WorldWideScience

Sample records for raw meat samples

  1. In vitro antimicrobial effect of Satureja wiedemanniana against Bacillus species isolated from raw meat samples.

    Science.gov (United States)

    Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan

    2009-08-01

    In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.

  2. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  3. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  4. Detection of horse meat contamination in raw and heat-processed meat products.

    Science.gov (United States)

    Hsieh, Yun-Hwa P; Ofori, Jack A

    2014-12-31

    Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

  5. Artificial neural network as the tool in prediction rheological features of raw minced meat

    OpenAIRE

    Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko

    2012-01-01

      Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...

  6. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark

    DEFF Research Database (Denmark)

    Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud

    2006-01-01

    Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....

  7. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  8. The Influence of Stunning Method, Refrigeration and Freezing Time on the Rheological and Textural Properties of Raw Meat

    Directory of Open Access Journals (Sweden)

    Liliana Tudoreanu

    2013-11-01

    Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio

  9. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  11. Volatiles in raw and cooked meat from lambs fed olive cake and linseed.

    Science.gov (United States)

    Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A

    2015-04-01

    This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.

  12. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  13. Artificial neural network as the tool in prediction rheological features of raw minced meat.

    Science.gov (United States)

    Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta

    2012-01-01

    The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.

  14. Fate of gamma-irradiated Listeria monocytogenes during refrigerated storage on raw or cooked turkey breast meat

    International Nuclear Information System (INIS)

    Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.

    1998-01-01

    The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat

  15. Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland

    Directory of Open Access Journals (Sweden)

    Danuser Jürg

    2003-12-01

    Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other

  16. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

    2014-02-05

    Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

  17. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  18. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  19. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

    2010-04-01

    Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

  20. Occurrence of Thermotolerant Campylobacter in Raw Poultry Meat, Environmental and Pigeon Stools Collected in Open-Air Markets.

    Science.gov (United States)

    Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia

    2014-08-28

    Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.

  1. The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product

    Directory of Open Access Journals (Sweden)

    Rini Mastuti

    2012-02-01

    Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value  7.89, WHC  48.345, and moisture content  75.20%.   Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.

  2. Development of a Rapid Immunodiagnostic Test for Pork Components in Raw Beef and Chicken Meats: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    S. N. Depamede

    2011-08-01

    Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.

  3. Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria

    Directory of Open Access Journals (Sweden)

    Adekunbi Bridget Omotoso

    2015-07-01

    Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry

  4. Properties of raw meat and meat curry from spent goat in relation with post-mortem handling conditions.

    Science.gov (United States)

    Narayan, Raj; Mendiratta, S K; Mane, B G

    2013-04-01

    The properties of raw meat and meat curry from spent goat meat in relation with post-mortem handling conditions were evaluated. The conditions evaluated were: cooking of meat within 1-2 h post-slaughter (condition 1); deboning meat storage at 25 ± 2 °C for 5-6 h and cooking (condition 2); post-slaughter storage of carcass at room temperature for 5-6 h, then deboning followed by storage of meat at refrigeration temperature for 5-6 h and cooking (condition 3); deboning and storage of meat at 25 ± 2 °C for 10-12 h and cooking (condition 4). Significant difference was observed in pH values in condition 1 (p meat as compared to the conditions 2, 3 and 4. However, the moisture content of cooked meat was significantly higher (p meat chunks, that is, the mean value was significantly higher (p < 0.01) for condition 2 and significantly lower for condition 1. Sensory scores were significantly higher in condition 1 and significantly lower in condition 2. However, sensory scores for condition 4 were almost similar to the condition 1.

  5. IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. M. Bukreev

    2013-01-01

    Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.

  6. Effects of Tannic Acid on Lipid and Protein Oxidation, Color, and Volatiles of Raw and Cooked Chicken Breast Meat during Storage

    Directory of Open Access Journals (Sweden)

    Marwan Al-Hijazeen

    2016-06-01

    Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.

  7. Isolation of Yersinia from raw meat (pork and chicken) and precooked meat (porcine tongues and sausages) collected from commercial establishments in Mexico City.

    Science.gov (United States)

    Ramírez, E I; Vázquez-Salinas, C; Rodas-Suárez, O R; Pedroche, F F

    2000-04-01

    A total of 160 meat product samples were collected from commercial outlets in Mexico City to investigate the presence of different species of Yersinia by the 4 degrees C enrichment method after 1, 3, 5, and 7 days of incubation using alkaline treatment and isolating in cefsulodin-Irgasan-novobiocin and MacConkey agars with Tween 80. Overall, Yersinia spp. were isolated from 27% of the samples analyzed, whereas 40% of the raw and only 13% of the precooked samples were contaminated. Although 2,970 colonies showed Yersinia characteristics, only 706 (24%) actually corresponded to this genus: 49% were Yersinia enterocolitica, 25% Yersinia kristensenii, 15% Yersinia intermedia, 9% Yersinia frederiksenii, and 2% Yersinia aldovae; 10% corresponded to biotype 2, 2% to biotype 3, and 4% to biotype 4. The presence of Yersinia in raw and cooked meat products represents a health risk for consumers in Mexico, where further clinical studies are needed to assess the epidemiological importance of this pathogen.

  8. Comparison of the amounts of taste-related compounds in raw and cooked meats from broilers and Korean native chickens.

    Science.gov (United States)

    Jayasena, Dinesh D; Kim, Sun Hyo; Lee, Hyun Jung; Jung, Samooel; Lee, Jun Heon; Park, Hee Bok; Jo, Cheorun

    2014-12-01

    This study was aimed at comparing the taste-related compound content in the breast and leg meat from 100-d-old Korean native chickens (KNC-100) and 32-d-old commercial broilers (CB-32) and determining the changes in these compounds during cooking. Cocks from certified meat-type commercial broiler (Ross) and Korean native chicken (Woorimatdag) strains were raised under similar standard commercial conditions, and a total of 10 birds from each breed were slaughtered at 32 and 100 d of age, which represents their market ages, respectively. Raw and cooked meat samples were prepared separately from the breast and leg and analyzed. The KNC-100 showed significantly higher concentrations of inosine 5'-monophosphate, reducing sugars, glutamic acid, linoleic acid, arachidonic acid, and docosahexaenoic acid than CB-32 did. Additionally, significantly higher inosine 5'-monophosphate, cysteine, arachidonic acid, and docosahexaenoic acid concentrations were observed in the breast meat, whereas the leg meat had higher concentration of glutamic acid, oleic acid, and linoleic acid (P cooking process, except oleic and linoleic acids. We suggest that the higher levels of taste-related compounds present in KNC-100 meat compared with CB-32 meat may result in the unique taste of the former meat, as has been previously reported. In addition, the results of this study may provide useful information for selection and breeding programs. ©2014 Poultry Science Association Inc.

  9. OFFGEL electrophoresis and tandem mass spectrometry approach compared with DNA-based PCR method for authentication of meat species from raw and cooked ground meat mixtures containing cattle meat, water buffalo meat and sheep meat.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth

    2017-10-15

    The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Antioxidant Enzyme Activity, Iron Content and Lipid Oxidation of Raw and Cooked Meat of Korean Native Chickens and Other Poultry

    Directory of Open Access Journals (Sweden)

    Muhlisin

    2016-05-01

    Full Text Available This study was conducted to observe antioxidant enzyme activity, iron content and lipid oxidation of Korean native chickens and other poultry. The breast and thigh meat of three Korean native chicken breeds including Woorimatdak, Hyunin black and Yeonsan ogye, and three commercial poultry breeds including the broiler, White Leghorn and Pekin duck (Anasplatyrhyncos domesticus were studied. The analyses of the antioxidant enzymes activity, iron content and lipid oxidation were performed in raw and cooked samples. The activity of catalase (CAT in the thigh meat was higher than that of the breast meat of three Korean native chickens and the broiler, respectively. The activity of glutathione peroxidase (GPx in the uncooked thigh meat of three Korean native chickens was higher than that of the breasts. The breast meat of Woorimatdak and Pekin duck had higher superoxide dismutase (SOD activity than the others, while only the thigh meat of Pekin duck had the highest activity. Cooking inactivated CAT and decreased the activity of GPx and SOD. The thigh meat of Woorimatdak, White Leghorn, Yeonsan ogye and Hyunin black contained more total iron than the breast meat of those breeds. The heme-iron lost during cooking ranged from 3.2% to 14.8%. It is noted that the thigh meat had higher thiobarbituric acid reactive substances values than the breast in all chicken breeds. Though Woorimatdak showed higher antioxidant enzyme activity and lower released-iron percentage among Korean native chickens, no differences were found on lipid oxidation. We confirm that the dark meat of poultry exhibited higher antioxidant enzyme activity and contained more iron than the white meat.

  11. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    OpenAIRE

    Claudiu-Dan Salagean; Dorin Tibulca; Radu Marin

    2013-01-01

    Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste) in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon) and mix of natural spices - fine grinding variant (1) and coarse grinding variant (3) - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon) + vegetable protein supplements (textured soy protein) + binder (protein + fiber) + add...

  12. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia.

    Science.gov (United States)

    Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S

    2016-08-01

    Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.

  13. Dietary vitamin E affects lipid oxidation and total volatiles of irradiated raw turkey meat

    International Nuclear Information System (INIS)

    Ahn, D.U.; Sell, J.L.; Jeffery, M.; Jo, C.; Chen, X.; Lee, J.I.

    1997-01-01

    Breast and leg meat patties, prepared from turkeys fed diets containing 25, 200, 400 or 600 IU of dl-alpha-tocopheryl acetate (TA) per kg diet, were irradiated at 0 or 2.5 kGy with vacuum or loose packaging. The effects of dietary TA on storage stability and production of volatiles in irradiated raw turkey meat were determined. Dietary TA at 200 IU/kg decreased lipid oxidation and reduced total volatiles of raw turkey patties after 7-days of storage. However, the antioxidant effects of dietary TA were more notable when the patties were loosely packaged than when vacuum-packaged. Irradiation increased lipid oxidation of raw turkey meats only when loosely packaged but had limited effects on formation of total volatiles after storage at 4 degrees C for 7 days or longer

  14. Biochemical and microstructural characteristics of meat samples ...

    African Journals Online (AJOL)

    This study was conducted to compare the efficiency of different plant proteases for changing biochemical and microstructural characteristics in muscle foods. The meat samples from chicken, giant catfish, pork and beef were treated with four types of proteolytic enzymes: Calotropis procera latex proteases, papaya latex ...

  15. Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

    Science.gov (United States)

    Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

    2015-07-01

    The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

  16. Survival of Salmonella Copenhagen in food bowls following contamination with experimentally inoculated raw meat: Effects of time, cleaning, and disinfection

    OpenAIRE

    Weese, J Scott; Rousseau, J.

    2006-01-01

    There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.

  17. Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

    Science.gov (United States)

    Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

    2017-08-01

    Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  18. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    NARCIS (Netherlands)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-01

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and

  19. 76 FR 44855 - Common or Usual Name for Raw Meat and Poultry Products Containing Added Solutions

    Science.gov (United States)

    2011-07-27

    ...'s experience in reviewing labels of meat and poultry products with added solution, the Agency has... or prior to consumption. Therefore, to ensure that labels adequately inform consumers that raw... of identity and that are sold for retail sale, institutional use, or further processing. If retail...

  20. Freezing of meat raw materials affects tyramine and diamine accumulation in spontaneously fermented sausages.

    Science.gov (United States)

    Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen

    2006-01-01

    Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.

  1. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus.

    Science.gov (United States)

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E; Hanson, Blake M; Smith, Tara C

    2017-09-07

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n = 3347) and contemporaneously from meat products in stores where participants report purchasing meat (n = 913). The staphylococcal protein A (spa) gene was sequenced for all isolates to determine a spa type. Morisita indices and Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) were used to determine the relationship between spa type composition among human samples and meat samples. spa type composition was significantly different between households and meat sampled from their associated grocery stores. spa types found in meat were not significantly different regardless of the store or county in which they were sampled. spa types in people also exhibit high similarity regardless of residential location in urban or rural counties. Such findings suggest meat is not an important source of S. aureus colonization in shoppers.

  2. Presence of Staphylococcus aureus and Shiga Toxigenic Escherichia coli O157:H7 in Raw Meat in Ağrı, Turkey

    Directory of Open Access Journals (Sweden)

    Naim Deniz Ayaz

    2016-08-01

    Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.

  3. Determination of radioactivity in meat samples

    International Nuclear Information System (INIS)

    Malik, G.M.; Atta, M.A.; Shafiq, M.; Zafar, M.S.

    1993-01-01

    The presence of radionuclides in edibles can create harmful effects in the human body. It is, therefore, essential that the radioactivity must be searched in the food stuff specially in those items which are available near the nuclear installations. The radioactivity in the meat samples obtained from the surroundings of PINSTECH (Pakistan Institute of Nuclear Science and Technology), PINSTECH Complex has been determined using high resolution Ge(Li) gamma ray spectrometer and a low level beta counting system. The results show that the measured values of the radioactivity are below the maximum permissible levels. (author)

  4. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Flavour development in pork. Influence of flavour precursor concentrations in longissimus dorsi from pigs with different raw meat qualities

    DEFF Research Database (Denmark)

    Meinert, Lene; Tikk, Kaja; Tikk, Meelis

    2009-01-01

    Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...... the differences in sensory perception of the pan-fried pork chops. Overall, the differences were small....

  6. Physico-chemical and microbiological properties of raw fermented sausages are not influenced by color differences of turkey breast meat.

    Science.gov (United States)

    Popp, J; Krischek, C; Janisch, S; Wicke, M; Klein, G

    2013-05-01

    It has been suggested that the color of turkey breast meat influences both physico-chemical and microbiological properties of raw fermented sausages. In this study, raw fermented sausages were produced with turkey breast meat in 3 different colors (pale, normal, or dark), which were obtained from 2 fast-growing-genetic-line toms at 2 slaughterhouses. Prior to the sausage production, the breast muscles were sorted into color groups according to the lightness values determined at 24 h postmortem. This meat was subsequently processed to raw fermented sausages using 1.5 or 2.5% curing salt (CS). The pale meat had higher lightness, electrical conductivity, and drip loss, whereas the dark meat showed a darker color only. The physico-chemical (pH, water activity), visual (lightness, redness), and microbial (total plate count) properties of the sausages were not influenced by the color of the turkey breast meat. The sausage made with 2.5% CS had lower aw and higher ash and hardness values than the sausages produced with 1.5% CS. In conclusion, processing of differently colored turkey meat to raw fermented sausages does not influence the quality characteristics of the products. Based on these findings, there is no reason for the sausage producer to separate turkey breast muscles by color before producing raw fermented sausages.

  7. Prevalence and antimicrobial susceptibility of Salmonella isolated from a variety of raw meat sausages in Gaborone (Botswana) retail stores.

    Science.gov (United States)

    Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz

    2012-04-01

    The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.

  8. Effect of type of suckling and polyunsaturated fatty acid use on lamb production. 2. Chemical and fatty acid composition of raw and cooked meat

    Directory of Open Access Journals (Sweden)

    Francesco Toteda

    2010-01-01

    Full Text Available This study was carried out in order to examine the chemical and fatty acid composition of raw and cooked meat obtained fromlambs raised under mothers or reared by artificial suckling with acidified milk replacers with or without polyunsaturated fattyacid (PUFA supplementation. Meat samples were taken from twenty Gentile di Puglia male lambs subjected to the followingfeeding treatments: the control group received only maternal milk (MM, n.=6 while two groups were reared by artificial sucklingwith an acidified milk replacer (MR, n.=7 or with an acidified milk replacer supplemented with 10 ml/l of a PUFA enrichedoil (MR+PUFA, n.=7. Lambs were slaughtered at 45 days of age. After 24 hours of refrigeration at 4 °C, the lumbar regionwas dissected from each right half-carcass and split into pieces, one of which was used raw while the other was cooked in aventilated electric oven at 180 °C until an internal temperature of 75 °C was reached. Chemical and fatty acid analysis wereperformed on raw and cooked meat, while only raw meat was assessed for cholesterol. Cooking losses were also evaluated.Meat obtained from MR+PUFA fed lambs contained more fat (Punder mothers increased the total amount of saturated fatty acids (SFA, compared with both the MR group (Pthe MR+PUFA one (Pcomparison with both MR diets. The highest PUFA/SFA ratio of meat was recorded for the MR+PUFA group (0.27, with statisticaldifferences respect to the MR group (0.21; Pmilk produced meat containing more cholesterol than the MR+PUFA group (85.89 vs 76.26 mg/100 g; Pindex of meat was higher following natural rearing in comparison with the MR+PUFA treatment (1.34 vs 1.05;Pand 0.76, respectively; Pparameters evaluated. In conclusion, artificial suckling with acidified milk replacers improves some meat quality features.Supplementation of milk replacers with PUFAs, although in a limited way, may improve the dietetic properties of lamb meat.

  9. Campylobacter fetus meningitis associated with eating habits of raw meat and raw liver in a healthy patient: A case report and literature review.

    Science.gov (United States)

    Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi

    2018-01-01

    Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.

  10. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  11. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2016-07-01

    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  12. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    Science.gov (United States)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-13

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and parasitic pathogens in Dutch commercial RMBDs. We analysed 35 commercial frozen RMBDs from eight different brands. Escherichia coli serotype O157:H7 was isolated from eight products (23 per cent) and extended-spectrum beta-lactamases-producing E coli was found in 28 products (80 per cent). Listeria monocytogenes was present in 19 products (54 per cent), other Listeria species in 15 products (43 per cent) and Salmonella species in seven products (20 per cent). Concerning parasites, four products (11 per cent) contained Sarcocystis cruzi and another four (11 per cent) S tenella In two products (6 per cent) Toxoplasma gondii was found. The results of this study demonstrate the presence of potential zoonotic pathogens in frozen RMBDs that may be a possible source of bacterial infections in pet animals and if transmitted pose a risk for human beings. If non-frozen meat is fed, parasitic infections are also possible. Pet owners should therefore be informed about the risks associated with feeding their animals RMBDs. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  14. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    Directory of Open Access Journals (Sweden)

    Claudiu-Dan Salagean

    2013-11-01

    Full Text Available Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon and mix of natural spices - fine grinding variant (1 and coarse grinding variant (3 - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon + vegetable protein supplements (textured soy protein + binder (protein + fiber + additive mix - fine grinding variant (2 and coarse grinding variant (4 - chopping at the volf through the sieve of 3 - 4 mm. In this respect organoleptic analyzes were performed on appearance (exterior and section, color, smell, texture and taste of the finished product (after roasting, the results highlighting that, in terms of organoleptic, sample 1 obtained the highest score (on a scale of 1-poor to 5-very good quality (average 21.83, followed by sample 3 (average 19.22, the very small difference in the case of sample 2 (average 19.19 and finally, sample 4 (average 18.75. It was noted that sample 1 obtained the highest score (average of all analyzed organoleptic indicators: appearance (4.33, color (4.39, smell (4.67, texture (4.33 and taste (4.11 being favorite by all volunteer subjects who participated at the analysis. The same thing was found in sensory analysis of mici paste in fresh/chilled condition: 65% of subjects preferred variant 1 followed by variant 3 (19.2%, variant 2 (11.5% and finally, variant 4 (3.8%. In terms of economic the highest efficiency was found in 2 (specific consumption 0.73 and 4 (specific consumption 0.77 variants compared to 1 (specific consumption 0.80 and 3 (specific consumption 0.82 variants, which translates into a reduction in the cost of products manufactured in the variants 2 and 4 (with protein supplements and additive mix by about 25-20% (with importance for the manufacturer. Also, thermal processing (roasting revealed the

  15. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat.

    Science.gov (United States)

    Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M

    2015-04-01

    One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.

  16. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage

    Science.gov (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  17. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  18. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    Omega-3 long-chain (≥C 20 ) polyunsaturated fatty acids (ω3 LC-PUFA) confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL) muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO) was evaluated. Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO): a control diet at 0 mL/kg DM of DCCO (DCCOC); 25 mL/kg DM of DCCO (DCCOM) and 50 mL/kg DCCO (DCCOH). Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Within raw meats: DCCOH supplemented lambs had significantly ( P  culinary preparation method can be used as effective management tools to deliver nutritionally improved ω3 LC-PUFA lamb to meat consumers.

  19. Analysis of raw meat for heavy metals and bacterial contamination and comparison of antibiotic susceptibility of isolated bacteria

    International Nuclear Information System (INIS)

    Ahmad, F.

    2016-01-01

    The focus of the study was to analyze the commercially available meat for its heavy metal contents and bacterial contamination. The meat samples were collected from four commercial markets of Lahore, i.e., as Wafaqi Colony (Site I),Township (Site II), G-1 Market (Site III) and Zenith (Site IV), and analyzed for heavy metal [i.e., manganese (Mn), nickel (Ni), chromium (Cr), cadmium (Cd) and copper (Cu)] contents and bacterial contaminants (E. coli, Pseudomonas sp., Bacillus sp. and Salmonella sp.) Atomic absorption spectrophotometery was employed for the detection of the heavy metals and plate count method was used for the detection of bacterial contaminants. The Ni concentration in the Site II sample only and Cd concentration in all meat samples were found above the standard value and the concentration of other metals (Cu, Cr, and Mn) was less than the standard concentrations. Bacterial (E. coli, Pseudomonas sp., Bacillus sp., Salmonella sp. and Staphylococcus sp.) contamination was found in all meat samples; however, the number was a little lower in the Site IV samples. Statistical analysis was done, by one-way ANOVA using SPSS, to compare heavy metal contamination in the meat samples. The results showed distribution of heavy metals in all meat samples there was significant difference of Ni concentration in the meat samples. The measure of antibiotic susceptibility showed that isolated species of bacteria were resistant to lincomycin, streptomycin, tertracyclin, ampicillin, amoxicillin and doxycyclin, but did not survive in the medium containing ofloxacin. (author)

  20. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

    Science.gov (United States)

    Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

    2017-01-01

    Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

  1. Polycyclic aromatic hydrocarbons in air samples of meat smokehouses

    DEFF Research Database (Denmark)

    Hansen, Åse Marie; Olsen, I L; Poulsen, O M

    1992-01-01

    In a screening programme nine Danish meat smokehouses were randomly selected for measurements on concentration of airborne polycyclic aromatic hydrocarbons (PAH). A total of 23 stationary air samples were collected during the entire working period of the kiln either above the kiln doors or approx......In a screening programme nine Danish meat smokehouses were randomly selected for measurements on concentration of airborne polycyclic aromatic hydrocarbons (PAH). A total of 23 stationary air samples were collected during the entire working period of the kiln either above the kiln doors...

  2. Effect of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat during refrigerated storage.

    Science.gov (United States)

    Devatkal, Suresh K; Naveena, B M

    2010-06-01

    Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

  3. Two sampling techniques for game meat

    OpenAIRE

    van der Merwe, Maretha; Jooste, Piet J.; Hoffman, Louw C.; Calitz, Frikkie J.

    2013-01-01

    A study was conducted to compare the excision sampling technique used by the export market and the sampling technique preferred by European countries, namely the biotrace cattle and swine test. The measuring unit for the excision sampling was grams (g) and square centimetres (cm2) for the swabbing technique. The two techniques were compared after a pilot test was conducted on spiked approved beef carcasses (n = 12) that statistically proved the two measuring units correlated. The two sampling...

  4. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus

    OpenAIRE

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E.; Hanson, Blake M.; Smith, Tara C.

    2017-01-01

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n?=?3347) and contemporaneously from meat produc...

  5. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand.

    Science.gov (United States)

    Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E

    2017-09-01

    Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.

  6. Traceability of Plant Diet Contents in Raw Cow Milk Samples

    Science.gov (United States)

    Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

    2009-01-01

    The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

  7. Two sampling techniques for game meat

    Directory of Open Access Journals (Sweden)

    Maretha van der Merwe

    2013-03-01

    Full Text Available A study was conducted to compare the excision sampling technique used by the export market and the sampling technique preferred by European countries, namely the biotrace cattle and swine test. The measuring unit for the excision sampling was grams (g and square centimetres (cm2 for the swabbing technique. The two techniques were compared after a pilot test was conducted on spiked approved beef carcasses (n = 12 that statistically proved the two measuring units correlated. The two sampling techniques were conducted on the same game carcasses (n = 13 and analyses performed for aerobic plate count (APC, Escherichia coli and Staphylococcus aureus, for both techniques. A more representative result was obtained by swabbing and no damage was caused to the carcass. Conversely, the excision technique yielded fewer organisms and caused minor damage to the carcass. The recovery ratio from the sampling technique improved 5.4 times for APC, 108.0 times for E. coli and 3.4 times for S. aureus over the results obtained from the excision technique. It was concluded that the sampling methods of excision and swabbing can be used to obtain bacterial profiles from both export and local carcasses and could be used to indicate whether game carcasses intended for the local market are possibly on par with game carcasses intended for the export market and therefore safe for human consumption.

  8. Two sampling techniques for game meat.

    Science.gov (United States)

    van der Merwe, Maretha; Jooste, Piet J; Hoffman, Louw C; Calitz, Frikkie J

    2013-03-20

    A study was conducted to compare the excision sampling technique used by the export market and the sampling technique preferred by European countries, namely the biotrace cattle and swine test. The measuring unit for the excision sampling was grams (g) and square centimetres (cm2) for the swabbing technique. The two techniques were compared after a pilot test was conducted on spiked approved beef carcasses (n = 12) that statistically proved the two measuring units correlated. The two sampling techniques were conducted on the same game carcasses (n = 13) and analyses performed for aerobic plate count (APC), Escherichia coli and Staphylococcus aureus, for both techniques. A more representative result was obtained by swabbing and no damage was caused to the carcass. Conversely, the excision technique yielded fewer organisms and caused minor damage to the carcass. The recovery ratio from the sampling technique improved 5.4 times for APC, 108.0 times for E. coli and 3.4 times for S. aureus over the results obtained from the excision technique. It was concluded that the sampling methods of excision and swabbing can be used to obtain bacterial profiles from both export and local carcasses and could be used to indicate whether game carcasses intended for the local market are possibly on par with game carcasses intended for the export market and therefore safe for human consumption.

  9. The physicochemical properties and antioxidative potential of raw thigh meat from broilers fed a dietary medicinal herb extract mixture

    Directory of Open Access Journals (Sweden)

    K. Shirzadegan

    2014-07-01

    Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.

  10. Lessons learned from a textbook outbreak: EHEC-O157:H7 infections associated with the consumption of raw meat products, June 2012, Limburg, Belgium.

    Science.gov (United States)

    Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis

    2014-01-01

    On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.

  11. Is meat quality from Longissimus lumborum samples correlated with other cuts in horse meat?

    Science.gov (United States)

    De Palo, Pasquale; Maggiolino, Aristide; Centoducati, Pasquale; Milella, Paola; Calzaretti, Giovanna; Tateo, Alessandra

    2016-03-01

    The present work aims to investigate if the variation of each parameter in Longissimus lumborum muscle could correspond to the same or to a similar variation of the parameter in the other muscles. The work presents results of Pearson's correlations between Longissimus lumborum samples and other muscle samples, such as Biceps femoris, Rectus femoris, Semimembranosus, Supraspinatus and Semitendinosus in horse meat. A total of 27 male IHDH (Italian Heavy Draught Horse) breed foals were employed. They were slaughtered at 11 months of age and the above-mentioned muscles were sampled. The Longissimus lumborum muscle showed to be representative of other muscles and of the whole carcass for some chemical parameters (moisture, protein and ash) and for some fatty acids profile patterns such as C12:0, C14:0, total monounsaturated fatty acid and polyunsaturated fatty acid, but poor correlations were recorded for intramuscular fat concentration, rheological and colorimetric parameters. Although almost all the qualitative parameters in meat are affected by the anatomical site and by the muscle, the Longissimus lumborum is often not representative in horse meat with regard to modifications of this parameters. © 2015 Japanese Society of Animal Science.

  12. Omega-3 fatty acids, nutrient retention values, and sensory meat eating quality in cooked and raw Australian lamb.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    This study evaluated omega-3 intramuscular fatty acids in the longissimus thoracis et lumborum of commercially prepared Australian lamb loin chops. Meats, denuded of external fats were cooked by means of conductive dry-heat using a fry grilling hot plate, to a core temperature of 70°C. An untrained consumer panel assessed meat appearance, aroma, tenderness, juiciness, taste and overall liking. Results showed no compositional alterations (P>0.05) to omega-3 fatty acids due to cooking treatment, whereas on absolute terms (mg/100g muscle) omega-3 fatty acids significantly (Pcooked meat at 32.8±2.3mg/100g muscle exceeded the minimum 30mg/100g per edible portion required for the defined Australian classification as 'source' long-chain (≥C 20 ) omega-3 for cooked lamb. A 3.4% intramuscular fat content in the initial raw meat was sufficient to maintain acceptable overall sensory eating quality. Results endorse the application of this cooking method to enable delivery of health beneficial long-chain omega-3 fatty acids of commercially prepared Australian lamb loin chops to consumers without impediments to sensory eating properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR.

    Science.gov (United States)

    Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg

    2012-01-01

    The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

  14. The radioactivity of meat samples between 1977 and 1982

    International Nuclear Information System (INIS)

    Zalabai, Bela

    1983-01-01

    90 Sr and 137 Cs from atmospheric nuclear explosions can get into the organizations of domestic animals via fodder. Radiological tests of meat samples revealed a load maximum last time in 1976. The regular tests of pork and beef samples between 1977 and 1982 in Hungary showed no significant differences in their radiocesium contents. The change of strontium activity in bones, however, lasts longer than that of cesium. According to the measurements, the strontium activity in swine bones was almost one order lower than that in cattle bones. (Sz.J.)

  15. Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2017-01-01

    Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

  16. Effect of chosen lactic acid bacteria strains on Staphylococcus aureus in vitro as well as in meat and raw sausages.

    Science.gov (United States)

    Gomółka-Pawlicka, M; Uradziński, J; Wiszniewska, A

    2004-01-01

    The present study was aimed at determining the influence of 15 strains of lactic acid bacteria on the growth of 2 Staphylococcus aureus strains in vitro as well as in meat and raw sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus sp. strains and, partly, methodological approach. The study also considered water activity (a(w)) and pH of the products investigated. The results obtained are demonstrated in 5 diagrams. It was found that among 15 strains of Lactobacillus aureus investigated only one strain, Lactobacillus helveticus T 78, showed antagonistic effect on studied strains of Staphylococcus aureus both in vitro as well as in meat and raw sausages. Five other strains of Lactobacillus spp. displayed the antagonistic effect in vitro only. The temperature and incubation time of sausages, but also the type of sausage stuffing were found to have a distinct or slight influence, respectively, on the antagonistic interaction between the bacteria. However, this phenomenon was affected by neither a(w) nor pH.

  17. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  18. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat

    Directory of Open Access Journals (Sweden)

    Aaron Ross Flakemore

    2017-08-01

    Full Text Available Abstract Background Omega-3 long-chain (≥C20 polyunsaturated fatty acids (ω3 LC-PUFA confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO was evaluated. Methods Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO: a control diet at 0 mL/kg DM of DCCO (DCCOC; 25 mL/kg DM of DCCO (DCCOM and 50 mL/kg DCCO (DCCOH. Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Results Within raw meats: DCCOH supplemented lambs had significantly (P < 0.05 higher concentrations of eicosapentaenoic (EPA, 20:5ω3 and EPA + docosahexaenoic (DHA, 22:6ω3 acids than those supplemented with DCCOM or DCCOC; Dorset sired lambs contained significantly (P < 0.05 more EPA and EPA + DHA than other sire breeds; diet and sire breed interactions were significant (P < 0.05 in affecting EPA and EPA + DHA concentrations. In cooked meat, ω3 LC-PUFA concentrations in DCCOM (32 mg/100 g, DCCOH (38 mg/100 g, Dorset (36 mg/100 g, White Suffolk (32 mg/100 g, ewes (32 mg/100 g and wethers (33 mg/100 g, all exceeded the minimum content of 30 mg/100 g of edible cooked portion of EPA + DHA for Australian defined ‘source’ level ω3 LC-PUFA classification. Conclusion These results present that combinations of dietary degummed crude canola oil, sheep genetics and culinary preparation method can be used as

  19. Compared with Raw Bovine Meat, Boiling but Not Grilling, Barbecuing, or Roasting Decreases Protein Digestibility without Any Major Consequences for Intestinal Mucosa in Rats, although the Daily Ingestion of Bovine Meat Induces Histologic Modifications in the Colon.

    Science.gov (United States)

    Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire

    2016-08-01

    Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications

  20. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  1. THE USAGE OF ANIMAL AND VEGETABLE ORIGIN RAW MATERIALS COMBINATORICS IN MEAT PRODUCTS OF “HALAL†CATEGORY DEVELOPMENT

    OpenAIRE

    Ivan F. Gorlov; Oksana B. Gelunova; Tatiana M. Giro; Ekaterina P. Mirzayanova

    2014-01-01

    Integrated researches aimed to develop technologies and recipes for meat products of “Halal†category using seed fat and Milk Protein-Carbohydrate Concentrate (MPCC) represent a new generation of scientific and practical interest. In this connection, the authors propose technologies and recipes for meat products of “Halal†category, designed on the basis of rational combinatorics of animal and vegetable origin raw materials, that l...

  2. Impact of rearing conditions on the microbiological quality of raw retail poultry meat.

    Science.gov (United States)

    Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene

    2013-08-01

    There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®

  3. Aerobic Mesophilic, Coliform, Escherichia coli, and Staphylococcus aureus Counts of Raw Meat from the Formal and Informal Meat Sectors in South Africa.

    Science.gov (United States)

    Jaja, Ishmael Festus; Green, Ezekiel; Muchenje, Voster

    2018-04-21

    Foodborne disease (FBD) is a global public health concern, and foods from animal sources have been associated with outbreaks of food-related illness. In this study, animal carcasses from the two abattoirs (HT1 and HT2) in the formal meat sector (FMS) and slaughter points in the informal meat sector (INMS) were examined at two stages of slaughter (before washing and after washing) for aerobic colony counts (ACC) and total viable count (TCC), as well as Escherichia coli and Staphylococcus aureus count. At each stage, carcasses were sampled by swabbing at the neck, brisket, flank, and rump. ACC for beef, mutton, and pork carcasses at HT1 and HT2 before washing were between 2.5⁻5.8, 2.2⁻4.7, and 2.7⁻3.7 mean log CFU/cm², respectively, and TCC count before washing was highest on the neck of cattle (6.3 ± 2.4) and after washing was highest on the perineal of sheep (5.7 ± 6.9). In the INMS, TCC count was highest on the brisket (6.9 ± 3.2) and in the neck (5.5 ± 2.4). Higher ACC values of 6.2⁻6.7 mean log CFU/cm² were obtained in the INMS. The highest count for E. coli (4.2 mean log CFU/cm²) after washing was in the neck, while the highest count for S. aureus (4.0 mean log CFU/cm²) was in the flank. All bacteria count in the INMS exceeded acceptable limits, and washing did not significantly reduce microbial load in meat in the FMS and INMS. Bacteria count in the FMS and INMS exceeded acceptable standards. However, meat processed in the INMS poses a more significant risk of FBD to consumers.

  4. Improvement of biomolecular methods for the identification and typing of Escherichia coli O157:H7 isolated from raw meat.

    Science.gov (United States)

    Paris, A; Bonardi, S; Bacci, C; Boni, E; Salmi, F; Bassi, L; Brindani, F

    2010-06-01

    The aim of the study was to evaluate the sensitivity of two m-PCR methods for the quantitative determination of E. coli O157:H7 in foodstuffs. Genomic serotyping was carried out on bacterial cultures, and the necessary time was optimized to increase the resolution of the method. Subsequently, artificial contamination trials using meat were conducted to assess method accuracy in foodstuffs and pursue the genetic typing of pathogens. Measurement thresholds were shown to range between 10(5) and 10(6) CFU/mL, but were reduced by four logarithmic cycles in 80% of samples. Relative to the meat contamination trials, serotypes were identified after 24 hours, corresponding to 10 CFU/mL inoculum, with higher rates seen when m-TSB was used for enrichment. Inoculated samples were found to contain three virulence factors (hlyA, eaeA, and stx1).

  5. Effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits.

    Science.gov (United States)

    Liao, Kuoyao; Cai, Jingyi; Shi, Zhujun; Tian, Gang; Yan, Dong; Chen, Delin

    2017-06-01

    This study was conducted to investigate the effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits, in order to determine appropriate rabbit feed processing methods and processing parameters. In Exp. 1, an orthogonal design was adopted. Barrel temperature, material moisture content and feed rate were selected as test factors, and acid detergent fiber (ADF) content was selected as an evaluation index to research the optimum extrusion parameters. In Exp. 2, a two-factor design was adopted. Four kinds of rabbit feeds were processed and raw material extrusion adopted optimum extrusion parameters of Exp. 1. A total of 40 healthy and 42-day-old rabbits with similar weight were used in a randomized design, which consisted of 4 groups and 10 replicates in each group (1 rabbits in each replicate). The adaptation period lasted for 7 d, and the digestion trial lasted for 4 d. The results showed as follows: 1) ADF was significantly affected by barrel temperature ( P  digestibility of dry matter and total energy ( P  digestibility of crude fiber (CF), ADF and NDF ( P  digestibility of rabbit feed. Thus, using extrusion and steam conditioning technology at the same time in the weaning rabbits feed processing can improve the pellet quality and nutrient apparent digestibility of rabbit feed.

  6. Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food

    International Nuclear Information System (INIS)

    Lari, L; Dudkiewicz, A

    2014-01-01

    Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility

  7. Sample preparation and EFTEM of Meat Samples for Nanoparticle Analysis in Food

    Science.gov (United States)

    Lari, L.; Dudkiewicz, A.

    2014-06-01

    Nanoparticles are used in industry for personal care products and the preparation of food. In the latter application, their functions include the prevention of microbes' growth, increase of the foods nutritional value and sensory quality. EU regulations require a risk assessment of the nanoparticles used in foods and food contact materials before the products can reach the market. However, availability of validated analytical methodologies for detection and characterisation of the nanoparticles in food hampers appropriate risk assessment. As part of a research on the evaluation of the methods for screening and quantification of Ag nanoparticles in meat we have tested a new TEM sample preparation alternative to resin embedding and cryo-sectioning. Energy filtered TEM analysis was applied to evaluate thickness and the uniformity of thin meat layers acquired at increasing input of the sample demonstrating that the protocols used ensured good stability under the electron beam, reliable sample concentration and reproducibility.

  8. Raw meat based diet influences faecal microbiome and end products of fermentation in healthy dogs.

    Science.gov (United States)

    Sandri, Misa; Dal Monego, Simeone; Conte, Giuseppe; Sgorlon, Sandy; Stefanon, Bruno

    2017-02-28

    Dietary intervention studies are required to deeper understand the variability of gut microbial ecosystem in healthy dogs under different feeding conditions and to improve diet formulations. The aim of the study was to investigate in dogs the influence of a raw based diet supplemented with vegetable foods on faecal microbiome in comparison with extruded food. Eight healthy adult Boxer dogs were recruited and randomly divided in two experimental blocks of 4 individuals. Dogs were regularly fed a commercial extruded diet (RD) and starting from the beginning of the trial, one group received the raw based diet (MD) and the other group continued to be fed with the RD diet (CD) for a fortnight. After 14 days, the two groups were inverted, the CD group shifted to the MD and the MD shifted to the CD, for the next 14 days. Faeces were collected at the beginning of the study (T0), after 14 days (T14) before the change of diet and at the end of experimental period (T28) for DNA extraction and analysis of metagenome by sequencing 16SrRNA V3 and V4 regions, short chain fatty acids (SCFA), lactate and faecal score. A decreased proportion of Lactobacillus, Paralactobacillus (P diet significantly (P diet composition modifies faecal microbial composition and end products of fermentation. The administration of MD diet promoted a more balanced growth of bacterial communities and a positive change in the readouts of healthy gut functions in comparison to RD diet.

  9. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  10. 40 CFR 89.413 - Raw sampling procedures.

    Science.gov (United States)

    2010-07-01

    ... of the exhaust pipe—whichever is the larger—upstream of the exit of the exhaust gas system. (b) In..., such as in a “Vee” engine configuration, it is permissible to: (1) Sample after all exhaust pipes have been connected together into a single exhaust pipe. (2) For each mode, sample from each exhaust pipe...

  11. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  12. Estimating waste disposal quantities from raw waste samples

    International Nuclear Information System (INIS)

    Negin, C.A.; Urland, C.S.; Hitz, C.G.; GPU Nuclear Corp., Middletown, PA)

    1985-01-01

    Estimating the disposal quantity of waste resulting from stabilization of radioactive sludge is complex because of the many factors relating to sample analysis results, radioactive decay, allowable disposal concentrations, and options for disposal containers. To facilitate this estimation, a microcomputer spread sheet template was created. The spread sheet has saved considerable engineering hours. 1 fig., 3 tabs

  13. meat

    African Journals Online (AJOL)

    p2492989

    These nutrient values determined in meat from red hartebeest could ... percentage of a-linolenic acid (C18:3n-3) (Wiklund et al., 2001). .... system (1525 HPLC with a binary gradient delivery, 717 auto-sampler and Injector, 1500 ..... polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork: A review.

  14. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  15. Effects of diet, packaging, and irradiation on protein oxidation, lipid oxidation, and color of raw broiler thigh meat during refrigerated storage.

    Science.gov (United States)

    Xiao, S; Zhang, W G; Lee, E J; Ma, C W; Ahn, D U

    2011-06-01

    This study was designed to evaluate the effects of dietary treatment, packaging, and irradiation singly or in combination on the oxidative stability of broiler chicken thigh meat. A total of 120 four-week-old chickens were divided into 12 pens (10 birds/pen), and 4 pens of broilers were randomly assigned to a control oxidized diet (5% oxidized oil) or an antioxidant-added diet [500 IU of vitamin E + 200 mg/kg of butylated hydroxyanisole (BHA)] and fed for 2 wk. After slaughter, thigh meats were separated, ground, packaged in either oxygen-permeable or oxygen-impermeable vacuum bags, and irradiated at 0 or 3 kGy. Lipid oxidation (TBA-reactive substances), protein oxidation (carbonyl), and color of the meat were measured at 1, 4, and 7 d of refrigerated storage. The lipid and protein oxidation of thigh meats from birds fed the diet supplemented with antioxidants (vitamin E + BHA) was significantly lower than the lipid and protein oxidation of birds fed the control diet, whereas the lipid and protein oxidation of broilers fed the oxidized oil diet was higher than that of birds fed the control diet. Vacuum packaging slowed, but irradiation accelerated, the lipid and protein oxidation of thigh meat during storage. Dietary antioxidants (vitamin E + BHA) and irradiation treatments showed a stronger effect on lipid oxidation than on protein oxidation. A significant correlation between lipid and protein oxidation in meat was found during storage. Dietary supplementation of vitamin E + BHA and the irradiation treatment increased the lightness and redness of thigh meat, respectively. It is suggested that appropriate use of dietary antioxidants in combination with packaging could be effective in minimizing oxidative changes in irradiated raw chicken thigh meat.

  16. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  17. Predicting the concentration of verotoxin-producing Escherichia coli bacteria during processing and storage of fermented raw-meat sausages.

