef products for the presence of Escherichia coli O157:H7 has become an important cornerstone of control and verification activities within many meat supply chains. Validation of the ability of methods to detect low levels of E. coli O157:H7 is critical to confidence in test systems. Many rapid methods have been validated against standard cultural methods for 25-g samples. In this study, a number of previously validated enrichment broths and commercially available test kits were validated for the detection of low numbers of E. coli O157:H7 in 375-g samples of raw ground beef component matrices using 1 liter of enrichment broth (large-sample:low-volume enrichment protocol). Standard AOAC International methods for 25-g samples in 225 ml of enrichment broth, using the same media, incubation conditions, and test kits, were used as reference methods. No significant differences were detected in the ability of any of the tests to detect low levels of E. coli O157:H7 in samples of raw ground beef components when enriched according to standard or large-sample:low-volume enrichment protocols. The use of large-sample:low-volume enrichment protocols provides cost savings for media and logistical benefits when handling and incubating large numbers of samples.
Contamination of ready-to-eat raw vegetables with Clostridium difficile in France.
Eckert, Catherine; Burghoffer, Béatrice; Barbut, Frédéric
2013-09-01
The presence of Clostridium difficile in food like shellfish, vegetables and meat has been reported in several publications during the past few years. The objective of this study was to assess the prevalence of ready-to-eat raw vegetables contaminated with C. difficile in France. One hundred and four ready-to-eat salads and vegetables were studied. Toxigenic C. difficile strains were isolated in three samples (2.9 %): two ready-to-eat salads (one heart of lettuce and one lamb's lettuce salad) and one portion of pea sprouts. The strains belonged to three different PCR ribotypes: 001, 014/020/077 and 015. The detection thresholds for vegetative cells and spores cells varied between 1 and 3 c.f.u. in 20 g salad and between 6 and 15 c.f.u. in 20 g salad, respectively, for the method employed.
Preservation of Minced Meats by Using Medium and High-doses Irradiation
International Nuclear Information System (INIS)
Hammad, A.A.I.; Swailam, H.M.H.; Taha, S.M.A.
2003-01-01
The effect of medium (2.5-10 kGy) dose irradiation and high(20-70 kGy) dose irradiation on the microbiological, chemical and organoleptic properties of minced meat samples was studied. It was found that irradiation dose of only 5 kGy greatly reduced all microbial counts and completely eliminated all non-spore forming pathogenic bacteria contaminated minced meat samples. Consequently this irradiation dose extended the refrigerated (3 degree ±1) storage life of these products for more than 8 weeks. This irradiation dose almost did not affect the chemical composition, particularly the main amino acids and main fatty acids of minced meat samples. Panelists could not differentiate between irradiated minced meat samples at this dose and unirradiated samples. High doses irradiation, i.e.40 and 70 kGy were sufficient and efficient in sterilization of minced meat samples and in obtaining long-stable minced meat products (Two years) at ambient temperature. These irradiation doses slightly reduced (not more than 7%) aspartic acid, glutamic acid, methionine and lysine of minced meat. It also decreased the relative percentage of total unsaturated fatty acids by not more than 17 % . These high irradiation doses caused loss of C 18:3 and C 20:1
Multiresistant Bacteria Isolated from Chicken Meat in Austria
Directory of Open Access Journals (Sweden)
Gernot Zarfel
2014-12-01
Full Text Available Multidrug resistant bacteria (MDR bacteria, such as extended spectrum beta-lactamase (ESBL Enterobacteriaceae, methicillin resistant Staphylococcus aureus (MRSA, and vancomycin-resistant Enterococci (VRE, pose a challenge to the human health care system. In recent years, these MDR bacteria have been detected increasingly outside the hospital environment. Also the contamination of food with MDR bacteria, particularly of meat and meat products, is a concern. The aim of the study was to evaluate the occurrence of MDR bacteria in chicken meat on the Austrian market. For this study, 50 chicken meat samples were analysed. All samples originated from chickens slaughtered in Austrian slaughterhouses and were marked as produced in Austria. Samples were analysed for the presence of ESBL Enterobacteriaceae, methicillin resistant Staphylococci and VRE. Resistance genes of the isolated bacteria were characterised by PCR and sequencing. In the present study 26 ESBL producing E. coli, five mecA gene harbouring Staphylococci (but no MRSA, and four VRE were detected in chicken meat samples of Austrian origin. In 24 (48% of the samples no ESBL Enterobacteriaceae, MRSA, methicillin resistant coagulase negative Staphylococcus (MRCNS or VRE could be detected. None of the samples contained all three types of investigated multiresistant bacteria. In concordance to previous studies, CTX-M-1 and SHV-12 were the dominant ESBL genes.
Directory of Open Access Journals (Sweden)
Bayu Setya Hertanto
2017-05-01
Full Text Available Halal is one of important aspects in consumer protection. Meat and processed meat products are food that should be controlled strictly because those are prone to be adulterated by pork contamination. Therefore, it is necessary to provide detection technique which is accurate, fast and cheap. The objective of this research was to identify the presence of impurities of pork meat on raw chicken meat using gene Cyt-b with duplex-PCR analysis. This research used six samples of raw chicken meat and raw pork. Raw chicken meat was bought from supermarkets in the city of Surakarta and raw pork was obtained from pig slaughterhouse. The percentage of raw pork contamination on raw chicken meat was designed as much as 1, 5, 10, and 25%, respectively. The DNA genome was isolated according to DNA isolation protocol from Genomic DNA Mini Kit. In addition, duplex-PCR was performed based on protocol of KAPA2G Fast Multiplex PCR kit. The data was descriptively analyzed by directly looking the DNA bands on the gel documentation apparatus. The result showed that specific DNA bands for chicken and pig were completely appeared on 1.5% of agarose gels. Duplex-PCR detect contamination of pork on raw meat of chicken at all contamination levels. This research proved that the duplex-PCR detect the contamination of pork until the level of 1%.
The objective of this simulation study is to determine which sampling method (Cozzini core sampler, core drill shaving, and N-60 surface excision) will better detect Shiga Toxin-producing Escherichia coli (STEC) at varying levels of contamination when present in the meat. 1000 simulated experiments...
Tekay, Fikret; Ozbek, Erdal
2007-01-01
Toxoplasma gondii is an obligate intracellular protozoan that can infect all kind of birds and all mammals including humans and is common throughout the world. The prevalence varies according to social and cultural habits, pet cats in homes and geographic factors. Domestic cats are considered to be an important source of Toxoplasma gondii infection. From January to June 2006, the prevalence of toxoplasmosis was retrospectively monitored from blood samples that had been sent to our laboratory in order to determine the levels of IgM and IgG. All the subjects were women and 2,586 blood samples were investigated with the chemiluminescence immunoassay method. The rates of Toxoplasma gondii IgM antibodies were found to be 3.0% (78/2,586) and that of Toxoplasma gondii IgG antibodies, 69.5% (1.798/2,586). The total rate of positivity of Toxoplasma gondii antibodies was 69.6% (1,801/2,586) and the negativity, 30.4% (785/2,586). The highest positive rates have been reported in the southeastern region of Turkey and the 69.6% detected in our study seems to be the highest rate. Raw meatball consumption is common in our region and raw meat has a high risk of Toxoplasma gondii infection by direct ingestion of tissue cysts. As a result we consider that the high frequency of Toxoplasma gondii seropositivity in this region is due to raw meatball consumption.
Hardus, Madeleine E; Lameira, Adriano R; Zulfa, Astri; Atmoko, S Suci Utami; de Vries, Han; Wich, Serge A
2012-04-01
Meat-eating is an important aspect of human evolution, but how meat became a substantial component of the human diet is still poorly understood. Meat-eating in our closest relatives, the great apes, may provide insight into the emergence of this trait, but most existing data are for chimpanzees. We report 3 rare cases of meat-eating of slow lorises, Nycticebus coucang, by 1 Sumatran orangutan mother-infant dyad in Ketambe, Indonesia, to examine how orangutans find slow lorises and share meat. We combine these 3 cases with 2 previous ones to test the hypothesis that slow loris captures by orangutans are seasonal and dependent on fruit availability. We also provide the first (to our knowledge) quantitative data and high-definition video recordings of meat chewing rates by great apes, which we use to estimate the minimum time necessary for a female Australopithecus africanus to reach its daily energy requirements when feeding partially on raw meat. Captures seemed to be opportunistic but orangutans may have used olfactory cues to detect the prey. The mother often rejected meat sharing requests and only the infant initiated meat sharing. Slow loris captures occurred only during low ripe fruit availability, suggesting that meat may represent a filler fallback food for orangutans. Orangutans ate meat more than twice as slowly as chimpanzees (Pan troglodytes), suggesting that group living may function as a meat intake accelerator in hominoids. Using orangutan data as a model, time spent chewing per day would not require an excessive amount of time for our social ancestors (australopithecines and hominids), as long as meat represented no more than a quarter of their diet. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s10764-011-9574-z) contains supplementary material, which is available to authorized users.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
Douny, Caroline; El Khoury, Rawad; Delmelle, Julien; Brose, François; Degand, Guy; Moula, Nassim; Farnir, Frédéric; Clinquart, Antoine; Maghuin-Rogister, Guy; Scippo, Marie-Louise
2015-03-01
The fatty acids (FA) profile was determined in n-3 enriched (Columbus™) Belgian eggs and pork in order to evaluate to what extent the n-3 fatty acids, which are very sensitive to oxidation, are resistant to storage or cooking. In standard eggs or pork, no change of the fatty acid profile was observed after storage or cooking without culinary fat, as well as in Columbus™ eggs and pork after storage. Some cooking processes (eggs in custard and meat in oven) induced a slight significant loss of n-3 fatty acids in Columbus™ eggs or pork (11.1% in fat from eggs cooked in custard vs. 15.3% in raw Columbus™ eggs and 11.0% in fat from oven cooked meat vs. 11.6% in raw Columbus™ meat). As expected, when Columbus™ pork is cooked with culinary fat, its fatty acid profile is modified according to the nature of the fat used.
Occurrence of heterocyclic amines in cooked meat products.
Puangsombat, Kanithaporn; Gadgil, Priyadarshini; Houser, Terry A; Hunt, Melvin C; Smith, J Scott
2012-03-01
Heterocyclic amines (HCAs), potent mutagens and a risk factor for human cancers, are produced in meats cooked at high temperature. The aim of this study was to determine the HCA content in cooked meat products (beef, chicken, pork, fish) prepared by various cooking methods (pan frying, oven broiling, and oven baking at 170 to 230°C) that are preferred by U.S. meat consumers. The primary HCAs in these samples were PhIP (2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine) (1.49-10.89ng/g), MeIQx (2-amino-3,8-dimethylimidazo [4,5-f]quinoxaline) (not detected-4.0ng/g), and DiMeIQx (2-amino-3,4,8-trimethyl-imidazo [4,5-f]quinoxaline) (not detected-3.57ng/g). Type and content of HCAs in cooked meat samples were highly dependent on cooking conditions. The total HCA content in well-done meat was 3.5 times higher than that of medium-rare meat. Fried pork (13.91ng/g) had higher levels of total HCAs than fried beef (8.92ng/g) and fried chicken (7.00ng/g). Among the samples, fried bacon contained the highest total HCA content (17.59ng/g). Copyright © 2011 Elsevier Ltd. All rights reserved.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.
Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing
2015-06-15
Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yacoub, Haitham A; Sadek, Mahmoud A
2017-11-01
This study was conducted to find out the fraud in chicken-processed meat ingredients to protect consumers from commercial adulteration and authentication through a reliable way: direct amplification of conserved segment of cytochrome b gene of mitochondrial DNA, in addition, using species-specific primer assay for a certain cytochrome b. The results reported that chicken-processed meats were identified as a chicken meat based on amplification of conserved cytochrome b gene of mtDNA, while different fragments sizes were produced after the application of species-specific primer as follows: 227, 157, 274, 331, 389 and 439 bp for raw meat of chicken, goat, cattle, sheep, pig and horse, respectively. The results revealed that all chicken meat products are produced with 227 bp in size. While, an adulteration with pork stuffs was observed in some of the chicken meat products using a species-specific primer of cytochrome b gene, namely, chicken luncheon and chicken burger. This study represents a reliable technique that could be used to provide a promising solution for identifying the commercial adulteration and substitutions in processed meat in retail markets.
Color image analysis technique for measuring of fat in meat: an application for the meat industry
Ballerini, Lucia; Hogberg, Anders; Lundstrom, Kerstin; Borgefors, Gunilla
2001-04-01
Intramuscular fat content in meat influences some important meat quality characteristics. The aim of the present study was to develop and apply image processing techniques to quantify intramuscular fat content in beefs together with the visual appearance of fat in meat (marbling). Color images of M. longissimus dorsi meat samples with a variability of intramuscular fat content and marbling were captured. Image analysis software was specially developed for the interpretation of these images. In particular, a segmentation algorithm (i.e. classification of different substances: fat, muscle and connective tissue) was optimized in order to obtain a proper classification and perform subsequent analysis. Segmentation of muscle from fat was achieved based on their characteristics in the 3D color space, and on the intrinsic fuzzy nature of these structures. The method is fully automatic and it combines a fuzzy clustering algorithm, the Fuzzy c-Means Algorithm, with a Genetic Algorithm. The percentages of various colors (i.e. substances) within the sample are then determined; the number, size distribution, and spatial distributions of the extracted fat flecks are measured. Measurements are correlated with chemical and sensory properties. Results so far show that advanced image analysis is useful for quantify the visual appearance of meat.
Two Outbreaks of Trichinellosis Linked to Consumption of Walrus Meat - Alaska, 2016-2017.
Springer, Yuri P; Casillas, Shannon; Helfrich, Kathryn; Mocan, Deanna; Smith, Marscleite; Arriaga, Gabriela; Mixson, Lyndsey; Castrodale, Louisa; McLaughlin, Joseph
2017-07-07
During 1975-2012, CDC surveillance identified 1,680 trichinellosis cases in the United States with implicated food items; among these cases, 1,219 were attributed to consumption of raw or pork products, and 461 were attributed to nonpork products. Although trichinellosis in the United States has historically been associated with consumption of pork, multiple nonporcine species of wild game also are competent hosts for Trichinella spp. and have been collectively implicated in the majority of trichinellosis cases since the late 1990s (1-4) (Figure 1). During July 2016-May 2017, the Alaska Division of Public Health (ADPH) investigated two outbreaks of trichinellosis in the Norton Sound region associated with consumption of raw or undercooked walrus (Odobenus rosmarus) meat; five cases were identified in each of the two outbreaks. These were the first multiple-case outbreaks of walrus-associated trichinellosis in Alaska since 1992 (Figure 2). Health care providers should inquire about consumption of commercially prepared and personally harvested meats when evaluating suspected trichinellosis cases, especially in areas where consumption of wild game is commonplace.
Schmidt, Heinar; Sowoidnich, Kay; Maiwald, Martin; Sumpf, Bernd; Kronfeldt, Heinz-Detlef
2009-05-01
A hand-held Raman sensor head was developed for the in-situ characterization of meat quality. As light source, a microsystem based external cavity diode laser module (ECDL) emitting at 671 nm was integrated in the sensor head and attached to a miniaturized optical bench which contains lens optics for excitation and signal collection as well as a Raman filter stage for Rayleigh rejection. The signal is transported with an optical fiber to the detection unit which was in the initial phase a laboratory spectrometer with CCD detector. All elements of the ECDL are aligned on a micro optical bench with 13 x 4 mm2 footprint. The wavelength stability is provided by a reflection Bragg grating and the laser has an optical power of up to 200 mW. However, for the Raman measurements of meat only 35 mW are needed to obtain Raman spectra within 1 - 5 seconds. Short measuring times are essential for the hand-held device. The laser and the sensor head are characterized in terms of stability and performance for in-situ Raman investigations. The function is demonstrated in a series of measurements with raw and packaged pork meat as samples. The suitability of the Raman sensor head for the quality control of meat and other products will be discussed.
Extension of the Vane Pump-Grinder Technology to Manufacture Finely Dispersed Meat Batters.