    Science.gov (United States)

    Quinto, E J; Arinder, P; Axelsson, L; Heir, E; Holck, A; Lindqvist, R; Lindblad, M; Andreou, P; Lauzon, H L; Marteinsson, V Þ; Pin, C

    2014-05-01

    A model to predict the population density of verotoxigenic Escherichia coli (VTEC) throughout the elaboration and storage of fermented raw-meat sausages (FRMS) was developed. Probabilistic and kinetic measurement data sets collected from publicly available resources were completed with new measurements when required and used to quantify the dependence of VTEC growth and inactivation on the temperature, pH, water activity (aw), and concentration of lactic acid. Predictions were compared with observations in VTEC-contaminated FRMS manufactured in a pilot plant. Slight differences in the reduction of VTEC were predicted according to the fermentation temperature, 24 or 34°C, with greater inactivation at the highest temperature. The greatest reduction was observed during storage at high temperatures. A population decrease greater than 6 decimal logarithmic units was observed after 66 days of storage at 25°C, while a reduction of only ca. 1 logarithmic unit was detected at 12°C. The performance of our model and other modeling approaches was evaluated throughout the processing of dry and semidry FRMS. The greatest inactivation of VTEC was predicted in dry FRMS with long drying periods, while the smallest reduction was predicted in semidry FMRS with short drying periods. The model is implemented in a computing tool, E. coli SafeFerment (EcSF), freely available from http://www.ifr.ac.uk/safety/EcoliSafeFerment. EcSF integrates growth, probability of growth, and thermal and nonthermal inactivation models to predict the VTEC concentration throughout FRMS manufacturing and storage under constant or fluctuating environmental conditions.

  18. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  19. 40 CFR 90.414 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... probe may not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe must be... the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to the HC... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  20. 40 CFR 89.412 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... the exhaust pipe shall be as small as practical in order to minimize heat loss from the probe. (2) The... sample transport system from the engine exhaust pipe to the HC analyzer and the NOX analyzer must be... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  1. 40 CFR 91.414 - Raw gaseous exhaust sampling and analytical system description.

    Science.gov (United States)

    2010-07-01

    ... shall not be greater than 0.10 cm. The fitting that attaches the probe to the exhaust pipe shall be as... internally to the different analyzers. (2) Heat the sample transport system from the engine exhaust pipe to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Raw gaseous exhaust sampling and...

  2. Personality and attitudinal correlates of meat consumption: Results of two representative German samples.

    Science.gov (United States)

    Pfeiler, Tamara M; Egloff, Boris

    2018-02-01

    The vast amount of meat consumed in the Western world is critically discussed with regard to negative health consequences, environmental impact, and ethical concerns for animals, emphasizing the need to extend knowledge regarding the correlates of meat consumption in the general population. In the present article, we conducted two studies examining the associations between meat consumption and personality traits, political attitudes, and environmental attitudes in two large German representative samples (N total  = 8,879, aged 18-96 years). Cross-sectional data on frequency of meat consumption, socio-demographics, personality traits, and political and environmental attitudes were collected via self-reports. In both studies, male sex, younger age, and lower educational attainment were significantly positively related to meat consumption. In Study 1, results of the partial correlations and the hierarchical regression analysis controlling for socio-demographics showed that the personality traits of openness and agreeableness, as well as conservative political and social views, explained unique variance in meat consumption. In Study 2, partial correlations and hierarchical regression analyses showed that openness, agreeableness, and conscientiousness were all uniquely negatively related to meat consumption. Moreover, these analyses documented that people scoring high in right-wing attitudes and low in pro-environmental attitudes reported more overall meat consumption. Taken together, these two studies provided evidence that socio-demographics, personality traits, and attitudes are indeed related to how much meat is consumed. Implications and future prospects for the study of individual differences in meat consumption are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Presence of Salmonella Spp and Escherichia Coli O157:H7 in Raw Meat, in São Paulo City, Brazil and Evaluation of Low Temperature (Refrigeration and Freezing) Resistance of these Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)

    2005-01-15

    A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)

  4. Quality characteristics of raw and canned goat meat in water, brine, oil and Thai curry during storage

    OpenAIRE

    Yoottana Polpara; Thanyaporn Sornprasitt; Saowakon Wattanachant

    2008-01-01

    The quality characteristics of three groups of goat meat obtained from one year and three years old Anglonubian crossed native, and culled Saanen crossed native were investigated. Significant differences in fat, ash and total collagen content, were observed among groups of goat meat (P

  5. Nutritional quality of raw and processed unripe Carica papaya fruit ...

    African Journals Online (AJOL)

    the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...

  6. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  7. Study on natural radionuclide activities in meat samples consumed in Sao Paulo City, Brazil

    International Nuclear Information System (INIS)

    Rosa, Mychelle M.L.; Taddei, Maria HelenaT.

    2015-01-01

    Consumption of food is usually the most important route by which natural and artificial radionuclides can enter the human body. An assessment of radionuclide levels in different foods and diets is therefore important to estimate the intake of these radionuclides by man. The contamination by radionuclides can occur via the food chain (soil, root, plant and animal), with emphasis to the long half-life radionuclides, which can also have their transfer through the animal meat. The inclusion of meat in human nutrition is important because it is an excellent source of high quality protein, nutrient related to construction and cell regeneration. This work aims the determination of natural radionuclides ( 234 U, 235 U, 238 U, 228 Th, 230 Th, 232 Th, 226 Ra, 228 Ra, and 210 Pb) in meat samples. Five groups of samples were analyzed, such as cattle meat (beef), fish, pork, poultry, and processed meat, after radiochemical separation followed by alpha or alpha beta spectrophotometry, and total count quantification. The determination of these radionuclides is very important because they are products of the natural decay series of 238 U and 232 Th, being easily found in meat samples. (author)

  8. Study on natural radionuclide activities in meat samples consumed in Sao Paulo City, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Rosa, Mychelle M.L.; Taddei, Maria HelenaT. [Comissao Nacional de Energia Nuclear (LAPOC/CNEN), Pocos de Caldas, MG (Brazil). Laboratorio de Pocos de Caldas; Avegliano, Roseane P.; Maihara, Vera A., E-mail: mychelle@cnen.gov.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2015-07-01

    Consumption of food is usually the most important route by which natural and artificial radionuclides can enter the human body. An assessment of radionuclide levels in different foods and diets is therefore important to estimate the intake of these radionuclides by man. The contamination by radionuclides can occur via the food chain (soil, root, plant and animal), with emphasis to the long half-life radionuclides, which can also have their transfer through the animal meat. The inclusion of meat in human nutrition is important because it is an excellent source of high quality protein, nutrient related to construction and cell regeneration. This work aims the determination of natural radionuclides ({sup 234}U, {sup 235}U, {sup 238}U, {sup 228}Th, {sup 230}Th, {sup 232}Th, {sup 226}Ra, {sup 228}Ra, and {sup 210}Pb) in meat samples. Five groups of samples were analyzed, such as cattle meat (beef), fish, pork, poultry, and processed meat, after radiochemical separation followed by alpha or alpha beta spectrophotometry, and total count quantification. The determination of these radionuclides is very important because they are products of the natural decay series of {sup 238}U and {sup 232}Th, being easily found in meat samples. (author)

  9. Chemical and biotechnological processing of collagen-containing raw materials into functional components of feed suitable for production of high-quality meat from farm animals

    Science.gov (United States)

    Baburina, M. I.; Ivankin, A. N.; Stanovova, I. A.

    2017-09-01

    The process of chemical biotechnological processing of collagen-containing raw materials into functional components of feeds for effective pig rearing was studied. Protein components of feeds were obtained as a result of hydrolysis in the presence of lactic acid of the animal collagen from secondary raw materials, which comprised subcutaneous collagen (cuticle), skin and veined mass with tendons from cattle. For comparison, a method is described for preparing protein components of feeds by cultivating Lactobacillus plantarum. Analysis of the kinetic data of the conversion of a high-molecular collagen protein to an aminolyte polypeptide mixture showed the advantage of microbiological synthesis in obtaining a protein for feeds. Feed formulations have been developed to include the components obtained, and which result in high quality pork suitable for the production of quality meat products.

  10. Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

    Directory of Open Access Journals (Sweden)

    afshin Nazari

    2007-10-01

    Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

  11. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  12. Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria

    DEFF Research Database (Denmark)

    Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.

    2013-01-01

    Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...

  13. FEEDING OF FERRETS WITH THE RAW MEAT AND LIVER OF CHICKENS CHRONICALLY POISONED WITH TOXIC GROUNDNUT MEAL.

    Science.gov (United States)

    PLATONOW, N; BEAUREGARD, M

    1965-03-01

    Chickens were fed a ration containing 30 per cent of toxic groundnut meal for up to six weeks. The concentration of aflatoxin (toxic metabolites of Aspergillus flavus) in the above ration was 3.06 p.p.m. At the end of 2nd, 4th or 6th week the birds were killed. The meat was removed from the bones and put through a meat grinder. The livers of three groups were pooled together. Three control groups of birds kept on commercial pellets were treated similarly. Female ferrets, two years of age, were used in the present study. They were divided into four groups. The first three groups were given for one month meat from chickens fed the toxic ration for 2, 4, and 6 weeks, respectively. Each of these three groups contained one control ferret that was fed with the meat of chickens fed a commercial ration for a similar period of time. One half of the 4th group was fed pooled liver from intoxicated birds and one half was fed liver from control birds. No significant changes in the ferret tissues were observed as a consequence of feeding them with the meat or liver from the chickens chronically poisoned with toxic groundnut meal.

  14. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market

    Directory of Open Access Journals (Sweden)

    Alvarado Pavel Espinoza

    2017-08-01

    Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.

  15. Residual Nitrite in Some Egyptian Meat Products and the Reduction Effect of Electron Beam Irradiation

    OpenAIRE

    Dalia A. Zahran; Gehan M.A. Kassem

    2011-01-01

    Nitrite, a curing agent of meat products, is a precursor of carcinogenic N-nitrosamines during processing of meat products or under human stomach conditions, as well as having its own toxicity. To investigate the residual nitrite level in meat products marketed in Egyptian markets, 160 samples of cured cooked (luncheon and frankfurter) and cured raw (oriental sausages and pastirma) meat products (40 sample each) were analyzed for residual nitrite by a spectrophotometric method. Samples were s...

  16. Soybean and lactose in meat products and preparations sampled at retail

    Directory of Open Access Journals (Sweden)

    Filomena Piccolo

    2016-06-01

    Full Text Available Food allergies and intolerances have increased during the last decades and regulatory authorities have taken different measures to prevent and manage consumers’ adverse reactions, including correct labelling of foods. Aim of this work was to search for soybean and lactose in meat products and meat preparations taken from retail in some provinces of Campania Region (Southern Italy and to evaluate the food labels compliance with Regulation (EU n.1169/2011. Soybean and lactose were searched using commercial kits in n. 58 samples of meat products produced in or distributed by 19 establishments, and in n. 55 samples of meat products and n. 8 of meat preparations produced in 21 plants. All samples were selected on the basis of the absence of any information on the labels about the presence of the two searched allergens, with the exception of n. 5 samples tested for lactose. Traces of soybean were detected in 50 out of the 58 examined samples, at concentrations up to 0.93 mg kg–1. Only two samples contained levels above the detection limit of 0.31 mg kg–1. Lactose levels ranging from 0.11 to 2.95 g/100 g, i.e. above the detection limit, were found in all the tested samples (n. 63. The results of the present research underline the need for careful controls and planning by operators as part of the self-control plans, and deserve attention from the competent authorities considering not only the consumers’ health but also the great attention media pay to regulations providing consumers with information on food.

  17. Analysis of micro-structure in raw and heat treated meat emulsions from multimodal X-ray microtomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2014-01-01

    This study presents a novel non-destructive X-ray technique for analyzing meat emulsions before and after heat treatment. The method is based on X-ray grating-interferometry where three complementary imaging modalities are obtained simultaneously measuring the absorption, refraction and scatterin...

  18. Detection of H5N1 high-pathogenicity avian influenza virus in meat and tracheal samples from experimentally infected chickens.

    Science.gov (United States)

    Das, Amaresh; Spackman, Erica; Thomas, Colleen; Swayne, David E; Suarez, David L

    2008-03-01

    The Asian H5N1 highly pathogenic avian influenza (HPAI) virus causes a systemic disease with high mortality of poultry and is potentially zoonotic. In both chickens and ducks, the virus has been demonstrated to replicate in both cardiac and skeletal muscle cells. Experimentally, H5N1 HPAI virus has been transmitted to chickens through the consumption of raw infected meat. In this study, we investigated virus replication in cardiac and skeletal muscle and in the trachea of chickens after experimental intranasal inoculation with the H5N1 HPAI virus. The virus was detected in tissues by real-time reverse transcription-polymerase chain reaction (RRT-PCR) and virus isolation, and in the trachea by RRT-PCR and a commercial avian influenza (AI) viral antigen detection test. A modified RNA extraction protocol was developed for rapid detection of the virus in tissues by RRT-PCR. The H5N1 HPAI virus was sporadically detected in meat and the tracheas of infected birds without any clinical sign of disease as early as 6 hr postinfection (PI), and was detected in all samples tested at 24 hr PI and later. No differences in sensitivity were seen between virus isolation and RRT-PCR in meat samples. The AI viral antigen detection test on tracheal swabs was a useful method for identifying infected chickens when they were sick or dead, but was less sensitive in detecting infected birds when they were preclinical. This study provides data indicating that preslaughter tracheal swab testing can identify birds infected with HPAI among the daily mortality and prevent infected flocks from being sent to processing plants. In addition, the modified RNA extraction and RRT-PCR test on meat samples provide a rapid and sensitive method of identifying HPAI virus in illegal contraband or domestic meat samples.

  19. Effect of irradiation dose and irradiation temperature on the thiamin content of raw and cooked chicken breast meat

    International Nuclear Information System (INIS)

    Graham, W.D.; Stevenson, M.H.; Stewart, E.M.

    1998-01-01

    The usefulness of ionising radiation for the elimination of pathogenic bacteria in poultry meat has been well documented as have the effects of this processing treatment on the nutritional status of the food, in particular, the vitamins. Unfortunately, much of the earlier research carried out on the effect of irradiation on vitamins was carried out in solution or in model systems at doses much greater than those used commercially thereby resulting in considerable destruction of these compounds. Thus, those opposed to the process of food irradiation labelled the treated food as nutritionally poor. However, in reality, due to the complexity of food systems the effects of irradiation on vitamins are generally not as marked and many processes, for example cooking, cause the same degree of change to the vitamins. Thiamin (vitamin B1) is the most radiation sensitive of the water-soluble vitamins and is therefore a good indicator of the effect of irradiation treatment. In this study the effects of irradiation at either 4°C or −20°C followed by cooking on the thiamin content of chicken breast meat was determined. Results showed that whilst both irradiation and cooking resulted in a decrease in thiamin concentration, the losses incurred were unlikely to be of nutritional significance and could be further minimised by irradiating the chicken meat at a low temperature. Thiamin analyses were carried out using high-performance liquid chromatography since this technique is faster and more selective than the chemical or microbiological methods more commonly employed. Total thiamin, both free and combined form, was determined following acid and enzyme hydrolysis. © 1998 Society of Chemical Industry

  20. Occurrence and characterization of shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh

    NARCIS (Netherlands)

    Islam, M.A.; Mondol, A.S.; Azmi, I.J.; Boer, de E.; Beumer, R.R.; Zwietering, M.H.; Heuvelink, A.E.; Talukder, K.A.

    2010-01-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)–producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of

  1. Comparative antioxidant effect of BHT and water extracts of banana and sapodilla peels in raw poultry meat.

    Science.gov (United States)

    Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita

    2014-02-01

    Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.

  2. Incomplete sanitation of a meat grinder and ingestion of raw ground beef: contributing factors to a large outbreak of Salmonella typhimurium infection.

    Science.gov (United States)

    Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P

    1997-10-01

    Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.

  3. Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.

    Science.gov (United States)

    Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E

    2016-05-01

    We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.

  4. Content of ochratoxin A in paired kidney and meat samples from healthy Danish slaughter pigs

    DEFF Research Database (Denmark)

    Jørgensen, Kevin; Petersen, Annette

    2002-01-01

    In 1999, paired samples of kidney and meat were taken from 300 healthy Danish pigs and analysed for ochratoxin A. The concentrations of ochratoxin A in kidney ranged from 0 to 15 mug kg(-1) (mean 0.50 mug kg(-1), median 0.18 mug kg(-1)) and in meat from 0 to 2.9 mug kg(-1) (mean 0.12 mug kg(-1......), median 0.03 mug kg(-1)). The data together with the Danish control data show that today the pig industry in Denmark has no problem keeping the content of ochratoxin A in pig at very low levels even in years with wet harvest conditions. The mean ratio 'content in meat/content in kidney' for paired samples...... was 39%. For kidney samples > 1.0 mug kg(-1), the mean ratio was 22%. The Danish control system for ochratoxin A in pig kidney established in 1978 can be regarded as a success because the levels in pig have been reduced substantially, and hence for the consumer the contribution from pig products...

  5. Microbiological, physicochemical and sensory parameters of dry fermented sausages manufactured with high hydrostatic pressure processed raw meat.

    Science.gov (United States)

    Omer, M K; Prieto, B; Rendueles, E; Alvarez-Ordoñez, A; Lunde, K; Alvseike, O; Prieto, M

    2015-10-01

    The aim of this trial was to describe physicochemical, microbiological and organoleptic characteristics of dry fermented sausages produced from high hydrostatic pressure (HHP) pre-processed trimmings. During ripening of the meat products pH, weight, water activity (aw), and several microbiological parameters were measured at zero, eight, fifteen days and after 6weeks. Sensory characteristics were estimated at day 15 and after six weeks by a test panel by using several sensory tests. Enterobacteriaceae were not detected in sausages from HHP-processed trimmings. Fermentation was little affected, but weight and aw of the HHP-processed sausages decreased faster during ripening. HHP-treated sausages were consistently less favoured than non HHP-treated sausages, but the strategy may be an alternative approach if the process is optimized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. On-chip sample preparation for complete blood count from raw blood.

    Science.gov (United States)

    Nguyen, John; Wei, Yuan; Zheng, Yi; Wang, Chen; Sun, Yu

    2015-03-21

    This paper describes a monolithic microfluidic device capable of on-chip sample preparation for both RBC and WBC measurements from whole blood. For the first time, on-chip sample processing (e.g. dilution, lysis, and filtration) and downstream single cell measurement were fully integrated to enable sample preparation and single cell analysis from whole blood on a single device. The device consists of two parallel sub-systems that perform sample processing and electrical measurements for measuring RBC and WBC parameters. The system provides a modular environment capable of handling solutions of various viscosities by adjusting the length of channels and precisely controlling mixing ratios, and features a new 'offset' filter configuration for increased duration of device operation. RBC concentration, mean corpuscular volume (MCV), cell distribution width, WBC concentration and differential are determined by electrical impedance measurement. Experimental characterization of over 100,000 cells from 10 patient blood samples validated the system's capability for performing on-chip raw blood processing and measurement.

  7. Molecular assay to fraud identification of meat products.

    Science.gov (United States)

    Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim

    2014-01-01

    Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.

  8. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    International Nuclear Information System (INIS)

    Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel

    2015-01-01

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  9. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    Energy Technology Data Exchange (ETDEWEB)

    Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2015-12-11

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  10. Antibiotic resistance in bacteria Staphylococcus spp. isolated from samples of raw sheep's milk

    Directory of Open Access Journals (Sweden)

    Milan Vasiľ

    2016-12-01

    Full Text Available From samples of raw sheep's milk were determined results of bacteriological examination from two herds in region of Eastern Slovakia in three years lasting study. The occurrence of Staphylococcus spp. 41.6% (124 was determined from 298 samples. The seven species of staphylococci were on a regular basis isolated: S. epidermidis (34, S. chromogenes (26, S. aureus (16. Alternately have been recorded S. warneri (16, S. schleiferi (15, S. haemolyticus (9 and S. xylosus (8. All isolated pathogens were tested by in vitro test on Mueller-Hinton agar by disc methods on resistance to 10 types of antibiotics.  Highest value of resistance was determined to Penicilin 21.0%, Neomycin 10.5% and Novobiocin 9.7%. Lower resistance was in to Oxacilin 7.2% and Amoxicilin 6.5%. Minimal resistance was founded to Cefoxitin 0.8%, Linkomycin 2.4%, Erytromycin, and Streptomycin 3.2%. Was founded total resistance (21.0% to all antibiotics in S. epidermidis (34 during the three years, S. chromogenes (26 showed resistance to 8 types of antibiotics (12.9%, S. aureus (16 to 6 antibiotics (10.5% and S. warneri (16 to 4 antibiotics (5.6%. It was confirmed that sheep's milk remains a major source of staphylococci. Bacteria in comparison with isolates from cows' raw milk, showed lower values of resistance, but were resistant to more than two antibiotics. Recorded occurrence of resistance in staphylococci may be connected with a minimum use of antibiotics in the treatment of mastitis and other diseases in sheep herds. Reported resistance to the tested antibiotics became the basis for the recommendation to use preparations to treat mastitis in sheep principally by the detection of resistance to antibiotics contained.

  11. Sampling and Homogenization Strategies Significantly Influence the Detection of Foodborne Pathogens in Meat.

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-01-01

    Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.

  12. Fate of acid-resistant and non-acid resistant Shiga toxin-producing Escherichia coli strains in experimentally contaminated French fermented raw meat sausages.

    Science.gov (United States)

    Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C

    2009-02-28

    Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.

  13. Effect of gamma-radiation treatment on the lipids of meat products during storage.II Fatty acid composition in durable raw-dried products of chopped meat

    International Nuclear Information System (INIS)

    Dimitrov, G.; Bakalivanova, T.; Tsvetkova, E.; Grigorova, S.; Marinova, T.

    2004-01-01

    Studied is the effect of gamma rays treatment with 4 kGy on the total fatty acid composition (FAC) of Karlovska Lukanka and Shumenski Sudzhuk for 30 days and nights from the moment of treatment with gamma-rays. The saturated fatty acids in the Lukanka/flat sausage/ are 42,5-44,7% of the total lipids, and in the Sudzhuk/sausage/ the level of the saturated fatty acids is 45,7-49,7%. The mono-unsaturated fatty acids in the two products are between 44 and 47%. The share of poly-unsaturated fatty acids in the Lukanka is over 10% of the total lipids, and in the Sudzhuk - 7%. It was established that the treatment of Karlovo Lukanka and Shumen Sudzhuk with 4 kGy gamma-rays: does not affect the total fatty acid composition of the tested samples; does not change the balance in the fatty acid composition and the nutritional value of the tested samples; does not change the quantity of the essential fatty acids; quarantees the safety of the treated products

  14. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  15. Healthier meat and meat products: Their role as functional foods

    OpenAIRE

    Jiménez Colmenero, Francisco; Carballo, José; Cofrades, Susana

    2001-01-01

    This review deals with the implications of meat and meat products for human health. It analyses the effect of the presence or absence of various factors: fat, fatty acid composition, cholesterol, calorific value, salt, nitrite or lipid oxidation products that can cause health problems. Bearing in mind these considerations, it then describes the strategies used in animal production, treatment of meat raw material and reformulation of meat products to obtain healthier meat and meat products. Fu...

  16. INCIDENCE OF FILAMENTOUS FUNGI WITH TOXIGENIC POTENTIAL ON SAMPLES OF FEED AND RAW MATERIALS FOR THEIR MANUFACTURE

    Directory of Open Access Journals (Sweden)

    Rodrigo Vera

    2016-06-01

    Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.

  17. The detection and antimicrobial susceptibility profile of Shigella isolates from meat and swab samples at butchers' shops in Gondar town, Northwest Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Hagos, Zenabu; Zegeye, Bidir; Addis, Zelalem

    2016-01-01

    Food borne pathogens are major causes of deaths, illnesses and billions of dollars of expenses. The burden of food borne illness is worsened by the ever increasing rate of antimicrobial resistance microbes. Shigella, a bacterial pathogen associated with food, is reported to account for higher prevalence rates of food borne illness in different settings. A cross-sectional study was conducted from February 10 to June 30, 2013, at the butcher houses of Gondar town in the Northwest of Ethiopia to assess the prevalence and antimicrobial susceptibility pattern of Shigella. Cattle raw meat and swab samples from selected critical control points, including knives, chopping boards, and the hands and noses of butchers, were collected and analyzed. The identification of Shigella was carried out using colony characteristics, the Gram reaction, and biochemical tests. Antimicrobial susceptibility testing was performed using the Kirby-Bauer disc diffusion method. The overall hygienic status of the butcher shops was also assessed using a checklist. An observational analysis revealed that the sanitary condition of the butcher shops and their premises was poor. Of 306 samples screened, 10.5% were positive for Shigella. Approximately 7.4% of meat samples and 10.2% of swab samples were contaminated with Shigella. Out of the total Shigella isolates, 90.6%, 46.9%, 18.8% and 9.4% were resistant to ampicillin, amoxicillin, ceftriaxone and tetracycline, respectively. A multidrug resistance pattern was recorded in 27.8% of the isolates. In conclusion, the safety of meat sold at Gondar butchers houses was poor. The identified Shigella isolates showed high levels of drug resistance and multidrug resistance patterns for commonly used antimicrobials in veterinary and human medicine. Practicing wise use of antimicrobials and strict sanitary interventions at different critical control points is strongly recommended, in addition to further in-depth studies to prevent unprecedented consequences from

  18. Quantification of the neurotoxic beta-carboline harmane in barbecued/grilled meat samples and correlation with level of doneness.

    Science.gov (United States)

    Louis, Elan D; Zheng, Wei; Jiang, Wendy; Bogen, Kenneth T; Keating, Garrett A

    2007-06-01

    Harmane, one of the heterocyclic amines (HCAs), is a potent neurotoxin linked to human diseases. Dietary exposure, especially in cooked meats, is the major source of exogenous exposure for humans. However, knowledge of harmane concentrations in cooked meat samples is limited. Our goals were to (1) quantify the concentration of harmane in different types of cooked meat samples, (2) compare its concentration to that of other more well-understood HCAs, and (3) examine the relationship between harmane concentration and level of doneness. Thirty barbecued/grilled meat samples (8 beef steak, 12 hamburger, 10 chicken) were analyzed for harmane and four other HCAs (2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine [PhIP], amino-3,8-dimethylimidazo[4,5-f]quinoxaline [MeIQx], 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline [DiMeIQx], and 2-amino-1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine [IFP]). Mean (+/- SD) harmane concentration was 5.63 (+/- 6.63) ng/g; harmane concentration was highest in chicken (8.48 +/- 9.86 ng/g) and lowest in beef steak (3.80 +/- 3.6 ng/g). Harmane concentration was higher than that of the other HCAs and significantly correlated with PhIP concentration. Harmane concentration was associated with meat doneness in samples of cooked beef steak and hamburger, although the correlation between meat doneness and concentration was greater for PhIP than for harmane. Evidence indicates that harmane was detectable in nanograms per gram quantities in cooked meat (especially chicken) and, moreover, was more abundant than other HCAs. There was some correlation between meat doneness and harmane concentration, although this correlation was less robust than that observed for PhIP. Data such as these may be used to improve estimation of human dietary exposure to this neurotoxin.

  19. Quantification of the Neurotoxic β-Carboline Harmane in Barbecued/Grilled Meat Samples and Correlation with Level of Doneness

    Science.gov (United States)

    Louis, Elan D.; Zheng, Wei; Jiang, Wendy; Bogen, Kenneth T.; Keating, Garrett A.

    2016-01-01

    Harmane, one of the heterocyclic amines (HCAs), is a potent neurotoxin linked to human diseases. Dietary exposure, especially in cooked meats, is the major source of exogenous exposure for humans. However, knowledge of harmane concentrations in cooked meat samples is limited. Our goals were to (1) quantify the concentration of harmane in different types of cooked meat samples, (2) compare its concentration to that of other more well-understood HCAs, and (3) examine the relationship between harmane concentration and level of doneness. Thirty barbecued/grilled meat samples (8 beef steak, 12 hamburger, 10 chicken) were analyzed for harmane and four other HCAs (2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine [PhIP], amino-3,8-dimethylimidazo[4,5-f]quinoxaline [MeIQx], 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline [DiMeIQx], and 2-amino-1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine [IFP]). Mean (± SD) harmane concentration was 5.63 (± 6.63) ng/g; harmane concentration was highest in chicken (8.48 ± 9.86 ng/g) and lowest in beef steak (3.80 ± 3.6 ng/g). Harmane concentration was higher than that of the other HCAs and significantly correlated with PhIP concentration. Harmane concentration was associated with meat doneness in samples of cooked beef steak and hamburger, although the correlation between meat doneness and concentration was greater for PhIP than for harmane. Evidence indicates that harmane was detectable in nanograms per gram quantities in cooked meat (especially chicken) and, moreover, was more abundant than other HCAs. There was some correlation between meat doneness and harmane concentration, although this correlation was less robust than that observed for PhIP. Data such as these may be used to improve estimation of human dietary exposure to this neurotoxin. PMID:17497412

  20. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  1. β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

    Science.gov (United States)

    Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

    2011-07-01

    Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Antibacterial activity and optimisation of bacteriocin producing lactic acid bacteria isolated from beef (red meat) samples

    International Nuclear Information System (INIS)

    Ali, N.M.; Mazhar, B.; Khadija, I.; Kalim, B.

    2016-01-01

    Bacteriocin producing bacteria are commonly found in meat products to enhance their shelf-life. In the present study, bacterial species were isolated from meat samples (beef) from different localities of Lahore, Pakistan. MRS agar medium was used to isolate lactic acid bacteria (LAB) through spread and streak methods (incubated for 72 h at 37 degree C). Identification of bacteriocinogenic LAB strains was done by using staining techniques, morphology based characteristics and biochemical tests. These strains were BSH 1b, BSH 3a, BIP 4a, BIP 3a, BIP 1b and BRR 3a. Antibacterial activity of LAB was performed against food borne pathogens viz., Escherichia coli and Staphylococcus aureus through paper disc diffusion method. Three bacterial strains showed maximum inhibition and characterised by ribotyping viz., BIP 4a was identified as Lactobacillus curvatures, BIP 3a was Staphylococcus warneri and BIP 1b was Lactobacillus graminis . Optimum pH 5-6.5 and 30-37 degree C temperature for isolated bacterial strains was recorded. Protein concentration measured was 0.07 mg/mL for BSH 1b, 0.065 mg/mL for BSH 3a, 0.057 mg/mL for BIP 4a, 0.062 mg/mL for BIP 1b, 0.065 mg/mL for BIP 3a and for BRR 3a 0.078 mg/mL, respectively. Bacteriocin of all isolates except BIP 3a was found to be sensitive towards pepsin and resistant towards Rnase. Bacteriocin production was stable at between pH 5.0 and 6.0 and resistant temperature was 40 degree C. It was concluded that lactic acid bacteria (LAB) from meat can be helpful as antibacterial agents against food-borne bacterial pathogens because of thermostable producing bacteriocin. (author)

  3. Survey of Toxoplasma gondii antibodies in meat juice of wild boar (Sus scrofa in several districts of the Czech Republic

    Directory of Open Access Journals (Sweden)

    Karol Račka

    2015-05-01

    The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.

  4. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

    Science.gov (United States)

    Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A

    2011-11-01

    To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.

  5. Detection of Enterotoxigenic Clostridium perfringens in Meat Samples by Using Molecular Methods▿

    Science.gov (United States)

    Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A.

    2011-01-01

    To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >103 cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates. PMID:21890671

  6. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  7. In-gel and OFFGEL-based proteomic approach for authentication of meat species from minced meat and meat products.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth

    2018-02-01

    Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  9. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  10. Shiga toxin-producing Escherichia coli in meat: a preliminary simulation study on detection capabilities for three sampling methods

    Science.gov (United States)

    The objective of this simulation study is to determine which sampling method (Cozzini core sampler, core drill shaving, and N-60 surface excision) will better detect Shiga Toxin-producing Escherichia coli (STEC) at varying levels of contamination when present in the meat. 1000 simulated experiments...

  11. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-01-01

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100–400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat. PMID:27338486

  12. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat.

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-06-07

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100-400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat.

  13. Fast derivatization of fatty acids in different meat samples for gas chromatography analysis.

    Science.gov (United States)

    Figueiredo, Ingrid Lima; Claus, Thiago; Oliveira Santos Júnior, Oscar; Almeida, Vitor Cinque; Magon, Thiago; Visentainer, Jesuí Vergilio

    2016-07-22

    In order to analyze the composition of fatty acids employing gas chromatography as the separation method, a derivatization of lipids using esterification and transesterification reactions is needed. The methodologies currently available are time consuming and use large amounts of sample and reagents. Thus, this work proposes a new procedure to carry out the derivatization of fatty acids without the need for prior extraction of lipids. The use of small amounts of sample (100mg) allows the analysis to be performed in specific parts of animals, in most cases without having them slaughtered. Another benefit is the use of small amounts of reagents (only 2mL of NaOH/Methanol and H2SO4/Methanol). The use of an experimental design procedure (Design Expert software) allows the optimization of the alkaline and acid reaction times. The procedure was validated for five minutes in both steps. The method was validated for bovine fat, beef, chicken, pork, fish and shrimp meats. The results for the merit figures of accuracy (from 101.07% to 109.18%), precision (RSDintra-day (from 0.65 to 3.93%), RSDinter-day (from 1.57 to 5.22%)), linearity (R(2)=0.9864) and robustness confirmed that the new method is satisfactory within the linear range of 2-30% of lipids in the sample. Besides the benefits of minimizing the amount of samples and reagents, the procedure enables gas chromatography sample preparation in a very short time compared with traditional procedures. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Determination of some metal ions in various meat and baby food samples by atomic spectrometry.

    Science.gov (United States)

    Daşbaşı, Teslima; Saçmacı, Şerife; Ülgen, Ahmet; Kartal, Şenol

    2016-04-15

    In this paper, we report a simple and rapid solid phase extraction system for the separation/preconcentration and determination of Cd(II), Co(II), Cu(II), Fe(III), Cr(III), Pb(II), and Zn(II) ions by flame atomic absorption spectrometry (FAAS). This method is based upon the retention of metal ions on a column packed with poly[N-(3-methyl-1H-indole-1-yl)]-2-methacrylamide-co-2-acrylamido-2-methyl-1-propane sulphonic acid-co divinylbenzene] (MMAD) resin as a solid-phase extraction (SPE) sorbent at pH 8. At the optimized conditions, the limits of detection (3 s/b) between 0.12 and 1.6 μg L(-1), preconcentration factor of 100, and the relative standard deviation of ⩽1.8% were achieved (n=10). The accuracy of the method was verified by analyzing certified reference materials (CRMs) and performing recovery experiments. The developed method was successfully applied to the various natural water, meat products and baby food samples. The recoveries of analyte ions were found in added real samples and CRMs from 95% to 102%. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Changes in endogenous bioactive compounds of Korean native chicken meat at different ages and during cooking.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Bae, Young Sik; Kim, Sun Hyo; Lee, Soo Kee; Lee, Jun Heon; Jo, Cheorun

    2014-07-01

    This study aimed to examine the effect of bird age on the contents of endogenous bioactive compounds, including carnosine, anserine, creatine, betaine, and carnitine, in meat from a certified meat-type commercial Korean native chicken strain (KNC; Woorimatdag). Additionally, the effects of the meat type (breast or leg meat) and the state of the meat (raw or cooked) were examined. Cocks of KNC were raised under similar standard commercial conditions at a commercial chicken farm. At various ages (10, 11, 12, 13, and 14 wk), breast and leg meats from a total of 10 birds from each age group were obtained. Raw and cooked meat samples were then prepared separately and analyzed for bioactive compounds. The age of the KNC had a significant effect only on the betaine content. The breast meat of KNC had higher amounts of carnosine and anserine but had lower amounts of betaine and carnitine than the leg meat (P cooking (P cooking, whereas breast meat showed almost complete retention of betaine and carnitine. The results of this study provide useful and rare information regarding the presence, amounts, and determinants of endogenous bioactive compounds in KNC meat, which can be useful for selection and breeding programs, and also for popularizing indigenous chicken meat. © 2014 Poultry Science Association Inc.

  16. Strand-specific transcriptomes of Enterohemorrhagic Escherichia coli in response to interactions with ground beef microbiota: interactions between microorganisms in raw meat.

    Science.gov (United States)

    Galia, Wessam; Leriche, Francoise; Cruveiller, Stéphane; Garnier, Cindy; Navratil, Vincent; Dubost, Audrey; Blanquet-Diot, Stéphanie; Thevenot-Sergentet, Delphine

    2017-08-03

    Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O26 21765 and O157 EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O26 21765 , the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157 EDL933 , the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial community on relevant functions of an individual

  17. Detection of IgG against Toxocara in Sera of Employees of Meat Industry

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernández-Tinoco, Jesús; Sánchez-Anguiano, Luis Francisco; Ramos-Nevárez, Agar; Cerrillo-Soto, Sandra Margarita; Guido-Arreola, Carlos Alberto; Saenz-Soto, Leandro

    2015-01-01

    Contact with raw meat could represent a risk for Toxocara infection. We assessed the association of Toxocara infection with an occupation of meat worker though a case-control seroprevalence study of 124 meat workers and 248 subjects without this occupation. Sera of participants was analyzed for the presence of anti-Toxocara IgG antibodies. One (0.8%) of the 124 meat workers, and 5 (2.0%) of the 248 controls were positive for anti-Toxocara IgG antibodies (OR=0.39; 95% CI: 0.04-3.41; P=0.66). The seropositive meat worker was a male aged 28 years old, without vision impairment. None of the work characteristics i.e. frequency of contact with raw meat, use of safety practices, history of splashes at face with blood or raw meat, and injuries with sharp material at work was associated with Toxocara exposure. Seroprevalence of Toxocara infection was significantly higher (P=0.04) in meat workers with consumption of boar meat (1/6: 16.7%) than in those without this consumption (0/117: 0%). We conclude that meat workers do not have a higher risk for Toxocara infection than subjects without this occupation do. The 2% seroprevalence of Toxocara infection found in control subjects might suggest a low seroprevalence of this infection among people with other occupations in Durango City. However, additional case-control studies with larger sample sizes to confirm our results are needed. PMID:26508909

  18. Chlorotrimethylsilane, a reagent for the direct quantitative analysis of fats and oils present in vegetable and meat samples.

    Science.gov (United States)

    Eras, Jordi; Ferran, Javier; Perpiña, Belén; Canela, Ramon

    2004-08-20

    Acylglycerides present in oil seeds and meat can be transformed into volatile fatty esters using chlorotrimethylsilane (CTMS) and 1-pentanol as reagents. The volatile esters can then be analysed by GC. The method is quantitative and involves only minor sample manipulation. It often permits major recoveries of the total saponifiable lipids present in solid samples. A 40 min reaction time is enough to ensure the total conversion of saponifiable lipids to the corresponding FAPEs.

  19. Importance of the producer on retail broiler meat product contamination with Campylobacter spp

    DEFF Research Database (Denmark)

    Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta

    2013-01-01

    Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...

  20. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  1. Determination of Cesium - 137 in the Oyster (Crassostrea belcheri) Meat and Seawater Samples from the Lower Gulf of Thailand

    International Nuclear Information System (INIS)

    Pakkong, P.; Phaopeng, N.; Tumnoi, Y.

    2014-01-01

    Cs-137 radioactivity was determined in the oyster (Crassostrea belcheri) meat samples which were collected on October 2010 and August 2011. The seawater samples were collected in 3 different provinces of the Lower Gulf of Thailand. The oyster meat samples were prepared as oven dried at 80±C. The seawater samples were prepared with AMP precipitation technique. The results of Cs-137 radioactivity in oyster meat samples in October 2010 were 3.179±2.2929, 3.1797±2.2929 and 3.1797±2.2929 mBq/kg-ww respectively and in August 2011 were 2.5437±2.2029, 1.9078±2.1091 and 3.1797±2.2929 mBq/kg-ww respectively. The Minimum Detectable Activity (MDA) of oyster meat samples were estimated to be 10.4723 mBq/kg-ww. Statistic calculation of critical limit (Lc) values of 2.9634mBq/kg-ww was used to confirm the value of Cs-137 radioactivity in oyster meat samples. The Cs-137 radioactivity in seawater samples which had been collected on October 2010 were 4.7806±0.1113, 3.7161±0.0868 and 3.19330.0745 mBq/L, respectively and the average of MDA was 0.4562 mBq/L, on March 2011 were 3.2213±0.0756, 2.7824±0.0653 and 1.9566±0.0462 mBq/L respectively and the average of MDA was 0.3142 mBq/L. The third collection of seawater samples on August 2011 after Fukushima Daiichi crisis accident were 4.9673±0.1155, 3.8469±0.0897 and 3.5294±0.0826 mBq/L respectively and the average of MDA was 0.4793 mBq/L) The results from calculation of radiation dose assessment for general public consumption were found lower than the accepted value (1 mSv/y).

  2. A Class of Estimators for Finite Population Mean in Double Sampling under Nonresponse Using Fractional Raw Moments

    Directory of Open Access Journals (Sweden)

    Manzoor Khan

    2014-01-01

    Full Text Available This paper presents new classes of estimators in estimating the finite population mean under double sampling in the presence of nonresponse when using information on fractional raw moments. The expressions for mean square error of the proposed classes of estimators are derived up to the first degree of approximation. It is shown that a proposed class of estimators performs better than the usual mean estimator, ratio type estimators, and Singh and Kumar (2009 estimator. An empirical study is carried out to demonstrate the performance of a proposed class of estimators.

  3. On-chip acoustophoretic isolation of microflora including S. typhimurium from raw chicken, beef and blood samples.

    Science.gov (United States)

    Ngamsom, Bongkot; Lopez-Martinez, Maria J; Raymond, Jean-Claude; Broyer, Patrick; Patel, Pradip; Pamme, Nicole

    2016-04-01

    Pathogen analysis in food samples routinely involves lengthy growth-based pre-enrichment and selective enrichment of food matrices to increase the ratio of pathogen to background flora. Similarly, for blood culture analysis, pathogens must be isolated and enriched from a large excess of blood cells to allow further analysis. Conventional techniques of centrifugation and filtration are cumbersome, suffer from low sample throughput, are not readily amenable to automation and carry a risk of damaging biological samples. We report on-chip acoustophoresis as a pre-analytical technique for the resolution of total microbial flora from food and blood samples. The resulting 'clarified' sample is expected to increase the performance of downstream systems for the specific detection of the pathogens. A microfluidic chip with three inlets, a central separation channel and three outlets was utilized. Samples were introduced through the side inlets, and buffer solution through the central inlet. Upon ultrasound actuation, large debris particles (10-100 μm) from meat samples were continuously partitioned into the central buffer channel, leaving the 'clarified' outer sample streams containing both, the pathogenic cells and the background flora (ca. 1 μm) to be collected over a 30 min operation cycle before further analysis. The system was successfully tested with Salmonella typhimurium-spiked (ca. 10(3)CFU mL(-1)) samples of chicken and minced beef, demonstrating a high level of the pathogen recovery (60-90%). When applied to S. typhimurium contaminated blood samples (10(7)CFU mL(-1)), acoustophoresis resulted in a high depletion (99.8%) of the red blood cells (RBC) which partitioned in the buffer stream, whilst sufficient numbers of the viable S. typhimurium remained in the outer channels for further analysis. These results indicate that the technology may provide a generic approach for pre-analytical sample preparation prior to integrated and automated downstream detection of

  4. Comparision of the BAX® System with an in-house MSRV method for the detection of Salmonella in chicken carcasses and pork meat

    OpenAIRE

    Franchin,Paulo R.; Ogliari,Paulo J.; Andrade,Dalton F.; Chiapinoto,Maura; Lemos,Giovana; Rebelatto,Marina; Silva,Ivair G. da; Batista,Cleide R.V.

    2006-01-01

    A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV) method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762) and raw pork meat (n = 566). The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and oth...

  5. Natural radioactivity measurement in pumice samples used raw materials in Turkey

    International Nuclear Information System (INIS)

    Turhan, S.; Yuecel, H.; Guenduez, L.; Sahin, S.; Vural, M.; Parmaksiz, A.; Demircioglu, B.