Irmscher, Stefan B; Gibis, Monika; Herrmann, Kurt; Oechsle, Anja Maria; Kohlus, Reinhard; Weiss, Jochen
2016-03-01
A vane pump-grinder system was extended to enable the manufacture of finely dispersed emulsion-type sausages by constructing and attaching a high-shear homogenizer at the outlet. We hypothesized that the dispersing capabilities of the extended system may be improved to the point of facilitating meat-fat emulsification due to an overall increased volumetric energy input EV . Coarsely ground raw material mixtures were processed to yield meat batters at varying volume flow rates (10 to 60 L/min) and rotational rotor speeds of the homogenizer nrotor (1000 to 3400 rpm). The normalized torques acting on pump, grinder, and homogenizer motors were recorded and unit power consumptions were calculated. The structure of the manufactured meat batters and sausages were analyzed via image analysis. Key physicochemical properties of unheated and heated batters, that is, texture, water-binding, color, and solubilized protein were determined. The mean diameter d10 of the visible lean meat particles varied between 352 and 406 μm whereas the mean volume-surface diameter d32 varied between 603 and 796 μm. The lightness L* ranged from 66.2 to 70.7 and correlated with the volumetric energy input and product structure. By contrast, varying process parameters did not impact color values a* (approximately 11) and b* (approximately 8). Interestingly, water-binding and protein solubilization were not affected. An exponential process-structure relationship was identified allowing manufacturers to predict product properties as a function of applied process parameters. Raw material mixtures can be continuously comminuted, emulsified, and subsequently filled into casings using an extended vane pump-grinder. © 2016 Institute of Food Technologists®
Effects of Storage Time on the Quality of Local Chicken Meat
African Journals Online (AJOL)
Addressing factors that affect meat quality ... pH values were measured for each sample followed by storage at -20oC to arrest further changes in meat. .... nutritional value in addition to other physical .... Meat and meat products in human.
Eras, Jordi; Ferran, Javier; Perpiña, Belén; Canela, Ramon
2004-08-20
Acylglycerides present in oil seeds and meat can be transformed into volatile fatty esters using chlorotrimethylsilane (CTMS) and 1-pentanol as reagents. The volatile esters can then be analysed by GC. The method is quantitative and involves only minor sample manipulation. It often permits major recoveries of the total saponifiable lipids present in solid samples. A 40 min reaction time is enough to ensure the total conversion of saponifiable lipids to the corresponding FAPEs.
Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, C. de
2004-01-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in the Netherlands. The sample used for this study (participants ≥18 years) was taken from the Dutch National Food
Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, de C.
2004-01-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food
Quinto, E J; Arinder, P; Axelsson, L; Heir, E; Holck, A; Lindqvist, R; Lindblad, M; Andreou, P; Lauzon, H L; Marteinsson, V Þ; Pin, C
2014-05-01
A model to predict the population density of verotoxigenic Escherichia coli (VTEC) throughout the elaboration and storage of fermented raw-meat sausages (FRMS) was developed. Probabilistic and kinetic measurement data sets collected from publicly available resources were completed with new measurements when required and used to quantify the dependence of VTEC growth and inactivation on the temperature, pH, water activity (aw), and concentration of lactic acid. Predictions were compared with observations in VTEC-contaminated FRMS manufactured in a pilot plant. Slight differences in the reduction of VTEC were predicted according to the fermentation temperature, 24 or 34°C, with greater inactivation at the highest temperature. The greatest reduction was observed during storage at high temperatures. A population decrease greater than 6 decimal logarithmic units was observed after 66 days of storage at 25°C, while a reduction of only ca. 1 logarithmic unit was detected at 12°C. The performance of our model and other modeling approaches was evaluated throughout the processing of dry and semidry FRMS. The greatest inactivation of VTEC was predicted in dry FRMS with long drying periods, while the smallest reduction was predicted in semidry FMRS with short drying periods. The model is implemented in a computing tool, E. coli SafeFerment (EcSF), freely available from http://www.ifr.ac.uk/safety/EcoliSafeFerment. EcSF integrates growth, probability of growth, and thermal and nonthermal inactivation models to predict the VTEC concentration throughout FRMS manufacturing and storage under constant or fluctuating environmental conditions.
Ultrasonic characterization of pork meat salting
International Nuclear Information System (INIS)
García-Pérez, J V; De Prados, M; Pérez-Muelas, N; Cárcel, J A; Benedito, J
2012-01-01
Salting process plays a key role in the preservation and quality of dry-cured meat products. Therefore, an adequate monitoring of salt content during salting is necessary to reach high quality products. Thus, the main objective of this work was to test the ability of low intensity ultrasound to monitor the salting process of pork meat. Cylindrical samples (diameter 36 mm, height 60±10 mm) of Biceps femoris were salted (brine 20% NaCl, w/w) at 2 °C for 1, 2, 4 and 7 days. During salting and at each experimental time, three cylinders were taken in order to measure the ultrasonic velocity at 2 °C. Afterwards, the cylinders were split in three sections (height 20 mm), measuring again the ultrasonic velocity and determining the salt and the moisture content by AOAC standards. In the whole cylinders, moisture content was reduced from 763 (g/kg sample) in fresh samples to 723 (g/kg sample) in samples salted for 7 days, while the maximum salt gain was 37.3 (g/kg sample). Although, moisture and salt contents up to 673 and 118 (g/kg sample) were reached in the sections of meat cylinders, respectively. During salting, the ultrasonic velocity increased due to salt gain and water loss. Thus, significant (p 2 = 0.975) and moisture (R 2 = 0.863) contents. In addition, the change of the ultrasonic velocity with the increase of the salt content showed a good agreement with the Kinsler equation. Therefore, low intensity ultrasound emerges as a potential technique to monitor, in a non destructive way, the meat salting processes carried out in the food industry.
Evaluation of direct saponification method for determination of cholesterol in meats.
Adams, M L; Sullivan, D M; Smith, R L; Richter, E F
1986-01-01
A gas chromatographic (GC) method has been developed for determination of cholesterol in meats. The method involves ethanolic KOH saponification of the sample material, homogeneous-phase toluene extraction of the unsaponifiables, derivatization of cholesterol to its trimethylsilylether, and quantitation by GC-flame ionization detection using 5-alpha-cholestane as internal standard. This direct saponification method is compared with the current AOAC official method for determination of cholesterol in 20 different meat products. The direct saponification method eliminates the need for initial lipid extraction, thus offering a 30% savings in labor, and requires fewer solvents than the AOAC method. It produced comparable or slightly higher cholesterol results than the AOAC method in all meat samples examined. Precision, determined by assaying a turkey meat sample 16 times over 4 days, was excellent (CV = 1.74%). Average recovery of cholesterol added to meat samples was 99.8%.
Mamani-Linares, L W; Gallo, C; Alomar, D
2012-02-01
Visible and near infrared reflectance spectroscopy (VIS-NIRS) was used to discriminate meat and meat juices from three livestock species. In a first trial, samples of Longissimus lumborum muscle, corresponding to beef (31) llamas (21) and horses (27), were homogenised and their spectra collected in reflectance (NIRSystems 6500 scanning monochromator, in the range of 400-2500 nm). In the second trial, samples of meat juice (same muscle) from the same species (20 beef, 19 llama and 19 horse) were scanned in folded transmission (transflectance). Discriminating models (PLS regression) were developed against "dummy" variables, testing different mathematical treatments of the spectra. Best models indentified the species of almost all samples by their meat (reflectance) or meat juice (transflectance) spectra. A few (three of beef and one of llama, for meat samples; one of beef and one of horse, for juice samples) were classified as uncertain. It is concluded that NIRS is an effective tool to recognise meat and meat juice from beef, llama and horses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Damez, Jean-Louis; Clerjon, Sylvie
2013-12-01
The meat industry needs reliable meat quality information throughout the production process in order to guarantee high-quality meat products for consumers. Besides laboratory researches, food scientists often try to adapt their tools to industrial conditions and easy handling devices useable on-line and in slaughterhouses already exist. This paper overviews the recently developed approaches and latest research efforts related to assessing the quality of different meat products by electromagnetic waves and examines the potential for their deployment. The main meat quality traits that can be assessed using electromagnetic waves are sensory characteristics, chemical composition, physicochemical properties, health-protecting properties, nutritional characteristics and safety. A wide range of techniques, from low frequency, high frequency impedance measurement, microwaves, NMR, IR and UV light, to X-ray interaction, involves a wide range of physical interactions between the electromagnetic wave and the sample. Some of these techniques are now in a period of transition between experimental and applied utilization and several sensors and instruments are reviewed. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sampers, Imca; Jacxsens, Liesbeth; Luning, Pieternel A; Marcelis, Willem J; Dumoulin, Ann; Uyttendaele, Mieke
2010-08-01
A diagnostic instrument comprising a combined assessment of core control and assurance activities and a microbial assessment instrument were used to measure the performance of current food safety management systems (FSMSs) of two poultry meat preparation companies. The high risk status of the company's contextual factors, i.e., starting from raw materials (poultry carcasses) with possible high numbers and prevalence of pathogens such as Campylobacter spp., requires advanced core control and assurance activities in the FSMS to guarantee food safety. The level of the core FSMS activities differed between the companies, and this difference was reflected in overall microbial quality (mesophilic aerobic count), presence of hygiene indicators (Enterobacteriaceae, Staphylococcus aureus, and Escherichia coli), and contamination with pathogens such as Salmonella, Listeria monocytogenes, and Campylobacter spp. The food safety output expressed as a microbial safety profile was related to the variability in the prevalence and contamination levels of Campylobacter spp. in poultry meat preparations found in a Belgian nationwide study. Although a poultry meat processing company could have an advanced FSMS in place and a good microbial profile (i.e., lower prevalence of pathogens, lower microbial numbers, and less variability in microbial contamination), these positive factors might not guarantee pathogen-free products. Contamination could be attributed to the inability to apply effective interventions to reduce or eliminate pathogens in the production chain of (raw) poultry meat preparations.
Kenawi M.A.; Abdelsalam R.R.; El-Sherif S.A.
2009-01-01
The chemical, physical, and sensory evaluation of buffalo meat patties was evaluated in order to study the effect of adding low fat soy flour and/or mung bean powder as meat extenders. The results indicated that using low fat soy flour or mung bean powder as meat extenders at a level of 10% reduced the moisture and fat content, whereas increased the fiber and protein contents in the cooked samples. The reduction was greatest in the control (100% buffalo meat), and lowest in the sample contain...
Turner, K E; Cassida, K A; Zerby, H N
2014-12-01
This experiment was conducted in 2005-2007 to evaluate carcass and chevon (goat meat) quality parameters when meat-goat kids (n=72) were finished on alfalfa (Medicago sativa L; ALF); red clover (Trifolium pratense L.; RCG); or orchardgrass (Dactylis glomerata L.; OGR) pastures. Carcass conformation score was greater (P=0.08) when meat-goat kids were finished on ALF compared to OGR with RCG intermediate. Chevon meat samples from goats finished on the three pasture treatments did not differ in ash, intramuscular fat, or crude protein content or in concentrations of omega6 and omega3 fatty acids, or the omega6 to omega3 ratio. Goats finished on OGR had higher (Pmeat-goat kids finished on ALF, RCG, or ORG produced desirable carcass weights for most niche markets in the USA. Chevon is a low-fat meat option with high desirable fatty acids for human diets. Published by Elsevier Ltd.
Martín, B; Corominas, L; Garriga, M; Aymerich, T
2009-01-01
Four local small-scale factories were studied to determine the sources of enterococci in traditional fermented sausages. Different points during the production of a traditional fermented sausage type (fuet) were evaluated. Randomly amplified polymorphic DNA (RAPD)-PCR was used to type 596 Enterococcus isolates from the final products, the initial meat batter, the casing, the workers' hands and the equipment. Species-specific PCR-multiplex and the partial sequencing of atpA gene and 16S rRNA gene sequencing allowed the identification of the isolates: Enterococcus faecalis (31.4%), Enterococcus faecium (30.7%), Enterococcus sanguinicola (14.9%), Enterococcus devriesei (9.7%), Enterococcus malodoratus (7.2%), Enterococcus gilvus (1.0%), Enterococcus gallinarum (1.3%), Enterococcus casseliflavus (3.4%), Enterococcus hermanniensis (0.2%), and Enterococcus durans (0.2%). A total of 92 different RAPD-PCR profiles were distributed among the different factories and samples evaluated. Most of the genotypes found in fuet samples were traced back to their source. The major sources of enterococci in the traditional fermented sausages studied were mainly the equipment followed by the raw ingredients, although a low proportion was traced back to human origin. This work contributes to determine the source of enterococcal contamination in fermented sausages and also to the knowledge of the meat environment.
RESEARCH ON CONSUMER BEHAVIOUR ON BUCHAREST MEAT MARKET
Directory of Open Access Journals (Sweden)
Agatha POPESCU
2013-01-01
Full Text Available The paper aimed to analyze consumer behavior for meat on Bucharest market, using a sample of 100 individuals, representatives as age, sex and profession, who were interviewed within a structured questionaire based survey on their preference to buy and consume meat. The answers were processed using the semantic differential and Likert Scale. The obtained results pointed out that white meat is the top preference, because it is healthier and its price is more acceptable compared to red meat. However, men prefer red meat, no matter its price. The most prefered meat sorts in order of their importance are chicken meat, pork and beef. Consumers prefer to buy 1-2 kg fresh meat from supermarket every 2-3 days. Income/family and meat pice are the major factors limiting the amount of consumed meat and buying frequence. The term of availability and meat origin have become more and more important criteria on which buying decision is based, besides meat quality. All consumers prefer to consume Romanian meat which is tasty and has a pleasant flavor. As a conclusion, consumers expectations from meat producers are related to a large variety of meat of a higher quality. Also, presentation form in packed portionated meat parts on the shelf as wellas hygiene come on the next positions from consumers side in order to satisfy their needs better.
Preliminary Studies on the Development of Meat Balls | Igene ...
African Journals Online (AJOL)
The UUFB sample was rated highest in terms of overall likeness and may economically complement some of the existing popular meat-based snacks in Nigeria. The significance of the study is discussed. @JASEM Keyterms: Meat, Meat ball, Quality, Product development. J. Appl. Sci. Environ. Manage. June, 2012, Vol.
Irradiation and additive combinations on the pathogen reduction and quality of poultry meat.
Ahn, Dong U; Kim, Il Suk; Lee, Eun Joo
2013-02-01
Reduction of foodborne illnesses and deaths by improving the safety of poultry products is one of the priority areas in the United States, and developing and implementing effective food processing technologies can be very effective to accomplish that goal. Irradiation is an effective processing technology for eliminating pathogens in poultry meat. Addition of antimicrobial agents during processing can be another approach to control pathogens in poultry products. However, the adoption of irradiation technology by the meat industry is limited because of quality and health concerns about irradiated meat products. Irradiation produces a characteristic aroma as well as alters meat flavor and color that significantly affect consumer acceptance. The generation of a pink color in cooked poultry and off-odor in poultry by irradiation is a critical issue because consumers associate the presence of a pink color in cooked poultry breast meat as contaminated or undercooked, and off-odor in raw meat and off-flavor in cooked meat with undesirable chemical reactions. As a result, the meat industry has difficulties in using irradiation to achieve its food safety benefits. Antimicrobials such as sodium lactate, sodium diacetate, and potassium benzoate are extensively used to extend the shelf-life and ensure the safety of meat products. However, the use of these antimicrobial agents alone cannot guarantee the safety of poultry products. It is known that some of the herbs, spices, and antimicrobials commonly used in meat processing can have synergistic effects with irradiation in controlling pathogens in meat. Also, the addition of spices or herbs in irradiated meat improves the quality of irradiated poultry by reducing lipid oxidation and production of off-odor volatiles or masking off-flavor. Therefore, combinations of irradiation with these additives can accomplish better pathogen reduction in meat products than using them alone even at lower levels of antimicrobials/herbs and
Kim, Min Geun; Alçiçek, Zayde; Balaban, Murat O; Atar, Hasan Huseyin
2014-04-01
Aquacultured green lipped mussel (Perna canaliculus) is the New Zealand export leader of seafood in terms of weight. Different treatments shrink mussel meat differently and affect the consumer perception of half-shelled mussels. In order to quantify this, digital images of half-shelled green lipped mussels subjected to two postharvest treatments (ultrahigh pressure (UHP) and heat treatment (HT)) and raw controls were taken. The ratio of the view area of the meat to that of the shell (labelled as 'visual condition index' (VCI)) was measured using image analysis. A polygonal region of interest was defined on the image to depict the boundary of the meat and to calculate the view area. Raw mussels had a VCI of 85%. HT mussels had a much reduced VCI of 41%, indicating shrinkage of the meat due to heat. UHP treatment used as a shucking method resulted in a VCI of 83%. Since VCI is one measure of quality for the consumer, this quantitative method can be used in the optimization of shucking treatment (HT or UHP). VCI can be used to optimize postharvest treatments to minimize meat shrinkage. This method can also be applied to other shellfish such as oysters and clams. © 2013 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Meat waste as feedstock for home composting: Effects on the process and quality of compost.