    2007-01-01

    The activity concentrations of 232 Th, 226 Ra, and 4 K in different pumice samples have been determined by high-resolution γ-ray spectrometry using a 110% HpGe detector. The radium equivalent activities (Ra eq ), external hazard index (H ex ), and internal hazard index (H in ) associated with the natural radionuclides and representative level index (I γ r ) are calculated to assess the radiation hazard of the natural radioactivity in the pumice samples. The mean values of the measured radioactivity concentrations of 232 Th, 226 Ra, and 4 K for pumice samples from the region of lakes (ROL) are 232.4±8.0, 196.9±7.8, and 1325.8±20.4 Bq kg -1 and for pumice samples from Cukurova region (CR) 16.3±4.0, 16.1±4.9, and 479.7±170.4 Bq kg -1 , respectively. The calculated Ra eq values vary from 435.9±12.5 to 883.6±41.5 Bq kg -1 with a mean of 630.9±20.2 Bq kg -1 for the ROL samples and from 49.7±3.3 to 101.9±7.2 Bq kg -1 with a mean of 76.3±23.7 Bq kg -1 for the CR samples. For the ROL samples, Ra eq are above the limit of 370 Bq kg -1 , equivalent to external γ dose of 1.5 mSv yr -1 , recommended for the safe use of construction materials by NEA-OECD, while for the CR samples, Ra eq values are lower than the limit

  6. Occurrence of aflatoxin M(1) in some samples of UHT, raw & pasteurized milk from Indian states of Karnataka and Tamilnadu.

    Science.gov (United States)

    Siddappa, Vinutha; Nanjegowda, Divyashree Kallenahalli; Viswanath, Prema

    2012-11-01

    Aflatoxin M(1) (AFM(1)) is a toxic metabolite found in the milk of lactating animals which have consumed feedstuffs contaminated with aflatoxin B(1). Ultra high temperature treated (UHT) milk is a product which is becoming popular in developing countries like India as there is a lack of proper cold storage or refrigeration facilities. In this study, 45 samples of UHT milk of popular brands prevalent in the market were analyzed for the presence of AFM(1) by reversed phase HPLC using fluorescent detector after cleanup of sample with immunoaffinity columns. All samples of plain UHT milk were positive for AFM(1) and 38% of these contained levels more than 0.5 μg/kg, the maximum permitted limit prescribed by the Codex Alimentarius Commission and by the mandatory regulations of the country, the FSSAI Regulations, 2011. In 62.5% of flavored UHT milk, AFM(1) was below detectable levels (0.02 μgL(-1)). However, 12.5% of these samples also contained levels exceeding the maximum permitted limits. AFM(1) was present in 61.6% of the 52 raw milk samples analyzed from the two states of Karnataka and Tamilnadu with a range of 0.1-3.8 μgL(-1). 17.3% of these samples also exceeded the regulatory limits of the country. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes

    Directory of Open Access Journals (Sweden)

    Tahlina Tanzin

    2016-03-01

    Conclusion: Two different species of bacteria i.e., S. aureus and E. coli are contaminating with milk samples. The pathogenic bacteria can be controlled effectively by using Ciprofloxacin and Levofloxacin in the case of mastitis in cattle and buffaloes in Bangladesh. [J Adv Vet Anim Res 2016; 3(1.000: 62-67

  8. ANTE-MORTEM FORMATION OF THE QUALITATIVE CHARACTERISTICS OF ENVIRONMENTALLY FRIENDLY MEAT RAW MATERIAL BY INTENSIFICATION OF THE MECHANISMS OF THE METABOLIC PROCESSES IN GILTS

    Directory of Open Access Journals (Sweden)

    T. M. Giro

    2016-01-01

    Full Text Available Abstract In order to reduce the time of feeding, increase the intensity of weight gain without hormones, antibiotics, anabolic drugs, as well as to obtain high-quality meat with marble structure, the authors studied the influence of ovarioectomy on the intensification of the metabolic processes in gilts. The experiments were carried out in the FGUP “Mummovskoe” – the educational experimental enterprise of the Russian State Agrarian University - Moscow Timiryazev Agricultural Academy (RSAU – MAA named after K.A.  Timiryazev, in the Atkarsky district of the Saratov region. Two groups of Duroc gilts (10 animals each raised under the same conditions were studied. As a result of the experiment, the influence of ovariectomy on the level of insulinlike growth factor-1 (IGF-1 and indicators of metabolic processes in gilts were established. It is confirmed that stimulation of the the somatotropin/insulin-like growth factor (ST-IGF system along with hereditary factors and the characteristics of feeding contributes to the development of muscle tissue. Stimulation of ST secretion with insulin-like growth factor facilitates the development of muscle tissue.An increase in IGF-1 level leads to the development of new muscle fibers and muscle hyperplasia. After surgery, the major factors of changes in meat and feeding indicators in gilts were the rise in the metabolic activity of muscle tissue and fat metabolism, enhancement of production of IGF-1, which has insulin-like action and ensures activation of the processes of cell proliferation and differentiation. Increase in IGF-1 level had a positive impact on meat productivity, chemical and biochemical composition of pork. Simultaneous triggering of the systemic catabolic and local anabolic reactions in gilts after ovariectomy contributed to obtaining higher nutritional value of meat.

  9. Vertebrate DNA in fecal samples from bonobos and gorillas: evidence for meat consumption or artefact?

    Directory of Open Access Journals (Sweden)

    Michael Hofreiter

    Full Text Available BACKGROUND: Deciphering the behavioral repertoire of great apes is a challenge for several reasons. First, due to their elusive behavior in dense forest environments, great ape populations are often difficult to observe. Second, members of the genus Pan are known to display a great variety in their behavioral repertoire; thus, observations from one population are not necessarily representative for other populations. For example, bonobos (Pan paniscus are generally believed to consume almost no vertebrate prey. However, recent observations show that at least some bonobo populations may consume vertebrate prey more commonly than previously believed. We investigated the extent of their meat consumption using PCR amplification of vertebrate mitochondrial DNA (mtDNA segments from DNA extracted from bonobo feces. As a control we also attempted PCR amplifications from gorilla feces, a species assumed to be strictly herbivorous. PRINCIPAL FINDINGS: We found evidence for consumption of a variety of mammalian species in about 16% of the samples investigated. Moreover, 40% of the positive DNA amplifications originated from arboreal monkeys. However, we also found duiker and monkey mtDNA in the gorilla feces, albeit in somewhat lower percentages. Notably, the DNA sequences isolated from the two ape species fit best to the species living in the respective regions. This result suggests that the sequences are of regional origin and do not represent laboratory contaminants. CONCLUSIONS: Our results allow at least three possible and mutually not exclusive conclusions. First, all results may represent contamination of the feces by vertebrate DNA from the local environment. Thus, studies investigating a species' diet from feces DNA may be unreliable due to the low copy number of DNA originating from diet items. Second, there is some inherent difference between the bonobo and gorilla feces, with only the later ones being contaminated. Third, similar to bonobos, for

  10. Vertebrate DNA in fecal samples from bonobos and gorillas: evidence for meat consumption or artefact?

    Science.gov (United States)

    Hofreiter, Michael; Kreuz, Eva; Eriksson, Jonas; Schubert, Grit; Hohmann, Gottfried

    2010-02-25

    Deciphering the behavioral repertoire of great apes is a challenge for several reasons. First, due to their elusive behavior in dense forest environments, great ape populations are often difficult to observe. Second, members of the genus Pan are known to display a great variety in their behavioral repertoire; thus, observations from one population are not necessarily representative for other populations. For example, bonobos (Pan paniscus) are generally believed to consume almost no vertebrate prey. However, recent observations show that at least some bonobo populations may consume vertebrate prey more commonly than previously believed. We investigated the extent of their meat consumption using PCR amplification of vertebrate mitochondrial DNA (mtDNA) segments from DNA extracted from bonobo feces. As a control we also attempted PCR amplifications from gorilla feces, a species assumed to be strictly herbivorous. We found evidence for consumption of a variety of mammalian species in about 16% of the samples investigated. Moreover, 40% of the positive DNA amplifications originated from arboreal monkeys. However, we also found duiker and monkey mtDNA in the gorilla feces, albeit in somewhat lower percentages. Notably, the DNA sequences isolated from the two ape species fit best to the species living in the respective regions. This result suggests that the sequences are of regional origin and do not represent laboratory contaminants. Our results allow at least three possible and mutually not exclusive conclusions. First, all results may represent contamination of the feces by vertebrate DNA from the local environment. Thus, studies investigating a species' diet from feces DNA may be unreliable due to the low copy number of DNA originating from diet items. Second, there is some inherent difference between the bonobo and gorilla feces, with only the later ones being contaminated. Third, similar to bonobos, for which the consumption of monkeys has only recently been

  11. Comparison of the isolation rates and characteristics of Salmonella isolated from antibiotic-free and conventional chicken meat samples.

    Science.gov (United States)

    Park, J-H; Kim, H-S; Yim, J-H; Kim, Y-J; Kim, D-H; Chon, J-W; Kim, H; Om, A-S; Seo, K-H

    2017-08-01

    Salmonella contamination in chicken samples can cause major health problems in humans. However, not only the effects of antibiotic treatment during growth but also the impacts of the poultry slaughter line on the prevalence of Salmonellae in final chicken meat sold to consumers are unknown. In this study, we compared the isolation rates and antimicrobial resistance of Salmonellae among antibiotic-free, conventional, conventional Korean native retail chicken meat samples, and clonal divergence of Salmonella isolates by multilocus sequence typing. In addition, the distribution of extended-spectrum β-lactamase (ESBL) genes in ESBL-producing Salmonella isolates was analyzed. A total of 72 retail chicken meat samples (n = 24 antibiotic-free broiler [AFB] chickens, n = 24 conventional broiler [CB] chickens, and n = 24 conventional Korean native [CK] chickens) was collected from local retail markets in Seoul, South Korea. The isolation rates of Salmonellae were 66.6% in AFB chickens, 45.8% in CB chickens, and 25% in CK chickens. By analyzing the minimum inhibitory concentrations of β-lactam antibiotics with the disc-diffusion test, we found that 81.2% of Salmonella isolates from AFB chickens, 63.6% of isolates from CB chickens, and 50% of isolates from CK chickens were ESBL producers; all ESBL-positive isolates had the CTX-M-15 genotype. Interestingly, all ESBL-producing Salmonellae were revealed as ST16 by multilocus sequence typing and had the genetic platform of blaCTX-M gene (IS26-ISEcp1-blaCTX-M-15-IS903), which was first reported in Salmonellae around the world. The Salmonella ST33 strain (S. Hadar) isolated in this study has never been reported in South Korea. In conclusion, our findings showed that antibiotic-free retail chicken meat products were also largely contaminated with ESBL-producing Salmonellae and that their ESBL genes and genetic platforms were the same as those isolated from conventional retail chicken meat products. © 2017 Poultry Science

  12. In Dogs with Periodontal Disease Is Feeding a Complete Raw Meat Diet More Effective Than a Complete Kibble 'Dental' Diet at Reducing Periodontal Disease?

    Directory of Open Access Journals (Sweden)

    Nieky van Veggel

    2017-04-01

    Full Text Available Clinical bottom line:In light of the absence of evidence, vets and vet nurses should be cautious when recommending raw diets to support periodontal health and advise clients accordingly by relying on their clinical experience rather than the literature until more evidence is generated.

  13. Assessment of levels of bacterial contamination of large wild game meat in Europe.

    Science.gov (United States)

    Membré, Jeanne-Marie; Laroche, Michel; Magras, Catherine

    2011-08-01

    The variations in prevalence and levels of pathogens and fecal contamination indicators in large wild game meat were studied to assess their potential impact on consumers. This analysis was based on hazard analysis, data generation and statistical analysis. A total of 2919 meat samples from three species (red deer, roe deer, wild boar) were collected at French game meat traders' facilities using two sampling protocols. Information was gathered on the types of meat cuts (forequarter or haunch; first sampling protocol) or type of retail-ready meat (stewing meat or roasting meat; second protocol), and also on the meat storage conditions (frozen or chilled), country of origin (eight countries) and shooting season (autumn, winter, spring). The samples were analyzed in both protocols for detection and enumeration of Escherichia coli, coagulase+staphylococci and Clostridium perfringens. In addition, detection and enumeration of thermotolerant coliforms and Listeria monocytogenes were performed for samples collected in the first and second protocols, respectively. The levels of bacterial contamination of the raw meat were determined by performing statistical analysis involving probabilistic techniques and Bayesian inference. C. perfringens was found in the highest numbers for the three indicators of microbial quality, hygiene and good handling, and L. monocytogenes in the lowest. Differences in contamination levels between game species and between meats distributed as chilled or frozen products were not significant. These results might be included in quantitative exposure assessments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Application of radioactivation analysis for determination of impurities in aluminium, raw materials and in samples from aluminium production process

    International Nuclear Information System (INIS)

    Vucina, L.J.

    1977-01-01

    Trace elements in aluminium, raw materials and in the samples from different stages of aluminium production were determined by nondestructive neutron radioactivation analysis. The samples were taken from the Bayer's process of alumina production (bauxite, red sludge and alumina), from the components of the reduction cell (anode, criolyte and AlF 3 ) and of the final product - aluminium (purity 99.5-99.7%). Under given set of conditions ten trace elements (V,La,Ga,Mn,Co,Cr,Sc,Sb,Zn and Fe) were determined in aluminium and followed through the production process. It was found that the main impurities in aluminium are iron (0.15%) and zinc (0.O6%). It has been concluded that the purity of produced aluminium depends mainly on the purity of used alumina. The second important source of contamination of aluminium is anode. The results obtained by radioactivation analysis for V, Mn, Cr and Fe fall within the ranges of concentrations of these elements determined by use of other methods (volumetry, spectrophotometry, atomic absorption). Higher values for zinc were obtained by radioactivation analysis, probably due to unsatisfactory irradiation and measuring conditions for this element. The possibilities of application of radioactivation analysis to these kinds of samples are also disscused

  15. Effects of vitamin E and fish oil inclusion in broiler diets on meat fatty acid composition and on the flavour of a composite sample of breast meat.

    Science.gov (United States)

    Rymer, Caroline; Givens, D Ian

    2010-08-15

    Enriching poultry meat with long-chain n-3 polyunsaturated fatty acids (LC n-3 PUFA) can increase low population intakes of LC n-3 PUFA, but fishy taints can spoil reheated meat. This experiment determined the effect of different amounts of LC n-3 PUFA and vitamin E in the broiler diet on the fatty acid composition and sensory characteristics of the breast meat. Ross 308 broilers (120) were randomly allocated to one of five treatments from 21 to 42 days of age. Diets contained (g kg(-1)) 0, 9 or 18 LC n-3 PUFA (0LC, 9LC, 18LC), and 100, 150 or 200 mg LD-alpha-tocopherol acetate kg(-1) (E). The five diets were 0LC100E, 9LC100E, 18LC100E, 18LC150E, 18LC200E, with four pens per diet, except 18LC100E (eight pens). Breast meat was analysed for fatty acids (uncooked) and sensory analysis by R-index (reheated). LC n-3 PUFA content (mg kg(-1) meat) was 514 (0LC100E) and 2236 (9LC and 18LC). Compared with 0LC100E, meat from 18LC100E and 18LC150E tasted significantly different, while 23% of panellists detected fishy taints in 9LC100E and 18LC200E. Chicken meat can be enriched with nutritionally meaningful amounts of LC n-3 PUFA, but > 100 mg dl-alpha-tocopherol acetate kg(-1) broiler diet is needed to protect reheated meat from oxidative deterioration. Copyright (c) 2010 Society of Chemical Industry.

  16. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Irradiation of bovine meat: effect of heme-iron concentration

    International Nuclear Information System (INIS)

    Mistura, Liliana Perazzini Furtado

    2002-01-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  18. Detection of Salmonella enterica in Meat in Less than 5 Hours by a Low-Cost and Noncomplex Sample Preparation Method.

    Science.gov (United States)

    Fachmann, M S R; Löfström, C; Hoorfar, J; Hansen, F; Christensen, J; Mansdal, S; Josefsen, M H

    2017-03-01

    Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella , and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. Copyright © 2017 American Society for Microbiology.

  19. Volatile compounds in meat and meat products

    Directory of Open Access Journals (Sweden)

    Monika KOSOWSKA

    Full Text Available Abstract Meaty flavor is composed of a few hundreds of volatile compounds, only minor part of which are responsible for the characteristic odor. It is developed as a result of multi-directional reactions proceeding between non-volatile precursors contained in raw meat under the influence of temperature. The volatile compounds are generated upon: Maillard reactions, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products as well as upon thiamine degradation. The developed flavor is determined by many factors associated with: raw material (breed, sex, diet and age of animal, conditions and process of slaughter, duration and conditions of meat storage, type of muscle, additives applied and the course of the technological process. The objective of this review article is to draw attention to the issue of volatile compounds characteristic for meat products and factors that affect their synthesis.

  20. An improved UPLC method for the detection of undeclared horse meat addition by using myoglobin as molecular marker.

    Science.gov (United States)

    Di Giuseppe, Antonella M A; Giarretta, Nicola; Lippert, Martina; Severino, Valeria; Di Maro, Antimo

    2015-02-15

    In 2013, following the scandal of the presence of undeclared horse meat in various processed beef products across the Europe, several researches have been undertaken for the safety of consumer health. In this framework, an improved UPLC separation method has been developed to detect the presence of horse myoglobin in raw meat samples. The separation of both horse and beef myoglobins was achieved in only seven minutes. The methodology was improved by preparing mixtures with different composition percentages of horse and beef meat. By using myoglobin as marker, low amounts (0.50mg/0.50g, w/w; ∼0.1%) of horse meat can be detected and quantified in minced raw meat samples with high reproducibility and sensitivity, thus offering a valid alternative to conventional PCR techniques. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. In vitro evaluation of the antimicrobial effect of a raw bacteriocin extract in combination with chemical preservatives employed in meat industry

    Directory of Open Access Journals (Sweden)

    Luis A. Aguado Bautista

    2010-12-01

    Full Text Available Biopreservation can be defined as the foods shelf life extension employing antibacterial products like bacteriocins. The objective of this work was to determinate the efficacy of E. faecium MXVK29 bacteriocin in combination with chemical preservatives against spoilage and pathogens microorganisms. Bacteriocin raw extrac antimicrobial activity was 46.34 UA/g of protein. Growth of Pseudomonas putida was not affected by the preservatives employed at the conditions employed. Antimicrobial response was different for other microorganisms since a synergetic effect of the preservatives combination inhibited Brochothrix thermosphacta and Escherichia coli growth. Sodium lactate had additive effect only against Listeria innocua.

  2. Metabolic bone disease and central retinal degeneration in a kitten due to nutritional inadequacy of an all-meat raw diet

    Directory of Open Access Journals (Sweden)

    Catherine Lenox

    2015-05-01

    Full Text Available A 5-month-old castrated male Sphynx kitten presented with left hindlimb lameness shortly after adoption. Prior to adoption, the breeder had fed the kitten an exclusively raw chicken diet. Radiographs revealed generalized osteopenia and a left tibia–fibula fracture. Ophthalmic examination revealed corneal vascularization and opacity in the right eye, and lesions suggestive of feline central retinal degeneration in the left eye. The patient’s diagnoses included metabolic bone disease and feline central retinal degeneration, which can result from taurine deficiency. The kitten’s nutritional diseases were managed with a complete and balanced canned diet designed for kitten growth and with taurine supplementation.

  3. Myoglobin chemistry and meat color.

    Science.gov (United States)

    Suman, Surendranath P; Joseph, Poulson

    2013-01-01

    Consumers rely heavily on fresh meat color as an indicator of wholesomeness at the point of sale, whereas cooked color is exploited as an indicator of doneness at the point of consumption. Deviations from the bright cherry-red color of fresh meat lead to product rejection and revenue loss. Myoglobin is the sarcoplasmic heme protein primarily responsible for the meat color, and the chemistry of myoglobin is species specific. The mechanistic interactions between myoglobin and multiple extrinsic and intrinsic factors govern the color of raw as well as cooked meats. The objective of this review is to provide an overview of the current research in meat color and how the findings are applied in the meat industry. Characterizing the fundamental basis of myoglobin's interactions with biomolecules in postmortem skeletal muscles is necessary to interpret the chemistry of meat color phenomena and to engineer innovative processing strategies to minimize meat discoloration-induced revenue loss to the agricultural economy.

  4. Prevalence and antibiotic resistance of Salmonella spp. in meat products, meat preparations and minced meat

    Science.gov (United States)

    Rašeta, M.; Mrdović, B.; Janković, V.; Bečkei, Z.; Lakićević, B.; Vidanović, D.; Polaček, V.

    2017-09-01

    This study aimed to determine Salmonella spp. prevalence in meat products, meat preparations and minced meat. Over a period of three years, a total of 300 samples were taken (100 RTE meat products, 100 meat preparations and 100 minced meat) and examined for the presence of Salmonella spp. Sampling was carried out at the warehouses of the food manufacturers. Salmonella spp. were not detected in RTE meat products, while 7% of semi-finished meat products (fresh sausages, grill meat formed and unformed) contained Salmonella, as did 18% of minced meats (minced pork II category, minced beef II category, mixed minced meat). The 25 Salmonella isolates obtained were examined for antibiotic resistance by the disk diffusion test, according to the NCCLS and CLSI guidelines. Isolates showed resistance to ampicillin and nalidixic acid (80%), tetracycline (72%), cefotaxime/clavulanic acid (48%), but not to gentamicin (8%) or trimethoprim/sulfamethoxazole (0%).

  5. Integrity of nuclear genomic deoxyribonucleic acid in cooked meat: Implications for food traceability.

    Science.gov (United States)

    Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M

    2009-01-01

    It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P 800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.

  6. Dietary energy source affecting fat deposition mechanism, muscle fiber metabolic and overall meat quality

    Directory of Open Access Journals (Sweden)

    M. Al-Hijazeen

    2017-03-01

    Full Text Available A study was conducted to investigate the effect of two dietary energy sources, soy bean oil, and sucrose on regulatory mechanisms of meat preservation. Twenty one day-old Hubbard commercial broilers were randomly allocated into two dietary treatment groups with six replicates per treatment, and four broilers per replicate. All birds were coded for the influence of energy source: fat based diet (FD, and sugar based diet (SD. Formulated grower diets were isonitrogenous and isocaloric. The chickens were slaughtered and then boneless, skinless ground chicken tight meat was prepared. Both raw and cooked meats were analyzed for lipid and protein oxidation, and sensory panel evaluation. In addition, meat from the small muscles of the raw thigh was used to evaluate other meat quality characteristics. Proximate analyses showed no significant differences between both dietary treatments on protein, ash and moisture percentage values. Meat samples of the group that was fed FD showed higher significant values of both TBARS and total carbonyl at day 7 of storage time. However, samples of the second group (Fed SD showed lower values of both ultimate pH and water separation % using raw thigh meat. The effect of FD treatment on the meat composition appeared clearly especially on fat percentage content. In addition, meat samples obtained from chickens fed SD showed better significant values of the overall acceptability attribute. According to the current findings, sucrose could be an excellent alternative to oil in dietary broilers which improved the meat preservation bio-system, and post-mortem storage stability.

  7. Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

    Science.gov (United States)

    Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

    2008-10-01

    The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

  8. Nutritional value and fatty acid composition of some traditional Argentinean meat sausages

    OpenAIRE

    Mara Cristina Romero; Ana María Romero; Mirtha Marina Doval; Maria Alicia Judis

    2013-01-01

    The aim of this work was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat) of meat products elaborated in the northeast of Argentina, analyzing fatty acids composition, PUFA/SFA ratio, n-6/n-3 relation, and CLA content. Thirty traditional meat products from different processes were used. Samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage), chorizos (raw sausage), chorizo ahumado (cooked and smoked s...

  9. A comparison of surface water natural organic matter in raw filtered water samples, XAD, and reverse osmosis isolates

    Science.gov (United States)

    Maurice, P.A.; Pullin, M.J.; Cabaniss, S.E.; Zhou, Q.; Namjesnik-Dejanovic, K.; Aiken, G.R.

    2002-01-01

    This research compared raw filtered waters (RFWs), XAD resin isolates (XAD-8 and XAD-4), and reverse osmosis (RO) isolates of several surface water samples from McDonalds Branch, a small freshwater fen in the New Jersey Pine Barrens (USA). RO and XAD-8 are two of the most common techniques used to isolate natural organic matter (NOM) for studies of composition and reactivity; therefore, it is important to understand how the isolates differ from bulk (unisolated) samples and from one another. Although, any comparison between the isolation methods needs to consider that XAD-8 is specifically designed to isolate the humic fraction, whereas RO concentrates a broad range of organic matter and is not specific to humics. The comparison included for all samples: weight average molecular weight (Mw), number average molecular weight (Mn), polydispersity (??), absorbance at 280nm normalized to moles C (??280) (RFW and isolates); and for isolates only: elemental analysis, % carbon distribution by 13C NMR, and aqueous FTIR spectra. As expected, RO isolation gave higher yield of NOM than XAD-8, but also higher ash content, especially Si and S. Mw decreased in the order: RO>XAD-8>RFW>XAD-4. The Mw differences of isolates compared with RFW may be due to selective isolation (fractionation), or possibly in the case of RO to condensation or coagulation during isolation. 13C NMR results were roughly similar for the two methods, but the XAD-8 isolate was slightly higher in 'aromatic' C and the RO isolate was slightly higher in heteroaliphatic and carbonyl C. Infrared spectra indicated a higher carboxyl content for the XAD-8 isolates and a higher ester:carboxyl ratio for the RO isolates. The spectroscopic data thus are consistent with selective isolation of more hydrophobic compounds by XAD-8, and also with potential ester hydrolysis during that process, although further study is needed to determine whether ester hydrolysis does indeed occur. Researchers choosing between XAD and RO

  10. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    OpenAIRE

    Juni Sumarmono; Samsu Wasito

    2010-01-01

    Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thor...

  11. Radiation decontamination of meat lyophylized products

    International Nuclear Information System (INIS)

    Migdal, W.; Owczarczyk, H.B.

    2002-01-01

    There is an increasing demand for a powder soups and sauces composed with lyophylizated meat. Technology of lyophylization is not always accompanied by thermal treatment of raw materials. That is the reason the meat lyophylization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment

  12. Prevalence of methicillin-resistant Staphylococcus aureus in meat.

    Science.gov (United States)

    de Boer, E; Zwartkruis-Nahuis, J T M; Wit, B; Huijsdens, X W; de Neeling, A J; Bosch, T; van Oosterom, R A A; Vila, A; Heuvelink, A E

    2009-08-31

    Recently the isolation of methicillin-resistant Staphylococcus aureus (MRSA) strains from several food-producing animals has been reported. During slaughtering of MRSA-positive animals, contamination of carcasses with MRSA may occur and consequently the meat of these animals may get contaminated. The aim of this study was to estimate the prevalence of MRSA in raw meat samples from the retail trade. Samples of raw beef, pork, veal, lamb/mutton, chicken, turkey, fowl and game were collected from the retail trade. A detection method including a two-step enrichment in Mueller-Hinton broth+6.5% NaCl and phenol red mannitol broth containing ceftizoxime and aztreonam, followed by isolation on MRSA ID agar (bioMérieux) was evaluated and subsequently applied for the detection of MRSA in samples of raw meats. MRSA strains were isolated from 264 (11.9%) of 2217 samples analyzed. Isolation percentages for the meat species were: beef (10.6%), veal (15.2%), lamb and mutton (6.2%), pork (10.7%), chicken (16.0%), turkey (35.3%), fowl (3.4%) and game (2.2%). The majority (85%) of the isolated strains belonged to spa-types of pulsed-field gel electrophoresis (PFGE) non-typeable (NT)-MRSA, corresponding to the multilocus sequence type ST398, a type also recently isolated in the Netherlands from pigs. However, a smaller part of these strains were found to be of other ST's, possibly of human origin. Further studies are needed to elucidate transmission routes of MRSA in relation to meat and other foods and to provide the tools for preventing the spread of MRSA. At present the high prevalence of MRSA in meat has not been shown to contribute significantly to the dissemination of MRSA to humans and the possible health hazard for consumers of the presence of MRSA in foods should be further elucidated.

  13. Detection of Salmonella enterica in Meat in Less than 5 Hours by a Low-Cost and Noncomplex Sample Preparation Method

    Science.gov (United States)

    Hoorfar, J.; Hansen, F.; Christensen, J.; Mansdal, S.; Josefsen, M. H.

    2016-01-01

    ABSTRACT Salmonella is recognized as one of the most important foodborne bacteria and has wide health and socioeconomic impacts worldwide. Fresh pork meat is one of the main sources of Salmonella, and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella detection in fresh meat usually include >16 h of culture enrichment, in a few cases meat, consisting of a 3-h enrichment in standard buffered peptone water and a real-time PCR-compatible sample preparation method based on filtration, centrifugation, and enzymatic digestion, followed by fast-cycling real-time PCR detection. The method was validated in an unpaired comparative study against the Nordic Committee on Food Analysis (NMKL) reference culture method 187. Pork meat samples (n = 140) were either artificially contaminated with Salmonella at 0, 1 to 10, or 10 to 100 CFU/25 g of meat or naturally contaminated. Cohen's kappa for the degree of agreement between the rapid method and the reference was 0.64, and the relative accuracy, sensitivity, and specificity for the rapid method were 81.4, 95.1, and 97.9%, respectively. The 50% limit of detections (LOD50s) were 8.8 CFU/25 g for the rapid method and 7.7 CFU/25 g for the reference method. Implementation of this method will enable faster release of Salmonella low-risk meat, providing savings for meat producers, and it will help contribute to improved food safety. IMPORTANCE While the cost of analysis and hands-on time of the presented rapid method were comparable to those of reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs for work hours and cold storage, but consumers and retailers will also benefit from fresher meat with a longer shelf life. Furthermore, the presented sample preparation might be adjusted for application in the detection of other pathogenic bacteria in different sample types. PMID:27986726

  14. Tritium analysis in environmental samples around Nuclear Power Plants and nationwide surveillance of radionuclides in some environmental samples(meat and drinking water)

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yong Woo; Han, Man Jung; Cho, Seong Won; Cho, Hong Jun; Oh, Hyeon Kyun; Lee, Jeong Min; Chang, Jae Sook [KORTIC, Taejon (Korea, Republic of)

    2001-12-15

    12 kind of environmental samples such as soil, underground water, seawater, etc. around the Nuclear Power Plants(NPP) and surface seawater around the Korea peninsula were sampled, For the samples of rain, pine-needle, air, seawater, underground water, chinese cabbage, grain of rice and milk sampled around NPP, and surface seawater and rain sampled all around country, tritium concentration was measured, The tritium concentration in the tap water and the gamma activity in the domestic and imported beef that were sampled at ward in the large city in Korea(Seoul, Pusan, Taegu, Taejun, Inchun, Kwangju) were analyzed for the meat and drinking waters. As the results of analyzing, tritium concentration in rain and tap water were very low all around country, but a little higher around the NPP than general surrounding. At the Wolsung NPP, tritium concentration was descend according to distance from the stack. Tritium activity of surface seawater around the Korea peninsula was also, very low. The measured radioactive elements in the beef is the same as the radioactive elements on the earth surface.

  15. Advancements in meat packaging.

    Science.gov (United States)

    McMillin, Kenneth W

    2017-10-01

    Packaging of meat provides the same or similar benefits for raw chilled and processed meats as other types of food packaging. Although air-permeable packaging is most prevalent for raw chilled red meat, vacuum and modified atmosphere packaging offer longer shelf life. The major advancements in meat packaging have been in the widely used plastic polymers while biobased materials and their integration into composite packaging are receiving much attention for functionality and sustainability. At this time, active and intelligent packaging are not widely used for antioxidant, antimicrobial, and other functions to stabilize and enhance meat properties although many options are being developed and investigated. The advances being made in nanotechnology will be incorporated into food packaging and presumably into meat packaging when appropriate and useful. Intelligent packaging using sensors for transmission of desired information and prompting of subsequent changes in packaging materials, environments or the products to maintain safety and quality are still in developmental stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Campylobacter in Broiler Chicken and Broiler Meat in Sri Lanka: Influence of Semi-Automated vs. Wet Market Processing on Campylobacter Contamination of Broiler Neck Skin Samples

    Directory of Open Access Journals (Sweden)

    Kottawattage S. A. Kottawatta

    2017-11-01

    Full Text Available Broiler meat can become contaminated with Campylobacter of intestinal origin during processing. The present study aimed to identify the prevalence of Campylobacter in broiler flocks and meat contamination at retail shops, and determine the influence of semi-automated and wet market processing on Campylobacter contamination of neck skin samples. Samples were collected from semi-automated plants (n = 102 and wet markets (n = 25. From each batch of broilers, pooled caecal samples and neck skin samples were tested for Campylobacter. Broiler meat purchased from retail outlets (n = 37 was also tested. The prevalence of Campylobacter colonized broiler flocks was 67%. The contamination of meat at retail was 59%. Both semi-automated and wet market processing resulted to contaminate the broiler neck skins to the levels of 27.4% and 48%, respectively. When Campylobacter-free broiler flocks were processed in semi-automated facilities 15% (5/33 of neck skin samples became contaminated by the end of processing whereas 25% (2/8 became contaminated after wet market processing. Characterization of isolates revealed a higher proportion of C. coli compared to C. jejuni. Higher proportions of isolates were resistant to important antimicrobials. This study shows the importance of Campylobacter in poultry industry in Sri Lanka and the need for controlling antimicrobial resistance.

  17. Campylobacter in Broiler Chicken and Broiler Meat in Sri Lanka: Influence of Semi-Automated vs. Wet Market Processing on Campylobacter Contamination of Broiler Neck Skin Samples.

    Science.gov (United States)

    Kottawatta, Kottawattage S A; Van Bergen, Marcel A P; Abeynayake, Preeni; Wagenaar, Jaap A; Veldman, Kees T; Kalupahana, Ruwani S

    2017-11-29

    Broiler meat can become contaminated with Campylobacter of intestinal origin during processing. The present study aimed to identify the prevalence of Campylobacter in broiler flocks and meat contamination at retail shops, and determine the influence of semi-automated and wet market processing on Campylobacter contamination of neck skin samples. Samples were collected from semi-automated plants ( n = 102) and wet markets ( n = 25). From each batch of broilers, pooled caecal samples and neck skin samples were tested for Campylobacter . Broiler meat purchased from retail outlets ( n = 37) was also tested. The prevalence of Campylobacter colonized broiler flocks was 67%. The contamination of meat at retail was 59%. Both semi-automated and wet market processing resulted to contaminate the broiler neck skins to the levels of 27.4% and 48%, respectively. When Campylobacter -free broiler flocks were processed in semi-automated facilities 15% (5/33) of neck skin samples became contaminated by the end of processing whereas 25% (2/8) became contaminated after wet market processing. Characterization of isolates revealed a higher proportion of C. coli compared to C. jejuni . Higher proportions of isolates were resistant to important antimicrobials. This study shows the importance of Campylobacter in poultry industry in Sri Lanka and the need for controlling antimicrobial resistance.

  18. 78 FR 53017 - Changes to the Salmonella Verification Sampling Program: Analysis of Raw Beef for Shiga Toxin...

    Science.gov (United States)

    2013-08-28

    ... evaluated the FSIS Salmonella detection method (FSIS Microbiology Laboratory Guidebook Chapter 4.06) using... prevalence estimates, FSIS defines prevalence as the proportion of applicable product that would test... that is intended for use as raw, non-intact product tests positive for STEC, the product is adulterated...

  19. Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA.

    Science.gov (United States)

    Thapaliya, Dipendra; Forshey, Brett M; Kadariya, Jhalka; Quick, Megan K; Farina, Sarah; O' Brien, Ashley; Nair, Rajeshwari; Nworie, Amos; Hanson, Blake; Kates, Ashley; Wardyn, Shylo; Smith, Tara C

    2017-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of infectious disease morbidity and mortality. Previous studies have confirmed the presence of S. aureus, including MRSA, on raw meat products. We investigated the prevalence and molecular epidemiology of S. aureus and MRSA in commercially-distributed antibiotic-free and conventional raw meat products (n = 3290) purchased in 8 Iowa retail stores weekly for a period of one year. Isolates were characterized using spa typing, and PCR was used to detect the presence of the Panton-Valentine leukocidin (PVL) and mecA genes. Quantitation of S. aureus on meat products was carried out one week per month. The prevalence of S. aureus on meat samples was 27.8% (913/3290). Compared to antibiotic-free meat samples, higher prevalence of both MRSA and methicillin-susceptible S. aureus (MSSA) were found in conventional meat samples. Among the S. aureus isolates, 18 were PVL-positive (1.9%) and 41 (4.5%) carried mecA. Phenotypic oxacillin resistance was observed for 17.1% (41/239) of the isolates tested, while 23% (55/239) were multi-drug resistant. A total of 132 spa types were detected from 913 contaminated meat samples. Overall, t002 was the most common spa type identified (137; 15.0%). The number of colony-forming units (CFU) per 10 g meat ranged from 2 to 517 (median: 8 CFU per 10 g of meat; mean: 28) with the highest bacterial load observed on turkey samples. These data reinforce the need to consider meat products as potential vehicles of S. aureus transmission from farm into human households, and the potential need for public health intervention programs pre and post-slaughter in meat processing facilities. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. The Rate of Success of the Accelerated Solvent Extraction (Ase of Fat and Organochlorine Pesticides from Dried Fish Meat Samples

    Directory of Open Access Journals (Sweden)

    Ana Andreea CIOCA

    2017-05-01

    Full Text Available The replacement of conventional sample preparation techniques with newer techniques which are automated, faster and more eco-friendly, is nowadays desired in every analytical laboratory. One of the techniques with the attributes mentioned above is the Accelerated Solvent Extraction. In order to evaluate how successful this method is for the extraction of fat and organochlorine pesticides (OCPs from dried fish meat samples, we have tested two series of diverse fish using Dionex™ 350 ASE provided by Thermo Scientific™ (Germany. For a more interesting approach, we added to our investigation 7 polychlorinated biphenyl (PCBs, 3 thricholorobenzenes, 2 tetrachlorobenzenes, 1 pentachlorobenzenes and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD. The study focused on comparing the recoveries of these analytes from different fish samples, after replacing the conventional reference method of the laboratory with ASE. The ASE parameters tested were previously used for the extraction of fat and polybrominated diphenyl ethers (PBDE from fish samples: temperature: 120 ° C; static time: 5 min; number of cycles: 3; flushing volume: 25%; rinse with nitrogen: 90 s; solvent: cyclohexane/ethyl acetate (ratio 1:1. The ASE method provided similar and in some cases better results when compared to the standard reference method, more rapidly, eco-friendly and safer. Any high or low recoveries of the analytes taken into study are attributed to random or systematic errors during the Clean-up step of the extracts and the quantification with Gas Chromatography coupled with Tandem Mass-Spectrometry (GC MS/MS.

  1. Determination of benzimidazoles in meat samples by capillary zone electrophoresis tandem mass spectrometry following dispersive liquid-liquid microextraction.

    Science.gov (United States)

    Tejada-Casado, Carmen; Moreno-González, David; Lara, Francisco J; García-Campaña, Ana M; Del Olmo-Iruela, Monsalud

    2017-03-24

    A novel method based on capillary zone electrophoresis-tandem mass spectrometry has been proposed and validated for the identification and simultaneous quantification of twelve benzimidazoles in meat samples. Electrophoretic separation was carried out using 500mM formic acid (pH 2.2) as background electrolyte and applying a voltage of 25kV at 25°C. In order to improve the sensitivity, stacking mode injection was applied, using as injection solvent a mixture of 30:70 acetonitrile/water at 50mbar for 75s. Sensitivity enhancement factors from 74 to 317 were obtained under these conditions. Detection using an ion trap as analyzer, operating in multiple reactions monitoring mode was employed. The main MS/MS parameters as well as the composition of the sheath liquid and other electrospray variables were optimized in order to obtain the highest sensitivity and precision in conjunction with an unequivocal identification. The method was applied to poultry and pork muscle samples. The deproteinization of samples and extraction of benzimidazoles was carried out with acetonitrile. MgSO 4 and NaCl were added as salting-out agents. Subsequently, dispersive liquid-liquid microextraction was applied as clean up procedure. The organic layer (acetonitrile, used as dispersant) containing the benzimidazoles was mixed with the extractant (chloroform) and both were injected in water, producing a cloudy solution. Recoveries for fortified samples were higher than 70%, with relative standard deviations lower than 16% were obtained in all cases. The limits of detection were below 3μgkg -1 , demonstrating the applicability of this fast, simple, and environmentally friendly method. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. CLOSTRIDIUM PERFRINGENS IN MEAT AND MEAT PRODUCTS.

    Science.gov (United States)

    HALL, H E; ANGELOTTI, R

    1965-05-01

    A total of 262 specimens of meat and meat dishes were examined for the presence of Clostridium perfringens. Of this total, 161 were raw, unprocessed beef, veal, lamb, pork, or chicken; 101 were processed meats and meat dishes. C. perfringens was isolated from 113 (43.1%) of these specimens. The highest percentage of contamination (82%) was found in veal cuts, and the lowest (4.7%) in sliced sandwich meats and spreads. Only 2 of the 113 isolates were shown to produce heat-resistant spores, which indicates a very low incidence (0.8%) of contamination. These findings indicate that outbreaks of C. perfringens food-borne disease in the Cincinnati area are caused principally by the contamination of the food with vegetative cells or spores of the organism after cooking. Studies of the effects of various holding temperatures on the growth of C. perfringens indicated that, in the range of 5 to 15 C, no multiplication would occur, but that viable cells would still be present at the end of a 5-day holding period. Extremely rapid growth occurred at temperatures around 45 C, and complete inhibition of growth was accomplished between 49 and 52 C.

  3. Identification of characteristic aroma compounds in raw and thermally processed African giant snail (Achatina fulica).

    Science.gov (United States)

    Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma

    2018-04-24

    Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.

  4. Meat Processing.

    Science.gov (United States)

    Legacy, Jim; And Others

    This publication provides an introduction to meat processing for adult students in vocational and technical education programs. Organized in four chapters, the booklet provides a brief overview of the meat processing industry and the techniques of meat processing and butchering. The first chapter introduces the meat processing industry and…

  5. Tenacity of Alaria alata mesocercariae in homemade German meat products.

    Science.gov (United States)

    González-Fuentes, Hiromi; Hamedy, Ahmad; von Borell, Eberhard; Luecker, Ernst; Riehn, Katharina

    2014-04-17

    A renewed interest in the pathogenic potential of Alaria alata mesocercariae emerged over the last 10years as a result of increased findings of this parasite in feral pigs during official examination for Trichinella spp. Cases of food associated human alariosis in North America suggest that a risk associated with the consumption of traditional raw cured products from infected wild boar meat cannot be neglected because the commonly applied preservation techniques may not necessarily kill the mesocercariae. In addition, changes in consumer behavior and new preparation methods for game meat (e.g. pink roasting and grilling) may increase the risk for food-associated parasitic infections. Thus, there is a strong need for the evaluation of the tenacity of A. alata mesocercariae against different physical and chemical influences as pertaining to common preservation and preparation techniques. Against this backdrop the aim of our work was a sound analysis of the survivability of A. alata mesocercariae during curing, fermentation, cold smoking and drying in raw cured meat products. Eighty three samples of traditional German meat products were prepared from naturally infected game meat and partly spiked with additional vital mesocercariae to achieve an adequate dose of infection. The resultant products were examined chronologically for dead and viable A. alata mesocercariae with the Alaria mesocercariae migration technique. After 24h of production, vital A. alata mesocercariae were still found in raw type sausages but no vital parasites were detected in the final products. Based on these results a possible risk for the consumer for an infection with A. alata mesocercariae through the consumption of contaminated raw cured products can be largely ruled out if the respective food technological procedures are carried out properly. However, a risk for the consumer cannot be excluded in cases of very early consumption of these products. Copyright © 2014 Elsevier B.V. All rights

  6. Halal authenticity issues in meat and meat products.

    Science.gov (United States)

    Nakyinsige, Khadijah; Man, Yaakob Bin Che; Sazili, Awis Qurni

    2012-07-01

    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. U.S. Food safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: an establishment-level analysis.

    Science.gov (United States)

    Eblen, Denise R; Barlow, Kristina E; Naugle, Alecia Larew

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) pathogen reduction-hazard analysis critical control point systems final rule, published in 1996, established Salmonella performance standards for broiler chicken, cow and bull, market hog, and steer and heifer carcasses and for ground beef, chicken, and turkey meat. In 1998, the FSIS began testing to verify that establishments are meeting performance standards. Samples are collected in sets in which the number of samples is defined but varies according to product class. A sample set fails when the number of positive Salmonella samples exceeds the maximum number of positive samples allowed under the performance standard. Salmonella sample sets collected at 1,584 establishments from 1998 through 2003 were examined to identify factors associated with failure of one or more sets. Overall, 1,282 (80.9%) of establishments never had failed sets. In establishments that did experience set failure(s), generally the failed sets were collected early in the establishment testing history, with the exception of broiler establishments where failure(s) occurred both early and late in the course of testing. Small establishments were more likely to have experienced a set failure than were large or very small establishments, and broiler establishments were more likely to have failed than were ground beef, market hog, or steer-heifer establishments. Agency response to failed Salmonella sample sets in the form of in-depth verification reviews and related establishment-initiated corrective actions have likely contributed to declines in the number of establishments that failed sets. A focus on food safety measures in small establishments and broiler processing establishments should further reduce the number of sample sets that fail to meet the Salmonella performance standard.

  8. Detection of Salmonella in Meat

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, Flemming; Mansdal, Susanne

    2012-01-01

    Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective of this study was to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab samples...... obtained (SP, SE, and AC were 100, 95, and 97%, respectively). This test is under implementation by the Danish meat industry, and can be useful for screening of large number of samples in the meat production, especially for fast release of minced meat with a short shelf life....

  9. Radioecological studies of 137Cs in limnological ecosystems. Biochemical states of 137Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    International Nuclear Information System (INIS)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki; Izumo, Yoshiro; Nakamura, Fumio.

    1997-01-01

    Biochemical states of 137 Cs accumulated in killifish's (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of 137 Cs radioactivity in the killifish's raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish's control raw meat mixed with 137 Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to 137 CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD 280nm in the samples were different from those of each radioactive peak. It was so suggested that 137 Cs accumulated in the killifish's meat was shown not to be binding to protein's composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with 137 Cs in samples and ammonium phosphomolybdate, 137 Cs in the NPNC fraction of the killifish's meat was not almost different from those of each control and 137 CsCl solution. (author)

  10. Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

    Science.gov (United States)

    Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

    2014-01-01

    In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

  11. Comparison of quality attributes of buffalo meat curry at different storage temperature.

    Science.gov (United States)

    Kandeepan, Gurunathan; Anjaneyulu, Anne Seet Ram; Kondaiah, Napa; Mendiratta, Sanjod Kumar

    2011-01-01

    The product quality of curry is determined by the food animal source, raw materials and the method of processing. Moreover the scientific information on processing and quality of traditional buffalo meat curry from different groups of buffaloes is not available. This study was undertaken to develop processed curry from different buffalo groups and to compare its quality during storage at ambient and refrigeration temperature. The meat samples were collected from the longissimus dorsi muscle of the carcasses from each group of buffaloes slaughtered according to the traditional halal method. Buffalo meat curry was prepared in a pressure cooker with the standardized formulation. This final product was subjected to evaluation of quality and shelf life. To evaluate the effect of different groups of meat samples on the quality of curry, product yield, pH, proximate composition, water activity (aw), thiobarbituric acid reactive substances (TBARS), calorific value, sensory attributes and microbiological assay were determined The energy of meat curry from young buffaloes was significantly lower than the meat curry from spent animal groups. The overall acceptability of curry decreased significantly during 3 days ambient storage compared to refrigeration storage. Scientific processing by adopting good manufacturing practices and suitable packaging helped greatly to improve the shelf life of the ambient temperature stored buffalo meat curry. Buffalo meat curry from young male group showed better product characteristics and overall acceptability scores than spent buffalo group.

  12. Solvent microextraction-flame atomic absorption spectrometry (SME-FAAS) for determination of ultratrace amounts of cadmium in meat and fish samples.

    Science.gov (United States)

    Goudarzi, Nasser

    2009-02-11

    A simple, low cost and highly sensitive method based on solvent microextraction (SME) for separation/preconcentration and flame atomic absorption spectrometry (FAAS) was proposed for the determination of ultratrace amounts of cadmium in meat and fish samples. The analytical procedure involved the formation of a hydrophobic complex by mixing the analyte solution with an ammonium pyrrolidinedithiocarbamate (APDC) solution. In suitable conditions, the complex of cadmium-APDC entered the micro organic phase, and thus, separation of the analyte from the matrix was achieved. Under optimal chemical and instrumental conditions, a detection limit (3 sigma) of 0.8 ng L(-1) and an enrichment factor of 93 were achieved. The relative standard deviation for the method was found to be 2.2% for Cd. The interference effects of some anions and cations were also investigated. The developed method has been applied to the determination of trace Cd in meat and fish samples.

  13. Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

    Science.gov (United States)

    Eftekhari, Mohsen; Mosavari, Nader

    2016-12-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

  14. Total arsenic in raw and boiled portions of Norway lobster (Nephrops norvegicus) from the central Adriatic Sea.

    Science.gov (United States)

    Visciano, Pierina; Perugini, Monia; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Salese, Carmine; Amorena, Michele

    2013-12-18

    The distribution of total arsenic in different portions of Norway lobster (Nephrops norvegicus L., Crustacea) was studied both in fresh samples and after a boiling process. All individuals (n = 80) were selected of medium standard commercial size (13-15 cm). The highest mean concentrations (26.86 ± 1.57 mg/kg wet weight (ww)) were found in the raw brown meat of the crustacean, probably due to its detoxification role, whereas the lowest mean values (15.97 ± 0.85 mg/kg ww) were in the raw exoskeleton. The raw white meat reported mean values of 16.09 ± 0.61 mg/kg ww. The levels of arsenic contamination detected in the boiled portions showed a significant (p < 0.01) decrease compared to the raw portions, as a consequence of solubilization phenomena. In fact, a large amount of arsenic from raw lobsters was transferred to the corresponding boiling broth. In the most commonly consumed portion, the white meat, only slight losses (7.22%) in total arsenic content were observed compared to the raw portion.

  15. Meat spoilage during distribution.

    Science.gov (United States)

    Nychas, George-John E; Skandamis, Panos N; Tassou, Chrysoula C; Koutsoumanis, Konstantinos P

    2008-01-01

    Meat spoilage during distribution can be considered as an ecological phenomenon that encompasses the changes of the available substrata (e.g., low molecular compounds), during the prevailing of a particular microbial association, the so-called specific spoilage organisms (SSO). In fact, spoilage of meat depends on an even smaller fraction of SSO, called ephemeral spoilage organisms (ESO). These ESO are the consequence of factors that dynamically persist or imposed during, e.g., processing, transportation and storage in the market. Meanwhile spoilage is a subjective judgment by the consumer, which may be influenced by cultural and economic considerations and background as well as by the sensory acuity of the individual and the intensity of the change. Indeed, when spoilage progresses, most consumers would agree that gross discoloration, strong off-odors, and the development of slime would constitute the main qualitative criteria for meat rejection. On the other hand, meat industry needs rapid analytical methods or tools for quantification of these indicators to determine the type of processing needed for their raw material and to predict remaining shelf life of their products. The need of an objective evaluation of meat spoilage is of great importance. The use of metabolomics as a potential tool for the evaluation of meat spoilage can be of great importance. The microbial association of meat should be monitored in parallel with the estimation of changes occurring in the production and/or assimilation of certain compounds would allow us to evaluate spoilage found or produced during the storage of meat under different temperatures as well as packaging conditions.

  16. Microstructure and physical changes in the Mexican cooked lamb meat barbacoa made with chilled and frozen meat.

    Science.gov (United States)

    Estrada-Solís, Joaquín; Figueroa-Rodríguez, Katia A; Figueroa-Sandoval, Benjamín; Hernández-Rosas, Francisco; Hernández-Cazares, Aleida S

    2016-08-01

    Longissimus dorci (LD) samples of different origin (imported and domestic) with pre-treatments (imported meat stored at -18°C for 6months, domestic meat stored at -18°C for 10days, and domestic meat stored at 4°C for 24h) were cooked as barbacoa and frozen using two treatments (air blast and liquid immersion) and then evaluated after 30days of storage. The results showed that the origin and pre-treatment of meat affected L*, a*, instrumental texture and microstructure; that the storage time affected pH, aw, b* and microstructure; and that the freezing treatments did not affect the meat. Overall, the frozen cooked lamb dish barbacoa could present some problems at the conservation stage due to an increase in pH, aw and changes in microstructure; however, the physical traits (color and texture) remained mostly unchanged and depended more on the quality of the raw meat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Survival of experimentally induced Toxoplasma gondii tissue cysts in vacuum packed goat meat and dry fermented goat meat sausages.

    Science.gov (United States)

    Neumayerová, Helena; Juránková, Jana; Saláková, Alena; Gallas, Leo; Kovařčík, Kamil; Koudela, Břetislav

    2014-05-01

    Ingestion of raw or undercooked meat is a potential source of human toxoplasmosis. The aim of this study was to determine the viability of Toxoplasma gondii cysts in vacuum packed (VP) goat meat and in dry fermented sausages (DFS), and evaluate certain physical and chemical parameters, like water activity (aw), pH value, content of salt, dry matter and fat. A portion of muscle tissue from experimentally infected animals was used for production of VP meat with or without addition of 2.5% curing salt, and stored at 4 °C or at -20 °C. Results of bioassay showed that, samples of vacuum packed Toxoplasma positive meat without salt addition were alive after six weeks at 4 °C. Incubation at -20 °C supported the viability after 3 h, but not after 4 h. After 7 days in 2.5% of curing salt, samples of T. gondii VP goat meat were still viable, but not after 14 days at 4 °C. All the DFS samples were not positive for infective cysts which mean that, they do not pose a risk of T. gondii transmission. These data suggest that vacuum packaging increases the survival of T. gondii cysts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The inhibitory effect of sodium thiocyanate and sodium percarbonate ratios on microorganism growth in raw milk samples as an effective treatment to extend milk quality during storage

    Directory of Open Access Journals (Sweden)

    Supreena Srisaikham

    2017-02-01

    Full Text Available Preservation of raw milk quality by activation of lactoperoxidase system (LPs was studied for the inhibition of microorganism growth. The antimicrobial effects of LPs were examined by measuring thiocyanate (SCN- concentration, lactoperoxidase (LP activity, milk composition, total bacterial count (TBC and coliform count (CC. All parameters were analyzed at 0 h and at 25°C and 30°C as a control. Thus, the experiment was conducted to evaluate the effect of 2 different temperatures (25°C vs 30°C and 4 ratios of NaSCN:2Na2CO3 3H2O2 (0:0, 7:15, 14:30 and 21:45 mg/L on milk samples (both uninoculated raw milk samples and Escherichia coli (E. coli inoculated milk samples with 8 replicates per run using 0-12 h incubation time in vitro assay. The runs were conducted on the same 4 NaSCN:2Na2CO3 3H2O2 ratios and different temperature and time of incubation were used. The results showed that the milk SCN- concentration and LP activity increased with increasing NaSCN:2Na2CO3 3H2O2 ratios. Milk compositions retained the quality of normal milk fat, protein, lactose, solid-not-fat (SNF and total solid (TS contents, and they were not significantly affected by the LPs activation. An obvious effect of the LP activated milk was the inhibition of TBC in uninoculated raw milk samples for 6 to 12 h both at 25°C and 30°C, and for 6 to 9 h in E. coil inoculated milk samples, whereas CC (6 h at 25°C and at least 3 h at 30°C for both uninoculated and E. coil inoculated milk samples. It is concluded that improved preservation of milk can be achieved through the addition of 14:30 and 21:45 mg/L of NaSCN:2Na2CO3 3H2O2 in uninoculated and E. coil inoculated milk samples respectively, to extend milk quality during storage.

  19. Detection of Salmonella enterica in meat in less than 5 hours by a low-cost and non-complex sample preparation method

    DEFF Research Database (Denmark)

    Fachmann, Mette Sofie Rousing; Löfström, Charlotta; Hoorfar, Jeffrey

    2017-01-01

    peptone water, and a real-time PCR compatible sample preparation method, based on filtration, centrifugation, and enzymatic digestion, followed by fast cycling real-time PCR detection. The method was validated in an un-paired, comparative study against the Nordic Committee on Food Analysis (NMKL......, and help contribute to improved food safety. While the cost of analysis and hands-on time of the presented rapid method were comparable to reference culture methods, the fast product release by this method can provide the meat industry with a competitive advantage. Not only will the abattoirs save costs......Salmonella is recognised as one of the most important foodborne bacteria, and has a wide health and socioeconomical impact worldwide. Fresh pork meat is one of the main sources of Salmonella and efficient and fast methods for detection are therefore necessary. Current methods for Salmonella...

  20. Evaluation of a fluid versus a powder pepsin formulation to detect Trichinella spiralis larvae in meat samples by a digestion technique

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Charlotte; Nockler, K.; Pozio, E.

    2007-01-01

    Pepsin powder constitutes a health risk, potentially causing severe allergic reactions to those handling the chemical. A fluid pepsin formulation was produced and tested, first in a preliminary study and then in a ring trial encompassing four European National Reference Laboratories (NRLs......). The purpose of each trial was to ascertain and compare the action of pepsin powder with that of the pepsin fluid for digesting meat and liberating encapsulated Trichinella spiralis larvae for subsequent counting. The quality of digestion was furthermore evaluated by assessing the visibility through...... the digestion fluid and the amount of debris remaining after digestion. For the ring trial, at each laboratory 20 blinded replicate 100-g samples of pork meat containing a known number of encapsulated T. spiralis larvae (0 to 30) were digested by the magnetic stirrer method using either the standard pepsin...

  1. Physicochemical properties of meat of ducks of mulberries in modern technologies of meat products

    Directory of Open Access Journals (Sweden)

    R. F. Galin

    2017-01-01

    Full Text Available The article presents the results of studying the chemical composition of mullards duck meat in comparison with the ducks of the Beijingg white breed and musk ducks. The chemical analysis results allow us to note the high moisture content for mullard duck meat. The low fat content for white and red mullard duck meat opens up wide opportunities for the development of an assortment of meat products with a functional orientation. The limited amino acids are determined. The total number of essential amino acids in the mullard duck meat is higher than in musk (by 1.02 g / 100 g protein and Beijingg (by 0.86 g / 100 g protein, which indicates a higher biological value. The limiting amino acid is methionine and cysteine. The article presents the results of the raw material aroma assessment using the "MAG 8" - "electronic nose" analyzer. The content of easily volatile compounds in the equilibrium gas phase for samples of muscle and fat tissue from ducks of different breeding was compared and evaluated. The most informative in the matrix are sensors with films of polydiethylene glycol succinate, polyvinylpyrrolidone, polyethylene glycol PEG-2000, 18-crown-6, trioctylphosphine oxidase, which show maximum sensitivity to polar and nitrogen-containing compounds, aromatic hydrocarbons. This is explained by the fact that the easily volatile fraction of both meat and fat of the samples under study is represented by a variety of organic compounds of different concentrations. Such a variety of substances can be perceived by tasters as "a noticeable smell, difficult". In accordance with the results obtained, we concluded that the aroma of muscle and fat tissue of mulard ducks is more intense, more saturated than the Beijingg duck. The obtained data on the chemical composition indicate possible dietary properties of meat of ducks of mullards. The rich, pronounced aroma of muscle and fatty tissue causes high organoleptic parameters of the finished product, which is

  2. Rapid screening of natually occurring radioactive nuclides({sup 2}'3{sup 8}U, {sup 232}Th) in raw materials and by-products samples using XRF

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Young; Lim, Chung Sup [Radiation Biotechnology and Applied Radioiostope Science, University of Science and Technology, Daejeon (Korea, Republic of); Lim, Jong Myoung; Ji, Young Yong; Chung, Kun Ho; Lee, Wan No; Kang, Mun Ja [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jang, Byung Uck [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2016-12-15

    As new legislation has come into force implementing radiation safety management for the use of naturally occurring radioactive materials (NORM), it is necessary to establish a rapid and accurate measurement technique. Measurement of {sup 238}U and {sup 232}Th using conventional methods encounter the most significant difficulties for pretreatment (e.g., purification, speciation, and dilution/enrichment) or require time-consuming processes. Therefore, in this study, the applicability of ED-XRF as a non-destructive and rapid screening method was validated for raw materials and by-product samples. A series of experiments was conducted to test the applicability for rapid screening of XRF measurement to determine activity of {sup 238}U and {sup 23{sup 2}}Th based on certified reference materials (e.g., soil, rock, phosphorus rock, bauxite, zircon, and coal ash) and NORM samples commercially used in Korea. Statistical methods were used to compare the analytical results of ED-XRF to those of certified values of certified reference materials (CRM) and inductively coupled plasma mass spectrometry (ICP-MS). Results of the XRF measurement for {sup 238}U and {sup 232}Th showed under 20% relative error and standard deviation. The results of the U-test were statistically significant except for the case of U in coal fly ash samples. In addition, analytical results of {sup 238}U and {sup 232}Th in the raw material and by-product samples using XRF and the analytical results of those using ICP-MS (R{sup 2}≥0.95) were consistent with each other. Thus, the analytical results rapidly derived using ED-XRF were fairly reliable. Based on the validation results, it can be concluded that the ED-XRF analysis may be applied to rapid screening of radioactivities ({sup 238}U and {sup 232}Th) in NORM samples.

  3. Lead, cadmium and chromium in raw and boiled portions of Norway lobster.

    Science.gov (United States)

    Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele

    2014-01-01

    Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.

  4. Organic beef production by Maremmana breed: qualitative meat characteristics

    OpenAIRE

    Mele, Prof. Marcello; Morbidini, Prof. Luciano; Cozza, Dr. Francesca; Pauselli, Prof. Mariano; Pollicardo, Dr. Alice

    2008-01-01

    Meat quality of Maremmana young bulls and steers was evaluated during three consecutive years, according to an extension service experimental program. Cooking loss values of meat samples were lower in meat from steers, whereas shear force values were higher. Meat from steers was darker than meat from young bulls, as a consequence of a low level of Lightness and a high level of Chroma. Meat chemical composition showed a higher content of intramuscular fat in steer meat, which showed also a low...

  5. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  6. Determination of steroid hormones and their metabolite in several types of meat samples by ultra high performance liquid chromatography-Orbitrap high resolution mass spectrometry.

    Science.gov (United States)

    López-García, Marina; Romero-González, Roberto; Garrido Frenich, Antonia

    2018-03-09

    A new analytical method based on ultra-high performance liquid chromatography (UHPLC) coupled to Orbitrap high resolution mass spectrometry (Orbitrap-HRMS) has been developed for the determination of steroid hormones (hydrocortisone, cortisone, progesterone, prednisone, prednisolone, testosterone, melengesterol acetate, hydrocortisone-21-acetate, cortisone-21-acetate, testosterone propionate, 17α-methyltestosterone, 6α-methylprednisolone and medroxyprogesterone) and their metabolite (17α-hydroxyprogesterone) in three meat samples (chicken, pork and beef). Two different extraction approaches were tested (QuEChERS "quick, easy, cheap, effective, rugged and safe" and "dilute and shoot"), observing that the QuEChERS method provided the best results in terms of recovery. A clean-up step was applied comparing several sorbents, obtaining the best results when florisil and aluminum oxide were used. The optimized method was validated, obtaining suitable results for all validation parameters in the three meat matrices evaluated. Recovery values ranged from 70% to 103% (except for prednisone in beef samples), meanwhile repeatability and reproducibility were obtained at values lower than 18% and 21%, respectively. The limit of quantification (LOQ) was established for most of the compounds at 1.0 μg/kg, except for testosterone in chicken and hydrocortisone-21-acetate and cortisone-21-acetate in pork at 2.0 μg/kg. Decision limit (CCα) and detection capability (CCβ) values ranged from 1.0-2.7 μg/kg and 1.9-5.5 μg/kg, respectively, in the three matrices. Finally, thirty one meat samples were analyzed and two hormones, progesterone and hydrocortisone, were detected in a beef and pork sample at 1.7 and 2.8 μg/kg respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Production of fungal chitosan from date wastes and its application as a biopreservative for minced meat.

    Science.gov (United States)

    Tayel, Ahmed A; Ibrahim, Sami I A; Al-Saman, Mahmoud A; Moussa, Shaaban H

    2014-08-01

    Raw and processed meat contaminated with pathogenic microorganisms is a continuing worldwide problem facing health and industry overseers. Fungal chitosan was extracted, purified and characterized from Aspergillus brasiliensis (niger) ATCC 16404 grown in date syrup (dips) and applied as a potential meat biopreservative. The main features of produced chitosan were a deacetylation degree of 81.3%, a molecular weight of 31,000Da, 96% solubility in 1% acetic acid solution and a harmonized IR-spectrum to standard commercial chitosan. The application of fungal chitosan, as a natural and safe biopreservative for minced meat, was conducted in comparison with potassium sorbate, as a commercial meat preservative. Treated meat samples with 0.02% chitosan was the least trials in microbial contents, i.e. total count, coliforms, β-glucuronidase-positive Escherichia coli, Enterobacteriaceae, yeasts and molds, Staphylococcus aureus and coagulase positive staphylococci. The antimicrobial activity of fungal chitosan was considerably greater than that of potassium sorbate or their combination at 0.01% from each. Sensory characteristics, e.g. color, odor and texture, of treated meat with chitosan, were higher than those of control and potassium sorbate treated samples. Fungal chitosan, however, could be recommended as a powerful, natural and eco-friendly alternative for meat preservation and overall quality maintenance. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Influence of the marinating type on the morphological and sensory properties of horse meat.

    Science.gov (United States)

    Vlahova-Vangelova, Dessislava B; Abjanova, Sholpan; Dragoev, Stefan G

    2014-01-01

    The aim of this study was to explore the influence of acid, alkaline and water-oil marinating on morphological changes and sensory properties of horse meat (m. Longissimus dorsi). Nine samples (C - control stored in air, AL - alkaline marinated in 2% polyphosphates and 2% sodium chloride brine solution, AC - acid marinated in 2% sodium lactate and 2% sodium chloride brine solution, WO - marinated in water-oil emulsion (50/50) contained and 2% sodium chloride and SC - marinated in 2% sodium chloride brine solution) were examined. After 24 h and 48 h of marinating changes in morphology of marinated meat, pH and sensory properties of raw and roasted samples were established. It was determined that sensory properties (aroma, flavor and tenderness) after roasting were classified as follows: AL48 > AL24 > AC24 > AC48 > SC48 > SC24 > WO24 > WO48 > С. Meat tenderness in AL48, AL24, AC24 and AC48 showed better results due to stronger morphological changes in connective and muscle tissues. Alkaline solutions were more suitable for horse meat marinating compared to acid solutions and the possible reason for strong action of alkaline solutions was lower internal meat pH. Alkaline marinating should be conducted for 24 h because after 48 h the meat acquires a soft and unusually tender texture. Water-oil marinating was not appropriate for horse meat.

  9. Studies on the quality of duck meat sausages during refrigeration.

    Science.gov (United States)

    Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M

    2016-01-01

    Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating

  10. Influence of color on dielectric properties of marinated poultry breast meat.

    Science.gov (United States)

    Samuel, D; Trabelsi, S

    2012-08-01

    The dielectric behavior of foods when exposed to radio-frequency and microwave electric fields is highly influenced by moisture content and the degree of water binding with constituents of the food materials. The ability to correlate specific food quality characteristics with the dielectric properties can lead to the development of rapid, nondestructive techniques for such quality measurements. Water-holding capacity is a critical attribute in meat quality. Up to 50% of raw poultry meat in the United States is marinated with mixtures of water, salts, and phosphates. The objective of this study was to determine if variations in breast meat color would affect the dielectric properties of marinated poultry meat over a broad frequency range from 500 MHz to 50 GHz. Poultry meat was obtained from a local commercial plant in Georgia (USA). Color and pH measurements were taken on the breast filets. Groups of breast filets were sorted into classes of pale and normal before adding marination pickup percentages of 0, 5, 10, and 15. Breast filets were vacuum-tumbled and weighed for pickup percentages. Dielectric properties of the filets were measured with a coaxial open-ended probe on samples equilibrated to 25°C. Samples from pale meat exhibited higher dielectric properties than samples from normal meat. No differences could be observed between samples from pale and normal meat after marination of the samples. Overall, dielectric properties increased as the marination pickup increased (α=0.05). Marination pickup strongly influenced the dielectric loss factor. Differences between samples marinated at different pickup levels were more pronounced at lower frequencies for the dielectric loss factor. As frequency increased, the differences between samples decreased. Differences in dielectric constant between samples were not as consistent as those seen with the dielectric loss factor.

  11. Unraveling the chemical identity of meat pigments.

    Science.gov (United States)

    Pegg, R B; Shahidi, F

    1997-10-01

    This review examines the chemistry of nitrite curing of meat and meat products as it relates to the development of cured meat color and provides a detailed account of how nitrite-free processed meats could be prepared using the preformed cooked cured-meat pigment (CCMP). Thus, a chemical description of meat color, both raw and cooked, and characterization of nitrosylheme pigments follows. Based on electron paramagnetic resonance (EPR), visible and infrared spectroscopic studies, evidence has been provided to support the hypothesis that the chemical structure of the preformed CCMP is identical to that of the pigment prepared in situ after thermal processing of nitrite-cured meat and is in fact a mononitrosylheme complex. An appendix, which describes the basic principles of EPR spectroscopy used in the context of this review, is attached.

  12. Antibiotic Resistance Patterns of Enterococci and Occurrence of Vancomycin-Resistant Enterococci in Raw Minced Beef and Pork in Germany

    Science.gov (United States)

    Klein, Günter; Pack, Alexander; Reuter, Gerhard

    1998-01-01

    The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958

  13. Irradiation of bovine meat: effect of heme-iron concentration.; Irradiacao de carne bovina: efeito na concentracao de ferro heme

    Energy Technology Data Exchange (ETDEWEB)

    Mistura, Liliana Perazzini Furtado

    2002-07-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  14. Differentiation of Meat Samples from Domestic Horses ( Equus caballus and Asiatic Wild Asses ( Equus hemionus Using a Species-Speci fi c Restriction Site in the Mitochondrial Cytochrome b Region

    Directory of Open Access Journals (Sweden)

    Ralph Kuehn

    2006-12-01

    Full Text Available Recent studies suggest that Asiatic wild asses ( Equus hemionus are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse ( Equus caballus and wild ass meat, we developed a restriction fragment length polymorphism (RFLP assay based on the polymerase chain reaction (PCR. We ampli fi ed and sequenced a cytochrome b fragment (335 bp and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey ( Equus asinus and the Przewalski’s horse ( Equus ferus przewalskii . We detected a species-speci fi c restriction site (AatII for the Asiatic wild ass, resulting in a speci fi c restriction fragment length polymorphism (RFLP band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season.

  15. Consumer attitudes to meat eating.

    Science.gov (United States)

    Richardson, N J; Macfie, H J; Shepherd, R

    1994-01-01

    This study reports on current meat consumption in the UK and the factors that are percieved by the subjects to be influential in their choice of diet. A random sample of individuals from the population (n-1018) were questioned on their consumption and attitudes towards meat by a postal survey. The study revealed that 28·3% of the population considered themselves to be reducing meat consumption; attitudes found to be determinant in changes in the consumption of meat were healthiness, taste and concerns over additives. Hypothetical future events were found to affect people's estimated meat-eating. Knowledge of meat-related information was investigated with specific reference to the respondents' trust in the various sources used; food package labels were found to be an influential source of meat-related information. Copyright © 1993. Published by Elsevier Ltd.

  16. Radioecological studies of {sup 137}Cs in limnological ecosystems. Biochemical states of {sup 137}Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    Energy Technology Data Exchange (ETDEWEB)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Institute of Public Health, Urawa (Japan); Izumo, Yoshiro; Nakamura, Fumio

    1997-07-01

    Biochemical states of {sup 137}Cs accumulated in killifish`s (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of {sup 137}Cs radioactivity in the killifish`s raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish`s control raw meat mixed with {sup 137}Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to {sup 137}CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD{sub 280nm} in the samples were different from those of each radioactive peak. It was so suggested that {sup 137}Cs accumulated in the killifish`s meat was shown not to be binding to protein`s composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with {sup 137}Cs in samples and ammonium phosphomolybdate, {sup 137}Cs in the NPNC fraction of the killifish`s meat was not almost different from those of each control and {sup 137}CsCl solution. (author)

  17. THE YIELD OF DNA IN THERMAL TERATED DEER MEAT

    Directory of Open Access Journals (Sweden)

    Jozef Golian

    2011-07-01

    Full Text Available Residuals of DNA are one of the most important factors for detection, traceability and reverse authentication of deer meat. In this project we isolated DNA from deer processed meat and analysed by electrophoresis. Goal of the study was compute ratio between raw meat and several heat processed deer meat. Samples were prepared by five heat treatment techniques (pan roasted with temperature 180-240°C, fried with 156°C, braised with temperature 100-150°C, boiled in 100.2°C water and autoclaved in different time intervals. The highest amount of residual DNA 1927ng was obtained with two hours boiled sample. The lowest value 89.89ng was obtained with one hour braised sample. In technological adjustments highest amount of DNA and 1927ng, so the total yield of 192.7ng.-l was observed in the sample we cooked for two hours at boiling temperature.   doi:10.5219/153 

  18. Development of a simple and low-cost enzymatic methodology for quantitative analysis of carbamates in meat samples of forensic interest.

    Science.gov (United States)

    Sabino, Bruno Duarte; Torraca, Tathiana Guilliod; Moura, Claudia Melo; Rozenbaum, Hannah Felicia; de Castro Faria, Mauro Velho

    2010-05-01

    Foods contaminated with a granulated material similar to Temik (a commercial pesticide formulation containing the carbamate insecticide aldicarb) are often involved in accidental ingestion, suicides, and homicides in Brazil. We developed a simple technique to detect aldicarb. This technique is based on the inhibition of a stable preparation of the enzyme acetylcholinesterase, and it is specially adapted for forensic purposes. It comprises an initial extraction step with the solvent methylene chloride followed by a colorimetric acetylcholinesterase assay. We propose that results of testing contaminated forensic samples be expressed in aldicarb equivalents because, even though all other carbamates are also potent enzyme inhibitors, aldicarb is the contaminant most frequently found in forensic samples. This method is rapid (several samples can be run in a period of 2 h) and low cost. This method also proved to be precise and accurate, detecting concentrations as low as 40 microg/kg of aldicarb in meat samples.

  19. Determination of the uranium concentration in samples of raw, retorted and spent shale from Irati, Parana-Brazil, by the fission track registration technique

    International Nuclear Information System (INIS)

    Cabral, R.G.

    1981-02-01

    The feasibility of the determination of uranium in oil shale, by the fission track registration technique is studied. The wet and dry methods were employed, using a Bayer policarbonate, Makrofol KG, as detector. It was created a new variant of the dry method. The fission track registration technique was used in samples of raw, retorted and spent shale from Irati, Parana in Brazil, 16 μg U/g, 20 μg U/g and 20μg U/g were found, respectively, with a total error ranging from 19% to 20%. Some experimental results were included for illustration and comparison. The feasibility of the determination of uranium in oil shale from Irati was verified. (Author) [pt

  20. Existing drug resistance among Staphylococcus spp. from raw milk samples in Khon Kaen province, Northeastern Thailand by direct quadriplex PCR

    Directory of Open Access Journals (Sweden)

    Buppachat Trakarnchan

    2017-10-01

    Full Text Available To describe the proportion of methicillin resistant Staphylococcus aureus, and mupirocin resistant among the isolates from milk, three hundred and eighty-one samples were collected in Khon Kaen province, Thailand, during January to March, 2014. Quadriplex PCR was a method of choice. The occurrence of S. aureus and other Staphylococcus spp. were 21.26 and 34.12%, respectively. Among the 81 S. aureus isolates, 82.72 (67/81, 11.11 (9/81, and 6.17% (5/81 were S. aureus, S. aureus carrying mecA, and S. aureus harboring mupA genes, respectively. These two mutant genes may possibly be transferred to other bacteria in milk. Therefore, good hygienic practices and strict control may limit the spread.

  1. Trichinellosis acquired in Nunavut, Canada in September 2009: meat from grizzly bear suspected.

    Science.gov (United States)

    Houzé, S; Ancelle, T; Matra, R; Boceno, C; Carlier, Y; Gajadhar, A A; Dupouy-Camet, J

    2009-11-05

    Five cases of trichinellosis with onset of symptoms in September 2009, were reported in France, and were probably linked to the consumption of meat from a grizzly bear in Cambridge Bay in Nunavut, Canada. Travellers should be aware of the risks of eating raw or rare meat products in arctic regions, particularly game meat such as bear or walrus meat.

  2. Influence of Skin Packaging on Raw Beef Quality: A Review

    Directory of Open Access Journals (Sweden)

    S. Stella

    2018-01-01

    Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.

  3. Influence radurization on the sensory properties of broiler meat

    International Nuclear Information System (INIS)

    Zabielski, J.; Fiszer, W.; Mroz, J.; Niewiarowicz, A.

    1981-01-01

    The sensory properties of normal, PSE and DFD chicken carcasses have been investigated. Raw carcasses treated with 2,5 kGy and 5,0 kGy could be distinguished from non-irradiated by its appearance and slight irradiation odour, however all samples were in the acceptable range. The broiler carcasses after 14 days of storage in 4+-1 degC had received sensory acceptance ratings comparable with fresh, non-irradiated samples. Due to unpalatable odour, the shelf-life of radurized PSE carcasses was limited to 14 days in comparison with 21 days for normal and DFD type broiler meat. (author)

  4. Effect of storage conditions on the biogenic amine content in wild boar meat

    Directory of Open Access Journals (Sweden)

    Zdeňka Hutařová

    2014-01-01

    Full Text Available Hygienic quality of game meat depends on many factors during and after hunting. Freshness of meat is connected with the concentration of biogenic amines which is related to meat spoilage. The aim of this study was to assess changes in concentration of biogenic amines in raw meat of wild boar (n = 20, mean age 1–2 years during storage at different temperatures. Carcases of wild boars hunted in winter 2012 in hunting districts of south Moravia were stored unskinned during 21 days at various temperatures (0, 7 and 15 °C. Concentrations of biogenic amines (putrescine, cadaverine, tyramine, tryptamine, phenylethylamine, histamine, spermine and spermidine were determined in the shoulder and leg muscles by high-performance liquid chromatography in combination with triple quadrupole tandem mass spectrometry. Good hygienic quality was maintained when wild boar carcasses were stored for a maximum of 14 days at 0 °C (content of biogenic amines in 3 meat samples exceed the limit of 5 mg/kg on day 21 of storage or a maximum of 7 days at 7 °C (content of biogenic amines in 4 meat samples exceed the limit of 5 mg/kg on day 14 of storage. The temperature of 15 °C should be considered as unsuitable storage temperature if good hygienic quality of game meat during storage is to be guaranteed (content of biogenic amines in 2 meat samples exceed the limit of 5 mg/kg already on day 7 of storage. The study brings new information about the biogenic amine content and its changes in wild boar meat during the storage period of 21 days.

  5. Direct determination of Pb in raw milk by graphite furnace atomic absorption spectrometry (GF AAS) with electrothermal atomization sampling from slurries.

    Science.gov (United States)

    de Oliveira, Tatiane Milão; Augusto Peres, Jayme; Lurdes Felsner, Maria; Cristiane Justi, Karin

    2017-08-15

    Milk is an important food in the human diet due to its physico-chemical composition; therefore, it is necessary to monitor contamination by toxic metals such as Pb. Milk sample slurries were prepared using Triton X-100 and nitric acid for direct analysis of Pb using graphite furnace atomic absorption spectrometry - GF AAS. After dilution of the slurries, 10.00µl were directly introduced into the pyrolytic graphite tube without use of a chemical modifier, which acts as an advantage considering this type of matrix. The limits of detection and quantification were 0.64 and 2.14µgl -1 , respectively. The figures of merit studied showed that the proposed methodology without pretreatment of the raw milk sample and using external standard calibration is suitable. The methodology was applied in milk samples from the Guarapuava region, in Paraná State (Brazil) and Pb concentrations ranged from 2.12 to 37.36µgl -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2011-03-04

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  7. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Zarzycki, Pawel K., E-mail: pawel_k_z@hotmail.com [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland); Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J. [Section of Toxicology and Bioanalytics, Department of Civil and Environmental Engineering, Koszalin University of Technology, Sniadeckich 2, 75-453 Koszalin (Poland)

    2012-02-24

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  8. Reprint of: Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Paweł K.; Ślączka, Magdalena M.; Zarzycka, Magdalena B.; Włodarczyk, Elżbieta; Baran, Michał J.

    2012-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds’ feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5–8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  9. Application of micro-thin-layer chromatography as a simple fractionation tool for fast screening of raw extracts derived from complex biological, pharmaceutical and environmental samples

    International Nuclear Information System (INIS)

    Zarzycki, Pawel K.; Slaczka, Magdalena M.; Zarzycka, Magdalena B.; Wlodarczyk, Elzbieta; Baran, Michal J.

    2011-01-01

    The main goal of present paper is to demonstrate the separation and detection capability of micro-TLC technique involving simple one step liquid extraction protocols of complex materials without multi-steps sample pre-purification. In the present studies target components (cyanobacteria pigments, lipids and fullerenes) were isolated from heavy loading complex matrices including spirulina dried cells, birds' feathers and fatty oils as well as soot samples derived from biomass fuel and fossils-fired home heating systems. In each case isocratic separation protocol involving less that 1 mL of one component or binary mixture mobile phases can be completed within time of 5-8 min. Sensitive detection of components of interest was performed via fluorescence or staining techniques using iodine or phosphomolybdic acid. Described methodology can be applied for fast fractionation or screening of whole range of target substances as well as chemo-taxonomic studies and fingerprinting of complex mixtures, which are present in raw biological or environmental samples.

  10. DNA barcoding for species identification from dried and powdered plant parts: a case study with authentication of the raw drug market samples of Sida cordifolia.

    Science.gov (United States)

    Vassou, Sophie Lorraine; Kusuma, G; Parani, Madasamy

    2015-03-15

    The majority of the plant materials used in herbal medicine is procured from the markets in the form of dried or powdered plant parts. It is essential to use authentic plant materials to derive the benefits of herbal medicine. However, establishing the identity of these plant materials by conventional taxonomy is extremely difficult. Here we report a case study in which the species identification of the market samples of Sida cordifolia was done by DNA barcoding. As a prelude to species identification by DNA barcoding, 13 species of Sida were collected, and a reference DNA barcode library was developed using rbcL, matK, psbA-trnH and ITS2 markers. Based on the intra-species and inter-species divergence observed, psbA-trnH and ITS2 were found to be the best two-marker combination for species identification of the market samples. The study showed that none of the market samples belonged to the authentic species, S. cordifolia. Seventy-six per cent of the market samples belonged to other species of Sida. The predominant one was Sida acuta (36%) followed by S. spinosa (20%), S. alnifolia (12%), S. scabrida (4%) and S. ravii (4%). Such substitutions may not only fail to give the expected therapeutic effect, but may also give undesirable effects as in case of S. acuta which contains a 6-fold higher amount of ephedrine compared to the roots of S. cordifolia. The remaining 24% of the samples were from other genera such as Abutilon sp. (8%), Ixonanthes sp., Terminalia sp., Fagonia sp., and Tephrosia sp. (4% each). This observation is in contrast to the belief that medicinal plants are generally substituted or adulterated with closely related species. The current study strongly suggests that the raw drug market samples of herbal medicines need to be properly authenticated before use, and DNA barcoding has been found to be suitable for this purpose. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Effect of radiation processing on meat tenderisation

    International Nuclear Information System (INIS)

    Kanatt, Sweetie R.; Chawla, S.P.; Sharma, Arun

    2015-01-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour. - Highlights: • Effect of radiation processing on tenderness of three meat systems was evaluated. • Dose dependant reduction in shear force seen in buffalo meat. • Collagen solubility increased with irradiation

  12. A Potential Use of 3-D Scanning to Evaluate the Chemical Composition of Pork Meat.

    Science.gov (United States)

    Adamczak, Lech; Chmiel, Marta; Florowski, Tomasz; Pietrzak, Dorota; Witkowski, Marcin; Barczak, Tomasz

    2015-07-01

    The aim of this study was to determine the possibility of 3-D scanning method in chemical composition evaluation of pork meat. The sampling material comprised neck muscles (1000 g each) obtained from 20 pork carcasses. The volumetric estimation process of the elements was conducted on the basis of point cloud collected using 3-D scanner. Knowing the weight of neck muscles, their density was calculated which was subsequently correlated with the content of basic chemical components of the pork meat (water, protein and fat content, determined by standard methods). The significant correlations (P ≤ 0.05) between meat density and water (r = 0.5213), protein (r = 0.5887), and fat (r = -0.6601) content were obtained. Based on the obtained results it seems likely to employ the 3-D scanning method to compute the meat chemical composition. The use of the 3-D scanning method in industrial practice will allow to evaluate the chemical composition of meat in online mode on a dressing and fabrication line and in a rapid, noninvasive manner. The control of the raw material using the 3-D scanning will allow to make visual assessment more objective and will enable optimal standardization of meat batches prior to processing stage. It will ensure not only the repeatability of product quality characteristics, but also optimal use of raw material-lean and fat meat. The knowledge of chemical composition of meat is essential due to legal requirements associated with mandatory nutrition facts labels on food products. © 2015 Institute of Food Technologists®

  13. Meet meat

    NARCIS (Netherlands)

    Bekker, Gerben A.; Tobi, Hilde; Fischer, Arnout R.H.

    2017-01-01

    In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries

  14. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    Directory of Open Access Journals (Sweden)

    Juni Sumarmono

    2010-01-01

    Full Text Available Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thoroughly and ground using a 5 mm diameter grinding plate. The ground meat was divided into 4 batches (group of treatments; one batch was treated with iced tap water (M1, one batch with 0.1% NaCl solution (M2, one batch with 0.5% NaHCO3 solution (M3, and one batch was left as is as control (M4. Variables measured were water holding capacity (WHC, pH, emulsion capacity and stability of the meat; and firmness and tenderness of the meat gel. Results showed that M1 meat has significantly higher WHC (less percentage of free water than control (M4, whereas M2 and M3 meat has similar WHC to control. Processing caused the ground duck meat to have significantly higher pH than control. The highest meat pH was observed in M3, followed by M2, M1 and control. Processing duck meat with iced tap water, NaCl or NaHCO3 produced significantly more tender meat gel compared to untreated meat (as is. Tenderness of meat gel of M3 was the most tender followed by M2 and M1. Similar results for meat gel firmness were observed. No significant differences were observed in term of emulsion capacity (expressed as ml oil/gr protein and ml oil/gr fresh meat, emulsion stability (expressed as ml oil and total liquid released per 100 gr emulsion, and cooking recovery (%. The study reported in this paper offers simple processing technologies to improve functional characteristics of spent duck meat to be use as raw material for the production of emulsion type meat products. (Animal Production 12

  15. Significance of authenticity in meat and meat products in Iran

    Directory of Open Access Journals (Sweden)

    Tahereh Rezazadeh

    2014-06-01

    Full Text Available The Authenticity of meat products is very important for religious and health reasons in Iran. According to legislation in Iran, the consumption and importation of pork, horse, donkey and cat products should be banned. Therefore, the identification of meat products cannot be judged solely by its appearance. This issue led to the authenticity of bovine, sheep, pig, horse, donkey, chicken and soya (Glycine max in raw and processed meat products.In this study, specific primers were designed for the identification of pig ( base pair, donkey (325 base pair, chicken (391 base pair, sheep (499 base pair, horse (607 base pair, soya (707 base pair and bovine (853 base pair by Polymerase chain reaction. Following PCR, expected,, , 499,,  and  base pair fragments were detectable in pig, donkey, chicken, sheep, horse, soya and bovine, respectively. This protocol can be used for identification of raw and processed meat products in various animal species for replication to regulatory obligations for meat species safety in Iran.