Storino, Francesco; Arizmendiarrieta, Joseba S; Irigoyen, Ignacio; Muro, Julio; Aparicio-Tejo, Pedro M
2016-10-01
Home composting is a powerful tool, which is spreading in different parts of the world, to reduce the generation of municipal waste. However, there is debate concerning the appropriateness, in terms of domestic hygiene and safety, of keeping a composter bin in the household deputed to kitchen waste of animal origin, such as meat or fish scraps and pet droppings. The purpose of our work was to study how the addition of meat scraps to household waste influences the composting process and the quality of the final compost obtained. We compared four raw material mixtures, characterized by a different combination of vegetable and meat waste and different ratios of woody bulking agent. Changes in temperature, mass and volume, phenotypic microbial diversity (by Biolog™) and organic matter humification were determined during the process. At the end of the experiment, the four composts were weighed and characterized by physicochemical analysis. In addition, the presence of viable weed seeds was investigated and a germination bioassay was carried out to determine the level of phytotoxicity. Finally, the levels of pathogens (Escherichia coli and Salmonella spp.) were also determined in the final compost. Here we show that the presence of meat waste as raw feedstock for composting in bins can improve the activity of the process, the physicochemical characteristics and maturity of the compost obtained, without significantly affecting its salinity, pH and phytotoxicity. Pathogen levels were low, showing that they can be controlled by an intensive management and proper handling of the composter bins. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ralph Kuehn
2006-12-01
Full Text Available Recent studies suggest that Asiatic wild asses ( Equus hemionus are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse ( Equus caballus and wild ass meat, we developed a restriction fragment length polymorphism (RFLP assay based on the polymerase chain reaction (PCR. We ampli fi ed and sequenced a cytochrome b fragment (335 bp and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey ( Equus asinus and the Przewalski’s horse ( Equus ferus przewalskii . We detected a species-speci fi c restriction site (AatII for the Asiatic wild ass, resulting in a speci fi c restriction fragment length polymorphism (RFLP band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season.
AL-HIJAZEEN, Marwan
2017-01-01
Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1) control (no additive); (2) 100 ppm oregano essential oil (OE); (3) 150 ppm OE; (4) 300 ppm L-ascorbic acid (E-300); (5) 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320) for both breast and thigh meat respectively, and 6) 150 ppm Sodium nitrite (E-250), wer...
Game meat authentication through rare earth elements fingerprinting
International Nuclear Information System (INIS)
Danezis, G.P.; Pappas, A.C.; Zoidis, E.; Papadomichelakis, G.; Hadjigeorgiou, I.; Zhang, P.; Brusic, V.; Georgiou, C.A.
2017-01-01
Accurate labelling of meat (e.g. wild versus farmed, geographical and genetic origin, organic versus conventional, processing treatment) is important to inform the consumers about the products they buy. Meat and meat products declared as game have higher commercial value making them target to fraudulent labelling practices and replacement with non-game meat. We have developed and validated a new method for authentication of wild rabbit meat using elemental metabolomics approach. Elemental analysis was performed using rapid ultra-trace multi-element measurement by inductively coupled plasma mass spectrometry (ICP-MS). Elemental signatures showed excellent ability to discriminate the wild rabbit from non-wild rabbit meat. Our results demonstrate the usefulness of metabolic markers -rare earth signatures, as well as other trace element signatures for game meat authentication. - Highlights: • Elemental metabolomics is a powerful new methodology for authentication of game rabbit meat. • New method for meat authentication utilizing rare earths elemental signatures. • Samples are compared to group signatures using angular and Euclidean distances. • Meat reference materials (>70 elements) can be used for cross-comparison between studies.
Directory of Open Access Journals (Sweden)
L. V. Antipova
2016-01-01
Full Text Available One of the important technological trends in food production, balanced on the chemical and amino acid composition is the development of methods for enrichment product protein, vitamins and minerals. The solution to this problem has long been used a method of enrichment of vegetable raw materials to create a nutrient and healthy products available to different social groups. In theory justified the choice of research object – lentils, which have a number of advantages in food systems. Analyzed method of increasing the biological value of the object in the process of germination grains and marked improvement the balance of amino acid composition. Designed meat pate with using germination grains and investigated its main functional-technological (FTC, organoleptic properties and digestibility. In determining, the functional-technological characteristics revealed an increase in FTC-indicators, such as water binding, water holding, fat holding, and emulsifying ability when you add germination lentils. According to the results of organoleptic evaluation revealed improvement in the consistency of meat pate, when replacing 50% of raw meat, germination lentils, and in appearance, color, smell and taste, control and test products are almost identical. The digestibility of the paste was 97%. Proposed different options of using germination grains of lentils to create a products for public and preventive nutrition.
Comparative evaluation of quality and composition of ostrich, turkey and broiler meat
Jukna V.; Klementavičiūtė J.; Meškinytė-Kaušilienė E.; Pečiulaitienė N.; Samborskytė M.; Ambrasūnas L.
2012-01-01
In this article are presented research data on comparative evaluation of meat quality of various poultry species. The study was made on 5 samples of ostrich, turkey and broiler meat. Samples were weighed 500 to 550 grams. Qualitative and nutritional properties of meat from different species of poultry were estimated. The chemical composition, pH, color, firmness, water holding capacity, cooking loss, drip loss of ostrich, turkey and broiler meat were analyz...
Pourkhalili, Azin; Mirlohi, Maryam; Rahimi, Ebrahim
2013-01-01
Lamb meat is regarded as an important source of highly bioavailable iron (heme iron) in the Iranians diet. The main objective of this study is to evaluate the effect of traditional cooking methods on the iron changes in lamb meat. Four published experimental methods for the determination of heme iron were assessed analytically and statistically. Samples were selected from lambs' loin. Standard methods (AOAC) were used for proximate analysis. For measuring heme iron, the results of four experimental methods were compared regarding their compliance to Ferrozine method which was used for the determination of nonheme iron. Among three cooking methods, the lowest total iron and heme iron were found in boiling method. The heme iron proportions to the total iron in raw, boiled lamb meat and grilled, were counted as 65.70%, 67.75%, and 76.01%, receptively. Measuring the heme iron, the comparison of the methods in use showed that the method in which heme extraction solution was composed of 90% acetone, 18% water, and 2% hydrochloric acid was more appropriate and more correlated with the heme iron content calculated by the difference between total iron and nonheme iron.
Directory of Open Access Journals (Sweden)
Azin Pourkhalili
2013-01-01
Full Text Available Lamb meat is regarded as an important source of highly bioavailable iron (heme iron in the Iranians diet. The main objective of this study is to evaluate the effect of traditional cooking methods on the iron changes in lamb meat. Four published experimental methods for the determination of heme iron were assessed analytically and statistically. Samples were selected from lambs' loin. Standard methods (AOAC were used for proximate analysis. For measuring heme iron, the results of four experimental methods were compared regarding their compliance to Ferrozine method which was used for the determination of nonheme iron. Among three cooking methods, the lowest total iron and heme iron were found in boiling method. The heme iron proportions to the total iron in raw, boiled lamb meat and grilled, were counted as 65.70%, 67.75%, and 76.01%, receptively. Measuring the heme iron, the comparison of the methods in use showed that the method in which heme extraction solution was composed of 90% acetone, 18% water, and 2% hydrochloric acid was more appropriate and more correlated with the heme iron content calculated by the difference between total iron and nonheme iron.
Directory of Open Access Journals (Sweden)
CB de Lima
2015-12-01
Full Text Available ABSTRACT An experiment was conducted to evaluate the addition of the oil resins ofsucupira (Pterodon emarginatus Vog. and copaiba (Copaifera langsdorffii to broiler diets on chicken meat composition, quality, and lipid peroxidation. 350 one-d-old broiler chicks were submitted to seven treatments, consisting of the diets supplemented with copaiba (COP or sucupira (SUC resin oils at three different concentrations (500, 900, and 1300 ppm plus a negative control diet (CONT. At 37 days of age, 10 birds per treatment were selected according to the average weight of the experimental unit and slaughtered to collect breast and thigh meat, which was stored at 4°C for 24 hours to evaluate pH, color (L*, a*, b*, cooking weight loss (CWL, and shear force (SF. Raw meat was vacuum packed and stored frozen until lipid peroxidation analysis. Meat samples were pooled to prepare pre-cooked meatballs (30 ± 0.5g, stored under refrigeration (eight days, and analyzed every two days for TBARS concentration. Results were analyzed using the PROC GLM and MIXED procedures (SAS statistical software. Plant oils increased (p<0.05 breast meat humidity (HU and crude protein (CP levels and reduced (p<0.05 total lipid (TLC and ash (AS levels when compared with the CONT treatment. Plant oils increased (p<0.05 thigh meat HU when compared with the CONT. High COP dietary levels reduced (p<0.05 breast meat CWL, and increased (p<0.05 thigh meat L* values when compared to CONT, except for SUC500 and SUC900. The dietary inclusion of plant oil resins showed a pro-oxidant effect (p<0.01 on breast meat when compared with the CONT. Low SUC dietary supplementation levels significantly reduced (p<0.01 the concentration of secondary oxidation products in thigh meat.
Effects of meat addition on pasta structure, nutrition and in vitro digestibility.
Liu, Tingting; Hamid, Nazimah; Kantono, Kevin; Pereira, Loveena; Farouk, Mustafa M; Knowles, Scott O
2016-12-15
In our study, semolina flour was substituted with beef emulsion (EM) at three different levels of 15, 30 and 45% (w/w) to develop a pasta with enhanced nutritional profile. The protein, fat, and water content significantly increased with addition of meat. The addition of meat enhanced the pasta gluten network. The redness and yellowness of cooked pasta increased with meat addition. Tensile strength increased from 0.018N/mm(2) in the control sample to 0.046N/mm(2) in 45% beef emulsion (45EM) sample. All meat-containing samples had significantly higher elasticity than control (0.039N/mm(2)). GI significantly decreased and IVPD value increased in 45EM sample. Five essential amino acids (leucine, lysine, methionine, threonine, tryptophan) in pasta digesta increased significantly with increasing meat addition. Copyright © 2016 Elsevier Ltd. All rights reserved.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Czech Foreign Trade with Meat and Meat Products
Directory of Open Access Journals (Sweden)
Karina Pohlová
2016-04-01
Full Text Available The meat production and meat processing industry are the most important parts of the agribusiness in the Czech Republic. The problem of the industry is its low competitiveness towards foreign producers and processors which results in negative balance of foreign trade. The aim of the article is to evaluate long-term development of value and structure of Czech foreign trade flows of meat and meat products. The analysis covers the period of 2001–2014. The problems of the negative trade balance are revealed through description of the trade flows of meat and meat products, the RCA index and relations between import and export prices. The analysis points out the problems of low competitiveness of the intermediate and finalized meat. Alternatively, Czech Republic has comparative advantage in live animals, sausages and homogenized meat products.
Minerals Concentration and Textural Properties of Romanian Beef Row and Cooked Meat and Offal
Directory of Open Access Journals (Sweden)
Liliana Tudoreanu
2013-11-01
Full Text Available Introduction: Consumers preferences for solid food are, for the majority of foods groups, influenced by their textural properties. Romanian traditional cuisine is rich in meat foods and therefore this food group has an important contribution to the total mineral intake as well as the ingestion of potentially toxic metals such as Cd and Pb. Although beef liver is an important source of minerals for human consumption, its concentrations in Cd and Pb and heterogeneous textural properties may hinder its acceptability. Aims: The purpose of the work was to estimate raw and cooked beef meat and offal mineral quality including Cd and Pb concentrations and their contribution to a balanced human diet and health as well as the influenced of thermal preparation on their mineral and textural properties. Materials and methods: Beef liver, kidney and longissimus dorsi muscle were bought from local markets. Thermal preparation was conducted by microwave and boiling with no water contact. Texture profile analyses was conducted for quantifying textural properties such as Hardness, Cohesiveness, Springiness, Springiness Index, Chewiness, Adhesiveness and Stiffness. The mineral concentrations of the raw and cooked samples were analyzed by ICP-MS. Conclusion: The offal textural parameters variability was very large within the same organ and compared to the muscle textural parameters variability too. Muscle and offal thermal preparation strongly influenced their minerals’ concentrations as well as their textural properties. Thermal preparation significantly decreased beef liver and kidney samples’ total K and Na concentrations. It is suggested that for improving beef liver acceptability, the consumer has to be advised on the influence of the thermal preparation on beef liver parts’ textural properties as well as minerals concentrations.
Consumer sensory and hedonic perception of sheep meat coppa under blind and informed conditions.
de Andrade, Juliana Cunha; Nalério, Elen Silveira; Giongo, Citieli; de Barcellos, Marcia Dutra; Ares, Gastón; Deliza, Rosires
2018-03-01
The development of air-dried cured sheep meat products represents an interesting option to add value to the meat of adult animals. In this context, the aim of the present study was to evaluate consumer sensory and hedonic perception of sheep meat coppa, an innovative product. Four sheep meat coppa samples were formulated by varying smoking (smoked vs. non-smoked) and salt content (4.5% vs. 3.4%), and compared with two commercial samples of regular pork meat coppa. Samples were evaluated under blind or informed conditions by 202 consumers, who had to rate their liking and to answer a check-all-that-apply question. Sheep and pork meat coppa samples did not largely differ in their overall liking in both experimental conditions. Smoking and high salt content significantly increased consumers' hedonic perception of sheep meat coppa. The information included in the labels did not modify consumer hedonic perception but influenced their sensory description, particularly for the terms related to the type of meat used in their manufacture. Results indicate positive market opportunities for sheep meat coppa in the Brazilian market. Copyright © 2017 Elsevier Ltd. All rights reserved.
Goudarzi, Nasser
2009-02-11
A simple, low cost and highly sensitive method based on solvent microextraction (SME) for separation/preconcentration and flame atomic absorption spectrometry (FAAS) was proposed for the determination of ultratrace amounts of cadmium in meat and fish samples. The analytical procedure involved the formation of a hydrophobic complex by mixing the analyte solution with an ammonium pyrrolidinedithiocarbamate (APDC) solution. In suitable conditions, the complex of cadmium-APDC entered the micro organic phase, and thus, separation of the analyte from the matrix was achieved. Under optimal chemical and instrumental conditions, a detection limit (3 sigma) of 0.8 ng L(-1) and an enrichment factor of 93 were achieved. The relative standard deviation for the method was found to be 2.2% for Cd. The interference effects of some anions and cations were also investigated. The developed method has been applied to the determination of trace Cd in meat and fish samples.
Liu, Sophie F; Petty, Alexander R; Sazama, Graham T; Swager, Timothy M
2015-05-26
Chemiresistive detectors for amine vapors were made from single-walled carbon nanotubes by noncovalent modification with cobalt meso-arylporphyrin complexes. We show that through changes in the oxidation state of the metal, the electron-withdrawing character of the porphyrinato ligand, and the counteranion, the magnitude of the chemiresistive response to ammonia could be improved. The devices exhibited sub-ppm sensitivity and high selectivity toward amines as well as good stability to air, moisture, and time. The application of these chemiresistors in the detection of various biogenic amines (i.e. putrescine, cadaverine) and in the monitoring of spoilage in raw meat and fish samples (chicken, pork, salmon, cod) over several days was also demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Luo, Jiaqiang; Taylor, Cheryl; Nebl, Thomas; Ng, Ken; Bennett, Louise E
2018-07-15
Animal and aquatic meats represent important sources of dietary protein and micro-nutrients. Although red and processed meats carry some risks for human health, sensory and nutritional advantages drive meat consumption. Therefore, it is important to understand how meat processing and cooking influence healthiness. The research aim was to investigate relationships of meat composition (proximates, amino acids and minerals) and cooking conditions (raw, 90 s microwave, 200 °C oven for 10 or 30 min) on protein digestibility, for a selection of four animal (beef, chicken, pork, kangaroo) and four aquatic meats (salmon, trout, prawn, oyster). Lean meats were minced before cooking followed by in vitro gastro-intestinal digestion and analysed for progress of hydrolysis, and size ranges of peptides using MALDI-TOF-MS. Correlation matrix analysis between compositional and functional parameters indicated that digestibility was significantly linked with protein and metal concentrations, likely reflecting moisture-dependent solubility and inter-mixing of sarcoplasmic metallo-proteins and insoluble myofibrillar proteins. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke
2014-01-01
This study presents a novel non-destructive X-ray technique for analyzing meat emulsions before and after heat treatment. The method is based on X-ray grating-interferometry where three complementary imaging modalities are obtained simultaneously measuring the absorption, refraction and scatterin...
Xing, Tong; Zhao, Xue; Han, Minyi; Cai, Linlin; Deng, Shaolin; Zhou, Guanghong; Xu, Xinglian
2017-09-01
The selection of broilers for augmented growth rate and breast has brought about wooden-breast (WB) muscle abnormalities, which caused substantial economic losses. The objective of this study was to compare water holding capacity, water mobility and distribution, salt-soluble protein (SSP) content, and protein profiles of normal and WB chicken meat with different additions of NaCl. Thirty WB and 30 normal chicken breasts were selected from a deboning line of a major Chinese processing plant at 2 to 3 h post mortem. Two different meat batters were formulated to 150 mg/g meat protein and different NaCl contents (0%, 1%, 2%, 3%, and 4%). Results indicated that as NaCl contents increased, the cooking loss of meat batters decreased (P meat showed different protein profiles, with myosin heavy chain exhibiting a higher intensity at ≥3% salt level. Low-field nuclear magnetic resonance (LF-NMR)revealed an increased T22 and higher P22 in raw WB meat compared to normal meat (P meat batters, WB meat batters had reduced T21 and lower immobilized water proportions at low NaCl contents (meat gels. Meat gels prepared from WB had a lower proportion of water within the myofibrillar protein matrix and a greater proportion of exuded bulk water at NaCl contents meat, meat batters and gels, water distribution and mobility of WB exhibited significant differences compared to normal meat. The addition of NaCl affected water mobility and distributions in meat batters, with a level of 3% NaCl eliminating the differences between processed normal and WB meat products. © 2017 Poultry Science Association Inc.