  16. Prevalence of antibiotic resistant Staphylococcus aureus from raw milk samples collected from the local vendors in the region of Tirupathi, India

    Directory of Open Access Journals (Sweden)

    Sudhanthirakodi Sudhanthiramani

    2015-04-01

    Full Text Available Aim: The study was carried out with the aim to identify the suitability of the milk for consumer use with special reference to Staphylococcus aureus from milk samples collected from various local vendors and determine the antibiotic susceptibility pattern of those positive isolates. Materials and Methods: A total of 110 milk samples were collected from the local milk vendors in and around Tirupathi region of India. All the samples were enriched with buffered peptone water in 9:1 ratio and the then inoculated on baird parker agar medium with added 2% egg yolk tellurite emulsion as selective medium for S.aureus and confirmed with mannitol salt agar, Gram’s staining and biochemical tests. The typical cultural characters with coagulase-positive samples were taken as positive samples the positive samples were tested for antibiotic susceptibility with 10 different antibiotics by employing disc diffusion method. Results: Prevalence of coagulase-positive S. aureus was 39.09% (43/110 from the milk samples. The antibiotic susceptibility test of positive isolates showed high resistant toward penicillin G 37/43 (86.04% and ampicillin 32/43 (74.42%, and also showed resistant to methicillin 6/43 (13.95%, cephalothin 6/43 (13.95%, tetracycline 6/43 (13.95%, ciprofloxacin 4/43 (9.30%, enrofloxacin 3/43 (6.97%, cefoxitin 2/43 (4.65%, gentamicin 2/43 (4.65%, and co-trimoxazole 2/43 (4.65%. Many individual isolates showed resistant against two or more antibiotics in our study. Conclusion: The above study results show that the milk samples collected from local vendor having S. aureus, which can induce disease condition as well as antibiotic resistant to the humans particularly young children and old age peoples by means of consumption of raw milk and its products. This is the public health issue, which needs to be solved by educating the local vendors regarding health problems related to unhygienic milk supply and make the awareness among the consumers about this

  17. Spoilage-related activity of Carnobacterium maltaromaticum strains in air-stored and vacuum-packed meat.

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-10-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall.

  18. Spoilage-Related Activity of Carnobacterium maltaromaticum Strains in Air-Stored and Vacuum-Packed Meat ▿ †

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-01-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall. PMID:21784913

  19. Study on the meat isotopic composition for origin identification

    Directory of Open Access Journals (Sweden)

    Irina Chernukha

    2018-03-01

    Full Text Available Russian consumer and governmental authorities are equally concerned to know where food products come from. This requires more accurate and specialized methods for the evaluation of geographical location. The following methods are used: chemometrics, histological and histochemical, genomic and proteomic, microbiological, immunochemical and mass spectrometric. Method of stable isotope analysis is becoming increasingly promising nowadays for the identification of meat and meat products' place of origin. The isotope ratios of the four elements - carbon, nitrogen, oxygen and hydrogen, are mainly determined. The method is successfully used to identify a country of origin of wines, juices and water. The aim of the research was to study the stable isotope ratios for pork and beef samples purchased in Moscow supermarkets (Russian Federation. The country of production of meat samples was determined according to specifications and/or labels. The geography of countries of meat samples origin includes Europe, both America continents and Australia. Databases collected by the All-Russian Scientific Research Institute of the Brewing, Non-Alcoholic and Wine Industrywere used for the analysis and interpretation of the results. Values of 13С/12С, δ13С, 18О/16О, δ18О, 2Н/1Н, δ2Н for 30 pork and beef samples from 13 countries were obtained. Differences in stable isotope ratios were found depending on place of origin. The data correlated with the oxygen isotope characteristics for wine, which were in the range from 2.5 to 4.5 ppm. According to the 13С/12С, δ13С results, the assumption was made about a false indication of the region for the beef sample. Despite the fact that beef was labeled as a product of Lithuania, the region of origin was most probably defined as Germany. The studies carried out showed the possibility to identify the region of raw meat origin by the stable isotope ratio.

  20. Detection of thermophilic Campylobacter sp. in raw chicken sausages by methods ISO 10272: 2006 in Curitiba - Parana State - Brazil

    Directory of Open Access Journals (Sweden)

    K. Konell

    2014-12-01

    Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.

  1. Meat flavour

    International Nuclear Information System (INIS)

    Rosset, R.; Liger, P.; Roussel-Ciquard, N.

    1978-01-01

    For the consumer, meat is characterized by a certain number of organoleptic qualities; among them, flavour -that is to say the association of both odour and taste- plays a leading part. This property is based upon a great number of chemical components: some volatile components are responsible for the aroma and some non-volatile ones for the taste. These substances are either made or released during the heating of the meat on account of components called precursors which are produced during the aging of the meat. The two main reactions which preside over the elaboration of flavour are: the Maillard's reaction and the autooxidation reactions. Meat flavour is associated with the animal characteristics; it is influenced by the ante- and post mortem treatments as well as by the technological treatments for storing it. The use of synthetical flavours is to be considered as possible in the future [fr

  2. Development of a sodium dodecyl sulfate-polyacrylamide gel electrophoresis reference method for the analysis and identification of fish species in raw and heat-processed samples : A collaborative study

    DEFF Research Database (Denmark)

    Pineiro, C.; Barros-Velazquez, J.; Perez-Martin, R.I.

    1999-01-01

    A collaborative study was carried out in seven European labs with the aim of achieving a sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) standard operation procedure to identify fish species in raw and cooked samples. Urea and SDS-containing solutions were evaluated...... silver stained, yielded good results and afforded higher reproducibility, thus allowing a better matching of results among the laboratories participating in this collaborative study. Under the optimized technical conditions described above, all the fish species tested, either raw and cooked, yielded...... seemed not to be influenced so much by the state of the sample (raw, cooked at 60 degrees C, cooked at 85 degrees C). Desalting, ultrafiltration or treatment with RNase/DNase did not improve the discriminatory power of the protein patterns. Commercial homogeneous 15% ExcelGels, especially when they were...

  3. Salmonella in meats, water, fruit and vegetables as disclosed from testing undertaken by Food Business Operators in Ireland from 2005 to 2009

    Directory of Open Access Journals (Sweden)

    Duggan Sharon

    2012-09-01

    Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.

  4. Toxinotyping and antimicrobial susceptibility of enterotoxigenic Clostridium perfringens isolates from mutton, beef and chicken meat.

    Science.gov (United States)

    Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair

    2015-08-01

    A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.

  5. Virulence characterisation of Salmonella enterica isolates of differing antimicrobial resistance recovered from UK livestock and imported meat samples.

    Directory of Open Access Journals (Sweden)

    Roderick eCard

    2016-05-01

    Full Text Available Salmonella enterica is a foodborne zoonotic pathogen of significant public health concern. We have characterised the virulence and antimicrobial resistance gene content of 95 Salmonella isolates from 11 serovars by DNA microarray recovered from UK livestock or imported meat. Genes encoding resistance to sulphonamides (sul1, sul2, tetracycline (tet(A, tet(B, streptomycin (strA, strB, aminoglycoside (aadA1, aadA2, beta-lactam (blaTEM, and trimethoprim (dfrA17 were common. Virulence gene content differed between serovars; S. Typhimurium formed two subclades based on virulence plasmid presence. Thirteen isolates were selected by their virulence profile for pathotyping using the Galleria mellonella pathogenesis model. Infection with a chicken invasive S. Enteritidis or S. Gallinarum isolate, a multidrug resistant S. Kentucky, or a S. Typhimurium DT104 isolate resulted in high mortality of the larvae; notably presence of the virulence plasmid in S. Typhimurium was not associated with increased larvae mortality. Histopathological examination showed that infection caused severe damage to the Galleria gut structure. Enumeration of intracellular bacteria in the larvae 24 hours post-infection showed increases of up to 7 log above the initial inoculum and transmission electron microscopy (TEM showed bacterial replication in the haemolymph. TEM also revealed the presence of vacuoles containing bacteria in the haemocytes, similar to Salmonella containing vacuoles observed in mammalian macrophages; although there was no evidence from our work of bacterial replication within vacuoles. This work shows that microarrays can be used for rapid virulence genotyping of S. enterica and that the Galleria animal model replicates some aspects of Salmonella infection in mammals. These procedures can be used to help inform on the pathogenicity of isolates that may be antibiotic resistant and have scope to aid the assessment of their potential public and animal health risk.

  6. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

  7. Meat and Meat Product Consumption among Infants in Latvia

    Directory of Open Access Journals (Sweden)

    Širina Inga

    2017-12-01

    Full Text Available Meat consumption during the first year of life is especially important to provide necessary iron requirements. The aim of the study was to assess meat and meat product consumption of Latvian infants during their first year of life, in relation to different factors. Data were collected by interview method using two types of questionnaires: food frequency questionnaires and food diary. The study included a representative sample of infants and toddlers from all regions of Latvia with a target sample of 560 participants. The study included 266 infants: 127 girls, 139 boys, aged from 0 to 12 month. Data were summarised using the Excel software and analysed using the SPSS software. For data analysis two age groups were created: 0–5.9 months and 6–12 months. Consumption was analysed by two parameters: frequency and amount per feeding. Meat products were defined as offal products, sausages, and meat in baby food. Meat was mainly consumed after 6 months of age and by 73% of infants (n = 107. Meat from baby food was consumed only after 6 months and by 23% (n = 34. Sausages and offal products were consumed after 6 months of age. Sausages were consumed by 18% (n = 28 and offal products by 11% (n = 16 of infants. Meat consumption for the majority of infants was introduced after 6 months and was in accordance with recommendations.

  8. INFLUENCE OF AUTOLYTIC TRANSFORMATIONS ON ELECTROPHYSICAL PROPERTIES OF GOAT MEAT

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2014-01-01

    Full Text Available Functional foods represented an important element of a balanced, healthy diet. They play an important role in improving the structure of the diet of the population, are a means of prevention, correction and prevention of early transition premorbid conditions and various diseases. Meat and meat products based on it can be considered as a promising raw material for functional foods. Goat has certain dietary properties and can be used in manufacturing, but the production of high-grade products from goat meat, capable of long-term storage is not well developed. The chemical composition of the new raw meat - goat meat, on the example of the longissimus muscle of back is rich in protein, moisture, ash, and low-fat compared with other types of raw meat, which lets you create based on goat meat sector wide functional meat products. Therefore investigated the possibility of using goat meat in the production technology of functional foods. Showing the prospects for the development of goat in Russia. Investigated character of autolysis goat meat electro-physical methods and histological analysis. In the process of autolysis of goat meat are changing the electrical properties of raw meat, which are correlated with the morphological characteristics. Basic autolytic changes occurring in muscle tissue in the early stages of ripening, were reduced to a small extent the political process involving varying degrees of muscle structure in the early stages. In the later stages of maturation revealed changing widespread. Revealed that autolysis has characteristic periods and develops within 12 hours, further changes are irreversible. Shows the change in pH, carbohydrate fractions in the longissimus muscle of back goat. Results of the study of dynamics of change in pH, carbohydrate fractions in the longissimus muscle of back goat show compliance with the laws of classical autolysis noted in other sources, but differ in the time period. Defined stages of autolysis in

  9. Detection of irradiated meat, fish and their products by measuring 2-alkylcyclobutanones levels after frozen storage

    International Nuclear Information System (INIS)

    Obana, H.; Furuta, M.; Tanaka, Y.

    2007-01-01

    2-Alkylcyclobutanones, such as 2-dodecylcyclobutanone and 2-tetradecylcyclobutanone, were analyzed to assess the irradiation history of irradiated meats or fish, and cooked foods with irradiated ingredients, which had been stored frozen for up to one year. The purpose of the study was to show that irradiated meats could be detected even after having been stored in the distribution system. 2-Alkylcyclobutanones showed a small decrease in irradiated raw meats that had been stored frozen for one year. Cooked foods, such as pancake and fried chicken made with irradiated eggs and chicken, respectively, contained detectable levels of 2-alkylcyclobutanones after storage frozen for one year. The 2-alkylcyclobutanones became undetectable in highly dried samples, such as feed for lab animals, during the same period

  10. High pressure processing of meat: effects on ultrastructure and protein digestibility.

    Science.gov (United States)

    Kaur, Lovedeep; Astruc, Thierry; Vénien, Annie; Loison, Olivier; Cui, Jian; Irastorza, Marion; Boland, Mike

    2016-05-18

    The effects of high pressure processing (HPP, at 175 and 600 MPa) on the ultrastructure and in vitro protein digestion of bovine longissimus dorsi muscle meat were studied. HPP caused a significant change in the visual appearance and texture of the meat subjected to HPP at 600 MPa so that it appeared similar to cooked meat, unlike the meat subjected to HPP at 175 MPa that showed no significant visible change in the colour and texture compared to the raw meat. The muscles were subjected to digestion under simulated gastric conditions for 1 h and then under simulated small-intestinal conditions for a further 2 h. The digests were analysed using gel electrophoresis (SDS-PAGE) and ninhydrin assay for amino N. The effect of the acid conditions of the stomach alone was also investigated. Reduced SDS-PAGE results showed that pepsin-digested (60 min) HPP meats showed fewer proteins or peptides of high molecular weight than the pepsin-digested untreated meat, suggesting more breakdown of the parent proteins in HPP-treated meats. This effect was more pronounced in the muscles treated at 600 MPa. These results are in accordance with microscopy results, which showed greater changes in the myofibrillar structure after simulated gastric digestion of the sample processed at 600 MPa than at 175 MPa. Transmission electron microscopy also showed the presence of protein aggregates in the former sample, resulting probably from protein denaturation of sarcoplasmic proteins, in the subcellular space and between myofibrils; along with cell contraction (similar to that caused by heating) in the former.

  11. Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

    Directory of Open Access Journals (Sweden)

    Diego Gómez

    2015-07-01

    Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

  12. Taste-active compound levels in Korean native chicken meat: The effects of bird age and the cooking process.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Kim, Hyun Joo; Yong, Hae In; Nam, Ki Chang; Jo, Cheorun

    2015-08-01

    The effects of bird age and the cooking process on the levels of several taste-active compounds, including inosine 5'-monophosphate (IMP), glutamic acid, cysteine, reducing sugars, as well as oleic, linoleic, arachidonic, and docosahexaenoic acids (DHA), in the breast and leg meats from a certified meat-type commercial Korean native chicken (KNC) strain (Woorimatdag) were investigated. KNC cocks were raised under similar standard conditions at a commercial chicken farm, and breast and leg meats from birds of various ages (10, 11, 12, 13, and 14 wk; 10 birds/age group) were obtained. After raw and cooked meat samples were prepared, they were analyzed for the aforementioned taste-active compounds. Compared to the leg meat, KNC breast meat had higher levels of IMP, arachidonic acid, and DHA, but lower levels of the other taste-active compounds (P cooking process (P cooking process. This information could be useful for selection and breeding programs, and for popularizing native chicken meat. © 2015 Poultry Science Association Inc.

  13. The Influence of Moderate Pressure and Subzero Temperature on the Shelf Life of Minced Cod, Salmon, Pork and Beef Meat

    Directory of Open Access Journals (Sweden)

    Ilona Kołodziejska

    2013-01-01

    Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.

  14. Campylobacter in Broiler Chicken and Broiler Meat in Sri Lanka : Influence of Semi-Automated vs. Wet Market Processing on Campylobacter Contamination of Broiler Neck Skin Samples

    NARCIS (Netherlands)

    Kottawatta, Kottawattage S A; van Bergen, Marcel A P; Abeynayake, Preeni; Wagenaar, Jaap A; Veldman, Kees T; Kalupahana, Ruwani S

    2017-01-01

    Broiler meat can become contaminated with Campylobacter of intestinal origin during processing. The present study aimed to identify the prevalence of Campylobacter in broiler flocks and meat contamination at retail shops, and determine the influence of semi-automated and wet market processing on

  15. SELECTION OF MICROORGANISMS FOR FERMENTATION OF MEAT MATERIALS

    Directory of Open Access Journals (Sweden)

    Danylenko S. G.

    2014-08-01

    Full Text Available Principal criteria for the selection of microorganisms with a wide range of biological and technological properties for fermentation of raw meats are considered. Attention is paid to the main groups of microorganisms such as Micrococсus, Staphylococcus, Lactobacillus, Bifidobacterium and Propionibacterium which are promising for creation of bacterial preparations. To create bacterial preparations, the basic criteria of selection for microorganisms were determined as follows: the ability of microorganisms to be developed within the specific ecological niche (raw meat materials and their influence on flavor characteristics of the final product under the conditions of intensification of production technologies of meat products. Methods used for search and retrieval of technologically promising strains from different natural sources (fresh meats, minced meats, meat, dairy and sour-milk products, vegetables, fruit, brines and mixtures for salting are considered.

  16. Advances in ingredient and processing systems for meat and meat products.

    Science.gov (United States)

    Weiss, Jochen; Gibis, Monika; Schuh, Valerie; Salminen, Hanna

    2010-09-01

    Changes in consumer demand of meat products as well as increased global competition are causing an unprecedented spur in processing and ingredient system developments within the meat manufacturing sector. Consumers demand healthier meat products that are low in salt, fat, cholesterol, nitrites and calories in general and contain in addition health-promoting bioactive components such as for example carotenoids, unsaturated fatty acids, sterols, and fibers. On the other hand, consumers expect these novel meat products with altered formulations to taste, look and smell the same way as their traditionally formulated and processed counterparts. At the same time, competition is forcing the meat processing industry to use the increasingly expensive raw material "meat" more efficiently and produce products at lower costs. With these changes in mind, this article presents a review of novel ingredient systems and processing approaches that are emerging to create high quality, affordable meat products not only in batch mode but also in large-scale continuous processes. Fat replacers, fat profile modification and cholesterol reduction techniques, new texture modifiers and alternative antioxidant and antimicrobial systems are being discussed. Modern processing equipment to establish continuously operating product manufacturing lines and that allow new meat product structures to be created and novel ingredients to be effectively utilized including vacuum fillers, grinders and fine dispersers, and slicers is reviewed in the context of structure creation in meat products. Finally, trends in future developments of ingredient and processing systems for meat products are highlighted.

  17. Effect of radiation processing on meat tenderisation

    Science.gov (United States)

    Kanatt, Sweetie R.; Chawla, S. P.; Sharma, Arun

    2015-06-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour.

  18. European consumer attitudes on the associated health benefits of neutraceutical-containing processed meats using Co-enzyme Q10 as a sample functional ingredient.

    Science.gov (United States)

    Tobin, Brian D; O'Sullivan, Maurice G; Hamill, Ruth; Kerry, Joseph P

    2014-06-01

    This study accumulated European consumer attitudes towards processed meats and their use as a functional food. A survey was set up using an online web-application to gather information on consumer perception of processed meats as well as neutraceutical-containing processed meats. 548 responses were obtained and statistical analysis was carried out using a statistical software package. Data was summarized as frequencies for each question and statistical differences analyzed using the Chi-Square statistical test with a significance level of 5% (Pconsumer attitudes towards processed meat indicate that they are unhealthy products. Most believe that processed meats contain large quantities of harmful chemicals, fat and salt. Consumers were found to be very pro-bioactive compounds in yogurt style products but unsure of their feelings in meat based products, which is likely due to the lack of familiarity to these products. Many of the respondents were willing to consume meat based functional foods but were not willing to pay more for them. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. QUALITY CONTROL OF SOME TRADITIONAL MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    S. DOBRINAS

    2014-03-01

    Full Text Available In this paper, we present the characterization of six traditional meat products: smoked file, smoked bacon, pork sausages, sausage prepared from swine’s entrails, pork pastrami, sheep sausages. Organoleptic tests (the aspect and shape, the aspect of freshly cut in the section, smell, taste and consistency, physico-chemical and microbiological determinations (NTG, Salmonella, Listeria monocytogenes and Escherichia coli were performed. These analyzes are a part of quality control that must be done in order to obtain a certificate from the Ministry of Agriculture for a traditional product. After identification of H2S and starch and according to fat oxidation degree it was concluded that analyzed samples didn’t contain counterfeiters and all parameters analyzed are within the maximum limits allowed by law. Considering all the procedures for manufacturing, characteristics of raw and auxiliary materials, organoleptic properties of final products analyzed in this study, it can be concluded that analyzed meat specialties meet the requirements of Ministry Order no. 690/28.09.2004 for the traditional products certification.

  20. Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia

    DEFF Research Database (Denmark)

    Derra, F. A.; Karlsmose, Susanne; Monga, D. P.

    2013-01-01

    Background. Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. Objective. The objective...... of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Methods. Two hundred forty food samples were purchased...

  1. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity.

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane

    2016-07-01

    Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake

  2. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine

    2016-01-01

    ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in

  3. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  4. Analytical methods for multiresidue determination of sulfonamides and trimethoprim in meat and ground water samples by CE-MS and CE-MS/MS.

    Science.gov (United States)

    Soto-Chinchilla, Jorge J; García-Campaña, Ana M; Gámiz-Gracia, Laura

    2007-11-01

    This paper presents two methods based on CZE-MS detection and CZE-MS/MS detection developed for the multiresidue determination of ten sulfonamides (sulfapyridine, sulfadoxin, sulfamethazine, sulfadimethoxine, sulfameter, sulfamerazine, sulfachlorpyridazine, sulfadiazine, sulfamethoxazole, and sulfamethizole) and a potentiator, trimethoprim (TMP), whose contents are regulated by the EU Council Regulation no. 2377/90 in animal edible tissues. Experimental designs were employed to optimize the electrospray conditions. MS/MS experiments using an IT as analyzer operating in multiple reaction monitoring (MRM) mode were carried out to achieve the minimum number of points according to the 2002/657/EC European Decision for unambiguous identification. The proposed procedures have been compared in terms of the performance characteristics and trueness. The limits of detection and quantification were in all cases lower than the maximum residue limits legislated for these compounds and the recoveries were satisfactory, being possible the application for their monitoring in foodstuff of animal origin and in environmental samples, allowing the determination of sulfonamides and TMP residues in meat and in superficial water in the low microg/L range.

  5. Characteristics of cytotoxic necrotizing factor and cytolethal distending toxin producing Escherichia coli strains isolated from meat samples in Northern Ireland.

    Science.gov (United States)

    Kadhum, H J; Ball, H J; Oswald, E; Rowe, M T

    2006-08-01

    Swabs collected from pig, lamb and beef carcasses and samples of pork, lamb and beef mince were cultured for Escherichia coli strains. Strains harbouring cytotoxic necrotizing factors (CNF1 and 2) and cytolethal distending toxins (CDT-I,-II,-III and -IV) were identified in plate cultures of the isolates by colony hybridization with labelled probes and multiplex PCR assays. Simplex and multiplex PCR assays were used to further characterize the isolates to determine the presence of P, S and F17 fimbriae as well as afimbrial adhesins and haemolysin. The serotype was also determined where possible. Thirty strains with the capacity to code for CNF (4), CDT (24) or both (2) were isolated and characterized, and a wide range of associated factor patterns was observed. The methods utilized were successful in demonstrating the detection of viable strains with potentially significant pathogenic factors from human food sources.

  6. Radiation decontamination of meat lyophilized products

    International Nuclear Information System (INIS)

    Owczarczyk, H.B.; Migdal, W.

    2002-01-01

    There is an increasing demand for powder soups and sauces compose with lyophilized products. Technology of lyophilization is not always accompanied by thermal treatment of raw materials. That is the reason the products lyophilization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment. (author)

  7. Production of crispy bread snacks containing chicken meat and chicken meat powder

    Directory of Open Access Journals (Sweden)

    HULYA CAKMAK

    Full Text Available ABSTRACT Chicken meat in two different forms (chicken meat and chicken meat powder were added into white flour and whole wheat blend baguette bread formulations for protein enrichment and finally developing new and healthy snacks. The chicken meat and powder levels were 10% for white flour baguette, and 15% for whole wheat blend. The dried baguette samples were packaged under 100% N2, and physical, chemical, microbiological and sensorial properties were evaluated during 3 months of storage. Protein content of chicken meat powder added samples were found statistically higher than chicken meat added samples. Hardness of the snacks was significantly affected from type of chicken meat, such as values were higher for chicken meat added samples than chicken meat powder added samples. Lipid oxidation of the snacks was determined by TBA analysis, and TBA value for whole wheat mixture snack with 15% of chicken meat was the highest among all during storage. The highest overall acceptance score was obtained from white flour snack with 10% chicken meat. There was no coliform bacteria detected during storage and the results of yeast-mold count and aerobic plate count of snacks remained between the quantitative ranges.

  8. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  9. Some technological aspects of combined processing of meat by heat and ionizing radiations

    International Nuclear Information System (INIS)

    Gel'fand, S.Yu.; Nomenotskaya, N.F.; Mozul', M.Ya.

    1974-01-01

    The paper discusses the use of ionizing radiation to prolong the storage life of meat and meat products. Irradiating raw meat with doses of 0.4-0.6 Mrad increased storage life up to two months at low above-zero C temperatures. The difficulty of inhibiting autolytic processes during storage of irradiated raw meat led to searches for combined methods of meat treatment. A series of experiments was staged with pre-irradiation heating of meat up to 75, 77, and 80 0 C in order to see how cathepsin activity is affected by the duration and temperature of heating in the case of combined treatment. To increase the resistance of meat products to microbial damage, tests were carried out in which meat was exposed to short-term but intensive heat by immersing it in hot (130-160 0 C) vegetable oil (frying grease). The results are presented in the form of tables and diagrams. (E.T.)

  10. PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available Abstract Use of the prediction technologies is one of the directions of the research work carried out both in Russia and abroad. Meat processing is accompanied by the complex physico-chemical, biochemical and mechanical processes. To predict the behavior of meat raw material during the technological processing, a complex of physico-technological and structural-mechanical indicators, which objectively reflects its quality, is used. Among these indicators are pH value, water binding and fat holding capacities, water activity, adhesiveness, viscosity, plasticity and so on. The paper demonstrates the influence of animal proteins (beef and pork on the physico-chemical and functional properties before and after thermal treatment of minced meat made from meat raw material with different content of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence parameters linking the quantitative resultant and factor variables were obtained using the regression analysis, and the degree of the correlation with the experimental data was assessed. The maximum allowable levels of meat raw material replacement with animal proteins (beef and pork were established by the methods of mathematical programming. Use of the information technologies will significantly reduce the costs of the experimental search and substantiation of the optimal level of replacement of meat raw material with animal proteins (beef, pork, and will also allow establishing a relationship of product quality indicators with quantity and quality of minced meat ingredients.

  11. Prevalence and Antibiotic Susceptibility of Campylobacter species Isolated From Chicken and Beef Meat

    Directory of Open Access Journals (Sweden)

    Hossein Dabiri

    2014-05-01

    Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.

  12. The quality evaluation of frankfurter-type sausages from hand and mechanically deboned turkey meat.

    Science.gov (United States)

    Radomyski, T; Niewiarowicz, A

    1987-03-01

    A quality evaluation was made of frankfurter-type sausages made from hand and mechanically deboned meat from various parts of turkey carcasses. The results led to the conclusions that despite some differences in objective measurements of the sausage quality, mechanically deboned turkey meat can be considered as an exclusive meat raw material for the production of frankfurter-type sausages. The quality of sausages from mechanically deboned turkey meat from wings and frames with skin was the least satisfactory.

  13. RESEARCH ON CONSUMER BEHAVIOUR ON BUCHAREST MEAT MARKET

    Directory of Open Access Journals (Sweden)

    Agatha POPESCU

    2013-01-01

    Full Text Available The paper aimed to analyze consumer behavior for meat on Bucharest market, using a sample of 100 individuals, representatives as age, sex and profession, who were interviewed within a structured questionaire based survey on their preference to buy and consume meat. The answers were processed using the semantic differential and Likert Scale. The obtained results pointed out that white meat is the top preference, because it is healthier and its price is more acceptable compared to red meat. However, men prefer red meat, no matter its price. The most prefered meat sorts in order of their importance are chicken meat, pork and beef. Consumers prefer to buy 1-2 kg fresh meat from supermarket every 2-3 days. Income/family and meat pice are the major factors limiting the amount of consumed meat and buying frequence. The term of availability and meat origin have become more and more important criteria on which buying decision is based, besides meat quality. All consumers prefer to consume Romanian meat which is tasty and has a pleasant flavor. As a conclusion, consumers expectations from meat producers are related to a large variety of meat of a higher quality. Also, presentation form in packed portionated meat parts on the shelf as wellas hygiene come on the next positions from consumers side in order to satisfy their needs better.

  14. Biogenic amine formation and nitrite reactions in meat batter as affected by high-pressure processing and chilled storage.

    Science.gov (United States)

    Ruiz-Capillas, C; Aller-Guiote, P; Carballo, J; Colmenero, F Jiménez

    2006-12-27

    Changes in biogenic amine formation and nitrite depletion in meat batters as affected by pressure-temperature combinations (300 MPa/30 min/7, 20, and 40 degrees C), cooking process (70 degrees C/30 min), and storage (54 days/2 degrees C) were studied. Changes in residual nitrite concentration in raw meat batters were conditioned by the temperature and not by the pressure applied. Cooking process decreased (P nitrite concentration in all samples. High-pressure processing and cooking treatment increased (P nitrite concentration decreased with pressure processing, no effect was observed with the heating process of meat batters. High-pressure processing conditions had no effect on the rate of residual nitrite loss throughout the storage. The application of high pressure decreased (P processing conditions, generally, throughout storage biogenic amine levels did not change or increased, although quantitatively this effect was not very important.

  15. VacA and cagA genotypes status and antimicrobial resistance properties of Helicobacter pylori strains isolated from meat products in Isfahan province, Iran.

    Science.gov (United States)

    Gilani, A; Razavilar, V; Rokni, N; Rahimi, E

    2017-01-01

    Although Helicobacter pylori has a significant impact on the occurrence of severe clinical syndromes, its exact ways of transmission and origin have not been identified. According to the results of some previously published articles, foods with animal origins play a substantial role in the transmission of H. pylori to humans. The present investigation was carried out to study the vacuolating cytotoxin A ( vacA ) and cytotoxin associated gene A ( cagA ) genotypes status and antibiotic resistance properties of H. pylori strains recovered from minced-meat and hamburger samples. A total of 150 meat product samples were collected from supermarkets. All samples were cultured and the susceptive colonies were then subjected to nested-PCR, PCR-based genotyping and disk diffusion methods. 11 out of 150 samples (7.33%) were positive for H. pylori . All the isolates were further identified using the nested-PCR assay. Prevalence of H. pylori in hamburger and minced-meat samples was 1.42% and 12.5%, respectively. S1a , m1a and cagA were the most commonly detected genotypes. The most commonly detected combined genotypes in the H. pylori strains of minced-meat were s1am1a (10%), s1am1b (10%) and s2m1a (10%). Helicobacter pylori strains of meat products harbored the highest levels of resistance against ampicillin (90.90%), erythromycin (72.72%), amoxicillin (72.72%), trimethoprim (63.63%), tetracycline (63.63%), and clarithromycin (63.63%). Hamburger and minced-meat samples may be the sources of virulent and resistant strains of H. pylori . Meat products are possible sources of resistant and virulent strains of H. pylori similar to those vacA and cagA genotypes. Using healthy raw materials and observation of personal hygiene can reduce the risk of H. pylori in meat products.

  16. MODERN TECHNOLOGY OF FERMENTED MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2015-01-01

    Full Text Available Summary. New trends of meat industry development, on the example of sausages are shown. The detailed description of indicators of quality of meat raw materials, auxiliary materials and their influence on the processes of tissue and microbial fermentation in the process of ripening raw sausages. Measures for improving the quality control of meat raw materials, auxiliary materials, as well as the processing conditions in all stages of production of smoked products are suggested. The modern technology of production of raw sausages with starter cultures and complex products, allowing better standardization process is considered. Questions of chemistry of color formation, the formation of taste and flavor, textures and the suppression of undesired microflora in foods in general, and in particular the raw sausage are thoroughly covered. Ideas about factors affecting the formation of color in sausages are given. It is pointed out that the susceptibility to oxidation of nitrosilmioglobin is directly related to the fat oxidation in the whole redox potential. Trends in the market of raw sausages are shown. Requirements used in the meat industry to starting cultures are shown. Recommendations on the rational use of starter cultures, and other functional additives in technology of uncooked fermented products, which are used to improve the quality and ensure a high level of product safety are given. The characteristic of the innovative series of starter cultures Protect, its species belonging and qualitative composition, providing a unique protection system in the process of ripening and storage of smoked products is given. The properties are proved on the example of smoked poultry sausage.

  17. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  18. A hybrid molecularly imprinted polymer coated quantum dot nanocomposite optosensor for highly sensitive and selective determination of salbutamol in animal feeds and meat samples.

    Science.gov (United States)

    Raksawong, Phannika; Chullasat, Kochaporn; Nurerk, Piyaluk; Kanatharana, Proespichaya; Davis, Frank; Bunkoed, Opas

    2017-08-01

    A hybrid molecularly imprinted polymer (MIP)-coated quantum dot (QD) nanocomposite was synthesized and applied as a fluorescence probe for the highly sensitive and selective determination of salbutamol. The hybrid MIP-coated QD nanocomposite was synthesized via a copolymerization process in the presence of thioglycolic acid capped CdTe QDs with salbutamol as a template, 3-aminopropyltriethoxysilane as the functional monomer, and tetraethyl orthosilicate as a cross-linker. The optimum molar ratio of template, monomer, and cross-linker was 1:6:20. The fluorescence intensity of the hybrid MIP-coated QDs was efficiently quenched after salbutamol rebound to the recognition sites, as a result of charge transfer from QDs to salbutamol. The synthesized hybrid MIP-coated QD nanocomposite showed high sensitivity and good selectivity toward salbutamol. Under the optimal recognition conditions, the fluorescence intensity was quenched linearly with increasing concentration of salbutamol in the range from 0.10 to 25.0 μg L -1 , with a detection limit of 0.034 μg L -1 . The hybrid optosensor developed was successfully applied in the determination of salbutamol in animal feeds and meat samples. Satisfactory recoveries were obtained in the range from 85% to 98%, with a standard deviation of less than 8%. Furthermore, the accuracy of the hybrid MIP-coated QD nanocomposite was investigated by comparison with a conventional high-performance liquid chromatography method, with the results obtained with two methods agreeing well with each other. The advantages of this sensing method are simplicity, rapidity, cost-effectiveness, high sensitivity, and good selectivity. Graphical Abstract The synthesis of hybrid MIP-coated QDs nanocomposite.

  19. Evaluation of induced color changes in chicken breast meat during simulation of pink color defect.

    Science.gov (United States)

    Holownia, K; Chinnan, M S; Reynolds, A E; Koehler, P E

    2003-06-01

    The objective of the study was to establish a pink threshold and simulate the pink defect in cooked chicken breast meat with treatment combinations that would induce significant changes in the color of raw and cooked meat. The subjective pink threshold used in judging pink discoloration was established at a* = 3.8. Samples of three color groups (normal, lighter than normal, and darker than normal) of boneless, skinless chicken breast muscles were selected based on instrumental color values. The in situ changes were induced using sodium chloride, sodium tripolyphosphate, sodium erythorbate, and sodium nitrite at two levels: present and not present. Fillets in all treatments were subjected to individual injections, followed by tumbling, cooking, and chilling. Samples were analyzed for color [lightness (L*), red/green axis (a*), yellow/blue axis (b*)] and reflectance spectra. Simulation of the pink defect was achieved in eight of the 16 treatment combinations when sodium nitrite was present and in an additional two treatment combinations when it was absent. Pinking in cooked samples was affected (P meat color. Results confirmed that it was possible to simulate the undesired pinking in cooked chicken white meat when in situ conditions were induced by sodium chloride, sodium tripolyphosphate, and sodium nitrite. The continuation of the simulation study can aid in developing alternative processing methods to eliminate potential pink defects.

  20. Effects of the Dietary Supplementation of Sucupira (Pterodon Emarginatus Vog. and Copaiba (Copaifera Langsdorffii Resinoils on Chicken Breast and Thigh Meat Quality and Oxidative Stability

    Directory of Open Access Journals (Sweden)

    CB de Lima

    2015-12-01

    Full Text Available ABSTRACT An experiment was conducted to evaluate the addition of the oil resins ofsucupira (Pterodon emarginatus Vog. and copaiba (Copaifera langsdorffii to broiler diets on chicken meat composition, quality, and lipid peroxidation. 350 one-d-old broiler chicks were submitted to seven treatments, consisting of the diets supplemented with copaiba (COP or sucupira (SUC resin oils at three different concentrations (500, 900, and 1300 ppm plus a negative control diet (CONT. At 37 days of age, 10 birds per treatment were selected according to the average weight of the experimental unit and slaughtered to collect breast and thigh meat, which was stored at 4°C for 24 hours to evaluate pH, color (L*, a*, b*, cooking weight loss (CWL, and shear force (SF. Raw meat was vacuum packed and stored frozen until lipid peroxidation analysis. Meat samples were pooled to prepare pre-cooked meatballs (30 ± 0.5g, stored under refrigeration (eight days, and analyzed every two days for TBARS concentration. Results were analyzed using the PROC GLM and MIXED procedures (SAS statistical software. Plant oils increased (p<0.05 breast meat humidity (HU and crude protein (CP levels and reduced (p<0.05 total lipid (TLC and ash (AS levels when compared with the CONT treatment. Plant oils increased (p<0.05 thigh meat HU when compared with the CONT. High COP dietary levels reduced (p<0.05 breast meat CWL, and increased (p<0.05 thigh meat L* values when compared to CONT, except for SUC500 and SUC900. The dietary inclusion of plant oil resins showed a pro-oxidant effect (p<0.01 on breast meat when compared with the CONT. Low SUC dietary supplementation levels significantly reduced (p<0.01 the concentration of secondary oxidation products in thigh meat.

  1. Journey length and high temperatures: effects on rabbit welfare and meat quality.

    Science.gov (United States)

    Liste, G; María, G A; Buil, T; García-Belenguer, S; Chacón, G; Olleta, J L; Sañudo, C; Villarroel, M

    2006-02-01

    The transport of domestic animals by road can increase levels of stress and decrease meat quality, especially in unfavourable climates. The purpose of this study was to investigate the effect of journey duration and vertical position on the transport truck on some physiological indicators of stress and on instrumental meat quality parameters in commercial rabbits. In the summer months (June and July, 2003), 78 rabbits were subjected to either long (7 h) (LJ) or short (1 h) (SJ) journeys (3 replicates each, n = 6) between the farm and an abattoir in northern Spain. The position (top, middle, or bottom) occupied by the rabbits on the Multi-Floor cage Rolling Stand (MFRS) of the transport truck was recorded. Blood samples were collected at sticking and meat pH was measured at 24 h post-mortem (pH24). At 48 h post-mortem, samples of the M. longissimus dorsi were used to determine water-holding capacity (WHC) and instrumental tenderness using an INSTRON machine. The levels of corticosterone, glucose, lactate, and creatine kinase were slightly higher in LJ than in SJ samples, but the difference was not statistically significant (p MFRS showed higher levels (p < or = 0.05) of glucose and creatine kinase (middle), and corticosterone (bottom) than the rabbits located at the top floor. The pH 24 and WHC values of the SJ and LJ rabbits did not differ significantly. Journey length had a significant effect (p < or = 0.01) on meat tenderness. The meat from rabbits subjected to LJ had higher values of maximum stress and total toughness than did the SJ rabbits (p < or = 0.05). There were similar differences (p < or = 0.05) between LJ and SJ rabbits in their stress values of compression at 20% and 40% (measures of the tenderness of raw meat). In hot weather, the position on the transport truck appeared to have a greater effect on rabbit welfare than the duration of the journey.

  2. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  3. Binary combination of epsilon-poly-L-lysine and isoeugenol affect progression of spoilage microbiota in fresh turkey meat, and delay onset of spoilage in Pseudomonas putida challenged meat.

    Science.gov (United States)

    Hyldgaard, Morten; Meyer, Rikke L; Peng, Min; Hibberd, Ashley A; Fischer, Jana; Sigmundsson, Arnar; Mygind, Tina

    2015-12-23

    Proliferation of microbial population on fresh poultry meat over time elicits spoilage when reaching unacceptable levels, during which process slime production, microorganism colony formation, negative organoleptic impact and meat structure change are observed. Spoilage organisms in raw meat, especially Gram-negative bacteria can be difficult to combat due to their cell wall composition. In this study, the natural antimicrobial agents ε-poly-L-lysine (ε-PL) and isoeugenol were tested individually and in combinations for their activities against a selection of Gram-negative strains in vitro. All combinations resulted in additive interactions between ε-PL and isoeugenol towards the bacteria tested. The killing efficiency of different ratios of the two antimicrobial agents was further evaluated in vitro against Pseudomonas putida. Subsequently, the most efficient ratio was applied to a raw turkey meat model system which was incubated for 96 h at spoilage temperature. Half of the samples were challenged with P. putida, and the bacterial load and microbial community composition was followed over time. CFU counts revealed that the antimicrobial blend was able to lower the amount of viable Pseudomonas spp. by one log compared to untreated samples of challenged turkey meat, while the single compounds had no effect on the population. However, the compounds had no effect on Pseudomonas spp. CFU in unchallenged meat. Next-generation sequencing offered culture-independent insight into population diversity and changes in microbial composition of the meat during spoilage and in response to antimicrobial treatment. Spoilage of unchallenged turkey meat resulted in decreasing species diversity over time, regardless of whether the samples received antimicrobial treatment. The microbiota composition of untreated unchallenged meat progressed from a Pseudomonas spp. to a Pseudomonas spp., Photobacterium spp., and Brochothrix thermosphacta dominated food matrix on the expense of low

  4. Encapsulated phosphates reduce lipid oxidation in both ground chicken and ground beef during raw and cooked meat storage with some influence on color, pH, and cooking loss.

    Science.gov (United States)

    Kılıç, B; Simşek, A; Claus, J R; Atılgan, E

    2014-05-01

    Effects of encapsulated sodium tripolyphosphate (STP), sodium hexametaphosphate (HMP) and sodium pyrophosphate (SPP) on lipid oxidation in uncooked (0, 2, 24h) and cooked (0, 1, 7 d) ground chicken and beef during storage were determined. Ten phosphate treatments included a control (no phosphate), three unencapsulated (u) at 0.5% and three encapsulated (e) phosphates (0.5%) each at a low (e-low) and high (e-high) coating level. Two heating rates (slow, fast) were investigated. Cooking loss (CL), pH, color, orthophosphate (OP), TBARS and lipid hydroperoxides (LPO) were determined. A fast heating and uSTP resulted in lower CL (pcooked samples. Not increased coating level but encapsulated phosphates decreased lipid oxidation in cooked samples (p<0.05). Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  6. Occurrence and characteristics of extended-spectrum β-lactamases producing Escherichia coli in foods of animal origin and human clinical samples in Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Bhoomika

    2016-09-01

    Full Text Available Aim: To assess the prevalence of antimicrobial resistance producing extended-spectrum β-lactamases (ESBL (blaTEM, blaSHV, and blaCTX-M genes in Escherichia coli isolated from chicken meat, chevon meat, raw milk, and human urine and stool samples collected from tribal districts of Chhattisgarh, viz., Jagdalpur, Dantewada, Kondagaon, and Kanker. Materials and Methods: A total of 330 samples, comprising 98 chicken meat, 82 chevon meat, 90 raw milk, and 60 human urine and stool samples, were processed for isolation of E. coli. Isolates were confirmed biochemically and further tested against commonly used antibiotics to know their resistant pattern. The resistant isolates were tested for ESBL production by phenotypic method followed by characterization with molecular method using multiplex-polymerase chain reaction technique. Results: Overall 57.87% (191/330 samples were found positive for E. coli, which include 66.32% (65/98 chicken meat, 46.34% (38/82 chevon meat, 81.11% (73/90 raw milk, and 25% (15/60 human urine and stool samples. Isolates showed the highest resistance against cefotaxime (41.36% followed by oxytetracycline (34.03%, ampicillin (29.31%, cephalexin (24.60%, cefixime (16.75%, and ceftazidime (13.08%. Phenotypic method detected 10.99% (21/191 isolates as presumptive ESBL producers, however, molecular method detected 3.66% (7/191, 2.09% (4/191, and 0.00% (0/191 prevalence of blaTEM, blaCTX-M, and blaSHV, respectively. Conclusion: The present study indicates a high prevalence of E. coli in raw chicken meat, chevon meat, and milk due to poor hygienic practices. The antibiotic susceptibility test detected the presence of the resistance pattern against ESBL in E. coli isolated from raw chicken meat, chevon meat, milk, and also in human clinical samples is of great concern. The appearance of E. coli in the human food chain is alarming and requires adaptation of hygienic practices and stipulate use of antibiotics.

  7. Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

    International Nuclear Information System (INIS)

    Harsojo; Banati, D.; Ito, H.

    1997-01-01

    Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

  8. A Comparative Study Between the Antibacterial Effect of Nisin and Nisin-Loaded Chitosan/Alginate Nanoparticles on the Growth of Staphylococcus aureus in Raw and Pasteurized Milk Samples.

    Science.gov (United States)

    Zohri, Maryam; Alavidjeh, Mohammad Shafiee; Haririan, Ismaeil; Ardestani, Mehdi Shafiee; Ebrahimi, Seyed Esmaeil Sadat; Sani, Hadi Tarighati; Sadjadi, Seyed Kazem

    2010-12-01

    The aim of this study was to evaluate the antibacterial effect of nisin-loaded chitosan/alginate nanoparticles as a novel antibacterial delivery vehicle. The nisin-loaded nanoparticles were prepared using colloidal dispersion of the chitosan/alginate polymers in the presence of nisin. After the preparation of the nisin-loaded nanoparticles, their physicochemical properties such as size, shape, and zeta potential of the formulations were studied using scanning electron microscope and nanosizer instruments, consecutively. FTIR and differential scanning calorimetery studies were performed to investigate polymer-polymer or polymer-protein interactions. Next, the release kinetics and entrapment efficiency of the nisin-loaded nanoparticles were examined to assess the application potential of these formulations as a candidate vector. For measuring the antibacterial activity of the nisin-loaded nanoparticles, agar diffusion and MIC methods were employed. The samples under investigation for total microbial counts were pasteurized and raw milks each of which contained the nisin-loaded nanoparticles and inoculated Staphylococcus aureus (ATCC 19117 at 10(6) CFU/mL), pasteurized and raw milks each included free nisin and S. aureus (10(6) CFU/mL), and pasteurized and raw milks each had S. aureus (10(6) CFU/mL) in as control. Total counts of S. aureus were measured after 24 and 48 h for the pasteurized milk samples and after the time intervals of 0, 6, 10, 14, 18, and 24 h for the raw milk samples, respectively. According to the results, entrapment efficiency of nisin inside of the nanoparticles was about 90-95%. The average size of the nanoparticles was 205 nm, and the average zeta potential of them was -47 mV. In agar diffusion assay, an antibacterial activity (inhibition zone diameter, at 450 IU/mL) about 2 times higher than that of free nisin was observed for the nisin-loaded nanoparticles. MIC of the nisin-loaded nanoparticles (0.5 mg/mL) was about four times less than

  9. RAW CHICKEN LEG AND BREAST SENSORY EVALUATION

    Directory of Open Access Journals (Sweden)

    Octavian Baston

    2010-01-01

    Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.

  10. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  11. Gamma irradiation of meat

    International Nuclear Information System (INIS)

    Whitburn, K.D.; Hoffman, M.Z.; Taub, I.A.

    1982-01-01

    In ''A Re-Evaluation of the Products of Gamma Irradiation of Beef Ferrimyoglobin'', J. Food Sci. 46:1814 (1981), authors Whitburn, Hoffman and Taub state that color pigment myoglobin (Mb) undergoes chemical changes during irradiation that cause color changes in meat. They also state that they are in disagreement with Giddings and Markakis, J. Food Sci. 47:361 (1972) in regard to generation of MbO 2 in deaerated solutions, claiming their analysis demonstrates only Mb and Mb(IV) production. Giddings, in a letter, suggests that Whitburn, et al may have used differing systems and approaches which critically changed the radiation chemistry. He also states that radiation sterilization of aerobically packaged meats affects color only slightly. Whitburn, in a reply, shares Dr. Giddings concern for caution in interpretation of results for this system. The compositional changes are dependent on identity of free radicals, dose, O 2 and the time of analysis after irradiation. The quantification of these parameters in pure systems, sarcoplasma extracts and in meat samples should lead to a better understanding of color change mechanisms and how to minimize them

  12. On the accuracy of protein determination in large biological samples by prompt gamma neutron activation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kasviki, K. [Institute of Nuclear Technology and Radiation Protection, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece); Medical Physics Laboratory, Medical School, University of Ioannina, Ioannina 45110 (Greece); Stamatelatos, I.E. [Institute of Nuclear Technology and Radiation Protection, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece)], E-mail: ion@ipta.demokritos.gr; Yannakopoulou, E. [Institute of Physical Chemistry, NCSR ' Demokritos' , Aghia Paraskevi, Attikis 15310 (Greece); Papadopoulou, P. [Institute of Technology of Agricultural Products, NAGREF, Lycovrissi, Attikis 14123 (Greece); Kalef-Ezra, J. [Medical Physics Laboratory, Medical School, University of Ioannina, Ioannina 45110 (Greece)

    2007-10-15

    A prompt gamma neutron activation analysis (PGNAA) facility has been developed for the determination of nitrogen and thus total protein in large volume biological samples or the whole body of small animals. In the present work, the accuracy of nitrogen determination by PGNAA in phantoms of known composition as well as in four raw ground meat samples of about 1 kg mass was examined. Dumas combustion and Kjeldahl techniques were also used for the assessment of nitrogen concentration in the meat samples. No statistically significant differences were found between the concentrations assessed by the three techniques. The results of this work demonstrate the applicability of PGNAA for the assessment of total protein in biological samples of 0.25-1.5 kg mass, such as a meat sample or the body of small animal even in vivo with an equivalent radiation dose of about 40 mSv.

  13. On the accuracy of protein determination in large biological samples by prompt gamma neutron activation analysis

    International Nuclear Information System (INIS)

    Kasviki, K.; Stamatelatos, I.E.; Yannakopoulou, E.; Papadopoulou, P.; Kalef-Ezra, J.

    2007-01-01

    A prompt gamma neutron activation analysis (PGNAA) facility has been developed for the determination of nitrogen and thus total protein in large volume biological samples or the whole body of small animals. In the present work, the accuracy of nitrogen determination by PGNAA in phantoms of known composition as well as in four raw ground meat samples of about 1 kg mass was examined. Dumas combustion and Kjeldahl techniques were also used for the assessment of nitrogen concentration in the meat samples. No statistically significant differences were found between the concentrations assessed by the three techniques. The results of this work demonstrate the applicability of PGNAA for the assessment of total protein in biological samples of 0.25-1.5 kg mass, such as a meat sample or the body of small animal even in vivo with an equivalent radiation dose of about 40 mSv

  14. Chemistry in the kitchen. Making ground meat more healthful.

    Science.gov (United States)

    Small, D M; Oliva, C; Tercyak, A

    1991-01-10

    The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and

  15. Data for in-depth characterisation of the lamb meat proteome from longissimus lumborum

    Directory of Open Access Journals (Sweden)

    Tzer-Yang Yu

    2015-06-01

    Full Text Available This Data article provides Supplementary data related to the research article titled “In-depth characterisation of the lamb meat proteome from longissimus lumborum” by Yu et al. [1]. This research article reports the proteome catalogue of the 48 h post-mortem lamb longissimus lumborum. A list of 388 ovine-specific proteins were identified and characterised after separating the samples into sarcoplasmic, myofibrillar and insoluble fractions, followed by an in-depth shotgun proteomic evaluation and bioinformatic analysis. The detailed list of identified proteins, the annotated MS/MS spectra corresponding to the proteins identified by a single peptide-spectrum match, the raw Gene Ontology annotation data and other miscellaneous files, as will be described below, were contained in this Data article. We hope the data presented here will contribute to the current knowledge of the global protein composition of lamb skeletal muscle/meat.

  16. Evaluation of growth performance, serum biochemistry and haematological parameters on broiler birds fed with raw and processed samples of Entada scandens, Canavalia gladiata and Canavalia ensiformis seed meal as an alternative protein source.

    Science.gov (United States)

    Sasipriya, Gopalakrishnan; Siddhuraju, Perumal

    2013-03-01

    The experiment was carried out to investigate the inclusion of underutilised legumes, Entada scandens, Canavalia gladiata and Canavalia ensiformis, seed meal in soybean-based diet in broilers. The utilisation of these wild legumes is limited by the presence of antinutrient compounds. Processing methods like soaking followed by autoclaving in sodium bicarbonate solution in E. scandens and C. gladiata and soaking followed by autoclaving in ash solution in C. ensiformis were adopted. The proximate composition of raw and processed samples of E. scandens, C. gladiata and C. ensiformis were determined. The protein content was enhanced in processed sample of E. scandens (46 %) and C. ensiformis (16 %). This processing method had reduced the maximum number of antinutrients such as tannins (10-100 %), trypsin inhibitor activity (99 %), chymotrypsin inhibitor activity (72-100 %), canavanine (60-62 %), amylase inhibitor activity (73-100 %), saponins (78-92 %), phytic acid (19-40 %) and lectins. Hence, the raw samples at 15 % and processed samples at 15 and 30 % were replaced with soybean protein in commercial broiler diet respectively. Birds fed with 30 % processed samples of E. scandens, C. gladiata and C. ensiformis showed significantly similar results of growth performance, carcass characteristics, organ weight, haematological parameters and serum biochemical parameters (cholesterol, protein, bilirubin, albumin, globulin and liver and kidney function parameters) without any adverse effects after 42 days of supplementation. The proper utilisation of these underutilised legumes may act as an alternative protein ingredient in poultry diets.

  17. Preliminary Studies on the Development of Meat Balls | Igene ...

    African Journals Online (AJOL)

    The UUFB sample was rated highest in terms of overall likeness and may economically complement some of the existing popular meat-based snacks in Nigeria. The significance of the study is discussed. @JASEM Keyterms: Meat, Meat ball, Quality, Product development. J. Appl. Sci. Environ. Manage. June, 2012, Vol.

  18. Qualitative Assessment for Toxoplasma gondii Exposure Risk Associated with Meat Products in the United States.

    Science.gov (United States)

    Guo, Miao; Buchanan, Robert L; Dubey, Jitender P; Hill, Dolores E; Lambertini, Elisabetta; Ying, Yuqing; Gamble, H Ray; Jones, Jeffrey L; Pradhan, Abani K

    2015-12-01

    Toxoplasma gondii is a global protozoan parasite capable of infecting most warm-blooded animals. Although healthy adult humans generally have no symptoms, severe illness does occur in certain groups, including congenitally infected fetuses and newborns, immunocompromised individuals including transplant patients. Epidemiological studies have demonstrated that consumption of raw or undercooked meat products is one of the major sources of infection with T. gondii. The goal of this study was to develop a framework to qualitatively estimate the exposure risk to T. gondii from various meat products consumed in the United States. Risk estimates of various meats were analyzed by a farm-to-retail qualitative assessment that included evaluation of farm, abattoir, storage and transportation, meat processing, packaging, and retail modules. It was found that exposure risks associated with meats from free-range chickens, nonconfinement-raised pigs, goats, and lamb are higher than those from confinement-raised pigs, cattle, and caged chickens. For fresh meat products, risk at the retail level was similar to that at the farm level unless meats had been frozen or moisture enhanced. Our results showed that meat processing, such as salting, freezing, commercial hot air drying, long fermentation times, hot smoking, and cooking, are able to reduce T. gondii levels in meat products. whereas nitrite and/or nitrate, spice, low pH, and cold storage have no effect on the viability of T. gondii tissue cysts. Raw-fermented sausage, cured raw meat, meat that is not hot-air dried, and fresh processed meat were associated with higher exposure risks compared with cooked meat and frozen meat. This study provides a reference for meat management control programs to determine critical control points and serves as the foundation for future quantitative risk assessments.

  19. Effect of cooking temperatures on characteristics and microstructure of camel meat emulsion sausages.

    Science.gov (United States)

    Mohamed, Hussein Mh; Emara, Mohamed Mt; Nouman, Taha M

    2016-07-01

    The camel is an excellent source of high quality meat and camel meat might be a potential alternative for beef. This study aimed to manipulate the raw camel meat for the production of stable and acceptable emulsion sausage, as well as to study the effect of cooking at different core temperatures on the tenderness, sensory quality and microstructure of produced sausage. Increasing the cooking temperature of sausages resulted in reduction of the shear force values from 2.67 kgf after cooking at 85 °C to 1.57 kgf after cooking at 105 °C. The sensory scores of sausages have been improved by increasing the cooking core temperature of meat batter. The light and scanning electron microscope micrographs revealed solubilisation of the high quantity of connective tissue of camel meat. High emulsion stability values for the camel meat batter associated with high values of water-holding capacity for raw camel meat and meat batter have been recorded. Stable and acceptable camel meat emulsion can be developed from camel meat. Increasing the cooking core temperature of meat batter improved the quality of produced sausages. Therefore, camel meat emulsion sausages might be a potential alternative for beef particularly in Asian and African countries. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  20. Dietary Brazilian red pepper essential oil on pork meat quality and lipid oxidation

    Directory of Open Access Journals (Sweden)

    Franz Dias Gois

    Full Text Available ABSTRACT: The purpose of this study was to evaluate the effects of feeding pigs with diets containing increasing levels of Brazilian red pepper essential oil ( Schinus terebinthifolius Raddi on the physical attributes, fatty acid profile and oxidative stability of precooked meat. Seventy-two weanling pigs (5.7±0.8kg were allotted in a completely randomized block design experiment with four treatments, six replicates per treatment, and three animals per experimental unit (pen. Animals were fed with a basal diet supplemented with 0, 500, 1,000, or 1,500mg kg-1 Brazilian red pepper essential oil during the 35-d experimental period. At the end of the experiment, one animal per experimental unit (16.4±2.2kg was slaughtered to sample Longissimus dorsi muscle for analysis. Dietary supplementation of Brazilian red pepper had no effect (P>0.05 on pork meat color, pH, cooking loss and shear force. Inclusion of essential oil in the diet provided a linear increase (P<0.05 of the saturated fatty acids content of L. dorsi, especially myristic (C14:0 and stearic (C18:0 fatty acids. Utilization of essential oil in pig diets reduced significantly the production of secondary lipid oxidation compounds measured as TBARS in raw pork meat (P<0.001 and immediately after cooking (P<0.001. However, during 8-d storage assay, the addition of essential oil in the diet did not protect pork meat lipids from oxidation. Therefore, Brazilian red pepper added to pig diets increased the saturated fatty acids content and reduced lipid oxidation in fresh meat and short-term heat treatment without affecting pork meat physical attributes.

  1. The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).

    Science.gov (United States)

    Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş

    2007-03-01

    This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.

  2. Healthy n-6/n-3 fatty acid composition from five European game meat species remains after cooking.

    Science.gov (United States)

    Valencak, Teresa G; Gamsjäger, Lisa; Ohrnberger, Sarah; Culbert, Nicole J; Ruf, Thomas

    2015-06-27

    Intensive farming of livestock along with recent food scandals and consumer deception have increased awareness about risks for human nutrition. In parallel, the demand for meat obtained under more natural conditions from animals that can freely forage has largely increased. Interestingly, the consumption of game meat has not become more common despite its excellent quality and content of polyunsaturated fatty acids (PUFAs). We addressed the question if game meat fatty acid composition is modified through kitchen preparation. By analysing muscle fatty acid (FA) composition (polar and total lipids) of five European game species in a raw and a processed state, we aimed to quantify the proportion of PUFA that are oxidised and hydrogenated during processing. All game meat species originated from local hunters and free-living individuals. To mimic a realistic situation a professional chef prepared the meat samples with gentle use of heat in a standardised way. Expectedly, the overall content of polyunsaturated fatty acids declined during the cooking process but the decrease size was cooking does not substantially alter its favourable fatty acid composition. Further research is needed to elucidate species-specific differences and the role of habitat quality and locomotion for tissue composition.

  3. Survey of the parasite Toxoplasma gondii in human consumed ovine meat in Tunis City.

    Directory of Open Access Journals (Sweden)

    Sonia Boughattas

    Full Text Available Toxoplasmosis has been recognized as parasitic zoonosis with the highest human incidence. The human infection by the parasite can lead to severe clinical manifestations in congenital toxoplasmosis and immunocompromised patients. Contamination occurs mainly by foodborne ways especially consumption of raw or undercooked meat. In contrast to other foodborne infections, toxoplasmosis is a chronic infection which would make its economic and social impact much higher than even previously anticipated. Ovine meat was advanced as a major risk factor, so we investigated its parasite survey, under natural conditions. Serological MAT technique and touchdown PCR approaches were used for prevalence determination of the parasite in slaughtered sheep intended to human consumption in Tunis City. The genotyping was carried by SNPs analysis of SAG3 marker. Anti-Toxoplasma antibodies were present in 38.2% of young sheep and in 73.6% of adult sheep. Molecular detection revealed the contamination of 50% of ewes' tissue. Sequencing and SNPs analysis enabled unambiguous typing of meat isolates and revealed the presence of mixed strains as those previously identified from clinical samples in the same area. Our findings conclude that slaughtered sheep are highly infected, suggesting them as a major risk factor of Toxoplasma gondii transmission by meat consumption. Special aware should target consequently this factor when recommendations have to be established by the health care commanders.

  4. Changes in Meat Quality Characteristics of the Sous-vide Cooked Chicken Breast during Refrigerated Storage.

    Science.gov (United States)

    Hong, Go-Eun; Kim, Ji-Han; Ahn, Su-Jin; Lee, Chi-Ho

    2015-01-01

    This study was performed to investigate the changes in meat quality characteristics of the sous vide cooked chicken breast during refrigerated storage at 4℃ for 14 d between before and after sous-vide cooking. Cooking loss and shear force were significantly increased, whereas expressible drip was significantly decreased along with reduction in the water holding capacity in both of two groups. Redness of meat juice was significantly (p<0.05) increased during storage, and considerably increased in the refrigerated samples after sous-vide cooked at the 7 to 10 d. The thiobarbituric acid reactive substances (TBARS) was significantly increased and was higher in the refrigerator stored chicken breast samples after sous-vide cooking. The volatile basic nitrogen (VBN) value was significantly increased in both groups, but the VBN value of the stored raw meat sample before sous-vide cooking was increased at an early storage, while the VBN value of the stored sample after sous-vide cooking was increased gradually in this study. Total viable counts and coliform counts were significantly decreased during storage, and coliforms were not detected after 7 d of storage in both groups. Salmonella spp. was not detected during the whole studied period. The outcome of this research can provide preliminary data that could be used to apply for further study of chicken breast using sous-vide cooking method that could be attractive to consumers.

  5. Molecular Characterization of Shiga Toxin-Producing Escherichia coli Isolated from Ruminant and Donkey Raw Milk Samples and Traditional Dairy Products in Iran

    Directory of Open Access Journals (Sweden)

    Hassan Momtaz

    2012-01-01

    Full Text Available The aims of the current study were to detect the virulence factors and antibiotic resistance of Shiga toxin-producing E. coli, in animal milk and dairy products in Iran. After E. coli dentification with culture method, PCR assay were developed for detection of pathogenic genes, serotypes and antibiotic resistance genes of E. coli. Results showed that out of 719 samples, 102 (14.18% were confirmed to be positive for E. coli and out of 102 positive samples, 17.64% were O26 and 13.72% were O157 and 1.96% were O91 and 1.96% were O145 serotypes. Totally, the prevalence of stx1 and papA genes were the highest while the prevalence of sfaS and fyuA were the lowest in the positive samples. PCR results showed that tetA, tetB were the highest (64.70% and aac(3-IV were the lowest (27.45% antibiotic resistant genes in E. coli positive samples. Our study indicated that the isolated E. coli trains in these regions had a highest antibiotic resistance to tetracycline (58.82% and the lowest to nitrofurantoin (3.92%. tetA gene and E. coli O157 serotype had highest and aac(3-IV gene, and E. coli O145 serotype had a lowest frequency rates of antibiotics resistance genes, in the region.

  6. Clostridium difficile in Retail Meats

    Centers for Disease Control (CDC) Podcasts

    Clostridium difficile is a common cause of diarrhea in healthcare settings but little is known about what causes cases in the community. In this podcast, CDC's Dr. L. Clifford McDonald discusses two papers in the May 2009 edition of Emerging Infectious Diseases that explore whether the organism could be found in meat samples purchased in grocery stores in Arizona and Canada.

  7. Metronidazole resistance in Campylobacter jejuni from poultry meat

    DEFF Research Database (Denmark)

    Andersen, Sigrid Rita; Shukri, Naseer Mahmoud; Boel, Jeppe

    2006-01-01

    The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution with a signific......The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution...

  8. Application and optimization of microwave-assisted extraction and dispersive liquid-liquid microextraction followed by high-performance liquid chromatography for sensitive determination of polyamines in turkey breast meat samples.

    Science.gov (United States)

    Bashiry, Moein; Mohammadi, Abdorreza; Hosseini, Hedayat; Kamankesh, Marzieh; Aeenehvand, Saeed; Mohammadi, Zaniar

    2016-01-01

    A novel method based on microwave-assisted extraction and dispersive liquid-liquid microextraction (MAE-DLLME) followed by high-performance liquid chromatography (HPLC) was developed for the determination of three polyamines from turkey breast meat samples. Response surface methodology (RSM) based on central composite design (CCD) was used to optimize the effective factors in DLLME process. The optimum microextraction efficiency was obtained under optimized conditions. The calibration graphs of the proposed method were linear in the range of 20-200 ng g(-1), with the coefficient determination (R(2)) higher than 0.9914. The relative standard deviations were 6.72-7.30% (n = 7). The limits of detection were in the range of 0.8-1.4 ng g(-1). The recoveries of these compounds in spiked turkey breast meat samples were from 95% to 105%. The increased sensitivity in using the MAE-DLLME-HPLC-UV has been demonstrated. Compared with previous methods, the proposed method is an accurate, rapid and reliable sample-pretreatment method. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION

    Directory of Open Access Journals (Sweden)

    A. K. Kakimov

    2016-01-01

    Full Text Available In this paper, the results of the experimental research on developing the technology of a protein complex based on the meat-bone paste and protein-fat-blood emulsion are shown. The technological scheme of meat-bone paste production on the basis of complex grinding meat-bone raw material to bone particle size of 100 ∙10–6 m and further processing of bone particles using reagent, cheese whey, with pH 4,3 is presented. When studying the nutritive and biological value of the protein complex, it was established that the protein complex consisting of the food component from bone and protein-fat-blood emulsion could be used instead of the basic raw material in meat product production. The comparative analysis of the nutritive value of the protein complex and horse meat demonstrated the following results: the amino acid composition of the protein complex showed a balance of the essential amino acids and the high content of the essential amino acids which limit the biological value: lysine, leucine and threonine. The high content of polyunsaturated fatty acids was observed, which justified the biological value of the protein complex.

  10. Eosinophilic meningitis risk associated with raw Ampullarium canaliculatus snails consumption

    Directory of Open Access Journals (Sweden)

    Jiun-Jye Wang

    2011-05-01

    Full Text Available In Taiwan, Angiostrongylus cantonensis infection has been reported in foreign laborers who had consumed raw Ampullarium canaliculatus snails. This study analyzed three foreign laborers who had contracted enzyme-linked immunosorbent assay-confirmed A cantonensis infection while working in Taiwan. All three workers had consumed either roasted snails or raw snails flavored with seasoning while drinking wine. This study investigated possible risk factors for A cantonensis, including naturally occurring A cantonensis in A canaliculatus snails, viability of third-stage A cantonensis larvae in raw seasoned snails and in roasted snails, infectivity of larvae, and effects of alcohol while consuming snails. Positive infection rates in snails from five different irrigation canals in south Taiwan ranged from 12.3% to 29.4% and the average number of motile larvae per infected snail ranged from 36 to 65. The number of motile and coiled larvae in snail meat after 120 minutes seasoning was 93 (27.7% and 233 (69.3%, respectively. After 20 minutes of roasting, most larvae in the snail meat were dead. The infectivities of motile and coiled larvae from snail meat after 60 minutes seasoning were 53.2% and 33.2%, respectively, and those from snail meat after 5 minutes roasting were 33.2% and 7.0%, respectively. Eating Taiwan A canaliculatus snails raw is extremely risky given their high infection rates and infection intensities. Even after 120 minutes seasoning or after 20 minutes roasting, snail meat should be considered unsafe for human consumption. Finally, experimental rodent studies indicated that consuming alcohol while ingesting larvae does not significantly reduced infectivity.

  11. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  12. Lipid stability in meat and meat products.

    Science.gov (United States)

    Morrissey, P A; Sheehy, P J; Galvin, K; Kerry, J P; Buckley, D J

    1998-01-01

    Lipid oxidation is one of the main factors limiting the quality and acceptability of meats and meat products. Oxidative damage to lipids occurs in the living animal because of an imbalance between the production of reactive oxygen species and the animal's defence mechanisms. This may be brought about by a high intake of oxidized lipids or poly-unsaturated fatty acids, or a low intake of nutrients involved in the antioxidant defence system. Damage to lipids may be accentuated in the immediate post-slaughter period and, in particular, during handling, processing, storage and cooking. In recent years, pressure to reduce artificial additive use in foods has led to attempts to increase meat stability by dietary strategies. These include supplementation of animal diets with vitamin E, ascorbic acid, or carotenoids, or withdrawal of trace mineral supplements. Dietary vitamin E supplementation reduces lipid and myoglobin oxidation, and, in certain situations, drip losses in meats. However, vitamin C supplementation appears to have little, if any, beneficial effects on meat stability. The effect of feeding higher levels of carotenoids on meat stability requires further study. Some studies have demonstrated that reducing the iron and copper content of feeds improves meat stability. Post-slaughter carnosine addition may be an effective means of improving lipid stability in processed meats, perhaps in combination with dietary vitamin E supplementation.

  13. Effects of Storage Time on the Quality of Local Chicken Meat

    African Journals Online (AJOL)

    Addressing factors that affect meat quality ... pH values were measured for each sample followed by storage at -20oC to arrest further changes in meat. .... nutritional value in addition to other physical .... Meat and meat products in human.

  14. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.

    1975-01-01

    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  15. 19 CFR 151.22 - Estimated duties on raw sugar.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...

  16. 9 CFR 317.344 - Identification of major cuts of meat products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Identification of major cuts of meat... AND VOLUNTARY INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.344 Identification of major cuts of meat products. The major cuts of single-ingredient, raw...

  17. SAG2 locus genotyping of Toxoplasma gondii in meat products of ...

    African Journals Online (AJOL)

    Toxoplasmosis is an infection caused by Toxoplasma gondii, an intracellular obligate parasite. Its transmission is usually attributed to ingestion of undercooked or raw meat. The aim of this study was the detection and genotyping of T. gondii in meat products using the molecular method in East Azerbaijan. DNA was ...

  18. Microbial analysis of meat and meat products sold in fast food ...

    African Journals Online (AJOL)

    The present study was carried out to investigate the rate of microbial contamination of ready-to-eat meat and meat products sold in different fast food restaurants in Aba. This study was carried out between June and August, 2015. Samples were collected aseptically from five fast food restaurants using sterile polythene bags.

  19. Studies on emulsion-type buffalo meat sausages incorporating skeletal and offal meat with different levels of pork fat.

    Science.gov (United States)

    Krishnan, K R; Sharma, N

    1990-01-01

    Ready-to-eat emulsion-type buffalo meat sausages were developed by using a combination of 80% meat components with 20% pork back fat. The meat components were constituted of 70 parts buffalo skeletal meat and 30 parts offal meat (rumen meat and heart meat in equal proportions). The emulsion stability, cooking losses of emulsions and sausages, composition of cooked sausages, eating quality of sausages and the microscopic characteristics of the raw emulsion and cooked sausages were studied. The light microscope micrograph of the raw emulsion showed uniformly well distributed fat globules embedded in a dense protein gel. The cooked emulsion also showed uniformly sized fat globules well distributed in a fine, compact, coagulated protein gel, which retained their original spherical shape. Good quality emulsion-type sausages could be produced having a high emulsion stability (0·87 ± 0·07 ml fat release/100 g emulsion); a low emulsion cooking loss (9·60 ± 0·60%) and a low sausage cooking loss (8·83 ± 0·48%). The overall acceptability of sausages was also high. Copyright © 1990. Published by Elsevier Ltd.

  20. Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

    Directory of Open Access Journals (Sweden)

    Bahador Hajimohammadi

    2014-11-01

    Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

  1. Detection of neuronal tissue in meat using tissue specific DNA modifications

    Directory of Open Access Journals (Sweden)

    Harris N.

    2004-01-01

    Full Text Available A method has been developed to differentiate between non-muscle tissues such as liver, kidney and heart and that of muscle in meat samples using tissue specific DNA detection. Only muscle tissue is considered meat from the point of view of labelling (Food Labelling [Amendment] (England Regulations 2003 and Quantitative Ingredient Declaration (QUID, and also certain parts of the carcass are prohibited to be used in raw meat products (Meat Products [England] Regulations 2003. Included in the prohibited offal are brain and spinal cord. The described methodology has therefore been developed primarily to enforce labelling rules but also to contribute to the enforcement of BSE legislation on the detection of Central Nervous System (CNS tissue. The latter requires the removal of Specified Risk Material (SRM, such as bovine and ovine brain and spinal cord, from the food chain. Current methodologies for detection of CNS tissue include histological examination, analysis of cholesterol content and immunodetection. These can potentially be time consuming, less applicable to processed samples and may not be readily adapted to high throughput sample analysis. The objective of this work was therefore to develop a DNAbased detection assay that exploits the sensitivity and specificity of PCR and is potentially applicable to more highly processed food samples. For neuronal tissue, the DNA target selected was the promoter for Glial Fibrillary Acidic Protein (GFAP, a gene whose expression is restricted to astroglial cells within CNS tissue. The promoter fragments from both cattle and sheep have been isolated and key differences in the methylation patterns of certain CpG dinucleotides in the sequences from bovine and sheep brain and spinal cord and the corresponding skeletal muscle identified. These have been used to design a PCR assay exploiting Methylation Specific PCR (MSP to specifically amplify the neuronal tissue derived sequence and therefore identify the

  2. Nutritional value of traditional Italian meat-based dishes: influence of cooking methods and recipe formulation.

    Science.gov (United States)

    D'Evoli, L; Salvatore, P; Lucarini, M; Nicoli, S; Aguzzi, A; Gabrielli, P; Lombardi-Boccia, G

    2009-01-01

    The present study provides a picture of the compositional figure and nutritive value of meat-based dishes typical of Italian culinary tradition. Recipes specific for a bovine meat cut (top-side) were selected among the most widespread ones in Italy: in pan, pizzaiola, cutlet, meat ball, and escalope. The total fat and cholesterol content varied depending on the ingredients utilized (extra-virgin olive oil, parmesan, egg). Meat-based dishes that utilized extra-virgin olive oil showed a significant reduction in palmitic and stearic acids and a parallel increase in oleic acid compared with raw meat; furthermore, the ratio among saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids shifted in favour of monounsaturated fatty acids. B vitamins were affected at different extent by heating; by contrast, vitamin E content increased because of the new sources of this vitamin, which masked losses due to heating. Ingredients (parmesan, discretionary salt) induced significant increases in the calcium and sodium concentrations compared with raw meat. The total iron content did not show marked differences in most of the meat-based dishes compared with raw meat; by contrast, losses in the heme-iron concentration were detected depending on the severity of heating treatments. Our findings suggest that heme iron, because of its important health aspects, might be a useful index of the nutritional quality of cooked meats.

  3. Isolation of Toxoplasma gondii from horse meat in Egypt.

    Science.gov (United States)

    Shaapan, R M; Ghazy, A A

    2007-01-01

    Portions of heart, liver, skeletal and diaphragmatic muscles obtained from 150 slaughtered horses at Giza-Zoo abattoir were used for bioassays in mice and cats. T. gondii tachyzoites were isolated successfully from the peritoneal exudates of the inoculated mice 6-8 days post inoculation with pooled horse tissues. Whereas, T. gondii tissue cysts containing bradyzoites were detected in the impression smears of mice brain on the 45th days or more post infection. The oocysts were detected in feces of cats 3-6 days post feeding on horse tissues containing tissue cysts. The oocysts became sporulated within 3-5 days in 2.5% Potassium dichromate. A total of 79 out of 150 horse meat samples were found to be infected with an incidence rate of 52.6 %. This is the first trial for isolation of T. gondii infective stages from horses in Egypt. Moreover, this study pointed out to the high infection rate of T. gondii in horse meat which may be considered as an important source of infection to wild zoo-animals in Egypt and humans in some countries if consumed raw or insufficiently cooked.

  4. Meat analog: a review.

    Science.gov (United States)

    Malav, O P; Talukder, S; Gokulakrishnan, P; Chand, S

    2015-01-01

    The health-conscious consumers are in search of nutritious and convenient food item which can be best suited in their busy life. The vegetarianism is the key for the search of such food which resembles the meat in respect of nutrition and sensory characters, but not of animal origin and contains vegetable or its modified form, this is the point when meat analog evolved out and gets shape. The consumers gets full satisfaction by consumption of meat analog due to its typical meaty texture, appearance and the flavor which are being imparted during the skilled production of meat analog. The supplement of protein in vegetarian diet through meat alike food can be fulfilled by incorporating protein-rich vegetative food grade materials in meat analog and by adopting proper technological process which can promote the proper fabrication of meat analog with acceptable meat like texture, appearance, flavor, etc. The easily available vegetables, cereals, and pulses in India have great advantages and prospects to be used in food products and it can improve the nutritional and functional characters of the food items. The various form and functional characters of food items are available world over and attracts the meat technologists and the food processors to bring some innovativeness in meat analog and its presentation and marketability so that the acceptability of meat analog can be overgrown by the consumers.

  5. Antimicrobial Edible Films and Coatings for Meat and Meat Products Preservation

    Directory of Open Access Journals (Sweden)

    Irais Sánchez-Ortega

    2014-01-01

    Full Text Available Animal origin foods are widely distributed and consumed around the world due to their high nutrients availability but may also provide a suitable environment for growth of pathogenic and spoilage microorganisms. Nowadays consumers demand high quality food with an extended shelf life without chemical additives. Edible films and coatings (EFC added with natural antimicrobials are a promising preservation technology for raw and processed meats because they provide good barrier against spoilage and pathogenic microorganisms. This review gathers updated research reported over the last ten years related to antimicrobial EFC applied to meat and meat products. In addition, the films gas barrier properties contribute to extended shelf life because physicochemical changes, such as color, texture, and moisture, may be significantly minimized. The effectiveness showed by different types of antimicrobial EFC depends on meat source, polymer used, film barrier properties, target microorganism, antimicrobial substance properties, and storage conditions. The perspective of this technology includes tailoring of coating procedures to meet industry requirements and shelf life increase of meat and meat products to ensure quality and safety without changes in sensory characteristics.

  6. Immunofluorescent determination of wheat protein in meat products

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2014-02-01

    Full Text Available In food industry nowadays, there are various plant-origin protein additives which are meant for production of meat products. Among the most frequent additives of this type there are different kinds of flour, starch, fiber, and plant-origin proteins. Their usage at present is limited by the existing legislation not to prevent consumer deception but also for reasons of possible influence on consumer health. Therefore, this problem is paid a lot of attention not only in the Czech Republic but also all over the world. The main risk is seen in the impossibility to choose a suitable foodstuff for an individual prone to allergic reactions. Potential allergens are also often plant-origin raw materials which are added into foodstuffs for their technological qualities and low price. Wheat is widely cultivated cereal as well as an important source of proteins. After ingestion or inhalation, wheat proteins may cause adverse reactions. These adverse effects include a wide range of disorders which are dependent on the method of contact with wheat protein. These adverse effects can then take the form of various clinical manifestations, such as celiac disease, T-cell mediated inflammatory bowel disease, dermatitis, skin rash, breathing difficulties, allergy to pollen or to wheat flour or food allergy to foodstuffs containing gluten. The only possible protection against adverse immune reactions for those with food allergies is strictly excluding the allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. In order to avoid misleading consumers and also to protect allergic consumers, analytical methods applicable to all types of foodstuffs have been developed. Unfortunately, detection of allergens in

  7. Survey of [i]Toxoplasma gondii [/i]antibodies in meat juice of wild boar ([i]Sus scrofa[/i] in several districts of the Czech Republic

    Directory of Open Access Journals (Sweden)

    Karol Račka

    2015-05-01

    Full Text Available Introduction and objective. The aims of the study were: 1 to detect antibodies against T[i]oxoplasma gondii[/i] from wild boar meat; 1 establish seroprevalence of toxoplasmosis in the wild boar population; 3 establish risk factors concerned in higher possible seroprevalence; 4 to estimate the usefulness of meat juice for detection of [i]T. gondii[/i] antibodies in wild boar. Material and methods. Diaphragm meat juice samples from 656 wild boar ([i]Sus scrofa[/i] were collected during the hunting seasons between September 2008 – October 2010 from 9 districts of the Czech Republic. The samples were stratified per age category into 2 groups: piglets (n = 279 and yearlings together with adults (n = 377. The in-house ELISA test was used for the detection of antibodies against [i]T. gondii [/i]from the meat juice samples. Results. Antibodies against [i]T. gondii [/i]were detected by in-house ELISA in 260 of 656 wild boars (40% with 26% prevalence in piglets (72/279 and 50% prevalence in yearlings and adults (188/377. The district total seroprevalences ranged between 32% – 59%, with a significantly higher prevalence in the district of Havlíčkův Brod (59%. Statistically significant differences (p-value < 0.05 were found between 2 age categories, and between 9 districts, with a significant variability in the district of Havlíčkův Brod. Seroprevalence correlated positively with farm density, but without any statistical significance. Conclusion. The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.

  8. An assessment of the impact of pulsed electric fields processing factors on oxidation, color, texture, and sensory attributes of turkey breast meat.

    Science.gov (United States)

    Arroyo, Cristina; Eslami, Sara; Brunton, Nigel P; Arimi, Joshua M; Noci, Francesco; Lyng, James G

    2015-05-01

    Pulsed electric fields (PEF) is a novel nonthermal technology that has the potential to cause physical disruption to muscle tissue which in turn could alter the sensorial aspects of meat in both a positive (e.g., enhanced tenderization) and a negative way (e.g., off-flavor development). If there is a risk of off-flavor development it should be identified prior to embarking on an extensive investigation on PEF in meat tenderization and turkey meat was chosen for this purpose as it is particularly prone to oxidation. The objective of this study was to investigate the effect of various PEF treatments on the quality attributes of turkey breast meat. Turkey breast meat obtained 1 d postslaughter was treated in a batch PEF chamber with increasing electric field strength up to 3 kV/cm and analyzed for lipid oxidation by thiobarbituric acid reactive substances assay (TBARS) with up to 5 d storage at 4°C in aerobic conditions. In a separate experiment, turkey breast meat samples were exposed to PEF under various combinations of pulse number, frequency, and voltage. Following PEF treatments weight loss, cook loss, lipid oxidation, texture, and color were assessed by instrumental methods. A sensory analysis was also performed to determine consumer acceptability for color, texture, and odor of the samples. Lipid oxidation in all PEF-treated samples progressed at the same rate with storage as the untreated samples and was not found to be significantly different to the control. Under the conditions examined PEF treatments did not induce differences in instrumentally measured weight loss, cook loss, lipid oxidation, texture, and color (raw and cooked) either on fresh or frozen samples. However, the sensory evaluation suggested that panelists could detect slight differences between the PEF-treated samples and the controls in terms of texture and odor. © 2015 Poultry Science Association Inc.

  9. Assessment of Consumer Exposure to Salmonella spp., Campylobacter spp., and Shiga Toxin-Producing Escherichia coli in Meat Products at Retail in the City of Sao Paulo, Brazil.

    Science.gov (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Dos Santos, Luis Fernando; Jakabi, Miyoko; de Melo Franco, Bernadette Dora Gombossy

    2017-08-01

    Meat products may be vehicles of bacterial pathogens to humans, and Salmonella spp., Campylobacter spp., and Shiga toxin-producing Escherichia coli (STEC) are the most relevant. The aim of this study was to generate data on prevalence of these three pathogens in 552 samples of meat products (hot dogs, pork sausages, raw ground beef, and raw chicken legs) sold at retail in the city of Sao Paulo, Brazil. Salmonella spp. was detected in 5.8% (32/552) of samples, comprising pork sausages 62.5% (20/32) and chicken legs 37.5% (12/32). The counts of Salmonella spp. were low, ranging from Salmonella Typhimurium (28.1%), Salmonella I 4,[5],12:i:- (15.6%), Salmonella Enteritidis (12.5%), Salmonella Derby, and Salmonella Brandenburg (9.4%). Campylobacter spp. was detected in 33 samples (6.0%), comprising chicken legs (82%) and ground beef (18%). All samples were negative for STEC. These results suggest that meat products when subjected to inadequate cooking and/or cross-contamination with other products ready for consumption can lead to occurrence of outbreaks, highlighting the risks associated with them.

  10. Effects of meat juice on biofilm formation of Campylobacter and Salmonella.

    Science.gov (United States)

    Li, Jiaqi; Feng, Jinsong; Ma, Lina; de la Fuente Núñez, César; Gölz, Greta; Lu, Xiaonan

    2017-07-17

    Campylobacter and Salmonella are leading causes of foodborne illnesses worldwide, vastly harboured by raw meat as their common food reservoir. Both microbes are prevalent in meat processing environments in the form of biofilms that contribute to cross-contamination and foodborne infection. This study applied raw meat juice (chicken juice and pork juice) as a minimally processed food model to study its effects on bacterial biofilm formation. Meat juice was collected during the freeze-thaw process of raw meat and sterilized by filtration. In 96-well polystyrene plates and glass chambers, supplementation of over 25% meat juice (v/v) in laboratory media led to an increase in biofilm formation of Campylobacter and Salmonella. During the initial attachment stage of biofilm development, more bacterial cells were present on surfaces treated with meat juice residues compared to control surfaces. Meat juice particulates on abiotic surfaces facilitated biofilm formation of Campylobacter and Salmonella under both static and flow conditions, with the latter being assessed using a microfluidic platform. Further, the deficiency in biofilm formation of selected Campylobacter and Salmonella mutant strains was restored in the presence of meat juice particulates. These results suggested that meat juice residues on the abiotic surfaces might act as a surface conditioner to support initial attachment and biofilm formation of Campylobacter and Salmonella. This study sheds light on a possible survival mechanism of Campylobacter and Salmonella in meat processing environments, and indicates that thorough cleaning of meat residues during meat production and handling is critical to reduce the bacterial load of Campylobacter and Salmonella. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Investigating the Determinants of Toxoplasma gondii Prevalence in Meat: A Systematic Review and Meta-Regression.