Directory of Open Access Journals (Sweden)
Bayu Kanetro
2013-06-01
Full Text Available The aims of this research were to determine the best of local legume sprout as raw material of meat analog, based on its texture, sensory (preference properties, and the ratio of arginine/lysine, compared to meat analog from soybean. Meat analogs were made of protein of local legumes sprout, which were velvet beans, cowpeas, and winged beans that had been germinated for 48, 36 and 24 hr respectively. The protein of velvet beans, cowpeas, and winged beans sprout for meat analog production were extracted at pH 9 and precipitated at pH 4, 5, and 5 respectively. Hence their products were analyzed the texture, the sensory properties (the hedonic scales of color, texture, odor, taste, and overall, and the ratio of arginine/lysine. The characteristics of meat analog from the legumes sprout were compared to meat analog from soybean for determination of the best legume sprout as raw material of meat analog. The result of this research showed the properties of meat analog from winged bean and cowpeas sprouts were better than velvet beans sprout. The meat analog from soybean was still better than meat analog from the local legumes sprout, especially its texture. The arginine content, that was known as hypocholesterolemic and hypoglycemic component, of meat analog from cowpeas sprout was lower than meat analog from soybean, but its ratio of arginie/lysine was not signifi cantly different. While the ratio of arginine/lysine of meat analog from the other legumes sprout were lower than meat analog from soybean. Therefore the meat analog from cowpeas sprout was chosen as the best product and was potential as functional food especially for reducing blood cholesterol. Keywords: Meat analog, sprout, local legumes, arginine/lysine ratio ABSTRAK Tujuan penelitian ini adalah untuk menentukan jenis kecambah kacang-kacangan lokal terbaik sebagai bahan baku kedelai berdasarkan tekstur, sifat sensoris, dan rasio arginin/lisin dibandingkan meat analog dari biji
Energy Technology Data Exchange (ETDEWEB)
Brito, Poliana de Paula
2012-07-01
The Mechanically Deboned chicken meat (MDCM) is used in traditional meat products, in greater proportion in those emulsified, replacing meat raw materials more expensive. The raw material can have high MDCM the microbial load, as a result of contamination during processing or failure during the evisceration. The irradiation process is accepted as one of the most effective technologies when compared to conventional techniques of preservation, to reduce contamination of pathogens and spoilage. However, little information is available about the use and effects of different dose rates of ionizing radiation processing. Irradiation causes chemical changes in food, a major cause of deterioration of quality of raw or cooked meat products during refrigerated storage, frozen. The objective of this study was to evaluate the effects of different dose rates of ionizing radiation on the production of Thiobarbituric Acid Reactive Substances (TBARS), color, microbiological and sensory characteristics of mechanically deboned chicken added or without added antioxidants, during the cold storage and evaluation of functional properties. The results showed that among the tested dose rates using cobalt-60 source, dose rate of 4.04 kGy.h-1 was the best for processing MDCM. Furthermore, the use of the combination of rosemary antioxidant and α-tocopherol were able to reduce lipid oxidation generated by irradiation of the samples, showed a synergistic effect to the processing with ionizing radiation in reduction of psychrotrophic bacteria count and contributed to a better sensory quality. The use of radiation in the processing FDMI did not adversely affect the functional properties studied. (author)
Effectiveness of radiation processing in elimination of Campylobacter from poultry meat
International Nuclear Information System (INIS)
Raut, Amol D.; Shashidhar, Ravindranath; Bandekar, Jayant R.; Kapadnis, Balu P.
2012-01-01
Campylobacter, a common poultry intestine commensal, is a well known cause of human gastric illnesses across the globe. Consumption of contaminated poultry meat is a major cause of Campylobacter related infections. In the present study, radiation sensitivity of indigenous strains of C. jejuni and C. coli isolated from poultry was evaluated. The decimal reduction dose (D 10 ) values of different Campylobacter isolates at 0-4 o C in saline and blood broth were in the range of 0.120-0.210 kGy and 0.170-0.234 kGy, respectively. D 10 values in chicken meat homogenate for Campylobacter were in the range of 0.110-0.190 kGy. Chicken meat samples were inoculated with C. jejuni and exposed to gamma radiation to study the effectiveness of radiation treatment in elimination of Campylobacter. Radiation treatment with a dose of 1 kGy could achieve complete elimination of 10 5 CFU of Campylobacter/g in poultry meat samples. No recovery of Campylobacter was observed, even after enrichment and selective plating in 1 kGy treated chicken meat samples stored at 4 o C up to 7 days. Present study shows that irradiation of poultry meat with 1 kGy can ensure safety of poultry meat. - Highlights: → Campylobacter isolates were sensitive to gamma radiation. → Low dose of 1 kGy is effective for 5-log reduction of Campylobacter in chicken meat. → No recovery of Campylobacter in radiation processed samples during storage. → First report on radiation sensitivity of Indian Campylobacter isolates.
Effectiveness of radiation processing in elimination of Campylobacter from poultry meat
Energy Technology Data Exchange (ETDEWEB)
Raut, Amol D. [Department of Microbiology, University of Pune, Pune, Ganeshkhind 411007 (India); Shashidhar, Ravindranath [Food Technology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Bandekar, Jayant R., E-mail: jrb@barc.gov.in [Food Technology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kapadnis, Balu P. [Department of Microbiology, University of Pune, Pune, Ganeshkhind 411007 (India)
2012-01-15
Campylobacter, a common poultry intestine commensal, is a well known cause of human gastric illnesses across the globe. Consumption of contaminated poultry meat is a major cause of Campylobacter related infections. In the present study, radiation sensitivity of indigenous strains of C. jejuni and C. coli isolated from poultry was evaluated. The decimal reduction dose (D{sub 10}) values of different Campylobacter isolates at 0-4 {sup o}C in saline and blood broth were in the range of 0.120-0.210 kGy and 0.170-0.234 kGy, respectively. D{sub 10} values in chicken meat homogenate for Campylobacter were in the range of 0.110-0.190 kGy. Chicken meat samples were inoculated with C. jejuni and exposed to gamma radiation to study the effectiveness of radiation treatment in elimination of Campylobacter. Radiation treatment with a dose of 1 kGy could achieve complete elimination of 10{sup 5} CFU of Campylobacter/g in poultry meat samples. No recovery of Campylobacter was observed, even after enrichment and selective plating in 1 kGy treated chicken meat samples stored at 4 {sup o}C up to 7 days. Present study shows that irradiation of poultry meat with 1 kGy can ensure safety of poultry meat. - Highlights: > Campylobacter isolates were sensitive to gamma radiation. > Low dose of 1 kGy is effective for 5-log reduction of Campylobacter in chicken meat. > No recovery of Campylobacter in radiation processed samples during storage. > First report on radiation sensitivity of Indian Campylobacter isolates.
Hoek, Annet C; Luning, Pieternel A; Stafleu, Annette; de Graaf, Cees
2004-06-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food Consumption Survey, 1997/1998. Vegetarians (n = 63) and consumers of meat substitutes (n = 39) had similar socio-demographic profiles: higher education levels, higher social economic status, smaller households, and more urbanised residential areas, compared to meat consumers (n = 4313). Attitudes to food were assessed by the food-related lifestyle instrument. We found that vegetarians (n = 32) had more positive attitudes towards importance of product information, speciality shops, health, novelty, ecological products, social event, and social relationships than meat consumers (n = 1638). The health consciousness scale, which was used to assess attitudes to health, supported earlier findings that vegetarians are more occupied by health. Food-related lifestyle and health attitudes of meat substitute consumers (n = 17) were predominantly in-between those from vegetarians and meat consumers. The outcome of this study suggests that in strategies to promote meat substitutes for non-vegetarian consumers, the focus should not only be on health and ecological aspects of foods.
Directory of Open Access Journals (Sweden)
Tina Trebušak
2015-09-01
Full Text Available The aim of our study was to determine the changes in the fatty acid composition of rabbit meat, if palm fat (99% of saturated fatty acids (SFA, as a source of fat in rabbit diet, was replaced with linseed oil (71% of polyunsaturated fatty acids (PUFA, containing 52% of α-linolenic acid (n-3 PUFA. The Ganoderma lucidum or olive leaves were added in the diet as potential antioxidant in order to protect the PUFA against oxidation. 48 SIKA rabbits were randomly divided by mass and gender in four groups: CONT- 6% palm fat, CONT+ 6% linseed oil, REISHI 6% linseed oil and 1% Ganoderma lucidum, OLIVE 6% linseed oil and 1% olive leaves. After 22 days of the experimental procedure, the samples of back muscle were taken and divided in 7 portions. One was for fatty acid determination, other six for malondialdehyde (MDA determination after different storage condition; fresh, 6 days at 4°C or 3 months at -20°C, raw or cooked (60 minutes, 85°C. Addition of linseed oil resulted in a significant higher proportion of PUFA (n-3 PUFA and monounsaturated fatty acid (MUFA and lower proportion of SFA in the back muscle, but the oxidative stability of meat was reduced, since the level of MDA was significantly higher. After cooking, the level of MDA increased in all the groups, but more in the groups with linseed oil in the diet, the addition of Ganoderma lucidum or olive leaves slightly decreased the level of MDA, but the difference was not significant.
Energy Technology Data Exchange (ETDEWEB)
Cho, Yong Woo; Han, Man Jung; Cho, Seong Won; Cho, Hong Jun; Oh, Hyeon Kyun; Lee, Jeong Min; Chang, Jae Sook [KORTIC, Taejon (Korea, Republic of)
2001-12-15
12 kind of environmental samples such as soil, underground water, seawater, etc. around the Nuclear Power Plants(NPP) and surface seawater around the Korea peninsula were sampled, For the samples of rain, pine-needle, air, seawater, underground water, chinese cabbage, grain of rice and milk sampled around NPP, and surface seawater and rain sampled all around country, tritium concentration was measured, The tritium concentration in the tap water and the gamma activity in the domestic and imported beef that were sampled at ward in the large city in Korea(Seoul, Pusan, Taegu, Taejun, Inchun, Kwangju) were analyzed for the meat and drinking waters. As the results of analyzing, tritium concentration in rain and tap water were very low all around country, but a little higher around the NPP than general surrounding. At the Wolsung NPP, tritium concentration was descend according to distance from the stack. Tritium activity of surface seawater around the Korea peninsula was also, very low. The measured radioactive elements in the beef is the same as the radioactive elements on the earth surface.
Directory of Open Access Journals (Sweden)
João Pessoa de Paula Carvalho
1980-09-01
Full Text Available Com objetivo de evidenciar a freqüência e os níveis de resíduos de praguiddas organoclorados, foram analisadas 445 unidades amostrais de matéria prima (gordura bovina provenientes de carcaças de bovinos de frigoríficos e 132 unidades amostrais de carne bovina já processada (enlatados, tais como "corned beef" e "roast beef". Apresentaram-se com resíduos de praguicidas acima dos limites de tolerância estipulados, 77 unidades amostrais de gordura bovina e 5 de produto processado. Resíduos de praguiddas, sem contudo ultrapassar os limites de tolerância, foram identificados em, praticamente, todas as amostras, sendo que 27% das unidades amostrais de gordura bovina e 10,6% de produto processado apresentaram resíduos de praguicidas em violação aos limites estabelecidos na legislação. Heptacloro, BHC e Dieldrin foram os praguiddas mais freqüentes e Lindane e DDT os menos evidenciados.To bring attention to the frequency and the levels of organochlorine pesticide residue in meat, 445 samples of raw material (bovine fat from bovine carcasses collected from meat packing plants and 132 samples of preserved meat (canned, such as corned or roast beef were analyzed. Seventy-seven samples of bovine fat and 8 of preserved meat were discovered to have pesticide residue above the maximum acceptable limits. Pesticide residue was found in practically all the samples without, however, exceeding the acceptable limits. Twenty-seven percent of the bovine fat samples and 10.6% of the preserved meat contained residue above the legal tolerance levels. Heptachlor, BHC, and Dieldrin were the most frequent; Lindane and DDT, the least.
DEFF Research Database (Denmark)
Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.
2017-01-01
Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...
An investigation of the quality of meat sold in Lesotho
Directory of Open Access Journals (Sweden)
T.M. Seeiso
2009-05-01
Full Text Available Since the closure of the Lesotho abattoir in 2003, only imported meat can be legally sold. However, it was estimated in 2007 that 80 % of the meat sold at butcheries comes from informal slaughter. The aim of this study was to investigate the situation. The number and location of informal butcheries in Lesotho (n = 143 were recorded and mapped using Geographical Information Systems. Observations (photographs of informal slaughter indicated a lack of hygiene, unskilled slaughtermen and illegal disposal of offal with possible environmental pollution. In addition, a cross-sectional study was undertaken to determine the microbiological quality of meat from randomly selected carcasses (n = 237 of cattle, sheep and pigs from a sample of 44 butcheries, 4 of which were associated with registered supermarkets. As a control, samples for microbiological assay were taken from imported meat originating from carcasses (n = 20 slaughtered at a registered abattoir in South Africa. Of the 44 butcheries investigated only the 4 commercial butcheries associated with supermarkets sold imported meat only; 3 butcheries sold meat inspected at government slaughter slabs (n = 3, while the rest (n = 37 sold both imported and informally slaughtered meat. In terms of Lesotho legislation, informally slaughtered meat is only for home consumption. The bacteriological counts from all samples showed a total bacterial plate count exceeding 30 organisms per mℓ in contrast with the controls which all showed a count less than 5 colonies per mℓ. This was found for both imported and informally slaughtered meat sold in Lesotho. In addition, meat samples from butcheries showed the presence of the potential pathogens Salmonella (n = 2, Staphylococcus aureus (n = 12 and Escherichia coli (n=15. During the study, anthrax was confirmed in 9 human patients, 5 of whom died, after consumption of informally slaughtered livestock. Although no cases of animal abuse were detected, it was
Effect of some factors used to the chicken meat preservation and processing on the protease activity
International Nuclear Information System (INIS)
Przysiezna, E.; Skrabka-Blotnicka, T.
1996-01-01
The obtained results indicated that the cathepsin activity was higher by about 60% in the extract from thigh than from breast muscles. Freezing and defrosting (not stored) of chicken meat did not influence the breast muscle cathepsin activity while they caused a decrease of activity of about 20% in the case of thigh muscles. The increase in cathepsin activity was noticed in both kinds of muscles during storage at -20 °C up to 4 months (45.6% and 19.4% for thigh and breast muscles respectively). The activity of cathepsin in extract from 5 months stored meat reached 80% in case of breast muscles and 83% in case of thigh muscles in relation to control sample respectively. The cathepsin activity significantly increased during heating of breast muscles up to 60 °C, but in case of thigh muscles it was slightly higher than at 50°C. The heating of cured chicken breast muscles up to 60°C caused a non significant growth in cathepsin activity opposite to raw muscles. The cathepsin activity from all cured samples heated up to 70°C were several times lower in relation to control samples. The cathepsin activity of both thigh and breast muscles were resistant to gamma radiation. The investigated factors caused changes in the activity of cathepsin but none of them caused its total inactivation. The changes of cathepsin activity depended on the kind of muscles and the kind and the value of acting factors
International Nuclear Information System (INIS)
Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor
2012-01-01
We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)
Immunofluorescent determination of wheat protein in meat products
Directory of Open Access Journals (Sweden)
Michaela Petrášová
2014-02-01
Full Text Available In food industry nowadays, there are various plant-origin protein additives which are meant for production of meat products. Among the most frequent additives of this type there are different kinds of flour, starch, fiber, and plant-origin proteins. Their usage at present is limited by the existing legislation not to prevent consumer deception but also for reasons of possible influence on consumer health. Therefore, this problem is paid a lot of attention not only in the Czech Republic but also all over the world. The main risk is seen in the impossibility to choose a suitable foodstuff for an individual prone to allergic reactions. Potential allergens are also often plant-origin raw materials which are added into foodstuffs for their technological qualities and low price. Wheat is widely cultivated cereal as well as an important source of proteins. After ingestion or inhalation, wheat proteins may cause adverse reactions. These adverse effects include a wide range of disorders which are dependent on the method of contact with wheat protein. These adverse effects can then take the form of various clinical manifestations, such as celiac disease, T-cell mediated inflammatory bowel disease, dermatitis, skin rash, breathing difficulties, allergy to pollen or to wheat flour or food allergy to foodstuffs containing gluten. The only possible protection against adverse immune reactions for those with food allergies is strictly excluding the allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. In order to avoid misleading consumers and also to protect allergic consumers, analytical methods applicable to all types of foodstuffs have been developed. Unfortunately, detection of allergens in
Directory of Open Access Journals (Sweden)
C. Latha
2017-08-01
Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.