    Directory of Open Access Journals (Sweden)

    Simone Belluco

    Full Text Available Toxoplasma gondii is one of the most widespread parasites in humans and can cause severe illness in immunocompromised individuals. However, its role in healthy people is probably under-appreciated. The complex epidemiology of this protozoan recognizes several infection routes but consumption of contaminated food is likely to be the predominant one. Among food, consumption of raw and undercooked meat is a relevant route of transmission, but the role of different meat producing animal species and meats thereof is controversial.The aim of the present work is to summarize and analyse literature data reporting prevalence estimates of T. gondii in meat animals/meats.We searched Medline, Web of Science, Science Direct (last update 31/03/2015.Relevant papers should report data from primary studies dealing with the prevalence of T. gondii in meat from livestock species as obtained through direct detection methods. Meta-analysis and meta-regression were performed.Of 1915 papers screened, 69 papers were included, dealing mainly with cattle, pigs and sheep. Pooled prevalences, based on random-effect models, were 2.6% (CI95 [0.5-5.8] for cattle, 12.3% (CI95 [7.6-17.8] for pigs and 14.7% (CI95 [8.9-21.5] for sheep. Due to the high heterogeneity observed, univariable and multivariable meta-regression models were fitted showing that the geographic area for cattle (p = 0.032, the farming type for pigs (p = 0.0004 and the sample composition for sheep (p = 0.03 had significant effects on the prevalences of Toxoplasma detected/estimated. Moreover, the role of different animal species was dependent on the geographic location of animals' origin.Limitations were due mainly to a possible publication bias.The present work confirms the role of meat, including beef, as T. gondii sources, and highlights the need for a control system for this parasite to be implemented along the meat production chain. Moreover, consumer knowledge should be strengthened in order to reduce

  12. Technological characteristics of meat - viscosity

    OpenAIRE

    DIBĎÁK, Tomáš

    2012-01-01

    This bachelor thesis is focused on the technological characteristics of meat, mainly viscosity of meat. At the beginning I dealt with construction of meat and various types of meat: beef, veal, pork, mutton, rabbit, poultry and venison. Then I described basic chemical composition of meat and it?s characteristic. In detail I dealt with viscosity of meat. Viscosity is the ability of meat to bind water both own and added. I mentioned influences, which effects viscosity and I presented the possib...

  13. Preservation of crab meat by gamma irradiation

    International Nuclear Information System (INIS)

    Loaharanu, P.; Prompubesara, C.; Kraisorn, K.; Noochpramool, K.

    1972-01-01

    Fresh crab meat from swimming crab (Portunus pelagicus, Linn.) was irradiated at doses of 0.075, 0.15 and 0.25 Mrad and held at 3 0 C. The storage life of non-irradiated crab meat was approximately 7 days compared with 14 days for crab meat irradiated at 0.075 Mrad and 28 days for samples receiving 0.15 or 0.25 Mrad treatment. Total aerobic count, trimethylamine nitrogen, total volatile basic nitrogen, and ammonia contents were used as objective indices of freshness in comparison with sensory evaluation of the crab meat. All objective indices correlated well with the sensory judgement of the samples. The crab meat used in the study was heavily contaminated with microorganisms. Irradiation at 0.15 and 0.25 Mrad reduced approximately 2 log cycles in the total count. Acinetobacter (Achromobacter) was predominated in irradiated crab meat, especially after prolonged storage. High coagulase positive staphylococci count was detected in only non-irradiated crab meat

  14. Meat quality characteristics of DurocxYorkshire, DurocxYorkshirexwild boar and wild boar

    Directory of Open Access Journals (Sweden)

    Ivanović Snežana D.

    2013-01-01

    Full Text Available Chemical composition, pH value, fatty acids profile, cholesterol content, color and sensory analysis of pork meat from Duroc x Yorkshire (D x Y, Duroc x Yorkshire x wild boar (D x Y x WB crossbreeds and wild boars (WB was investigated. Samples for all tests were taken from m. longissimus dorsi. Chemical composition and pH value were tested by ISO methods. Fatty acid and cholesterol determination was performed by gas chromatography technique with external standard method. Color was determined instrumentally using the thristimulus colourimeter. The overall sensoric quality (appearance, texture and smell of samples of raw meat was evaluated. In evaluation of results the scoring system was used. In chemical composition (moisture, fat, protein, ash and pH values statistically significant difference was noted (p<0,05 between each of the examined groups. Also, among all the examined groups statistically significant difference (p<0,05 was found for fatty acids and cholesterol content. Measurment of the color of meat from all three groups showed that the L*, a * b *, Chroma and Hue angle were also statistically significantly different (p<0,01.

  15. UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN

    OpenAIRE

    Rimal, Arbindra; Fletcher, Stanley M.

    2003-01-01

    This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.

  16. [Characterization and nutritional value of a food artisan: the meat pie of Murcia].

    Science.gov (United States)

    Ruiz-Cano, Domingo; Pérez-Llamas, Francisca; López-Jiménez, José Ángel; González-Silvera, Daniel; Frutos, Maria José; Zamora, Salvador

    2013-01-01

    The main aims of this study are to describe the characteristics of the meat pie, a typical product of the regional gastronomy of Murcia and to determine its nutritional and energy values, fatty acid profile and fat quality. There were studied 24 samples of Murcia's meat pie from the six best-selling retail establishments in this Region (four units per establishment).The moisture, protein, fat, carbohydrates, fibre and minerals, contents and the energy value, fatty acid profile and fat quality were analyzed using the Official Analysis Methods of Foods. All analyses were performed by triplicate. The average weight of this product was 192.3 ± 11.8 g, with three differentiated parts (base, filling and pastry lid). All ingredients were natural raw materials: wheat flour, lard, ground beef, sliced boiled egg and chorizo, water and spices (salt, pepper, garlic, paprika and nutmeg). Most of its organoleptic attributes are due to the type and amount of fat or lard. The combination of the other ingredients and the particular formulation of the spices are also responsible of other attributes. Due to its protein content (11.0%), this meat pie can replace other meat dishes, and be incorporated into a balanced diet. However, it is necessary to take into account its fat and energy contents (17.3 g and 317 kcal/100 g, respectively). Unlike many common pastry products, it contains no trans fatty acids. The results of the research show that the studied product remains, at present, an artisan food, and offer reliable information that it is representative of the energy and nutritional values of the Murcia's meat pie, a typical product of the gastronomy of the Region of Murcia. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  17. Raw and renewable polymers

    CSIR Research Space (South Africa)

    Joseph, S

    2010-01-01

    Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...

  18. Affective Beliefs Influence the Experience of Eating Meat

    OpenAIRE

    Anderson, Eric C.; Barrett, Lisa Feldman

    2016-01-01

    People believe they experience the world objectively, but research continually demonstrates that beliefs influence perception. Emerging research indicates that beliefs influence the experience of eating. In three studies, we test whether beliefs about how animals are raised can influence the experience of eating meat. Samples of meat were paired with descriptions of animals raised on factory farms or raised on humane farms. Importantly, the meat samples in both conditions were identical. Howe...

  19. Quality, functionality, and shelf life of fermented meat and meat products: A review.

    Science.gov (United States)

    Kumar, Pavan; Chatli, M K; Verma, Akhilesh K; Mehta, Nitin; Malav, O P; Kumar, Devendra; Sharma, Neelesh

    2017-09-02

    Fermentation of meat is a traditional preservation method used widely for improving quality and shelf life of fermented meat products. Fermentation of meat causes a number of physical, biochemical, and microbial changes, which eventually impart functional properties, sensory characteristics, and nutritional aspects to these products and inhibit the growth of various pathogenic and spoilage microorganisms. These changes include acidification (carbohydrate catabolism), solubilization and gelation of myofibrillar and sarcoplasmic proteins of muscle, degradation of proteins and lipids, reduction of nitrate into nitrite, formation of nitrosomyoglobin, and dehydration. Dry-fermented sausages are increasingly being used as carrier of probiotics. The production of biogenic amines during fermentation can be controlled by selecting proper starter cultures and other preventive measures such as quality of raw materials, hygienic measures, temperature, etc.

  20. Evaluation of Technological Quality of Meat Produced from Nsukka ...

    African Journals Online (AJOL)

    The technological quality of raw meat from Nsukka local abattoir was evaluated by analyzing the proximate composition, water holding capacity, pH, Napole yield and sensory colour and texture of longissimus dorsi [LD] and psoas major [PM] of beef and pork. Results show that moisture [71.36 – 72.76%], protein [21.37 ...

  1. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Science.gov (United States)

    Pasquali, Frédérique; Palma, Federica; Guillier, Laurent; Lucchi, Alex; De Cesare, Alessandra; Manfreda, Gerardo

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1) assess persistence of L. monocytogenes isolates from the rabbit-plant; (2) select genes associated to physiological adaptation to the food-processing environment; (3) compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP) analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2) (alkaline and oxidative stress), qacH gene (resistance to benzalkonium chloride), cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride) and a truncated version of actA gene (biofilm formation). Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2) including the ars operon (arsenic resistance) and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride). Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121 carried the

  2. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Directory of Open Access Journals (Sweden)

    Frédérique Pasquali

    2018-03-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1 assess persistence of L. monocytogenes isolates from the rabbit-plant; (2 select genes associated to physiological adaptation to the food-processing environment; (3 compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2 (alkaline and oxidative stress, qacH gene (resistance to benzalkonium chloride, cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride and a truncated version of actA gene (biofilm formation. Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2 including the ars operon (arsenic resistance and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride. Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121

  3. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  4. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  5. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  6. Meat : a natural symbol.

    OpenAIRE

    Fiddes, Nick

    1989-01-01

    In Britain, and in cultures around the world, meat's significance extends beyond what might be anticipated from its nutritional utility. By looking at the academic and popular literature, and through a series of looselystructured interviews, this study investigates the range of ideas that people hold about meat in modern Britain for evidence as to what it is that makes animal flesh such an esteemed foodstuff. The principle conclusion is that meat's pre-eminence derives from ...

  7. Meat science research tendencies

    Directory of Open Access Journals (Sweden)

    José Arturo García Macías

    2010-12-01

    Full Text Available Meat is a high quality food due its higher protein content, besides to provide energy, vitamins particularly B complex, water and minerals, resulting in an appreciated food for humans. Even in same country, consumers search for different stuffs, since north consumers looks for meat cuts with fat and bone, whereas center-south consumers prefers fatless debones meat cuts. Modern consumers demand excellent appearance, color, taste and flavor in foods, microbiologically safe, minimal processed and curing salts, very nutritive and cheap. All these together in one single product are a hard challenge in the meat products area.

  8. Use of artificial intelligence in the production of high quality minced meat

    Science.gov (United States)

    Kapovsky, B. R.; Pchelkina, V. A.; Plyasheshnik, P. I.; Dydykin, A. S.; Lazarev, A. A.

    2017-09-01

    A design for an automatic line for minced meat production according to new production technology based on an innovative meat milling method is proposed. This method allows the necessary degree of raw material comminution at the stage of raw material preparation to be obtained, which leads to production intensification due to the traditional meat mass comminution equipment being unnecessary. To ensure consistent quality of the product obtained, the use of on-line automatic control of the technological process for minced meat production is envisaged. This system has been developed using artificial intelligence methods and technologies. The system is trainable during the operation process, adapts to changes in processed raw material characteristics and to external impacts that affect the system operation, and manufactures meat shavings with minimal dispersion of the typical particle size. The control system includes equipment for express analysis of the chemical composition of the minced meat and its temperature after comminution. In this case, the minced meat production process can be controlled strictly as a function of time, which excludes subjective factors for assessing the degree of finished product readiness. This will allow finished meat products with consistent, targeted high quality to be produced.

  9. Meat goat kids finished on alfalfa, red clover or orchardgrass pastures: carcass merit and meat quality.

    Science.gov (United States)

    Turner, K E; Cassida, K A; Zerby, H N

    2014-12-01

    This experiment was conducted in 2005-2007 to evaluate carcass and chevon (goat meat) quality parameters when meat-goat kids (n=72) were finished on alfalfa (Medicago sativa L; ALF); red clover (Trifolium pratense L.; RCG); or orchardgrass (Dactylis glomerata L.; OGR) pastures. Carcass conformation score was greater (P=0.08) when meat-goat kids were finished on ALF compared to OGR with RCG intermediate. Chevon meat samples from goats finished on the three pasture treatments did not differ in ash, intramuscular fat, or crude protein content or in concentrations of omega6 and omega3 fatty acids, or the omega6 to omega3 ratio. Goats finished on OGR had higher (Pmeat-goat kids finished on ALF, RCG, or ORG produced desirable carcass weights for most niche markets in the USA. Chevon is a low-fat meat option with high desirable fatty acids for human diets. Published by Elsevier Ltd.

  10. Nutritional value and fatty acid composition of some traditional Argentinean meat sausages

    Directory of Open Access Journals (Sweden)

    Mara Cristina Romero

    2013-03-01

    Full Text Available The aim of this study was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat of some meat products produced in the northeastern Argentina, analyzing fatty acids composition, polyunsaturated/saturated fatty acid ratio PUFA/SFA ratio (polyunsaturated/ saturated fatty acids, n-6/n-3 ratio, and CLA (conjugated linoleic acid content. Thirty traditional meat products produced by different processes were used. The samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage, chorizos (raw sausage, chorizo ahumado (cooked and smoked sausage, and morcilla (cooked sausage. From the results obtained it can be said that the total carbohydrate contents of the salamín studied were slightly lower; fat content of raw chorizo was significantly lower, and protein content of chorizo ahumado was significantly higher than those comparison from databases from other regions of Argentina, USA, and Spain. Except for chorizo, which has a value lower than 0.4, the PUFA/SFA-stearic ratio of the other products were a little higher than those reported by other researchers. CLA (Conjugated linoleic acid contents between 0.03% and 0.19% were detected. The results obtained indicate that salamín produced in northeastern Argentina, Chaco state, shows high protein and PUFA (Polyunsaturated fatty acids contents, and low atherogenic and thrombogenic indexes, which makes it a more healthful product than those of similar composition produced in other countries.

  11. Contamination of ready-to-eat raw vegetables with Clostridium difficile in France.

    Science.gov (United States)

    Eckert, Catherine; Burghoffer, Béatrice; Barbut, Frédéric

    2013-09-01

    The presence of Clostridium difficile in food like shellfish, vegetables and meat has been reported in several publications during the past few years. The objective of this study was to assess the prevalence of ready-to-eat raw vegetables contaminated with C. difficile in France. One hundred and four ready-to-eat salads and vegetables were studied. Toxigenic C. difficile strains were isolated in three samples (2.9 %): two ready-to-eat salads (one heart of lettuce and one lamb's lettuce salad) and one portion of pea sprouts. The strains belonged to three different PCR ribotypes: 001, 014/020/077 and 015. The detection thresholds for vegetative cells and spores cells varied between 1 and 3 c.f.u. in 20 g salad and between 6 and 15 c.f.u. in 20 g salad, respectively, for the method employed.

  12. A cluster of three cases of trichinellosis linked to bear meat consumption in the Arctic.

    Science.gov (United States)

    Dupouy-Camet, Jean; Yera, Hélène; Dahane, Naïma; Bouthry, Elise; Kapel, Christian M O

    2016-05-01

    We report here three cases of trichinellosis due to polar bear meat consumption in East Greenland. In the past 20 years, 31 cases of trichinellosis have been reported in French travellers to the Arctic (North Quebec, Nunavut and Greenland) who consumed undercooked meat from black, brown, or polar bears. If local communities are increasingly becoming aware of the risk of trichinellosis, travellers visiting regions where bear meat is consumed should be informed of the risk of eating raw or non-heat-processed meats. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

  13. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some factors belonging to the intrinsic quality of meat, animal slaughter methods, technological operations applied to the meat, and the auxiliary materials used.

  14. Flavonoids in the development of functional meat products: A review

    Directory of Open Access Journals (Sweden)

    Pramod K. Singh

    2013-06-01

    Full Text Available Flavonoids or bioflavonoids are unique low molecular weight ubiquitous polyphenolic compounds produced by plants during their metabolic activities as a secondary metabolites and responsible for major organoleptic characteristics and health benefits of plant derived foods. The flavonoids are potent antioxidants agents and protect the cells by scavenging and inhibiting the production and initiation of free radicals, superoxide anions and lipid peroxy radicals. Besides potent antioxidant capacity, flavonoids also shows antimicrobial, antimutagenic, antidiabetic, antithrombosis, antirheumatic, antiatherosclerotic, antiallergic, anti-inflammatory, antiulcers and hepatoprotectives and better termed as neutraceuticals. The antioxidant capacity of meat is very low and this can be increased by adding flavonoids in meat during processing in the form of plant parts rich in flavonoids such as seeds, fruit skin or peel, bark and flower as raw or in extract form without comprising the sensory attributes of meat and meat products. [Vet World 2013; 6(8.000: 573-578

  15. Heterocyclic amines in meat and meat products

    Directory of Open Access Journals (Sweden)

    Aliye BULGAN

    2013-06-01

    Full Text Available Heterocyclic amines (HA are the mutagenic/carcinogenic compounds which generate as a result of cooking of red meat, poultry meat and fish fillets at high temperatures. Up to 20 different HAs were detected and classified in the researches that conducted on these types of meats cooked at high temperatures. HAs are the products of Maillard reactions and the Strecker degredation of main precursors such as creatine/creatinine, aminoacid and the polysaccharides. Many physical and chemical factors effect the formation of HAs. Thus, it was reported by many researchers that utilizing coating and marination processes in addition to using natural and synthetic antioxidants and seasonings-plant extracts were effective on inhibiting/decreasing the formation of HAs. Additionally, boiling/steaming and microwave cooking methodologies were recommended instead of barbecuing, grilling or frying to inhibit/decrease the formation of HAs. The HAs formed in meat and meat products and the factors which have effects on the formation of HAs are presented in this review.

  16. Elimination of Escherichia coli O157:H7 in meats by gamma irradiation

    International Nuclear Information System (INIS)

    Thayer, D.W.; Boyd, G.

    1993-01-01

    Undercooked and raw meat has been linked to outbreaks of hemorrhagic diarrhea due to the presence of Escherichia coli O157:H7; therefore, treatment with ionizing radiation was investigated as a potential method for the elimination of this organism. Response-surface methods were used to study the effects of irradiation dose (0 to 2.0 kGy), temperature (-20 to +20 degrees C), and atmosphere (air and vacuum) on E. coli O157:H7 in mechanically deboned chicken meat. Differences in irradiation dose and temperature significantly affected the results. Ninety percent of the viable E. coli in chicken meat was eliminated by doses of 0.27 kGy at +5 degrees C and 0.42 kGy at -5 degrees C. Small, but significant, differences in radiation resistance by E. coli were found when finely ground lean beef rather than chicken was the substrate. Unlike nonirradiated samples, no measurable verotoxin was found in finely ground lean beef which had been inoculated with 10(4.8) CFU of E. coli O157:H7 per g, irradiated at a minimum dose of 1.5 kGy, and temperature abused at 35 degrees C for 20 h. Irradiation is an effective method to control this food-borne pathogen

  17. Nutritional value and digestion rate of rhea meat proteins in association with storage and cooking processes.

    Science.gov (United States)

    Filgueras, Renata S; Gatellier, Philippe; Ferreira, Claude; Zambiazi, Rui C; Santé-Lhoutellier, Véronique

    2011-09-01

    The nutritional value of proteins was investigated after the storage and cooking of rhea M. Gastrocnemius pars interna. Oxidation of basic and aromatic amino acids, surface hydrophobicity and aggregation state of proteins, were determined in raw and cooked meat. In addition, myofibrillar proteins were exposed in vitro to proteases of the digestive tract. Cooking markedly affected the protein surface hydrophobicity. The BBP bound content was three times greater in cooked than in fresh rhea meat. A small increment in tryptophan content after cooking was observed. Storage influenced Schiff bases formation indicating the presence of protein-aldehyde adducts after cooking. High content of Schiff bases was found after cooking of samples stored for 5 days, demonstrating a probable implication of free amino groups, most likely from lysine. Cooking decreased the myofibrillar protein susceptibility to pepsin activity. After cooking, the proteolysis rate by pancreatic enzymes increased. Our findings support the importance of protein aggregation in the nutritional value of meat proteins. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Towards a reduced meat diet: Mindset and motivation of young vegetarians, low, medium and high meat-eaters.

    Science.gov (United States)

    de Boer, Joop; Schösler, Hanna; Aiking, Harry

    2017-06-01

    This study provides insight into differences and similarities in the mindset and motivation of four dietary groups (young self-declared vegetarians, low, medium and high meat-eaters) to support the development of strategies for a general transition to a less meat-based diet. The paper highlights the value of the identity concept for our understanding of both vegetarians and meat eaters. The analysis involves a comparison of the four dietary groups focusing on the strength and the profile of their food-related motivation and their reasons for and against frequent meat eating. To check for the generalizability of the results, the analyses were performed in two samples of adults (aged 18-35) in the Netherlands (native Dutch, n = 357, and second generation Chinese Dutch, n = 350). In both samples, the vegetarians had the same level of food-related motivation as the other groups, but a different motivational profile and distinctive, taste- and animal-welfare related reasons to justify their abstinence from eating meat. The low and medium meat-eaters often considered health a reason to eat meat as well as to moderate meat eating, plus they liked to vary their meals. In these aspects they were different from both the vegetarians and the high meat-eaters. The findings are relevant for (non) governmental organizations that aim to influence dietary choices, as well as for businesses that operate in the market of meat substitutes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Comparision of the BAX® System with an in-house MSRV method for the detection of Salmonella in chicken carcasses and pork meat Comparação do Sitema BAX® com o Método MSRV para detecção de Salmonella em carcaças de frango e carnes suínas

    Directory of Open Access Journals (Sweden)

    Paulo R. Franchin

    2006-12-01

    Full Text Available A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762 and raw pork meat (n = 566. The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and others deboned raw fresh pork meat. The BAX® System detected 134 Salmonella-positive samples in chicken carcasses and 145 samples in pork meat, while the MSRV method isolated 142 and 144 Salmonella-positive samples, respectively. No significant difference was observed between the two methods for chicken carcasses and pork meat, according to McNemar test at the 5% level.Um estudo foi realizado com o objetivo de comparar o procedimento analítico de detecção de Salmonella com o Sistema BAX® automatizado, baseado na Reação em Cadeia da Polimerase (PCR com o método de Rappaport-Vassiliadis em Agar Semi-Sólido modificado (MSRV para detecção de Salmonella em amostras de carcaças de frango naturalmente contaminadas (n=762 e retalhos de carne suía (n=566. O Sistema BAX® detectou 134 amostras positivas para Salmonella em carcaças de frango e 145 amostras positivas para Salmonella em retalhos de carne suína, enquanto o MSRV detectou 142 e 144 amostras positivas respectivamente. Não houve diferença estatisticamente significativa entre os dois métodos, segundo McNemar ao nível de significância de 5%.

  20. The biofilm-positive Staphylococcus epidermidis isolates in raw materials, foodstuffs and on contact surfaces in processing plants.

    Science.gov (United States)

    Schlegelová, J; Babák, V; Holasová, M; Dendis, M

    2008-01-01

    Isolates from the "farm to fork" samples (182 isolates from 2779 samples) were examined genotypically (icaAB genes) and phenotypically (in vitro biofilm formation, typical growth on Congo red agar; CRA) with the aim to assess the risk of penetration of virulent strains of Staphylococcus epidermidis into the food chain. The contamination of meat and milk products was significantly higher in comparison with raw materials. Contamination of contact surfaces in the meat-processing plants was significantly lower than that of contact surfaces in the dairy plants. The ica genes (which precondition the biofilm formation) were concurrently detected in 20 isolates that also showed a typical growth on CRA. Two ica operon-negative isolates produced biofilm in vitro but perhaps by an ica-independent mechanism. The surfaces in the dairy plants and the milk products were more frequently contaminated with ica operon-positive strains (2.3 and 1.2 % samples) than the other sample types (0-0.6 % samples).

  1. Essential and toxic elements in meat of wild birds.

    Science.gov (United States)

    Roselli, Carla; Desideri, Donatella; Meli, Maria Assunta; Fagiolino, Ivan; Feduzi, Laura

    2016-01-01

    Essential and toxic elements were determined by inductively coupled plasma-atomic emission spectrometry (ICP-AES), mass spectrometry (MS), and atomic absorption (AS) in meat of 14 migratory birds originating from central and northern Europe to provide baseline data regarding game meat consumed in central Italy. In all samples analyzed, cobalt (Co) and chromium (Cr) (total) levels were meat. These findings indicate that elevated Pb concentrations in game ingested by humans may be a cause for concern.

  2. Safe meat-handling knowledge, attitudes and practices of private and government meat processing plants' workers: implications for future policy.

    Science.gov (United States)

    Adesokan, H K; Raji, A O Q

    2014-03-01

    Food-borne disease outbreaks remain a major global health challenge and cross-contamination from raw meat due to poor handling is a major cause in developing countries. Adequate knowledge of meat handlers is important in limiting these outbreaks. This study evaluated and compared the safe meat-handling knowledge, attitudes and practices (KAP) of private (PMPP) and government meat processing plants' (GMPP) workers in south-western Nigeria. This cross sectional study comprised 190 meat handlers (PMPP = 55; GMPP = 135). Data concerning their safe meat-handling knowledge, attitudes and practices as well as their socio-demographic characteristics, such as age, gender and work experience were collected. A significant association was observed between the type of meat processing plants and their knowledge (p = 0.000), attitudes (p = 0.000) and practices (p = 0.000) of safe meat-handling. Meat handlers in the GMPP were respectively, about 17 times (OR = 0.060, 95% CI: 0.018-0.203), 57 times (OR = 0.019, 95% CI: 0.007-0.054) and 111 times (OR = 0.009, 95% CI: 0.001- 0.067) less likely to obtain good knowledge, attitude and practice level of safe meat-handling than those from PMPP. Further, KAP levels were significantly associated with age group, education and work experience (p < 0.05). Study findings suggest the need for future policy in food industry in developing countries to accommodate increased involvement of private sector for improved food safety and quality delivery. Public health education on safe food handling and hygiene should be on the front burner among food handlers in general.

  3. Study on Influence of Different Types of Meat on the Quality of Meat Products

    Directory of Open Access Journals (Sweden)

    Melinda Nagy

    2015-11-01

    Full Text Available Meat species in processed food products have been gaining an increasing interest mainly due to public health, economic and legal concerns, but also due to religious reasons. In the recent years there was an increasing demand for healthier meat products. Formulation of healthier meat products based on processing strategies is one of the most important current approaches to the development of potential meat-based functional foods. The main objective of the study was to characterize different type of meat and to use that to obtain a meat product-smoked sausage. The physico-chemical analyses highlighted the moisture content (drying-oven at 105 ºC, protein (Kjeldahl method and fat (Soxhlet method content and sodium chloride content (Mohr method of the meat and the final product. Sensory analyses of the samples as well as control sample were evaluated by 17 untrained panellists using a 9 point hedonic scale. Following this study, it was noted an improvement of organoleptic characteristics (texture and appearance as well as physico-chemical and sensorial properties of the new product compared with the limits stipulated.

  4. Preliminary investigation on the relationship of Raman spectra of sheep meat with shear force and cooking loss.

    Science.gov (United States)

    Schmidt, Heinar; Scheier, Rico; Hopkins, David L

    2013-01-01

    A prototype handheld Raman system was used as a rapid non-invasive optical device to measure raw sheep meat to estimate cooked meat tenderness and cooking loss. Raman measurements were conducted on m. longissimus thoracis et lumborum samples from two sheep flocks from two different origins which had been aged for five days at 3-4°C before deep freezing and further analysis. The Raman data of 140 samples were correlated with shear force and cooking loss data using PLS regression. Both sample origins could be discriminated and separate correlation models yielded better correlations than the joint correlation model. For shear force, R(2)=0.79 and R(2)=0.86 were obtained for the two sites. Results for cooking loss were comparable: separate models yielded R(2)=0.79 and R(2)=0.83 for the two sites. The results show the potential usefulness of Raman spectra which can be recorded during meat processing for the prediction of quality traits such as tenderness and cooking loss. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Evaluation of quality characteristics and functional properties of mechanically deboned chicken meats treated with different dose rates of ionizing radiation and use of antioxidants

    International Nuclear Information System (INIS)

    Brito, Poliana de Paula

    2012-01-01

    The Mechanically Deboned chicken meat (MDCM) is used in traditional meat products, in greater proportion in those emulsified, replacing meat raw materials more expensive. The raw material can have high MDCM the microbial load, as a result of contamination during processing or failure during the evisceration. The irradiation process is accepted as one of the most effective technologies when compared to conventional techniques of preservation, to reduce contamination of pathogens and spoilage. However, little information is available about the use and effects of different dose rates of ionizing radiation processing. Irradiation causes chemical changes in food, a major cause of deterioration of quality of raw or cooked meat products during refrigerated storage, frozen. The objective of this study was to evaluate the effects of different dose rates of ionizing radiation on the production of Thiobarbituric Acid Reactive Substances (TBARS), color, microbiological and sensory characteristics of mechanically deboned chicken added or without added antioxidants, during the cold storage and evaluation of functional properties. The results showed that among the tested dose rates using cobalt-60 source, dose rate of 4.04 kGy.h-1 was the best for processing MDCM. Furthermore, the use of the combination of rosemary antioxidant and α-tocopherol were able to reduce lipid oxidation generated by irradiation of the samples, showed a synergistic effect to the processing with ionizing radiation in reduction of psychrotrophic bacteria count and contributed to a better sensory quality. The use of radiation in the processing FDMI did not adversely affect the functional properties studied. (author)

  6. [The seroprevalence of Toxoplasma gondii in women from Sanliurfa, a province with a high raw meatball consumption].

    Science.gov (United States)

    Tekay, Fikret; Ozbek, Erdal

    2007-01-01

    Toxoplasma gondii is an obligate intracellular protozoan that can infect all kind of birds and all mammals including humans and is common throughout the world. The prevalence varies according to social and cultural habits, pet cats in homes and geographic factors. Domestic cats are considered to be an important source of Toxoplasma gondii infection. From January to June 2006, the prevalence of toxoplasmosis was retrospectively monitored from blood samples that had been sent to our laboratory in order to determine the levels of IgM and IgG. All the subjects were women and 2,586 blood samples were investigated with the chemiluminescence immunoassay method. The rates of Toxoplasma gondii IgM antibodies were found to be 3.0% (78/2,586) and that of Toxoplasma gondii IgG antibodies, 69.5% (1.798/2,586). The total rate of positivity of Toxoplasma gondii antibodies was 69.6% (1,801/2,586) and the negativity, 30.4% (785/2,586). The highest positive rates have been reported in the southeastern region of Turkey and the 69.6% detected in our study seems to be the highest rate. Raw meatball consumption is common in our region and raw meat has a high risk of Toxoplasma gondii infection by direct ingestion of tissue cysts. As a result we consider that the high frequency of Toxoplasma gondii seropositivity in this region is due to raw meatball consumption.

  7. Meat and meat product preservation by ionizing radiation

    International Nuclear Information System (INIS)

    Egginger, R.

    A brief summary is given of experience with the preservation of meat and meat products by ionizing radiation, or by combined methods. The results of the research have proved that hygienically significant microorganisms (mainly salmonellas) are reliably destroyed and that the consumption of thus irradiated meat and meat products presents no danger to human health. (B.S.)

  8. Comparative evaluation of quality and composition of ostrich, turkey and broiler meat

    OpenAIRE

    Jukna V.; Klementavičiūtė J.; Meškinytė-Kaušilienė E.; Pečiulaitienė N.; Samborskytė M.; Ambrasūnas L.

    2012-01-01

    In this article are presented research data on comparative evaluation of meat quality of various poultry species. The study was made on 5 samples of ostrich, turkey and broiler meat. Samples were weighed 500 to 550 grams. Qualitative and nutritional properties of meat from different species of poultry were estimated. The chemical composition, pH, color, firmness, water holding capacity, cooking loss, drip loss of ostrich, turkey and broiler meat were analyz...

  9. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter

    2014-01-01

    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

  10. Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.

    Science.gov (United States)

    Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S

    2018-06-01

    Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.

  11. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  12. Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy

    Science.gov (United States)

    Jakes, W.; Gerdova, A.; Defernez, M.; Watson, A.D.; McCallum, C.; Limer, E.; Colquhoun, I.J.; Williamson, D.C.; Kemsley, E.K.

    2015-01-01

    This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz 1H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional “authentic” beef region (p = 0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze–thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz 1H NMR represents a feasible high-throughput approach for screening raw meat. PMID:25577043

  13. Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy.

    Science.gov (United States)

    Jakes, W; Gerdova, A; Defernez, M; Watson, A D; McCallum, C; Limer, E; Colquhoun, I J; Williamson, D C; Kemsley, E K

    2015-05-15

    This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz (1)H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional "authentic" beef region (p=0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze-thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz (1)H NMR represents a feasible high-throughput approach for screening raw meat. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Game meat authentication through rare earth elements fingerprinting

    International Nuclear Information System (INIS)

    Danezis, G.P.; Pappas, A.C.; Zoidis, E.; Papadomichelakis, G.; Hadjigeorgiou, I.; Zhang, P.; Brusic, V.; Georgiou, C.A.

    2017-01-01

    Accurate labelling of meat (e.g. wild versus farmed, geographical and genetic origin, organic versus conventional, processing treatment) is important to inform the consumers about the products they buy. Meat and meat products declared as game have higher commercial value making them target to fraudulent labelling practices and replacement with non-game meat. We have developed and validated a new method for authentication of wild rabbit meat using elemental metabolomics approach. Elemental analysis was performed using rapid ultra-trace multi-element measurement by inductively coupled plasma mass spectrometry (ICP-MS). Elemental signatures showed excellent ability to discriminate the wild rabbit from non-wild rabbit meat. Our results demonstrate the usefulness of metabolic markers -rare earth signatures, as well as other trace element signatures for game meat authentication. - Highlights: • Elemental metabolomics is a powerful new methodology for authentication of game rabbit meat. • New method for meat authentication utilizing rare earths elemental signatures. • Samples are compared to group signatures using angular and Euclidean distances. • Meat reference materials (>70 elements) can be used for cross-comparison between studies.

  15. Study of the combined effect of spices and marination on beef meat vacuum packaged

    Directory of Open Access Journals (Sweden)

    DANIELA ISTRATI

    2011-12-01

    Full Text Available Fresh beef slices were marinated by immersion in marinades based on dry red wine, lime-tree honey, salt, spices and seasoning plants as thyme (Thymus vulgaris, marjoram (Majorana hortensis, garlic (Allium sativum and horseradish (Armoracia rusticana. Control samples were represented by raw meat without marination treatment but stored in the same conditions as marinated samples. After marination, meat pieces were packed under vacuum and stored at refrigeration temperature of 4°C for 12 days. The influence of the combined effect of spices and marination on beef stability was evaluated by monitoring pH evolution, degree of lipid oxidation and by microbiological analysis. For control samples, a mean increase of 0.47 log CFU/g of total mesophilic aerobic bacteria was observed during the 48 h of storage, but for the samples marinated with the addition of spices was observed a decrease of 0.57 log CFU/g. The growth of LAB in control samples was generally limited and did not exceed 5 log CFU/g. During storage at 4°C, marination with the addition in the base marinade (wine, honey, garlic, pepper and salt of thyme, marjoram and horseradish separately inhibited the growth of LAB while marination with the addition in the base marinade of thyme, marjoram and horseradish together resulted in significantly lower levels of LAB. All marination treatments resulted in significantly lower TBA and POV values at the end of storage compared to the control. Marination with dry red wine, lime-tree honey, thyme marjoram, garlic, and horseradish can evidently control total mesophilic aerobic bacteria, lactic acid bacteria and oxidation of beef meat.

  16. The Effects of Cooking Process and Meat Inclusion on Pet Food Flavor and Texture Characteristics

    Science.gov (United States)

    Koppel, Kadri; Gibson, Michael; Alavi, Sajid; Aldrich, Greg

    2014-01-01

    Simple Summary The results of this research indicate that processing (baked vs. extruded) plays an important role in determining pet food product texture. In addition, raw ingredients (fresh meat vs. meal-based) did not consistently affect product sensory characteristics. These results may help pet food technologists better understand factors that affect palatability. Abstract The pet food industry is an important portion of the food and feed industries in the US. The objectives of this study were (1) to determine cooking method (baking or extrusion), meat inclusion (0 or 20%), and extrusion thermal to mechanical energy ratios (low, medium, and high) effects on sensory and volatile properties of pet foods, and (2) to determine associations among sensory and volatile characteristics of baked and extruded pet foods. Descriptive sensory analysis and gas chromatography-mass spectrometry were used to analyze the pet food samples. It was found that baked samples were lighter in color (2.0–2.6 baked vs. 3.5–4.3 extruded, color intensity scale 0–15), and had lower levels of attributes that indicated rancidity (i.e., fishy flavor; 0.3–0.6 baked, 0.6–1.5 extruded, scale 0–15), whereas extruded pet foods were more cohesive in mass, more friable, hard, and crisp, but less powdery than baked samples. Fresh meat inclusion tended to decrease bitterness and increase fishy flavor and cohesiveness of pet foods. High thermal to mechanical energy ratio during extrusion resulted in less musty and more porous kibbles. The main volatile compounds included aldehydes, such as hexanal and heptanal, ketones, and alcohols. Extruded samples did not contain methylpyrazine, while baked samples did not contain 2-butyl furan. Future studies should consider evaluating the relationship between sensory results and animal palatability for these types of foods. PMID:26480040

  17. Spectral and raw quasi in-situ energy dispersive X-ray data captured via a TEM analysis of an ODS austenitic stainless steel sample under 1 MeV Kr2+ high temperature irradiation.

    Science.gov (United States)

    Brooks, Adam J; Yao, Zhongwen

    2017-10-01

    The data presented in this article is related to the research experiment, titled: ' Quasi in-situ energy dispersive X-ray spectroscopy observation of matrix and solute interactions on Y-Ti-O oxide particles in an austenitic stainless steel under 1 MeV Kr 2+ high temperature irradiation' (Brooks et al., 2017) [1]. Quasi in-situ analysis during 1 MeV Kr 2+ 520 °C irradiation allowed the same microstructural area to be observed using a transmission electron microscope (TEM), on an oxide dispersion strengthened (ODS) austenitic stainless steel sample. The data presented contains two sets of energy dispersive X-ray spectroscopy (EDX) data collected before and after irradiation to 1.5 displacements-per-atom (~1.25×10 -3  dpa/s with 7.5×10 14  ions cm -2 ). The vendor software used to process and output the data is the Bruker Esprit v1.9 suite. The data includes the spectral (counts vs. keV energy) of the quasi in-situ scanned region (512×512 pixels at 56k magnification), along with the EDX scanning parameters. The.raw files from the Bruker Esprit v1.9 output are additionally included along with the.rpl data information files. Furthermore included are the two quasi in-situ HAADF images for visual comparison of the regions before and after irradiation. This in-situ experiment is deemed ' quasi' due to the thin foil irradiation taking place at an external TEM facility. We present this data for critical and/or extended analysis from the scientific community, with applications applying to: experimental data correlation, confirmation of results, and as computer based modeling inputs.

  18. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    , and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...

  19. Toxoplasma gondii in horse meat intended for human consumption in Romania.

    Science.gov (United States)

    Paştiu, Anamaria Ioana; Györke, Adriana; Kalmár, Zsuzsa; Bolfă, Pompei; Rosenthal, Benjamin Martin; Oltean, Miruna; Villena, Isabelle; Spînu, Marina; Cozma, Vasile

    2015-09-15

    The prevalence of Toxoplasma gondii, an economically important zoonotic protozoan, was investigated in horses slaughtered for export and human consumption in the North of Romania. Pairs of samples, sera and heart tissues, were collected from 82 slaughtered horses. Examination of horse sera by ELISA at a dilution of 1:10, and by modified agglutination test (MAT) at a dilution of 1:6, revealed that 32 (39%) and 31(37.8%) horses, respectively, had antibodies against T. gondii. Using polymerase chain reaction (PCR) analysis, T. gondii DNA was not found in any heart sample collected from horses. By bioassay in mice, we obtained viable isolates of T. gondii from two of ten horses determined to be strongly positive by serological assay/ELISA. The prevalence estimated in horses highlighted the potential risk for human contamination by consumption of raw or undercooked meat. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Antibiotic resistance and plasmid carriage among Escherichia coli isolates from chicken meat in Malaysia

    International Nuclear Information System (INIS)

    Tin Tin Myaing; Saleha, A.A.; Arifah, A.K.; Raha, A.R.

    2005-01-01

    Escherichia coli isolates from 131 raw chicken meat samples were tested for susceptibility to 12 antibiotics. Plasmids were isolated from many samples and their DNA molecular weight calculated. An 81.7% plasmid occurrence rate was observed among the isolates, ranging from 0 to 8 in number and with sizes from 1.2 to 118.6 MDa. Plasmids were detected in 93.8% of E. coIi isolates resistant to all 12 antibiotics, and in 90.5% of E. coli isolates resistant to 11. Three (2.8%) isolates harboured 8 plasmids and were resistant to all 12 antibiotics. Antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and it is postulated that E. coli with a high number of plasmids possesses wider resistance to antibiotics. (author)

  1. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    OpenAIRE

    Silvius STANCIU; Nicoleta STANCIUC; Loredana DUMITRASCU; Roxana ION; Costel NISTOR

    2013-01-01

    Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appea...

  2. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  3. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; ARSLAN, Ali

    2014-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  4. STUDY ON THE MEAT CONSUMER BEHAVIOR IN THE WESTERN PART OF THE COUNTRY

    Directory of Open Access Journals (Sweden)

    GENOVEVA BUZAMĂT

    2008-05-01

    Full Text Available In this study, we performed a quantitative research on the consumption of meat and meat products on individuals from the counties Timis, Caras-Severin and Arad. The work instrument was represented by the anonymous questionnaire with simple and multiple-answer variants, consisted of 13 questions. At the end of this questionnaire, we may find questions related to the investigated person status, age, sex, origin environment, education, income, family. The sample on which the research was performed was consisted of 425 individuals. The objectives of this research are: evaluation of the frequency of meat and meat products consumption, evaluation of meat quantity consumed per capita, evaluation of consumers’ preferences for meat types and products, identification of the place where consumers purchase meat and meat products from, identification of some correlations between meat consumption and consumer’s income level, education and age.

  5. Sampling

    CERN Document Server

    Thompson, Steven K

    2012-01-01

    Praise for the Second Edition "This book has never had a competitor. It is the only book that takes a broad approach to sampling . . . any good personal statistics library should include a copy of this book." —Technometrics "Well-written . . . an excellent book on an important subject. Highly recommended." —Choice "An ideal reference for scientific researchers and other professionals who use sampling." —Zentralblatt Math Features new developments in the field combined with all aspects of obtaining, interpreting, and using sample data Sampling provides an up-to-date treat

  6. Microbiological sampling plan based on risk classification to verify supplier selection and production of served meals in food service operation.