Detection of Yersinia enterocolitica in Retail Chicken Meat, Mashhad, Iran
Directory of Open Access Journals (Sweden)
Khadigeh Sirghani
2018-01-01
Full Text Available Poultry meat is one of the most important sources of infection of Yersinia spp. for humans. The aim of the present study was to evaluate the incidence of Yersinia enterocolitica in chicken meat by using culture method on selective medium and confirmation by PCR assay. Also, biochemical methods were used for biotyping. A total of 100 chicken thigh meat samples were collected randomly from retail outlets in Mashhad, Iran. Samples were enriched in Peptone-Sorbitol-Bile (PSB broth and then cultured on Cefsulodin-Irgasan-Novobiocin (CIN agar containing antibiotics supplement. The DNA was extracted from suspected colonies of Yersinia spp. and then PCR test using specific primers for 16S rRNA gene of Yersinia enterocolitica was performed. In this study, 30% of chicken meat was contaminated with Yersinia spp. by culture method and 25% of chicken meat was contaminated with Yersinia enterocolitica. Biotyping of isolated colonies showed that all of the isolates belonged to biotype 1A. Culture and detection of Yersinia spp. from food samples traditionally take 4 days. Due to high accuracy and speed of PCR assay, it is a good alternative method for microbiological techniques. In conclusion, poultry meat can act as a source of Y. enterocolitica and could be considered as a public health hazard.
Meat and meat product preservation by ionizing radiation
International Nuclear Information System (INIS)
Egginger, R.
A brief summary is given of experience with the preservation of meat and meat products by ionizing radiation, or by combined methods. The results of the research have proved that hygienically significant microorganisms (mainly salmonellas) are reliably destroyed and that the consumption of thus irradiated meat and meat products presents no danger to human health. (B.S.)
Lipid stability in meat and meat products.
Morrissey, P A; Sheehy, P J; Galvin, K; Kerry, J P; Buckley, D J
1998-01-01
Lipid oxidation is one of the main factors limiting the quality and acceptability of meats and meat products. Oxidative damage to lipids occurs in the living animal because of an imbalance between the production of reactive oxygen species and the animal's defence mechanisms. This may be brought about by a high intake of oxidized lipids or poly-unsaturated fatty acids, or a low intake of nutrients involved in the antioxidant defence system. Damage to lipids may be accentuated in the immediate post-slaughter period and, in particular, during handling, processing, storage and cooking. In recent years, pressure to reduce artificial additive use in foods has led to attempts to increase meat stability by dietary strategies. These include supplementation of animal diets with vitamin E, ascorbic acid, or carotenoids, or withdrawal of trace mineral supplements. Dietary vitamin E supplementation reduces lipid and myoglobin oxidation, and, in certain situations, drip losses in meats. However, vitamin C supplementation appears to have little, if any, beneficial effects on meat stability. The effect of feeding higher levels of carotenoids on meat stability requires further study. Some studies have demonstrated that reducing the iron and copper content of feeds improves meat stability. Post-slaughter carnosine addition may be an effective means of improving lipid stability in processed meats, perhaps in combination with dietary vitamin E supplementation.
Use Of Irradiation To Extend The Shelf Life Of Meat Luncheon And Ensure Its Microbiological Safety
International Nuclear Information System (INIS)
Hammad, A. A. I.; Zahran, D.; Attalla, S.
2004-01-01
The microbiological quality of meat luncheon sold in retail market at Cairo was evaluated E. coli was found in all tested samples (25 samples), Staphylococcus aureus was found in 23 (92%) samples, Salmonella was detected in only 2 (8%) samples, Aeromonas hydrophila was detected in only 1 (4%) samples. Listeria monocytogenes was not detected in any sample. According to the Egyptian standards, meat luncheon should be free from the above pathogens. Thus, only 2 (8%) samples of examined meat luncheon were accepted from the view point of microbiological quality. Irradiation at different dose levels used (1.5, 3.0, 5.0 kGy) greatly reduced all microbial counts, hence extended the shelf-life of meat luncheon at 4 deg. C ± 1 to 2, 3 and 4 weeks, respectively, against only 1 week of the unirradiated samples. Only meat luncheon samples irradiated at 5.0 kGy were free from all tested pathogens indicating that this irradiation dose was very effective in insuring microbial safety of meat luncheon. (Authors)
Prevalence of Clostridium difficile in uncooked ground meat products from Pittsburgh, Pennsylvania.
Curry, Scott R; Marsh, Jane W; Schlackman, Jessica L; Harrison, Lee H
2012-06-01
The prevalence of Clostridium difficile in retail meat samples has varied widely. The food supply may be a source for C. difficile infections. A total of 102 ground meat and sausage samples from 3 grocers in Pittsburgh, PA, were cultured for C. difficile. Brand A pork sausages were resampled between May 2011 and January 2012. Two out of 102 (2.0%) meat products initially sampled were positive for C. difficile; both were pork sausage from brand A from the same processing facility (facility A). On subsequent sampling of brand A products, 10/19 samples from processing facility A and 1/10 samples from 3 other facilities were positive for C. difficile. The isolates recovered were inferred ribotype 078, comprising 6 genotypes. The prevalence of C. difficile in retail meat may not be as high as previously reported in North America. When contamination occurs, it may be related to events at processing facilities.
Legacy, Jim; And Others
This publication provides an introduction to meat processing for adult students in vocational and technical education programs. Organized in four chapters, the booklet provides a brief overview of the meat processing industry and the techniques of meat processing and butchering. The first chapter introduces the meat processing industry and…
Replacement of Pork Meat with Pork Head Meat for Frankfurters
Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei
2016-01-01
The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (ppork head meat was increased from 0% to 20%, cooking loss, total expressible fluid separation, fat separation, and pH of frankfurters were increased, while the lightness, redness, yellowness, and apparent viscosity of frankfurters were decreased. Ash contents, cohesiveness, color, and tenderness of sensory characteristics of frankfurters added with different amounts of pork meat or pork head meat were not significantly (p>0.05) different from those of the control or there treatments. Frankfurters in T4 (frankfurter with 30% pork meat + 20% pork head) had the lowest (p0.05) from that in the control. Frankfurters with higher pork head meat concentrations had lower flavor, juiciness, and overall acceptability scores. Therefore, replacing pork meat with pork head meat in the formulation could successfully produce results similar to those of control frankfurters. The best results were obtained when 10% pork head meat was used to replace pork meat. PMID:27621683
Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk
Directory of Open Access Journals (Sweden)
Milan Vasiľ
2016-12-01
Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics. Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.
Rymer, Caroline; Givens, D Ian
2010-08-15
Enriching poultry meat with long-chain n-3 polyunsaturated fatty acids (LC n-3 PUFA) can increase low population intakes of LC n-3 PUFA, but fishy taints can spoil reheated meat. This experiment determined the effect of different amounts of LC n-3 PUFA and vitamin E in the broiler diet on the fatty acid composition and sensory characteristics of the breast meat. Ross 308 broilers (120) were randomly allocated to one of five treatments from 21 to 42 days of age. Diets contained (g kg(-1)) 0, 9 or 18 LC n-3 PUFA (0LC, 9LC, 18LC), and 100, 150 or 200 mg LD-alpha-tocopherol acetate kg(-1) (E). The five diets were 0LC100E, 9LC100E, 18LC100E, 18LC150E, 18LC200E, with four pens per diet, except 18LC100E (eight pens). Breast meat was analysed for fatty acids (uncooked) and sensory analysis by R-index (reheated). LC n-3 PUFA content (mg kg(-1) meat) was 514 (0LC100E) and 2236 (9LC and 18LC). Compared with 0LC100E, meat from 18LC100E and 18LC150E tasted significantly different, while 23% of panellists detected fishy taints in 9LC100E and 18LC200E. Chicken meat can be enriched with nutritionally meaningful amounts of LC n-3 PUFA, but > 100 mg dl-alpha-tocopherol acetate kg(-1) broiler diet is needed to protect reheated meat from oxidative deterioration. Copyright (c) 2010 Society of Chemical Industry.
UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN
Rimal, Arbindra; Fletcher, Stanley M.
2003-01-01
This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.
A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-05-01
Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.
Development of Sausages Containing Mechanically Deboned Chicken Meat Hydrolysates.
Jin, S K; Choi, J S; Choi, Y J; Lee, S J; Lee, S Y; Hur, S J
2015-07-01
Pork meat sausages were prepared using protein hydrolysates from mechanically deboned chicken meat (MDCM). In terms of the color, compared to the controls before and after storage, the redness (a*) was significantly higher in sausages containing MDCM hydrolysates, ascorbate, and sodium erythorbate. After storage, compared to the other sausage samples, the yellowness (b*) was lower in the sausages containing ascorbate and sodium erythorbate. TBARS was not significantly different among the sausage samples before storage, whereas TBARS and DPPH radical scavenging activities were significantly higher in the sausagescontainingascorbate and sodium erythorbate, compared to the other sausage samples after 4 wk of storage. In terms of sensory evaluation, the color was significantly higher in the sausages containing MDCM hydrolysates, ascorbate, and sodium erythorbate, compared to the other sausage samples after 4 wk of storage. The "off-flavor" and overall acceptability were significantly lower in the sausages containing MDCM hydrolysates than in the other sausage samples. In most of the developed countries, meat from spent laying hens is not consumed, leading toan urgent need for effectively utilization or disposal methods. In this study, sausages were prepared using spent laying hens and protein hydrolysates from mechanically deboned chicken meat. Sausage can be made by spent laying hens hydrolysates, although overall acceptability was lower than those of other sausage samples. © 2015 Institute of Food Technologists®
Occurrence of nitrate, nitrite and volatile nitrosamines in certain feedstuffs and animal products.
Ologhobo, A D; Adegede, H I; Maduagiwu, E N
1996-01-01
Nitrate, nitrite and nitrosamines were analysed in poultry feeds, meat and eggs. The poultry meat was boiled and roasted while the eggs were raw and boiled, and the effects of these processing treatments on the level of these compounds were investigated. Nitrate levels in the meat samples were significantly (P Nitrite levels were also reduced significantly by processing (P Nitrite levels were generally low in all feed samples. Nitrosamines were not detected in any of the feed samples and in the meat samples except in two samples of boiled meat which contained 0.001 g/kg each.
Color compensation in nitrite-reduced meat batters incorporating paprika or tomato paste.
Bázan-Lugo, Eduardo; García-Martínez, Ignacio; Alfaro-Rodríguez, Rosa Hayde; Totosaus, Alfonso
2012-06-01
Nitrite is a key ingredient the manufacture of meat products, forming a stable pink color characteristic of cured products, retarding the development of rancidity and off-odors and flavors during storage, and preventing microbial growth. The negative aspects of nitrite and the demands for healthy foods result in the need to reduce nitrite in cured meat products. Paprika or tomato has been employed as natural pigments in meat products. The objective of this work was to determine the effect of incorporating paprika powder or tomato paste on the texture, rancidity and instrumental and sensory color compensation in nitrite-reduced meat batters. Addition of tomato paste improved moisture content, resulting in harder but less cohesive samples as compared to control and paprika-containing meat batters. Color characteristics of reduced nitrite samples obtained higher a* red coloration (8.9 for paprika and 7.7-8.0 for tomato paste), as compared to control samples (5.65). Instrumental color was low in control samples, with high values for tomato paste and paprika samples. Nonetheless, tomato paste used to compensate color in nitrite-reduced meat batters was ranked closer to the control sample in sensory evaluation. Color characteristics-instrumental and sensory-in these kinds of meat products were enhanced by the addition of 2.5-3.0% of tomato paste, presenting results close to the non-reduced nitrite control. Similarly, antioxidant components of tomato paste or paprika reduced lipid oxidation. Nitrite reduction from 150 to 100 ppm could be achieved employing tomato paste as a natural pigment to improve color and texture. Copyright © 2011 Society of Chemical Industry.
Electrical impedance spectroscopy (EIS), as an effective analytical technique for electrochemical system, has shown a wide application for food quality and safety assessment recently. Individual differences of livestock cause high variation in quality of raw meat and fish and their commercialized pr...
MICROBIOLOGY OF RAW MATERIALS USED FOR CONFECTIONARY PRODUCTION
Directory of Open Access Journals (Sweden)
Jana Petrová
2015-02-01
Full Text Available The aim of our study was to evaluate the microbiological quality of raw materials used for preparation of confectionery products. For microbiological evaluation total count of bacteria, mesophilic aerobic bacteria, coliform bacteria, yeast and microscopic filamentous fungi in samples of raw materials used in the manufacture and creams of confectionery products were detected. In addition to these groups of microorganisms the presence of pathogenic microorganisms Salmonella spp. and Staphylococcus aureus in creams was monitored. Products are assessed according to the limit values of the number of microorganisms defined in the Codex Alimentary of the Slovak Republic. For microbiological analysis of confectionery products, sampling of components of confectionary products and cream was carried out according to current health regulations and altogether 65 samples of components and creams were collected: 10 samples of raw materials sugar, 10 samples of flour, 10 samples of butter and 10 samples of eggs, 5 samples of butter yolk from cream-filled disposable bag without rum addition, 5 samples of butter yolk from cream-filled disposable bag with rum addition, 5 samples of cream-filled multiple use paid bag, 5 samples of cream-filled newly purchased paid bag, 5 samples of Venček corpus and 5 samples of the French cubes corpus. From raw material the highest TBC (2.65log CFU was in flour, but the lowest in sugar (1.35 log CFU, the highest years counts was found on flour (2.42, but lowest in butter (1.18, while wasn’t in egg. In samples of creams and corpus were increased occurrence of yeast, coliform bacteria. Salmonella spp. and Staphylococcus aureus weren’t isolated from any tested sample.
Caffeine Extraction from Raw and Roasted Coffee Beans.
Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh
2018-04-01
Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.
The Hypertrophic Marchigiana: physical and biochemical parameters for meat quality evaluation
Directory of Open Access Journals (Sweden)
F. M. Sarti
2010-04-01
Full Text Available The aim of this study was to evaluate the meat quality of double muscled Marchigiana young bulls characterized by different genotypes for the hypertrophy: normal and mutated (heterozygous. Calpain and calpastatin activities were determined to verify the state of aging meat on a sample of Longissimus thoracis muscle (XIII thoracic rib taken at slaughtering (0h and after 24 hours (24h. After 14 days of aging, another sample of muscle was taken to evaluate physical and chemical parameters of meat quality. The results showed a better meat quality of mutated animals respect normal animals. Another interesting result was the correlation between the biochemical parameters and some physical parameters, such as WBS (Warner Bratzler Shear Force, CL (Cooking loss. These results showed the relationship between the proteolytic activity of calpain system and meat tenderness.
Directory of Open Access Journals (Sweden)
I. A. Glotova
2017-01-01
Full Text Available In the technology of traditional and new forms of food, the modification of structure of proteins is carry out in two opposite directions: the hydrolytic destruction of high-molecular polymers and the artificial creation of polymeric structures of high molecular mass. The transglutaminase preparations (protein-glutamine (-glutamyltransferase, EC 2.3.2.13, TG are used in practical work for realization of the second direction. The main mechanisms of action are polymerization reactions, which lead to a change in the hydrophobicity of protein molecules. The main catalyzed reactions are acyl transfer, binding between glutamine and lysine residues of proteins and deamination. The authors analyzed the approaches to the preparation, properties and studied the joint effect of temperature and pH on the activity of the commercial preparation Revada TG 11 with the application of an enzymatic colorimetric test. The authors studied combined stuffing systems based on beef, pork, poultry mechanical deboning, as well as replacing part of the raw material with protein-carbohydrate compositions with Revada TG 11. The results were used to develop simulated meat systems of biopolymer compositions (SMSBC, approximate in structure and properties to the gels formed by actin and myosin during extraction from myofibrils under the traditional technological processes of meat products production - maturation, salt curing, fine meat grinding. SMSBC includes lupine flour bio-activated by germination, a preparations of dietary fiber as well as a preparation of transglutaminase Revada TG 11. The protein components of the secondary raw materials during the processing of milk such as sodium caseinate, and also whey were used to balance the amino acid composition of the food systems. For practical use, the following options for SMSBC introducing into the composition of minced meat emulsions were recommended by the authors: in the form of hydrated biopolymer dispersion at cutting
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Impact of Culture on Meat and Related Food Preferences in Akwa ...
African Journals Online (AJOL)
The effectiveness of meat and related food products marketing in Akwa Ibom State is conditioned by the specifics of culture. In this study, cultural effect on meat consumption is examined. A sample of 568 respondents were analysed with OLS regression. The results reveal that meat consumption and preferences for related ...
Directory of Open Access Journals (Sweden)
Kamelia Mahmoud Osman
2016-11-01
Full Text Available The use of antibiotics in farm management (growing crops and raising animals has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mecA and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA, methicillin-resistant S. aureus (MRSA, methicillin-resistant coagulase-negative staphylococci (MRCNS and methicillin-susceptible coagulase-negative staphylococci (MSCNS isolated from the retail trade of ready-to-eat raw chicken meat samples collected during one year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim and vancomycin and their endorsement of the quinolone resistance determining region, mecA and cfr genes. The isolation results revealed 50 isolates, CPS (14 and CNS (36, representing ten species (S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius and S. lentus. Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mecA gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides and streptogramin B (MLS(B in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone
Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S; Moussa, Ihab M I; Hessain, Ashgan M; Girah, Zeinab M S Amin; Abo-Shama, Usama H; Orabi, Ahmed; Saad, Aalaa
2016-01-01
The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mec A and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), methicillin-resistant coagulase-negative staphylococci (MRCNS) and methicillin-susceptible coagulase-negative staphylococci (MSCNS) isolated from the retail trade of ready-to-eat raw chicken meat samples collected during 1 year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim, and vancomycin) and their endorsement of the quinolone resistance determining region, mec A and cfr genes. The isolation results revealed 50 isolates, CPS (14) and CNS (36), representing ten species ( S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius , and S. lentus ). Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mec A gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides, and streptogramin B [MLS( B )] in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone
Meat and meat products as a source of bioactive peptides
Directory of Open Access Journals (Sweden)
Alfonso Totosaus
2016-12-01
Full Text Available Meat is a high protein content food, with great nutritional and biological value. Meat protein hydrolysis begins with the muscle to meat conversion, during meat ageing. After slaughter, endogen enzymes are responsible of meat softening since myofibrillar anchorage proteins are degraded. Protein hydrolysis continues during food preparation. When meat reaches the stomach, pepsin is the first enzyme to interact. As the food travel trough out gastrointestinal tract, pancreatic enzymes degraded the remained protein and the peptidases made the final proteolysis process. The small proteins or peptides are the absorbed to the circulatory system and distributed to the rest of the body. Bioactive peptides activity of meat and meat products is anti-hypertensive mainly, where histidine, carnosine and anserine are the main peptides identified. Another peptide with anti-oxidant activity is glutathione. The content depends on animal species.
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Sensory evaluation of meat colour using photographs
Directory of Open Access Journals (Sweden)
Gianluigi Destefanis
2010-01-01
Full Text Available Five m. longissimus thoracis steaks from different breeds, purchased at retail, were cut into samples and simultaneously photographed under standard shooting conditions. The first photo was taken on samples just arrived at the laboratory, the second one on a freshly cut surface after blooming. Two consumer panels evaluated beef colour using respectively photo 1 and photo 2. Each consumer was asked to rank samples in order of preference. Rank sums were evaluated with Fridman’s test. Immediately after taking the photos, colour was measured with a colorimeter. Regarding photo 1, consumers were able to discriminate one sample, the worst, from all the others. Concerning photo 2, consumers discriminated the worst sample, as in photo 1, but also the best one. Therefore a more accurate colour evaluation can be obtained if the assessment is carried out on a fresh cut surface after blooming. In general consumers preferred samples with high lightness and a relatively high yellowness. The sensory evaluation of meat colour using photographs is a promising tool to overcome the difficulties when the meat is directly evaluated. But it is very important to standardize the shooting conditions to obtain a true reproduction of the meat. For this purpose the use of a colour target is useful to check the validity of the adopted parameters.
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
19 CFR 151.22 - Estimated duties on raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...
Directory of Open Access Journals (Sweden)
Alena Lorencova
2016-06-01
Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.
Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.
Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander
2016-01-01
Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.
Harada, Seiya; Furukawa, Masato; Tokuoka, Eisuke; Matsumoto, Kazutoshi; Yahiro, Shunsuke; Miyasaka, Jiro; Saito, Morihiro; Kamata, Yoichi; Watanabe, Maiko; Irikura, Daisuke; Matsumoto, Hiroshi; Sugita-Konishi, Yoshiko
2013-01-01
More than 27 outbreaks per year of food poisoning caused by consuming horse meat were reported in Kumamoto Prefecture (including Kumamoto City) from January 2009 to September 2011. It was found that the causative agent of the outbreaks was a protein with a molecular weight of 15 kDa that had originated from bradyzoites of Sarcocystis fayeri parasitizing the horse meat. Rabit ileal loop tests showed that pepsin treatment of homogenates of frozen horse meat containing the cysts of S. fayeri induced loss of toxicity, presumably by digestion of the proteinous causative agent(s). Slices of horse meat containing the cysts were frozen at below -20°C for various periods. The cysts were collected after thawing the slices, then treated in an artificial stomach juice containing pepsin. The bradyzoites of the cysts kept at -20°C for 48 hr or more completely disappeared. Simultaneously, the 15 kDa protein also disappeared in the frozen cysts. After notifying the public and recommending freezing treatment of horse meat, no subsequent cases of food poisoning were reported. This indicates that freezing of horse meat is effective to prevent the occurrence of food poisoning caused by consuming raw horse meat containing S. fayeri.
Meat quality characteristics of exotic and SPRD crossbred goats from the semiarid region
Directory of Open Access Journals (Sweden)
Ertha Janine Lacerda de Medeiros
2012-12-01
Full Text Available Thirty-two intact male goats from four genetic groups (eight pure-bred Boers, eight ¾ Boer + ¼ SPRD crossbreeds, eight ½ Boer + ½ SPRD crossbreeds, and eight ½ Anglo Nubian + ½ SPRD crossbreeds were evaluated for meat quality. The goats were reared in confinement and slaughtered at the average live weight of 29 kg. Temperature and pH decrease in the longissimus dorsi muscle was determined for 24 hours, and analyses of colour, cooking loss, water-holding capacity, and sensory attributes were also performed. Genotype significantly (P < 0.05 influenced the confinement period; ½ Boer + ½ SPRD crossbreeds required the most time in confinement to reach the target weight, while the pure-bred Boers required the least time. Genotype also significantly influenced (P < 0.05 the weight loss due to cooking, shearing force, colour (intensity of yellowness and luminescence, and the sensory attributes of flavour, odour, and raw colour of the meat. The crossing of exotic Boer and Anglo Nubian breeds with the native SPRD resulted in a goat meat of high quality.
THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET
Silvius STANCIU; Nicoleta STANCIUC; Loredana DUMITRASCU; Roxana ION; Costel NISTOR
2013-01-01
Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appea...
Essential and toxic elements in meat of wild birds.
Roselli, Carla; Desideri, Donatella; Meli, Maria Assunta; Fagiolino, Ivan; Feduzi, Laura
2016-01-01
Essential and toxic elements were determined by inductively coupled plasma-atomic emission spectrometry (ICP-AES), mass spectrometry (MS), and atomic absorption (AS) in meat of 14 migratory birds originating from central and northern Europe to provide baseline data regarding game meat consumed in central Italy. In all samples analyzed, cobalt (Co) and chromium (Cr) (total) levels were meat. These findings indicate that elevated Pb concentrations in game ingested by humans may be a cause for concern.
Heterocyclic amines in meat and meat products
Directory of Open Access Journals (Sweden)
Aliye BULGAN
2013-06-01
Full Text Available Heterocyclic amines (HA are the mutagenic/carcinogenic compounds which generate as a result of cooking of red meat, poultry meat and fish fillets at high temperatures. Up to 20 different HAs were detected and classified in the researches that conducted on these types of meats cooked at high temperatures. HAs are the products of Maillard reactions and the Strecker degredation of main precursors such as creatine/creatinine, aminoacid and the polysaccharides. Many physical and chemical factors effect the formation of HAs. Thus, it was reported by many researchers that utilizing coating and marination processes in addition to using natural and synthetic antioxidants and seasonings-plant extracts were effective on inhibiting/decreasing the formation of HAs. Additionally, boiling/steaming and microwave cooking methodologies were recommended instead of barbecuing, grilling or frying to inhibit/decrease the formation of HAs. The HAs formed in meat and meat products and the factors which have effects on the formation of HAs are presented in this review.
Effect of microbial cell-free meat extract on the growth of spoilage bacteria.
Nychas, G-J E; Dourou, D; Skandamis, P; Koutsoumanis, K; Baranyi, J; Sofos, J
2009-12-01
This study examined the effect of microbial cell-free meat extract (CFME) derived from spoiled meat, in which quorum sensing (QS) compounds were present, on the growth kinetics (lag phase, and growth rate) of two spoilage bacteria, Pseudomonas fluorescens and Serratia marcescens. Aliquots of CFME from spoiled meat were transferred to Brain Heart Infusion broth inoculated with 10(3) CFU ml(-1) of 18 h cultures of Ps. fluorescens or Ser. marcescens, both fresh meat isolates; CFME derived from unspoiled fresh meat ('clean' meat) served as a control. Changes in impedance measurements were monitored for 48 h, and the detection time (Tdet) was recorded. It was found that in the absence of CFME containing QS compounds the Tdet was shorter (P meat. The rate of growth of Ps. fluorescens, recorded as the maximum slope rate of conductance changes (MSrCC), after Tdet, was higher (P meat. Similar results in MSrCC of impedance changes were obtained for Ser. marcescens. The study indicated that the growth rate (expressed in MSrCC units) of meat spoilage bacteria in vitro was enhanced in samples supplemented with CFME containing QS compounds compared to control samples (i.e., without CFME or with CFME from 'clean' meat). This behaviour may explain the dominant role of these two bacteria in the spoilage of meat. These results illustrate the potential effect of signalling compounds released during storage of meat on the behaviour of meat spoilage bacteria. Understanding such interactions may assist in the control of fresh meat quality and the extension of its shelf life.
Serdaroğlu, M.; Nacak, B.; Karabıyıkoğlu, M.; Tepe, M.; Baykara, I.; Kökmen, Y.
2017-09-01
In this study, the effects of adding pumpkin seed oil (PSO) in water emulsion to model system chicken meat emulsions (MSME) on product quality and oxidative stability were investigated. MSME were produced by replacing 25% (P25) and 50% (P50) of beef fat with PSO-in-water emulsion (PSO/W) while control treatment was prepared with only beef fat. Addition of PSO/W to the formulation resulted in significant differences in chemical composition and pH values of both raw and cooked MSME treatments. The use of PSO/W produced significant improvements to emulsion stability, oxidative stability and cooking yield of MSME. It was determined that the use of PSO/W formulation results in decreased total expressible fluid values and increased cooking yields of the emulsions. It was observed that the highest cooking yield and the lowest total expressible fluid were found in the sample containing 50% PSO/W. It should be a feasible strategy to produce fat-reduced meat products with healthier lipid profiles by using PSO/W.
Buffière, Caroline; Gaudichon, Claire; Hafnaoui, Noureddine; Migné, Carole; Scislowsky, Valérie; Khodorova, Nadezda; Mosoni, Laurent; Blot, Adeline; Boirie, Yves; Dardevet, Dominique; Santé-Lhoutellier, Véronique; Rémond, Didier
2017-11-01
Background: Meat cooking conditions in in vitro and in vivo models have been shown to influence the rate of protein digestion, which is known to affect postprandial protein metabolism in the elderly. Objective: The present study was conducted to demonstrate the effect of cooking conditions on meat protein assimilation in the elderly. We used a single-meal protocol to assess the meat protein absorption rate and estimate postprandial meat protein utilization in elderly subjects. Design: The study recruited 10 elderly volunteers aged 70-82 y. Each received, on 2 separate occasions, a test meal exclusively composed of intrinsically 15 N-labeled bovine meat (30 g protein), cooked at 55°C for 5 min [rare meat (RM)] or at 90°C for 30 min [fully cooked meat (FCM)], and minced. Whole-body fluxes of leucine, before and after the meal, were determined with the use of a [1- 13 C]leucine intravenous infusion. Meat protein absorption was recorded with the use of 15 N enrichment of amino acids. Results: Postprandial time course observations showed a lower concentration in the plasma of indispensable amino acids ( P meat leucine in the plasma ( P meat nitrogen to plasma amino acid nitrogen ( P meat amino acids with RM than with FCM. This was associated with decreased postprandial whole-body protein synthesis with RM than with FCM (40% compared with 56% of leucine intake, respectively; P meat cooking conditions have little effect on postprandial protein utilization in young adults, the present work showed that the bioavailability and assimilation of meat amino acids in the elderly is lower when meat is poorly cooked. In view to preventing sarcopenia, elderly subjects should be advised to favor the consumption of well-cooked meat. This trial was registered at clinicaltrials.gov as NCT02157805. © 2017 American Society for Nutrition.
Lahou, Evy; Wang, Xiang; De Boeck, Elien; Verguldt, Elien; Geeraerd, Annemie; Devlieghere, Frank; Uyttendaele, Mieke
2015-08-03
In order to evaluate the effect of simulated home pan frying of raw meat and meat preparations of different animal species on the thermal inactivation of pathogens, the heat resistance (D-value) of three strains of Campylobacter jejuni, Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes and two strains of generic E. coli was validated in BHI and adjusted BHI (i.e. pH5.6 and 1.5% NaCl) at 60°C. The D-values were obtained of the linear phase of the survivor curves created in GInaFiT, a freeware tool to fit models to experimental data. The obtained D-values corresponded to those previously published in literature and confirmed L. monocytogenes to be the most heat resistant pathogen among them. Heat treatment in adjusted BHI significantly increased heat-resistance of E. coli O157:H7 and generic E. coli. Subsequently, the thermal inactivation of L. monocytogenes, Salmonella spp., C. jejuni and E. coli O157:H7 was evaluated using a standardized procedure simulating commonly used home pan frying of various types of meat including steaks or filets, hamburgers and meat strips from various animal species such as pork, beef, chicken, lamb and some turkey, horse, kangaroo and crocodile meat. Corresponding F70-values were calculated based upon measured core time/temperature profiles. It was noted that a core temperature of 70 °C was not always achieved and, moreover, a heat treatment equivalent to 2 min at 70 °C was also not always obtained. This was in particular noted in hamburgers although the meat was visually judged well done. On several occasions, residual survivors of the initial inoculated (4 logCFU/g) food borne pathogens could be recovered either by enumeration (limit of detection 1 logCFU/g) or by the presence/absence testing per 25 g. Pan frying of hamburgers yielded the highest number of surviving pathogenic bacteria (46%), followed by well-done filets and steaks (13%) and meat strips (12%). Taking only steaks (beef, horse, kangaroo, crocodile and
Elemental composition of game meat from Austria.
Ertl, Kathrin; Kitzer, Roland; Goessler, Walter
2016-06-01
Concentrations of 26 elements (B, Na, Mg, P, S, K, Ca, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Rb, Sr, Mo, Cd, Sb, Ba, Hg, Pb, U) in wild game meat from Austria were analysed using an inductively coupled plasma mass spectrometer. All investigated animals were culled during the hunting season 2012/2013, including 10 chamois (Rupicapra rupicapra), 9 hare (Lepus europaeus), 10 pheasant (Phasianus colchicus), 10 red deer (Cervus elaphus), 12 roe deer (Capreolus capreolus) and 10 wild boar (Sus scrofa). In 19 out of 61 meat samples lead concentrations were higher than 0.1 mg/kg, the maximum limit in meat as set by the European Commission (Regulation EC No 1881/2006), which is most likely caused by ammunition residues. Especially, pellet shot animals and chamois show a high risk for lead contamination. Despite ammunition residues all investigated muscle samples show no further health risk with respect to metal contamination.
Combined Methods for Improvement of the Safety of Minced Chicken Meat
International Nuclear Information System (INIS)
Dyankova, S.; Dyakova, A.; Miteva, D.; Ivanova, S.; Garbacheva, M.
2010-01-01
It was established that extracts of oregano, rosemary, marjoram and thyme incorporated in ground chicken meat in concentrations 0,005 g/g and 0,010 g/g inhibit the natural meat microflora during refrigerated storage for a period of 72 hours. In case of combining of two extract types a strongly expressed antibacterial effect on the microorganisms was observed. Best results showed the combination of oregano and thyme. After 3 days of storage the total number of microorganisms in those samples was 4,48 log units lower than in control samples stored under the same conditions. The effect of applying of gamma irradiation with 2 kGy dose of the chicken ground meat microflora, independently and in combination with a marjoram extract, was studied as well. The results showed a reduction by 7 lg of the total number of microorganisms in the irradiated ground meat and a presence of synergetic antibacterial effect in samples treated with marjoram extract and gamma irradiation
PAH in Barbecued Meat from Restaurants and by Home-Grilling in Denmark
DEFF Research Database (Denmark)
Duedahl-Olesen, Lene; Meinert, L.; Aaslyng, M.
2011-01-01
Barbecuing or grilling is known to result in the formation of polycyclic aromatic hydrocarbons (PAH). Thirty home-grilled meat samples (beef, pork and chicken) and 86 commercial grilled meat samples (beef, pork, chicken, salmon, lamb and calf) were analyzed for 23 PAH including PAH 4 (benzo[a]pyr...
Analytical Method for Differentiation of Chilled and Frozen-Thawed Chicken Meat
Directory of Open Access Journals (Sweden)
Ivanova Ivelina
2014-12-01
Full Text Available : Chilled and frozen chicken breast and thigh meat were stored at +4±1 oC and - 20±1 oC, respectively. Maillard reaction between ribose and meat proteins of the chicken samples was initiated. The changes in the ribose-induced Maillard reaction rate during chilled and frozen storage of chicken meat were evaluated on the bases of corrected absorbance values (A420* and bovine melanoidin equivalent values (mg BME/g. Application of BME as a measure of ribose-induced Maillard reaction rate enables comparability of the data obtained by different spectrophotometers. It was found that the BME values of chicken meat frozen stored for more than 15 days were significantly (P<0.05 lower than BME values of chilled-stored samples. According to the suggested threshold limit values the chicken thigh and breast meat with BME values lower than 30 mg BME/g and 51 mg BME/g, respectively could be classified as frozen-thawed.
International Nuclear Information System (INIS)
Gomes, Heliana de Azevedo
2002-01-01
Mechanically deboned chicken meat (MDCM) is widely used in traditional meat products such as sausages. The proceed of mechanical separation results in grinding of the bones, liberating the marrow and rupturing cells, thus making the MDCM a favorable medium for biochemical reactions and microbiological growth. Irradiation using a Co 60 source is one of the processes which has been developed aimed at reducing contamination by spoilage and pathogenic microorganisms in foods. The main advantages of food irradiation are the possibilities of treating the already packaged products at refrigerated and frozen temperatures, ideal for a highly perishable product such as MDCM, which, being a ground, easily spoiled product, requires rapid cooling followed by freezing, immediately after processing. Processing with ionizing radiation results in chemical alterations in the food, including the production of volatile compounds and free radicals. Irradiation of meat in the frozen state reduces or eliminates the negative sensory effects of this process. In this context, this study aimed at evaluating the effects of gamma radiation at doses of 3.0 and 4.0 kGy, on the microbiological quality, lipid oxidation and sensory properties of MDCM, at the refrigerated (2 ± 1 deg C) and frozen (-18 ± 1 deg C) storage, The results showed that irradiation increased the shelf life of this raw material when stored under refrigeration, as compared to non-irradiated samples. Since doses of 3.0 kGy produced increases in the shelf life of refrigerated MDCM equal or greater than those produced by doses of 4.0 kGy, this dose was considered the most adequate for the irradiation of this raw material. According to the results of microbiological, chemical and sensorial testing in irradiated MDCM samples with doses of 3.0 kGy and 4.0 kGy, the material studied presented conditions that were adequate for human consumption during the 90 days of frozen storage, whereas samples of non-irradiated MDCM were shown to
Assessing the use of frozen pork meat in the manufacture of cooked ham
Directory of Open Access Journals (Sweden)
Francine Gomes Basso LOS
2016-01-01
Full Text Available This study aimed to evaluate the effects of slow (–18 °C and fast freezing (liquid nitrogen of pork meat, and the use of exudate released upon thawing, on the physicochemical, color, rheological, microbiological, histological, and sensory characteristics of cooked ham. The meat samples were frozen at –18 °C and thawed after 22 weeks for the production of cooked ham. No significant difference was observed regarding physicochemical, color and microbiological parameters or in sensory acceptance. The hardness and chewiness parameters showed significant differences when compared to the control sample (ham made from chilled meat. Light microscopy of cooked ham samples showed that changes in the tissues were caused by freezing and thawing the meat. The effect of exudate was significant on the sodium content and compression force parameters, but this difference was not perceived in the sensory analysis, confirming that frozen pork meat can be used to produce cooked ham without loss of quality.
Directory of Open Access Journals (Sweden)
Jeevanandan V.
2016-09-01
Full Text Available The Total Antibiotics test is a microbial inhibition test which has been recently introduced for the detection of antibiotics in meat. The aim of this study was to determine whether it would be suitable for the detection of coccidiostats in poultry meat. A comparison with the Premi®Test was assessed also for the suitability of the detection of coccidiostats in poultry meat. A selection of poultry meat samples of different organ parts were assessed with 14 samples from Slovakian farms that had previously been tested for coccidiostats by the Veterinary and Food Institute in Košice. In addition, another 8 samples from varied Slovakian supermarkets such as Lidl, Billa and Tesco with samples of chicken or duck meat, were tested. Each prepared sample was added to the Total Antibiotics kit tubes and incubated. The samples from all sources showed a mixture of positive and negative results for the detection of coccidiostats.
Diagnostic value of meat juice in early detection of classical swine fever infection
DEFF Research Database (Denmark)
Lohse, Louise; Uttenthal, Åse; Rasmussen, Thomas Bruun
2011-01-01
samples originated from pigs infected with low virulence CSFV strains and/or when samples were collected within the first days after infection. In conclusion, while not the first choice for sample material for CSFV diagnosis, meat juice may constitute a useful alternative for herd-based studies or when......To evaluate the diagnostic potential of meat juice for early detection of Classical swine fever virus (CSFV), meat juice and serum samples from pigs experimentally infected with different strains of CSFV were compared for virus load. From all samples, viral RNA was extracted by automated procedure...... blood and/or target organ material is not available. Strain virulence and time points for sample collection after infection are factors of importance for diagnostic success....
Meat consumption, meat cooking and risk of lung cancer among Uruguayan men.
De Stefani, Eduardo; Ronco, Alvaro L; Boffetta, Paolo; Deneo-Pellegrini, Hugo; Acosta, Gisele; Mendilaharsu, María
2010-01-01
A case-control study was conducted in Uruguay, including 876 male cases of lung cancer and 876 male hospitalized controls, frequency matched for age (ten-year intervals), residence and hospital. The following explanatory variables were included in the study: fried red meat, barbecued red meat, boiled red meat, and salted red meat. These items were log transformed and energy-adjusted by the residuals method. The following potential confounders were included into the models: age, residence, hospital, education, family history of lung cancer, body mass index, smoking index, alcohol drinking, mate consumption, total energy intake, non-meat fatty foods and total fruits. The main objective was to estimate the odds ratios associated with lung cancer risk. Whereas fried meat, barbecued meat, and salted meat were positively associated with risk (OR of the highest quartile of salted meat versus the lowest, 2.90, 95 % CI 1.99-4.25, p-value for trend<0.0001), boiled red meat was mainly protective. We conclude that salted meat was the main risk factor. The mechanisms could be related to the content of N-nitroso compounds in salted meat.
Meat Consumption Patterns among Different Income Groups in Imo ...
African Journals Online (AJOL)
This research examined meat consumption patterns among different income groups in Imo State, Nigeria. A combination of purposive and simple random sampling techniques was used to select the markets and 200 respondents. The result of cross price elasticity of meat and fish showed that they were substitute with cross ...
Sheep meat commercialization in the retail market in Brazilian cities
Directory of Open Access Journals (Sweden)
Ricardo Firetti
2018-03-01
Full Text Available ABSTRACT This paper explored the mix market characteristics of sheep meat as a product for sale in different cities in the states of São Paulo and Paraná. For this, 81 products were purchased in 21 outlets sampled in a “non-probabilistic” manner for convenience and then subjected to analysis of yield of meat, bone, and fat. Imported products represented 20% of the total, being marketed in hypermarkets. It was observed that 37% of the total products were obtained in hypermarkets, 31% in supermarkets, 23% in butcher shops, and 8.6% in meat outlets. Almost 9% of the products had not undergone the official slaughter inspection system. The main types of products identified were palettes and legs with bones (33.3 and 24.7%, respectively; however, only 25% were satisfactorily displayed to consumers. The yields obtained in meat and deboned portions were 74% and 59% of the total weight, significantly affecting the average adjusted sales prices of the products, respectively US$13.01/kg sale price; US$17.82/kg deboned; and US$22.52/kg lean meat. The low yield of clean and boned meat observed in the samples can lead to negative experiences of these products by consumers.
Identification of new food alternatives: how do consumers categorize meat and meat substitutes?
Hoek, A.C.; Boekel, van M.A.J.S.; Voordouw, J.; Luning, P.A.
2011-01-01
New meat substitutes need to be recognized as alternatives to meat. We therefore investigated which category representations consumers have of meat and meat substitutes. Thirty-four non-vegetarian participants performed a free sorting task with 17 meat products and 19 commercially available meat
Red meat intake, insulin resistance, and markers of endothelial function among Iranian women.
Barak, Farzaneh; Falahi, Ebrahim; Keshteli, Ammar Hassanzadeh; Yazdannik, Ahmadreza; Saneei, Parvane; Esmaillzadeh, Ahmad
2015-02-01
Few data, with conflicting findings, are available linking red meat consumption to indicators of insulin resistance and endothelial dysfunction. This study aimed to investigate the association of red meat consumption with insulin resistance and endothelial dysfunction among a sample of female nurses in Isfahan, Iran. This cross-sectional study was carried out among 420 female nurses who were selected by a multistage cluster random sampling method. Usual dietary intakes were assessed using a validated food frequency questionnaire. Red meat intake was calculated by summing up the consumption of all kinds of red meat in foods and processed meat in sausages and fast foods. To measure serum concentrations of adhesion molecules and glycemic indexes, a fasting blood sample was taken. After adjustment for potential confounders, high red meat intake was significantly associated with higher fasting plasma glucose, homeostasis model assessment of insulin resistance, and lower quantitative insulin sensitivity check index. Although high red meat intake was significantly associated with higher serum insulin levels and lower homeostasis model assessment of beta-cell function in the crude model, after controlling for BMI, the association was no longer significant. Red meat consumption was associated with high concentrations of E-selectin, soluble vascular cell adhesion molecule-1 (sVCAM-1), and soluble intercellular adhesion molecule-1 (sICAM-1) after adjustment for different potential confounders. We found that increased red meat intake was associated with high concentrations of plasma endothelial dysfunction biomarkers and abnormal glucose homeostasis among Iranian women. Prospective studies are required to confirm these findings. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ionizing energy treatment of meat and meat products
International Nuclear Information System (INIS)
Macfarlane, J.J.; Eustace, I.J.; Grau, F.H.
1983-01-01
The radiation treatments that have received most attention with respect to red meats are radappertization, i.e. radiation sterilization (25-70 kGy), to enable the long term storage of meat without refrigeration, and radurization (0.5-10 kGy) in which a sufficient proportion of spoilage organisms are inactivated to enable the storage life of chilled meat to be extended. Shelf-stable radappertized meats cannot be produced in the fresh-like condition; they need to be heated to about 70 deg. C to inactivate endogenous enzymes that would otherwise cause flavour and texture defects. The products should be vacuum sealed in oxgyen-impermeable packages and irradiated in the frozen state, otherwise pronounced off-flavours and off-odours are formed. The radiation dose required to give a useful degree of microbial inactivation and permit an increase of storage life depends upon treatment and storage conditions. The dose required is likely to be in the range 0.25 to 1.0 kGy if aerobic conditions apply, and 1 to 4 kGy if anaerobic conditions apply. An acceleration in the rate of development of rancidity in meat as a result of irradiation may be of concern when meat is treated under aerobic conditions. At the highest dose indicated above for meat irradiated under anaerobic conditions (4 kGy), effects on the organoleptic attributes of mutton have been detected
Trichinella spp. imported with live animals and meat.
Pozio, Edoardo
2015-09-30
Nematodes of the genus Trichinella are widely distributed throughout the world in omnivorous and carnivorous animals (mammals, birds, and reptiles) and in incidental hosts. To prevent the transmission of these zoonotic parasites to humans, meat samples from Trichinella spp. susceptible animals are tested at the slaughterhouse or in game processing plants. The aim of the present review was to collect documented cases on Trichinella infected animals, meat, or meat derived products which reached the international trade or were illegally introduced from one to another country in personal baggage. In the course of the last 60 years in the international literature, there have been 43 reports of importation of Trichinella spp. infected animals or meat, most of which (60%, 26/43) related to live horses or their meat. Meat or meat derived products from pigs, wild boar and bears, account only for 18.6% (8/43), 4.7% (3/43), and 14.3% (6/43), respectively. However, only live horses or their meat intended for human consumption, meat from a single wild boar, and live polar bears caught in the wild for zoos, were imported through the international market; whereas, meat from pigs, wild boars and bears were illegally introduced in a country in personal baggage. Trichinella infected animals or meat which were officially or illegally introduced in a country were the source of 3443 Trichinella infections in humans in a 40-year period (1975-2014). Most of these infections (96.8%) have been linked to horsemeat consumption, whereas meat from pigs, wild boars and bears accounted only for 2.2%, 0.7% and 0.3% of cases, respectively. This review shows the Trichinella spp. risk in the international animal and meat trade has been linked mainly to horses and only one time to wild boar, if they carcasses are not adequately tested, whereas pigs and other wild animals or their derived products infected with Trichinella spp. are unlikely to reach the international market by the official animal and
THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET
Directory of Open Access Journals (Sweden)
Silvius STANCIU
2013-06-01
Full Text Available Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appeared lately. Lack of safety measures in the field can affect business continuity critically, creating significant losses.
DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam
International Nuclear Information System (INIS)
Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.
2001-01-01
Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7
Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China
Directory of Open Access Journals (Sweden)
Li Aijun
2016-01-01
Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.
International Nuclear Information System (INIS)
Whitburn, K.D.; Hoffman, M.Z.; Taub, I.A.
1982-01-01
In ''A Re-Evaluation of the Products of Gamma Irradiation of Beef Ferrimyoglobin'', J. Food Sci. 46:1814 (1981), authors Whitburn, Hoffman and Taub state that color pigment myoglobin (Mb) undergoes chemical changes during irradiation that cause color changes in meat. They also state that they are in disagreement with Giddings and Markakis, J. Food Sci. 47:361 (1972) in regard to generation of MbO 2 in deaerated solutions, claiming their analysis demonstrates only Mb and Mb(IV) production. Giddings, in a letter, suggests that Whitburn, et al may have used differing systems and approaches which critically changed the radiation chemistry. He also states that radiation sterilization of aerobically packaged meats affects color only slightly. Whitburn, in a reply, shares Dr. Giddings concern for caution in interpretation of results for this system. The compositional changes are dependent on identity of free radicals, dose, O 2 and the time of analysis after irradiation. The quantification of these parameters in pure systems, sarcoplasma extracts and in meat samples should lead to a better understanding of color change mechanisms and how to minimize them
International Nuclear Information System (INIS)
Lotfi, M.; Notaro, M.; Piermattei, S.; Tommasino, L.; Azimi-Garakani, D.
1990-01-01
Levels of radioactive contamination in meat have been studied, along with ways of decreasing them. Specifically, radiocaesium concentrations in a range of samples of different types of meat collected throughout Italy since April 1986 are presented here. The samples are of beef, lamb, pork, chicken, turkey and rabbit. It was found that the radiocesium content of lamb is higher than that in any of the other meat types considered here. Studies of the decrease in the radiocaesium content of meat during cooking showed that, when the meat is cooked in salt water (1%), the activity decreases by as much as 80% relative to uncooked samples. (author)
International Nuclear Information System (INIS)
Ali, N.M.; Mazhar, B.; Khadija, I.; Kalim, B.
2016-01-01
Bacteriocin producing bacteria are commonly found in meat products to enhance their shelf-life. In the present study, bacterial species were isolated from meat samples (beef) from different localities of Lahore, Pakistan. MRS agar medium was used to isolate lactic acid bacteria (LAB) through spread and streak methods (incubated for 72 h at 37 degree C). Identification of bacteriocinogenic LAB strains was done by using staining techniques, morphology based characteristics and biochemical tests. These strains were BSH 1b, BSH 3a, BIP 4a, BIP 3a, BIP 1b and BRR 3a. Antibacterial activity of LAB was performed against food borne pathogens viz., Escherichia coli and Staphylococcus aureus through paper disc diffusion method. Three bacterial strains showed maximum inhibition and characterised by ribotyping viz., BIP 4a was identified as Lactobacillus curvatures, BIP 3a was Staphylococcus warneri and BIP 1b was Lactobacillus graminis . Optimum pH 5-6.5 and 30-37 degree C temperature for isolated bacterial strains was recorded. Protein concentration measured was 0.07 mg/mL for BSH 1b, 0.065 mg/mL for BSH 3a, 0.057 mg/mL for BIP 4a, 0.062 mg/mL for BIP 1b, 0.065 mg/mL for BIP 3a and for BRR 3a 0.078 mg/mL, respectively. Bacteriocin of all isolates except BIP 3a was found to be sensitive towards pepsin and resistant towards Rnase. Bacteriocin production was stable at between pH 5.0 and 6.0 and resistant temperature was 40 degree C. It was concluded that lactic acid bacteria (LAB) from meat can be helpful as antibacterial agents against food-borne bacterial pathogens because of thermostable producing bacteriocin. (author)
Turner, K E; Cassida, K A; Zerby, H N; Brown, M A
2015-07-01
This study was conducted during the 2009 and 2010 grazing seasons to assess carcass parameters and chevon (goat meat) quality when meat-goat kids (n=72) were finished on pastures of red clover (Trifolium pratense L.; RCL), birdsfoot trefoil (Lotus corniculatus L.; BFT), or chicory (Cichorium intybus L.; CHIC). Final live weight (Pgoats were finished on RCL compared to CHIC with BFT being intermediate. Ribeye area, backfat thickness, body wall thickness, internal fat score, and leg score were not different (P>0.10) among treatments when adjusted for the covariate of carcass weight. Finishing meat-goat kids on RCL, BFT, or CHIC impacted concentrations of fatty acids (FAs) 18:1 trans-10, 18:1 cis-11, 18:2, 18:3 polyunsaturated fatty acids (PUFAs), omega-6, omega-3, and PUFA:saturated fatty acid ratio in longissimus lumborum samples. Finishing meat-goat kids on CHIC, RCL, or BFT pastures produced carcass weights acceptable for most ethnic markets in the USA. Published by Elsevier Ltd.
Influence of Cooling on the Glycolysis Rate and Development of PSE (Pale, Soft, Exudative Meat
Directory of Open Access Journals (Sweden)
Mayka Reghiany Pedrão
2015-04-01
Full Text Available The aim of this work was to evaluate pH values fall rate in chicken breast meat under commercial refrigeration processing conditions and the development of PSE (pale, soft, exudative meat. Broiler breast samples from the Cobb breed, both genders, at 47 days of age (n = 100 were taken from refrigerated carcasses (RS immersed in water and ice in a tank chilled at 0°C (±2. pH and temperature (T values were recorded at several periods throughout refrigeration in comparison to samples left at room T as control (CS. The ultimate pH (pHu value of 5.86 for RS carcasses were only reached at 11°C after 8.35 h post mortem (PM while, for CS samples, pHu value was 5.94 at 22°C after 4.08 h PM. Thus, under commercial refrigeration conditions, the glycolysis rate was retarded by over 4.0 h PM and the breast meat color was affected. At 24.02 h PM, PSE meat incidence was 30% while for CS, meat remained dark and PSE meat was not detected. Results show retardation in the glycolysis rate and PSE meat development was promoted by the refrigeration treatment when compared with samples stored at processing room temperature.
Directory of Open Access Journals (Sweden)
Zakaria Musa
2017-09-01
Full Text Available Objective: This study was conducted to determine the occurrence of Salmonella in various meat products (beef from cattle, chevon from goats, mutton from sheep and jaziir from camel, by screening the various selling points which includes; meat retailers in abattoir, markets and shops in Maiduguri and its environs. Materials and methods: A total of 120 samples of fresh meat from cattle, sheep, goats and camels sampled from ten meat retailers in abattoir, markets and shops in the Maiduguri metropolis, using simple random sampling technique. All samples were processed and examined according to standard bacteriological protocols. Results: Percentage occurrence of Salmonella species had the highest value of 15 (50.1% from the market, found in sheep, while the lowest occurrence of Salmonella species was associated with 3(10.0% in goats sampled from shop meat.. Antibiotic susceptibility pattern of Salmonella species from cattle meat revealed high resistant to Erythromycin (52%. In sheep, the higher percentage of resistance occurred against Ampicillin (33.3% and less resistant to Amoxicillin (4% was obtained. The isolates from camel meat recorded 25% resistant against Ampicillin, Gentamycin and 12.5% to Streptomycin. A total of 28.4% of the isolates were resistant to Ampicillin, Gentamycin and 23.1% to Ofloxacin. Conclusion: The study has shown that Salmonella species are present in fresh meat sold in abattoir, retail markets and shops. We recommend strict hygienic measures in places where fresh meat are sold in Maiduguri metropolis, Nigeria to ensure consumers right to have safe food. [J Adv Vet Anim Res 2017; 4(3.000: 227-233
Fast derivatization of fatty acids in different meat samples for gas chromatography analysis.
Figueiredo, Ingrid Lima; Claus, Thiago; Oliveira Santos Júnior, Oscar; Almeida, Vitor Cinque; Magon, Thiago; Visentainer, Jesuí Vergilio
2016-07-22
In order to analyze the composition of fatty acids employing gas chromatography as the separation method, a derivatization of lipids using esterification and transesterification reactions is needed. The methodologies currently available are time consuming and use large amounts of sample and reagents. Thus, this work proposes a new procedure to carry out the derivatization of fatty acids without the need for prior extraction of lipids. The use of small amounts of sample (100mg) allows the analysis to be performed in specific parts of animals, in most cases without having them slaughtered. Another benefit is the use of small amounts of reagents (only 2mL of NaOH/Methanol and H2SO4/Methanol). The use of an experimental design procedure (Design Expert software) allows the optimization of the alkaline and acid reaction times. The procedure was validated for five minutes in both steps. The method was validated for bovine fat, beef, chicken, pork, fish and shrimp meats. The results for the merit figures of accuracy (from 101.07% to 109.18%), precision (RSDintra-day (from 0.65 to 3.93%), RSDinter-day (from 1.57 to 5.22%)), linearity (R(2)=0.9864) and robustness confirmed that the new method is satisfactory within the linear range of 2-30% of lipids in the sample. Besides the benefits of minimizing the amount of samples and reagents, the procedure enables gas chromatography sample preparation in a very short time compared with traditional procedures. Copyright © 2016 Elsevier B.V. All rights reserved.
Baldi, G; Soglia, F; Mazzoni, M; Sirri, F; Canonico, L; Babini, E; Laghi, L; Cavani, C; Petracci, M
2018-01-01
During the past few years, there has been an increasing prevalence of broiler breast muscle abnormalities, such as white striping (WS) and wooden breast conditions. More recently, a new muscular abnormality termed as spaghetti meat (SM) because of the altered structural integrity of the Pectoralis major muscle often associated with WS has emerged. Thus, this study aimed at evaluating the effects of WS and SM conditions, occurring alone or combined within the same P. major muscle, on meat quality traits and muscle histology. In two replications, 96 P. major muscles were classified into four classes: normal (N), WS, SM and WS/SM. The whole fillet was used for weight assessment and morphometric measurements, then each sample was cut in order to separate the superficial layer from the deep one and used to evaluate proximate composition, histological features, nuclear magnetic resonance relaxation times, functional properties and both myofibrillar and sarcoplasmic proteins profile. Fillets affected by WS and SM abnormalities exhibited higher weights and increased thickness and length. SM condition was associated with a relevant decrease in protein content coupled with a significant increase in moisture level, whereas fat content was affected only by the simultaneous presence of WS. Histological evaluations revealed that abnormal samples were characterized by several degenerative aspects that almost completely concerned the superficial layer of the fillets. White striped fillets exhibited necrosis and lysis of fibers, fibrosis, lipidosis, loss of cross striation and vacuolar degeneration. Moreover, SM samples were characterized by poor fiber uniformity and a progressive rarefaction of the endo- and peri-mysial connective tissue, whereas WS/SM fillets showed intermediate histological features. Nuclear magnetic resonance relaxation analysis revealed a higher proportion of extra-myofibrillar water in the superficial section of all the abnormal fillets, especially in SM
Herbal Extracts for Ensuring Pork Meat Quality during Cold Storage
Directory of Open Access Journals (Sweden)
Grāmatiņa Ilze
2017-12-01
Full Text Available Oxidation and microbial spoilage have a negative effect on the quality of meat and meat products, causing changes in their sensory and nutritional properties. Herbs contain biologically active compounds, like phenols with antioxidative and antimicrobial properties. Phenols can be used as substitutes for commercial antioxidants to prevent lipid oxidation, thus maintaining the colour and flavour of the product. The aim of the study was to investigate the the potential use of herbal extracts in ethanol/water application for the maintenance of pork meat quality during storage. Four herbs growing in Latvia — nettle (Urtica dioica L., lovage (Levisticum officinale L., oregano (Origanum vulgare, and horseradish (Armoracia rusticana L. were chosen for the study. An optimal ethanol concentration for the extraction of the phenolic compounds was obtained with ethanol 50%/water 50% concentration (v/v. Prepared herbal extracts were added to chilled pork to determine the quality of the pork during storage. Changes in meat quality and its sensory properties for chilled pork without extracts appeared on day 18 of storage. Negative changes in sensory properties of meat samples with nettle extract were observed on day 22 of storage, and with lovage, oregano, and horseradish extracts on day 32. Statistically significant differences (p ≤ 0.05 were observed for microbiological indices between pork samples with herbal extracts and the control sample.
Microbiological Quality Assessment of Game Meats at Retail in Japan.
Asakura, Hiroshi; Kawase, Jun; Ikeda, Tetsuya; Honda, Mioko; Sasaki, Yoshimasa; Uema, Masashi; Kabeya, Hidenori; Sugiyama, Hiromu; Igimi, Shizunobu; Takai, Shinji
2017-12-01
In this study, we examined the prevalence of Shiga toxin-producing Escherichia coli and Salmonella spp. and the distribution of indicator bacteria in 248 samples of game meats (120 venison and 128 wild boar) retailed between November 2015 and March 2016 in Japan. No Salmonella spp. were detected in any of the samples, whereas Shiga toxin-producing Escherichia coli serotype OUT:H25 (stx 2d + , eae - ) was isolated from one deer meat sample, suggesting a possible source for human infection. Plate count assays indicated greater prevalence of coliforms and E. coli in wild boar meat than in venison, whereas their prevalence in processing facilities showed greater variation than in animal species. The 16S rRNA ion semiconductor sequencing analysis of 24 representative samples revealed that the abundances of Acinetobacter and Arthrobacter spp. significantly correlated with the prevalence of E. coli, and quantitative PCR analyses in combination with selective plate count assay verified these correlations. To our knowledge, this is the first report to characterize the diversity of microorganisms of game meats at retail in Japan, together with identification of dominant microbiota. Our data suggest the necessity of bottom-up hygienic assessment in areas of slaughtering and processing facilities to improve microbiological safety.
International Nuclear Information System (INIS)
Talib, M. A.; Bouba, A. I.
2010-01-01
Meat strips were dipped in three different concentrations (2, 4 and 8%) of sodium chloride (NaCl) each containing 120 ppm sodium nitrite combined with 300 ppm ascorbic acid for 30 minutes at ambient temperature. Pretreated meat samples were then divided into two equal batches and subjected to solar or oven drying. Untreated meat samples were used as control. Both meat samples were kept in plastic containers for two months at room temperature. Samples of meat were taken just after drying and during storage period of two months. Then physiochemical (moisture content, total lipid, total protein and pH) analyses were carried out. Results demonstrated that physicochemical analyses of meat samples treated with salt and preservatives decreased gradually. The decrease was proportional to the increase in NaCl concentrations. During storage period of two months total protein and lipid showed a decrease, meanwhile moisture content and pH slightly increased. No significant difference was observed between meat samples dehydrated using oven and solar drying. Therefore solar drying should be considered the best due to its energy cost. (author)
Effect of protective atmosphere on color of goose meat.
Orkusz, A; Woloszyn, J; Haraf, G; Okruszek, A
2013-08-01
The objective of the work was to characterize the color of the of the goose breast meat packaged in protective atmosphere and stored in the refrigerated conditions. The aim was realized by determination of total heme pigment concentration; relative concentration of myoglobin, oxymyoglobin, and metmyoglobin; parameters of color L* (lightness), a* (redness), and b* (yellowness); and sensory evaluation of the surface color. The experimental material was White Kołuda goose boneless breast meat with the skin from industrial slaughter. The following 2 protective atmospheres were used in the study: vacuum and modified atmosphere (MA) consisting of 80% O2 and 20% CO2. The muscles packed in protective atmosphere were examined on d 4, 7, 11, and 14 of storage. A control sample was goose breast meat stored in air and tested after 24 h after slaughter. The total pigment concentration decreased gradually within 14 d of storage for samples packed in 2 types of atmospheres. The increase in relative concentration of metmyoglobin and the decrease in oxymyoglobin relative concentration in total heme pigments in the meat stored in MA was noticed. However, in all times of storage, the relative concentration of the 3 samples of myoglobin forms stored in vacuum was unchanged. The color parameters (L*, a*, b*) did not change for 14 d of storage in the muscles packed in vacuum. One can state a decrease of the value of the color parameter a* as well as an increase of the value of the color parameter b* in the samples packed in MA. From d 11 to 14 of storage, goose meat packed under MA had lower sensory evaluation intensity of color than muscles under vacuum. The obtained data indicated that the surface color of goose breast meat packed in MA (consisting of 80% O2, 20% CO2) or vacuum packed was maintained for 11 and 14 d, respectively.
Meat juice serology for Toxoplasma gondii infection in chickens
Directory of Open Access Journals (Sweden)
Alice Vismarra
2016-01-01
Full Text Available Toxoplasma gondii is an important foodborne zoonosis. Free-range chickens are at particularly high risk of infection and are also excellent indicators of soil contamination by oocysts. In the present study, hearts of 77 freerange chickens were collected at slaughter. T. gondii meat juice enzyme-linked immunosorbent assay was performed with a commercial kit, following validation with positive controls, from experimentally infected chickens, and negative ones. Out of 77 samples, only 66 gave sufficient meat juice for serology. Of these, 24 (36.4% were positive for T. gondii considering the 5*standard deviation values (calculated on the optical density of negative controls, while all the samples were negative considering sample/positive% values. Parasite-specific polymerase chain reaction was carried out on all samples obtained from heart tissue and none were positive for the presence of T. gondii DNA. Results would suggest that further study on the use of meat juice with a validated serological test to detect T. gondii in chickens could lead to widespread epidemiological studies in this important intermediate host. However, sample collection and test specificity require further evaluation.
Meet meat: An explorative study on meat and cultured meat as seen by Chinese, Ethiopians and Dutch.
Bekker, Gerben A; Tobi, Hilde; Fischer, Arnout R H
2017-07-01
In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries and theory of social practices helps to better understand the possibly culturally dependent operationalization of the concept meat. Ten visiting graduate students from China, 10 from Ethiopia and 10 native Dutch graduate students completed freelist tasks, a pile sort task, interview and essay task, during a single session. We found that butchered animals are at the center of the concept of meat, although depending on culture not all animals are a source of meat. Symbolic boundaries were restricted or stretched depending on social practices within countries. Ethiopian participants applied strictly defined symbolic boundaries, where Chinese and Dutch participants used more broadly defined symbolic boundaries. Cultured meat was seen as a technology for the future and was positioned across the symbolic boundaries of meat. Copyright © 2017 Elsevier Ltd. All rights reserved.
Immunofluorescence detection of pea protein in meat products.
Petrášová, Michaela; Pospiech, Matej; Tremlová, Bohuslava; Javůrková, Zdeňka
2016-08-01
In this study we developed an immunofluorescence method to detect pea protein in meat products. Pea protein has a high nutritional value but in sensitive individuals it may be responsible for causing allergic reactions. We produced model meat products with various additions of pea protein and flour; the detection limit (LOD) of the method for pea flour was 0.5% addition, and for pea protein it was 0.001% addition. The repeatabilities and reproducibilities for samples both positive and negative for pea protein were all 100%. In a blind test with model products and commercial samples, there was no statistically significant difference (p > 0.05) between the declared concentrations of pea protein and flour and the immunofluorescence method results. Sensitivity was 1.06 and specificity was 1.00. These results show that the immunofluorescence method is suitable for the detection of pea protein in meat products.
Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita
2014-02-01
Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.
COMPOSITIONAL EVALUATION OF RAW AND PROCESSED HARMS (Brachystegia eurycoma SEED FLOUR
Directory of Open Access Journals (Sweden)
M.O Aremu
2014-12-01
Full Text Available Brachystegia eurycoma is predominantly grown in the eastern region of Nigeria. Its seed is used in food majorly as a soup condiment, flavouring agent and soup thickener. The proximate, mineral and amino acid compositions were determined on raw and processed seeds (boiled, fermented and roasted using standard analytical techniques. The processing methods showed deviations in nutrients from the raw seeds. The crude protein was reduced by the processing methods with exception of roasting method. Crude fat was reduced in all the processing methods in this order: Raw > fermented > roasted > boiled samples. All the processing methods enhanced calcium content in this order: Raw < boiled < fermented < roasted samples. Boiling and fermenting reduced the content of magnesium by 72.6 and 30.2%, respectively while boiling, fermenting and roasting increased potassium content by 124.5, 12.2 and 120.4%, respectively. Generally, all the samples were found to be a good source of essential minerals and harmful heavy metals such as lead, chromium, arsenic and cadmium were not at detectable range of atomic absorption spectrophotometer. The amino acid profile revealed that amino acids in fermented sample were better concentrated than that of raw and other processed samples. The total essential amino acids (TEAA ranged from 28.63 g/100g crude protein in roasted sample to 34.79 g/100g crude protein in fermented sample. The limiting amino acid (LAA for all the samples was Met + Cys (TSAA.