    Science.gov (United States)

    Lahou, Evy; Jacxsens, Liesbeth; Van Landeghem, Filip; Uyttendaele, Mieke

    2014-08-01

    Food service operations are confronted with a diverse range of raw materials and served meals. The implementation of a microbial sampling plan in the framework of verification of suppliers and their own production process (functionality of their prerequisite and HACCP program), demands selection of food products and sampling frequencies. However, these are often selected without a well described scientifically underpinned sampling plan. Therefore, an approach on how to set-up a focused sampling plan, enabled by a microbial risk categorization of food products, for both incoming raw materials and meals served to the consumers is presented. The sampling plan was implemented as a case study during a one-year period in an institutional food service operation to test the feasibility of the chosen approach. This resulted in 123 samples of raw materials and 87 samples of meal servings (focused on high risk categorized food products) which were analyzed for spoilage bacteria, hygiene indicators and food borne pathogens. Although sampling plans are intrinsically limited in assessing the quality and safety of sampled foods, it was shown to be useful to reveal major non-compliances and opportunities to improve the food safety management system in place. Points of attention deduced in the case study were control of Listeria monocytogenes in raw meat spread and raw fish as well as overall microbial quality of served sandwiches and salads. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Rabbit meat processing: historical perspective to future directions

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2013-12-01

    Full Text Available In past centuries, because rabbits are relatively small, animals slaughtered for consumption were generally eaten immediately. However, since a single rabbit would offer little more product than could be consumed at one sitting, little effort was devoted to developing preserved rabbit products (such as salted or dried meat, sausages, etc.. For this reason, although there is a rich history of recipes using rabbit meat in the Mediterranean area, there are few traditional further-processed products. Nowadays, even though the processing industry is pushing more and more towards the introduction of more attractive products (i.e. ready meals, ready-to-cook, etc. for consumers with little time for meal preparation, most rabbit meat worldwide is still sold as whole carcass or cut-up parts. This review analyses the main strength and weakness factors regarding the use of rabbit meat to manufacture further processed products. Bearing in mind these considerations, it then describes the more promising processing technologies for raw meat materials to obtain added-value products (marinated, formed, emulsified, coated, etc. by exploiting rabbit meat’s intrinsic characteristics, such as high protein/low fat content coupled with a balanced n-6 to n-3 PUFA ratio, low cholesterol and heme-iron content. Major trends in meat product formulation (modulation of lipid content and composition, use of novel antioxidants and salt reduction are also discussed by highlighting strategies to provide healthier meat products meeting current nutritional needs. Finally, major packaging solutions for rabbit meat and meat products (ordinary and modified atmosphere, vacuum are considered.

  8. Meat Consumption Patterns among Different Income Groups in Imo ...

    African Journals Online (AJOL)

    This research examined meat consumption patterns among different income groups in Imo State, Nigeria. A combination of purposive and simple random sampling techniques was used to select the markets and 200 respondents. The result of cross price elasticity of meat and fish showed that they were substitute with cross ...

  9. Rapid measurement of meat spoilage using fluorescence spectroscopy

    Science.gov (United States)

    Wu, Binlin; Dahlberg, Kevin; Gao, Xin; Smith, Jason; Bailin, Jacob

    2017-02-01

    Food spoilage is mainly caused by microorganisms, such as bacteria. In this study, we measure the autofluorescence in meat samples longitudinally over a week in an attempt to develop a method to rapidly detect meat spoilage using fluorescence spectroscopy. Meat food is a biological tissue, which contains intrinsic fluorophores, such as tryptophan, collagen, nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) etc. As meat spoils, it undergoes various morphological and chemical changes. The concentrations of the native fluorophores present in a sample may change. In particular, the changes in NADH and FAD are associated with microbial metabolism, which is the most important process of the bacteria in food spoilage. Such changes may be revealed by fluorescence spectroscopy and used to indicate the status of meat spoilage. Therefore, such native fluorophores may be unique, reliable and nonsubjective indicators for detection of spoiled meat. The results of the study show that the relative concentrations of all above fluorophores change as the meat samples kept in room temperature ( 19° C) spoil. The changes become more rapidly after about two days. For the meat samples kept in a freezer ( -12° C), the changes are much less or even unnoticeable over a-week-long storage.

  10. Method for selecting raw materials to preparing ceramic masses: application to raw material for red ceramic

    International Nuclear Information System (INIS)

    Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor

    2012-01-01

    We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)

  11. The Meat City

    DEFF Research Database (Denmark)

    Thelle, Mikkel

    2017-01-01

    This article investigates the emergence of the Copenhagen slaughterhouse, called the Meat City, during the late nineteenth century. This slaughterhouse was a product of a number of heterogeneous components: industrialization and new infrastructures were important, but hygiene and the significance...... of Danish bacon exports also played a key role. In the Meat City, this created a distinction between rising production and consumption on the one hand, and the isolation and closure of the slaughtering facility on the other. This friction mirrored an ambivalent attitude towards meat in the urban space: one...... where consumers demanded more meat than ever before, while animals were being removed from the public eye. These contradictions, it is argued, illustrate and underline the change of the city towards a ‘post-domestic’ culture. The article employs a variety of sources, but primarily the Copenhagen...

  12. Meat for keeps

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1981-01-01

    The advantages of gamma irradiation as a food preservation technique for meat are such that the author envisages its wide acceptance and application during this decade both locally and internationally

  13. Effect of some factors used to the chicken meat preservation and processing on the protease activity

    International Nuclear Information System (INIS)

    Przysiezna, E.; Skrabka-Blotnicka, T.

    1996-01-01

    The obtained results indicated that the cathepsin activity was higher by about 60% in the extract from thigh than from breast muscles. Freezing and defrosting (not stored) of chicken meat did not influence the breast muscle cathepsin activity while they caused a decrease of activity of about 20% in the case of thigh muscles. The increase in cathepsin activity was noticed in both kinds of muscles during storage at -20 °C up to 4 months (45.6% and 19.4% for thigh and breast muscles respectively). The activity of cathepsin in extract from 5 months stored meat reached 80% in case of breast muscles and 83% in case of thigh muscles in relation to control sample respectively. The cathepsin activity significantly increased during heating of breast muscles up to 60 °C, but in case of thigh muscles it was slightly higher than at 50°C. The heating of cured chicken breast muscles up to 60°C caused a non significant growth in cathepsin activity opposite to raw muscles. The cathepsin activity from all cured samples heated up to 70°C were several times lower in relation to control samples. The cathepsin activity of both thigh and breast muscles were resistant to gamma radiation. The investigated factors caused changes in the activity of cathepsin but none of them caused its total inactivation. The changes of cathepsin activity depended on the kind of muscles and the kind and the value of acting factors

  14. Irradiation and additive combinations on the pathogen reduction and quality of poultry meat.

    Science.gov (United States)

    Ahn, Dong U; Kim, Il Suk; Lee, Eun Joo

    2013-02-01

    Reduction of foodborne illnesses and deaths by improving the safety of poultry products is one of the priority areas in the United States, and developing and implementing effective food processing technologies can be very effective to accomplish that goal. Irradiation is an effective processing technology for eliminating pathogens in poultry meat. Addition of antimicrobial agents during processing can be another approach to control pathogens in poultry products. However, the adoption of irradiation technology by the meat industry is limited because of quality and health concerns about irradiated meat products. Irradiation produces a characteristic aroma as well as alters meat flavor and color that significantly affect consumer acceptance. The generation of a pink color in cooked poultry and off-odor in poultry by irradiation is a critical issue because consumers associate the presence of a pink color in cooked poultry breast meat as contaminated or undercooked, and off-odor in raw meat and off-flavor in cooked meat with undesirable chemical reactions. As a result, the meat industry has difficulties in using irradiation to achieve its food safety benefits. Antimicrobials such as sodium lactate, sodium diacetate, and potassium benzoate are extensively used to extend the shelf-life and ensure the safety of meat products. However, the use of these antimicrobial agents alone cannot guarantee the safety of poultry products. It is known that some of the herbs, spices, and antimicrobials commonly used in meat processing can have synergistic effects with irradiation in controlling pathogens in meat. Also, the addition of spices or herbs in irradiated meat improves the quality of irradiated poultry by reducing lipid oxidation and production of off-odor volatiles or masking off-flavor. Therefore, combinations of irradiation with these additives can accomplish better pathogen reduction in meat products than using them alone even at lower levels of antimicrobials/herbs and

  15. Elemental composition of game meat from Austria.

    Science.gov (United States)

    Ertl, Kathrin; Kitzer, Roland; Goessler, Walter

    2016-06-01

    Concentrations of 26 elements (B, Na, Mg, P, S, K, Ca, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Rb, Sr, Mo, Cd, Sb, Ba, Hg, Pb, U) in wild game meat from Austria were analysed using an inductively coupled plasma mass spectrometer. All investigated animals were culled during the hunting season 2012/2013, including 10 chamois (Rupicapra rupicapra), 9 hare (Lepus europaeus), 10 pheasant (Phasianus colchicus), 10 red deer (Cervus elaphus), 12 roe deer (Capreolus capreolus) and 10 wild boar (Sus scrofa). In 19 out of 61 meat samples lead concentrations were higher than 0.1 mg/kg, the maximum limit in meat as set by the European Commission (Regulation EC No 1881/2006), which is most likely caused by ammunition residues. Especially, pellet shot animals and chamois show a high risk for lead contamination. Despite ammunition residues all investigated muscle samples show no further health risk with respect to metal contamination.

  16. Food-related lifestyle and health attitudes of Dutch vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers

    NARCIS (Netherlands)

    Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, C. de

    2004-01-01

    The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in the Netherlands. The sample used for this study (participants ≥18 years) was taken from the Dutch National Food

  17. Food-related lifestyle and health attitudes of Dutch vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers

    NARCIS (Netherlands)

    Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, de C.

    2004-01-01

    The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food

  18. Effect of low-pressure plasma treatment on the color and oxidative stability of raw pork during refrigerated storage.

    Science.gov (United States)

    Ulbin-Figlewicz, Natalia; Jarmoluk, Andrzej

    2016-06-01

    The effect of low-pressure plasma on quality attributes of meat is an important aspect, which must be considered before application in food. The aim of this study was to determine the color, fatty acid composition, lipid oxidation expressed as thiobarbituric acid reactive substances and total antioxidant capacity of raw pork samples exposed to helium low-pressure plasma treatment (20 kPa) for 0, 2, 5, and 10 min during the storage period. The thiobarbituric acid reactive substance concentrations of all plasma-treated samples during storage were in the range from 0.26 to 0.61 mg malondialdehyde/kg. Exposure time caused significant changes only in total color difference, hue angle, and chroma after 10 min of treatment. Ferric reducing ability of plasma values of meat samples decreased from 1.93 to 1.40 mmol Trolox Eq/kg after 14 days of storage. The storage period significantly affected proportion of polyunsaturated fatty acids, with an increase about 3% after 14 days of refrigeration storage while the content of saturated fatty acids was at the same level. Helium low-pressure plasma does not induce oxidative processes. Application of this decontamination technique while maintaining product quality is possible in food industry. © The Author(s) 2015.

  19. Effect of comminution method and raw binder system in restructured beef.

    Science.gov (United States)

    Boles, J A; Shand, P J

    1998-07-01

    The effect of particle size, method of particle size reduction (grinding, flaking, slicing) and alginate or Fibrimex(™) binding systems on processing properties of restructured beef were investigated. The size of semimembranosus muscles was reduced with a meat slicer, grinder or flaker (Comitrol) through machine openings that were 2, 4 and 8 mm in size. Bind of meat pieces in raw and cooked beef steakettes were measured. Sensory evaluation to determine the effect of method of size reduction on texture of beef steakettes was done only on steakettes manufactured with alginate. Beef steakettes manufactured with the alginate binding system had significantly (p meat for the manufacture of restructured beef steakettes resulted in a higher raw bind than did either grinding or flaking the meat. Significant (p meat was sliced than when it was ground or flaked. However, when Fibrimex was used, bind was stronger when sliced meat was used. The alginate system resulted in higher binds for cooked product when particle size was smaller but with the Fibrimex system bind was higher when particle sizes were larger. A consumer panel on alginate restructured steakettes showed no preference for the texture produced by the different methods of particle size reduction.

  20. Update on the bird-egg syndrome and genuine poultry meat allergy.

    Science.gov (United States)

    Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines

    Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to sensitization to serum albumins present in many tissues including muscle tissue and egg yolk (Gal d 5). Primary sensitization to serum albumin may happen via the respiratory tract through exposure to pet birds (mainly in adults) or within the context of egg allergy in early childhood. Due to the heat lability of serum albumins, reactions are often limited to the skin upon contact with raw meat. Symptoms from meat ingestion are rare and mostly mild, whereas systemic reactions are common after ingestion of raw or soft-boiled egg yolk. Primary poultry meat allergy is mainly seen in adolescents and young adults, though hypersensitivity may have started already at (pre)school age. Egg allergy is usually absent. Typical symptoms of primary poultry meat allergy include OAS (±dyspnea), gastrointestinal complaints, urticaria and angioedema. Severe anaphylaxis with cardiovascular symptoms is rare. Chicken and turkey meat are highly cross-reactive and responsible for most reactions, while duck and goose meat causes milder or no symptoms. Soups, sausages, and ham represent relevant allergen sources, too. Patients with poultry meat allergy unexpectedly often suffer from concomitant allergy to fish and possibly shrimp. Serum specific IgE against fish and shrimp is found in respectively 60 and 40 % of sera, suggestive of cross-reactive allergens in these foods. The allergens thus far recognized in genuine poultry meat are LMW proteins of 5-25 kDa. One of them has been identified as

  1. Impact of Culture on Meat and Related Food Preferences in Akwa ...

    African Journals Online (AJOL)

    The effectiveness of meat and related food products marketing in Akwa Ibom State is conditioned by the specifics of culture. In this study, cultural effect on meat consumption is examined. A sample of 568 respondents were analysed with OLS regression. The results reveal that meat consumption and preferences for related ...

  2. Authentication of Meat Species in Sucuk by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Osman İrfan İLHAK

    2015-01-01

    Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

  3. Clostridium difficile in Retail Meats

    Centers for Disease Control (CDC) Podcasts

    2009-04-16

    Clostridium difficile is a common cause of diarrhea in healthcare settings but little is known about what causes cases in the community. In this podcast, CDC's Dr. L. Clifford McDonald discusses two papers in the May 2009 edition of Emerging Infectious Diseases that explore whether the organism could be found in meat samples purchased in grocery stores in Arizona and Canada.  Created: 4/16/2009 by Emerging Infectious Diseases.   Date Released: 4/16/2009.

  4. Effect of hunting awareness on wild game meat purchase behavior

    Directory of Open Access Journals (Sweden)

    Maria Elena Marescotti

    2018-06-01

    Full Text Available Although wild game meat constitutes a sustainable and healthy alternative to conventional meat and hunting contributes to the control of game populations, international studies on consumer attitudes towards this type of meat are still limited and no previous research has been focused on the Italian population. For the development of successful marketing strategies and/or public policy intervention, the knowledge of consumers’ purchase behavior is a key factor. Among all the determinants that can influence the behavior of consumers of hunted wild game meat (i.e. animal welfare, sustainability, ecological food choice, product safety, nutritional quality, the consumers’ awareness of hunting activity and their perceptions of wild game meat assume a crucial role. Accordingly, in this paper an online survey on a sample of 741 Italian meat consumers has been conducted to investigate the relationship between consumers’ purchase behavior and their awareness of hunted game meat and hunting practices (chi-square test, F-test. Statistically significant differences were found among segments of consumers with different levels of wild game meat consumption frequency. The analysis shows that, as expected, the highest consumption level of wild game meat relates to the highest level of general awareness of wild game meat and hunting practices. Our findings are in line with previous literature, that links positive behaviors of consumers towards wild game meat and hunting to familiarity and experience with hunting and hunters. Nonetheless, the present study provides a deeper understanding of the Italian consumers’ attitudes and perceptions of wild game meat and could suggests policy guidelines for the development of future targeted marketing strategies.

  5. VARIATION IN MEAT COMPOSITION VISCOSITY DURING THE MIXING PROCESS

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Animal raw material processing is directly influenced by the physical and chemical characteristics of the materials which also influence their water holding capacity. The various combinations and status of the raw materials used in the food industry determine specific behaviours that may influence the processing equipment performance and construction. The study on meat composition viscosity depending upon the added components, temperature and mixing time length, has shown that viscosity is increasing with lower added water percentage, lower mixing temperature and higher mixing time length.

  6. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR

    OpenAIRE

    Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

    2017-01-01

    Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos t...

  7. Cardiotoxic Effects of Raw Opium.

    Science.gov (United States)

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  8. Cardiotoxic Effects of Raw Opium

    OpenAIRE

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  9. NEW MEAT PRODUCTS WITH IMMUNOMODULATORY EFFECT CREATION METHOD

    Directory of Open Access Journals (Sweden)

    I. V. Kaltovich

    2016-01-01

    Full Text Available New meat products with immunomodulatory effect creation method reflecting differential characteristics of technological stages of manufacture of those types of meat products, including issues on the selection of primary and secondary raw materials, guidelines for development of formulations and production technologies, legislative requirements towards its labeling, etc, has been developed for the first time. A list of prospective meat raw materials for the manufacture of products with immunomodulatory effect was established: beef, pork, rabbit meat, broiler chicken meat, turkey, veal, ostrich meat, which have high content of protein (14,3– 21,7%, low content of fat (1,2–16,1%, excluding pork (33,3%, high levels of minimum amino-acid score (90,0–104,0%, protein quality indicator(0,91–1,64, essential amino acid index (1,16-1,25, coefficient of utility of amino acid content (0,72–0,86 and close to optimum fatty acid content, and also contain a great number of vitamins and minerals which play a significant role for immunity improvement. It was determined that the following functional ingredients are recommended to use: amino acids (valine, leucine, isoleucine, methionine, threonine, arginine, tryptophan, lysine, histidin, phenylalanyl, vitamins and provitamins (C,E, beta-carotene, B vitamins(Bc, B12, PP, etc., P(bioflavonoid complex, H, K, minerals (calcium, magnesium, iron, cuprum, zinc, manganese, selenium, polyunsaturated fatty acids omega-3 and omega-6, pseudo-vitamins (L-carnitin, coenzyme Q10, polysaccharides and peptides naturally occurring(squalen, B-Carotene, ginger, shiitake mushrooms, probiotics and prebiotics, glutathione, indole and lycopienes, bioflavonoids, L-arginine, N-acetylcysteine, gel from seaweed «Lamifaren». The use of the developed meat products with immunomodulatory effect creation method by process engineers of meat processing factories will allow them to form a single scientifically grounded approach during the

  10. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    Science.gov (United States)

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (ppork head meat was increased from 0% to 20%, cooking loss, total expressible fluid separation, fat separation, and pH of frankfurters were increased, while the lightness, redness, yellowness, and apparent viscosity of frankfurters were decreased. Ash contents, cohesiveness, color, and tenderness of sensory characteristics of frankfurters added with different amounts of pork meat or pork head meat were not significantly (p>0.05) different from those of the control or there treatments. Frankfurters in T4 (frankfurter with 30% pork meat + 20% pork head) had the lowest (p0.05) from that in the control. Frankfurters with higher pork head meat concentrations had lower flavor, juiciness, and overall acceptability scores. Therefore, replacing pork meat with pork head meat in the formulation could successfully produce results similar to those of control frankfurters. The best results were obtained when 10% pork head meat was used to replace pork meat. PMID:27621683

  11. Hand-held Raman sensor head for in-situ characterization of meat quality applying a microsystem 671 nm diode laser

    Science.gov (United States)

    Schmidt, Heinar; Sowoidnich, Kay; Maiwald, Martin; Sumpf, Bernd; Kronfeldt, Heinz-Detlef

    2009-05-01

    A hand-held Raman sensor head was developed for the in-situ characterization of meat quality. As light source, a microsystem based external cavity diode laser module (ECDL) emitting at 671 nm was integrated in the sensor head and attached to a miniaturized optical bench which contains lens optics for excitation and signal collection as well as a Raman filter stage for Rayleigh rejection. The signal is transported with an optical fiber to the detection unit which was in the initial phase a laboratory spectrometer with CCD detector. All elements of the ECDL are aligned on a micro optical bench with 13 x 4 mm2 footprint. The wavelength stability is provided by a reflection Bragg grating and the laser has an optical power of up to 200 mW. However, for the Raman measurements of meat only 35 mW are needed to obtain Raman spectra within 1 - 5 seconds. Short measuring times are essential for the hand-held device. The laser and the sensor head are characterized in terms of stability and performance for in-situ Raman investigations. The function is demonstrated in a series of measurements with raw and packaged pork meat as samples. The suitability of the Raman sensor head for the quality control of meat and other products will be discussed.

  12. Oxidative stability of dark chicken meat through frozen storage: influence of dietary fat and alpha-tocopherol and ascorbic acid supplementation.

    Science.gov (United States)

    Grau, A; Guardiola, F; Grimpa, S; Barroeta, A C; Codony, R

    2001-11-01

    We used factorial design to ascertain the influence of dietary fat source (linseed, sunflower and oxidized sunflower oils, and beef tallow) and the dietary supplementation with alpha-tocopheryl acetate (alpha-TA) (225 mg/kg of feed) and ascorbic acid (AA) (110 mg/kg) on dark chicken meat oxidation (lipid hydroperoxide and TBA values and cholesterol oxidation product content). alpha-TA greatly protected ground and vacuum-packaged raw or cooked meat from fatty acid and cholesterol oxidation after 0, 3.5, or 7 mo of storage at -20 C. In contrast, AA provided no protection, and no synergism between alpha-TA and AA was observed. Polyunsaturated fatty acid-enriched diets (those containing linseed, sunflower, or oxidized sunflower oils) increased meat susceptibility to oxidation. Cooking always involved more oxidation, especially in samples from linseed oil diets. The values of all the oxidative parameters showed a highly significant negative correlation with the alpha-tocopherol content of meat.

  13. Dietary exposure to short- and medium-chain chlorinated paraffins in meat and meat products from 20 provinces of China.

    Science.gov (United States)

    Huang, Huiting; Gao, Lirong; Zheng, Minghui; Li, Jingguang; Zhang, Lei; Wu, Yongning; Wang, Runhua; Xia, Dan; Qiao, Lin; Cui, Lili; Su, Guijin; Liu, Wenbin; Liu, Guorui

    2018-02-01

    Food intake is one of the main pathways of human exposure to chlorinated paraffins (CPs). This study assessed the dietary exposure for the general Chinese population to short-chain chlorinated paraffin (SCCPs) and medium-chain chlorinated paraffins (MCCPs) through meat and meat products. Twenty samples of meat and meat products from 20 Chinese provinces were collected in 2011. As the sampling sites covered about two-thirds of the Chinese population, the meat samples were considered to be representative of the true characteristics of CPs contamination in Chinese meat products. The concentrations of SCCPs and MCCPs in the meat samples were measured using the comprehensive two-dimensional gas chromatography electron capture negative ionization high-resolution time-of-flight mass spectrometry method. Forty-eight SCCP and MCCP homolog groups were detected in the meat samples. The mean SCCP and MCCP concentrations in all meat samples were 129 ± 4.1 ng g -1 wet weight and 5.7 ± 0.59 ng g -1 wet weight, respectively. The concentrations of SCCPs and MCCPs varied in samples from different provinces. The geographical distribution of CP concentrations was similar to the distribution of CPs manufacturing plants in China. The most abundant groups of SCCPs in all samples were C 10-11 Cl 6-7 , and the most abundant groups of MCCPs in most samples were C 14 Cl 7-8 . The possible sources of SCCPs and MCCPs in meat and meat products might be CP-42 and CP-52. The 50th percentile estimated daily intakes of SCCPs and MCCPs through meat consumption for a "standard" Chinese adult male were 0.13 and 0.0047 μg kg -1 bw d -1 , respectively, both much lower than the tolerable daily intakes (TDIs) for SCCPs and MCCPs. This preliminary risk assessment has indicated that the indirect exposure of SCCPs and MCCPs through meat consumption does not pose significant risk to human health in China. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    OpenAIRE

    DANIELA IANIłCHI; CARMEN NICOLAE; CRISTIANA DIACONESCU; GABRIELA MALOS; I. G. MALOS

    2008-01-01

    Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some...

  15. Effect of irradiated pork on physicochemical properties of meat emulsions

    Science.gov (United States)

    Choi, Yun-Sang; Sung, Jung-Min; Jeong, Tae-Jun; Hwang, Ko-Eun; Song, Dong-Heon; Ham, Youn-Kyung; Kim, Hyun-Wook; Kim, Young-Boong; Kim, Cheon-Jei

    2016-02-01

    The effect of pork irradiated with doses up to 10 kGy on meat emulsions formulated with carboxy methyl cellulose (CMC) was investigated. Raw pork was vacuums packaged at a thickness of 2.0 cm and irradiated by X-ray linear accelerator (15 kW, 5 MeV). The emulsion had higher lightness, myofibrillar protein solubility, total protein solubility, and apparent viscosity with increasing doses, whereas cooking loss, total expressible fluid separation, and hardness decreased. There were no significant differences in fat separation, sarcoplasmic protein solubility, springiness, and cohesiveness. Our results indicated that it is treatment by ionizing radiation which causes the effects the physicochemical properties of the final raw meat product.

  16. Effect of chopping time and heating on 1 H nuclear magnetic resonance and rheological behavior of meat batter matrix.

    Science.gov (United States)

    Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong

    2018-04-01

    The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.

  17. Effect of Selected Alternative Fuels and Raw Materials on the Cement Clinker Quality

    Directory of Open Access Journals (Sweden)

    Strigáč Július

    2015-11-01

    Full Text Available The article deals with the study of the effects of alternative fuels and raw materials on the cement clinker quality. The clinker quality was expressed by the content of two principal minerals alite C3S and belite C2S. The additions of alternative fuels ashes and raw materials, in principle, always increased the belite content and conversely reduced the amount of alite. The alternative fuels with high ash content were used such as the meat-bone meal, sewage sludge from sewage treatment plants and paper sludge and the used alternative raw materials were metallurgical slags - granulated blastfurnace slag, air cooled blastfurnace slag and demetallized steel slag, fluidized bed combustion fly ash and waste glass. Meat-bone meal, sewage sludge from sewage treatment plants and paper sludge were evaluated as moderately suitable alternative fuels which can be added in the amounts of 2.8 wt. % addition of meat-bone meals ash, 3.64 wt. % addition of sewage sludge ash and 3.8 wt. % addition of paper sludge ash to the cement raw mixture. Demetallised steel slag is suitable for production of special sulphate resistant cement clinker for CEM I –SR cement with addition up to 5 wt. %. Granulated blastfurnace slag is a suitable alternative raw material with addition 4 wt. %. Air cooled blastfurnace slag is a suitable alternative raw material with addition 4.2 wt. %. Waste glass is not very appropriate alternative raw material with addition only 1.16 wt. %. Fluidized bed combustion fly ash appears not to be equally appropriate alternative raw material for cement clinker burning with less potential utilization in the cement industry and with addition 3.41 wt. %, which forms undesired anhydrite CaSO4 in the cement clinker.

  18. Microbiological criteria in public catering: sampling and auditing experiences in canteens and cafeterias in Piedmont

    Directory of Open Access Journals (Sweden)

    Amaranta Traversa

    2013-02-01

    Full Text Available In the period 2006-2011 six public catering establishments (3 canteens and 3 cafeterias were monitored, trough audit and sampling, in order to verify the application of good manufacturing and hygiene practices during food production, handling and serving. The compliance to microbiological food safety criteria (Listeria monocytogenes and Salmonella spp. and process hygiene criteria were investigated using ISO standards for microbiological analyses. A total of 612 samples were collected: 192 food samples and 288 environmental swab samples from canteens; 33 food samples and 99 swab samples from cafeterias. Regarding food safety, two samples were in disagreement with criteria fixed in EU Regulation as Listeria monocytogenes was isolated from a turkey breast in a canteen and from a sandwich in a cafeteria. Regarding process hygiene criteria, as no microbiological limits are legally defined for catering services, for this study limits were fixed according to the quality standards of tender, scientific literature and laboratory experience. 23.4% foodstuffs and 8.7% swabs resulted non-compliant in canteens; 48.5% foodstuffs and 6.1% swabs resulted non-compliant in cafeterias. The count of coagulase-positive staphylococci (CPS was higher of the fixed limits in raw turkey meat and in cooked spinach: the presence among CPS of S. aureus was confirmed, strains were not able to produce enterotoxins. The most common non-compliance in hygiene criteria was represented by aerobic colony count (60.7% of total non-compliance in canteens and 75.0% in cafeterias and coliform bacteria (20.3% in canteens and 25.0% in cafeterias. Nine raw foods or raw readyto- eat food samples were non-compliant for both coliform bacteria and aerobic count; one sample (raw turkey meat was non-compliant for CPS and aerobic count but resulted to be compliant after cooking. Auditing and sampling are the most effective tools to improve food quality standard and to enhance food business

  19. Potential Biomarker of Myofibrillar Protein Oxidation in Raw and Cooked Ham: 3-Nitrotyrosine Formed by Nitrosation.

    Science.gov (United States)

    Feng, Xianchao; Li, Chenyi; Ullah, Niamat; Hackman, Robert M; Chen, Lin; Zhou, Guanghong

    2015-12-30

    The stability of cured meat products is increased by the protection of its proteins from oxidation by sodium nitrite (NaNO2) during processing. This study investigated the effects of NaNO2 (0, 50, 100, 200, and 400 mg/kg) on the physiochemical and structural characteristics of myofibrillar protein (MP) in raw and cooked ham. The NaNO2 showed a dose-dependent antioxidant effect, by inhibiting carbonyl formation, dityrosine formation, and denaturation of MP, and a nitrosative effect, through the formation of 3-Nitrotyrosine (3-NT). The 3-NT content within MP of raw ham had distinct negative correlations with sulfhydryl content and surface hydrophobicity. The 3-NT content within MP of cooked ham had significantly negative correlations with carbonyl, sulfhydryl content and turbidity and had significantly positive correlations with disulfide content. These results indicated that 3-NT may be a potential marker for protein oxidation in raw and cooked cured meat products.

  20. Vitamin D-3 and 25-hydroxyvitamin D-3 in raw and cooked pork cuts

    DEFF Research Database (Denmark)

    Clausen, Ina; Jakobsen, Jette; Leth, Torben

    2003-01-01

    The contents of vitamin D-3 and its metabolically active metabolite 25-hydroxyvitamin D-3 (25OHD(3)) were examined by HPLC in different parts of four common raw pork cuts (loin boneless, leg inside, thin belly, neck) and in cooked meat (loin boneless). In whole raw pork cuts, varying in fat content......, and that rind, despite its limited fat content, has a high concentration of vitamin D-3 and 25OHD(3). Cooking increased vitamin D-3 and 25OHD(3) calculated per 100 g of tissue in all parts and in the whole cut (in whole cuts in raw and cooked meat, respectively: vitamin D-3: 0.15 (0.08-0.24) mug/100 g and 0...... 25OHD(3) contributes significantly to vitamin D activity. Food databases should include concentrations of both vitamin D and 25OHD(3). (C) 2003 Elsevier Ltd. All rights reserved....

  1. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  2. Effect of different cooking methods on lipid oxidation and formation of volatile compounds in foal meat.

    Science.gov (United States)

    Domínguez, Rubén; Gómez, María; Fonseca, Sonia; Lorenzo, José M

    2014-06-01

    The influence of four different cooking methods (roasting, grilling, microwaving and frying) on cooking loss, lipid oxidation and volatile profile of foal meat was studied. Cooking loss were significantly (Pcooking methods increased TBARs content, since high temperature during cooking causes increased oxidation in foal steaks, this increase was significantly (Pcooking methods led to increased total volatile compounds (between 366.7 and 633.1AU×10(6)/g dry matter) compared to raw steaks (216.4AU×10(6)/g dry matter). The roasted steaks showed the highest volatile content, indicating that increased cooking temperature increases the formation of volatile compounds. Aldehydes were the most abundant compounds in cooked samples, with amounts of 217.2, 364.5, 283.5 and 409.1AU×10(6)/g dry matter in grilled, microwaved, fried and roasted samples, respectively, whereas esters were the most abundant compounds in raw samples, with mean amounts of 98.8AU×10(6)/g dry matter. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  4. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Directory of Open Access Journals (Sweden)

    Shi Wu

    Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  5. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  6. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  7. Meat and meat products as a source of bioactive peptides

    Directory of Open Access Journals (Sweden)

    Alfonso Totosaus

    2016-12-01

    Full Text Available Meat is a high protein content food, with great nutritional and biological value. Meat protein hydrolysis begins with the muscle to meat conversion, during meat ageing. After slaughter, endogen enzymes are responsible of meat softening since myofibrillar anchorage proteins are degraded. Protein hydrolysis continues during food preparation. When meat reaches the stomach, pepsin is the first enzyme to interact. As the food travel trough out gastrointestinal tract, pancreatic enzymes degraded the remained protein and the peptidases made the final proteolysis process. The small proteins or peptides are the absorbed to the circulatory system and distributed to the rest of the body. Bioactive peptides activity of meat and meat products is anti-hypertensive mainly, where histidine, carnosine and anserine are the main peptides identified. Another peptide with anti-oxidant activity is glutathione. The content depends on animal species.

  8. Czech Foreign Trade with Meat and Meat Products

    Directory of Open Access Journals (Sweden)

    Karina Pohlová

    2016-04-01

    Full Text Available The meat production and meat processing industry are the most important parts of the agribusiness in the Czech Republic. The problem of the industry is its low competitiveness towards foreign producers and processors which results in negative balance of foreign trade. The aim of the article is to evaluate long-term development of value and structure of Czech foreign trade flows of meat and meat products. The analysis covers the period of 2001–2014. The problems of the negative trade balance are revealed through description of the trade flows of meat and meat products, the RCA index and relations between import and export prices. The analysis points out the problems of low competitiveness of the intermediate and finalized meat. Alternatively, Czech Republic has comparative advantage in live animals, sausages and homogenized meat products.

  9. Validation of low-volume enrichment protocols for detection of Escherichia coli O157 in raw ground beef components, using commercial kits.

    Science.gov (United States)

    Ahmed, Imtiaz; Hughes, Denise; Jenson, Ian; Karalis, Tass

    2009-03-01

    Testing of beef destined for use in ground beef products for the presence of Escherichia coli O157:H7 has become an important cornerstone of control and verification activities within many meat supply chains. Validation of the ability of methods to detect low levels of E. coli O157:H7 is critical to confidence in test systems. Many rapid methods have been validated against standard cultural methods for 25-g samples. In this study, a number of previously validated enrichment broths and commercially available test kits were validated for the detection of low numbers of E. coli O157:H7 in 375-g samples of raw ground beef component matrices using 1 liter of enrichment broth (large-sample:low-volume enrichment protocol). Standard AOAC International methods for 25-g samples in 225 ml of enrichment broth, using the same media, incubation conditions, and test kits, were used as reference methods. No significant differences were detected in the ability of any of the tests to detect low levels of E. coli O157:H7 in samples of raw ground beef components when enriched according to standard or large-sample:low-volume enrichment protocols. The use of large-sample:low-volume enrichment protocols provides cost savings for media and logistical benefits when handling and incubating large numbers of samples.

  10. A comparative study of functional properties of normal and wooden breast broiler chicken meat with NaCl addition.

    Science.gov (United States)

    Xing, Tong; Zhao, Xue; Han, Minyi; Cai, Linlin; Deng, Shaolin; Zhou, Guanghong; Xu, Xinglian

    2017-09-01

    The selection of broilers for augmented growth rate and breast has brought about wooden-breast (WB) muscle abnormalities, which caused substantial economic losses. The objective of this study was to compare water holding capacity, water mobility and distribution, salt-soluble protein (SSP) content, and protein profiles of normal and WB chicken meat with different additions of NaCl. Thirty WB and 30 normal chicken breasts were selected from a deboning line of a major Chinese processing plant at 2 to 3 h post mortem. Two different meat batters were formulated to 150 mg/g meat protein and different NaCl contents (0%, 1%, 2%, 3%, and 4%). Results indicated that as NaCl contents increased, the cooking loss of meat batters decreased (P meat showed different protein profiles, with myosin heavy chain exhibiting a higher intensity at ≥3% salt level. Low-field nuclear magnetic resonance (LF-NMR)revealed an increased T22 and higher P22 in raw WB meat compared to normal meat (P meat batters, WB meat batters had reduced T21 and lower immobilized water proportions at low NaCl contents (meat gels. Meat gels prepared from WB had a lower proportion of water within the myofibrillar protein matrix and a greater proportion of exuded bulk water at NaCl contents meat, meat batters and gels, water distribution and mobility of WB exhibited significant differences compared to normal meat. The addition of NaCl affected water mobility and distributions in meat batters, with a level of 3% NaCl eliminating the differences between processed normal and WB meat products. © 2017 Poultry Science Association Inc.

  11. Behavioral, Ecological, and Evolutionary Aspects of Meat-Eating by Sumatran Orangutans (Pongo abelii).

    Science.gov (United States)

    Hardus, Madeleine E; Lameira, Adriano R; Zulfa, Astri; Atmoko, S Suci Utami; de Vries, Han; Wich, Serge A

    2012-04-01

    Meat-eating is an important aspect of human evolution, but how meat became a substantial component of the human diet is still poorly understood. Meat-eating in our closest relatives, the great apes, may provide insight into the emergence of this trait, but most existing data are for chimpanzees. We report 3 rare cases of meat-eating of slow lorises, Nycticebus coucang, by 1 Sumatran orangutan mother-infant dyad in Ketambe, Indonesia, to examine how orangutans find slow lorises and share meat. We combine these 3 cases with 2 previous ones to test the hypothesis that slow loris captures by orangutans are seasonal and dependent on fruit availability. We also provide the first (to our knowledge) quantitative data and high-definition video recordings of meat chewing rates by great apes, which we use to estimate the minimum time necessary for a female Australopithecus africanus to reach its daily energy requirements when feeding partially on raw meat. Captures seemed to be opportunistic but orangutans may have used olfactory cues to detect the prey. The mother often rejected meat sharing requests and only the infant initiated meat sharing. Slow loris captures occurred only during low ripe fruit availability, suggesting that meat may represent a filler fallback food for orangutans. Orangutans ate meat more than twice as slowly as chimpanzees (Pan troglodytes), suggesting that group living may function as a meat intake accelerator in hominoids. Using orangutan data as a model, time spent chewing per day would not require an excessive amount of time for our social ancestors (australopithecines and hominids), as long as meat represented no more than a quarter of their diet. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s10764-011-9574-z) contains supplementary material, which is available to authorized users.

  12. Development of methods for the neutron activation analysis to the determination of essential and toxic trace elements of biological and environmental samples: application of enzyme activity of raw hides

    International Nuclear Information System (INIS)

    Sipos, T.; Nagy, L.G.; Toeroek, G.; Kollar, J.

    1974-01-01

    Investigations on the post mortem enzymatic processes pointed out the fact, that significant deviations can be observed in the extent and in the results of the autolytic transformations occurring during the storage of raw hide. A neutron activation analysis procedure, based on a semiautomated radiochemical separation procedure and scintillation gamma spectrometry, was selected for the determination of some trace elements. Six trace elements, Cu, Mn, Zn, Au, As, and Cr, and one minor component,Br, were detected and/or determined in the concentration region of 0,1-10 3 ppM. According to preliminary investigations evaluated at the time being, concentration differences of some orders of magnitude were obtained for some trace elements: copper, zinc and manganese, whereas the concentration of bromine remained practically constant. These findings seem to correlate with large differences in appearance due to different enzyme activities in the raw hides

  13. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    OpenAIRE

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (p0...

  14. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  15. Decarbonising meat : Exploring greenhouse gas emissions in the meat sector

    NARCIS (Netherlands)

    Aan Den Toorn, S. I.; Van Den Broek, M. A.; Worrell, E.

    Consumption of meat is an important source of global greenhouse gas (GHG) emission and deep decarbonisation of the whole meat production chain is required to be able to meet global climate change (CC) mitigation goals. Emissions happen in different stages of meat production ranging from agricultural

  16. Meat and Appetite Regulation

    DEFF Research Database (Denmark)

    Kehlet, Ursula Nana

    effects of new formulations of pork products. Different strategies can be applied to potentially enhance the satiating properties of pork. Processed meat products such as meatballs can serve as a matrix for the addition of fiber ingredients. Based on their high protein and fiber contents, high......-fibre meatballs could provide a dual mechanistic action that would lead to greater satiety. For whole muscles, cooking is known to induce structural, physical and chemical changes of the meat proteins, which in turn may affect protein digestibility and potentially affect satiety. The overall aim of this Ph......D thesis was to investigate the effects of fiber addition to meatballs and the effects of cooking methods of pork on appetite regulation. The PhD thesis is based on three human meal test studies and one analytical study related to the characteristics of fiber meat products. In paper I, the objective...

  17. Ecological safety of meat products

    OpenAIRE

    A. K. Mikhailenko

    2009-01-01

    The level of toxicants was studied, and the biological value of sheep meat in the area of anthropogenic influence was checked up. The level of toxicants in meat depends straight on the age of animals.

  18. [Evaluation of the quality of poultry meat and its processing for vacuum packaging].

    Science.gov (United States)

    Swiderski, F; Russel, S; Waszkiewicz-Robak, B; Cholewińska, E

    1997-01-01

    The aim of study was to evaluate the quality of poultry meat, roasted and smoked chicken and poultry pie packing under low and high vacuum. All investigated products were stored at +4 degrees C and evaluated by microbiological analysis. It was showed that packing under low and high vacuum inhibited development of aerobic microorganisms, proteolytic bacteria, yeasts and moulds. Vacuum-packaged storage of poultry meat and its products stimulated activity of anaerobic, nonsporeforming bacteria. The fast spoilage of fresh poultry meat was observed both under vacuum and conventional storage. The microbiology quality of poultry products depended on technology of production and microbiological quality of raw material.

  19. Sustainability and meat consumption: is reduction realistic?

    NARCIS (Netherlands)

    Dagevos, H.; Voordouw, J.

    2013-01-01

    Meat is critical with respect to sustainability because meat products are among the most energy-intensive and ecologically burdensome foods. Empirical studies of the meat-consumption frequency of Dutch consumers show that, apart from meat-avoiders and meat-eaters, many people are meat-reducers that

  20. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Directory of Open Access Journals (Sweden)

    Monique Zagorec

    2017-09-01

    Full Text Available Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage.

  1. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Science.gov (United States)

    Zagorec, Monique; Champomier-Vergès, Marie-Christine

    2017-01-01

    Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage. PMID:28878171

  2. Methods and approaches to prediction in the meat industry

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available The modern stage of the agro-industrial complex is characterized by an increasing complexity, intensification of technological processes of complex processing of materials of animal origin also the need for a systematic analysis of the variety of determining factors and relationships between them, complexity of the objective function of product quality and severe restrictions on technological regimes. One of the main tasks that face the employees of the enterprises of the agro-industrial complex, which are engaged in processing biotechnological raw materials, is the further organizational improvement of work at all stages of the food chain, besides an increase in the production volume. The meat industry as a part of the agro-industrial complex has to use the biological raw materials with maximum efficiency, while reducing and even eliminating losses at all stages of processing; rationally use raw material when selecting a type of processing products; steadily increase quality, biological and food value of products; broaden the assortment of manufactured products in order to satisfy increasing consumer requirements and extend the market for their realization in the conditions of uncertainty of external environment, due to the uneven receipt of raw materials, variations in its properties and parameters, limited time sales and fluctuations in demand for products. The challenges facing the meat industry cannot be solved without changes to the strategy for scientific and technological development of the industry. To achieve these tasks, it is necessary to use the prediction as a method of constant improvement of all technological processes and their performance under the rational and optimal regimes, while constantly controlling quality of raw material, semi-prepared products and finished products at all stages of the technological processing by the physico-chemical, physico-mechanical (rheological, microbiological and organoleptic methods. The paper

  3. Radiation hygienization of raw sewage sludge

    International Nuclear Information System (INIS)

    Shah, M.R.; Lavale, D.S.; Rawat, P.; Benny, P.G.; Sharma, A.K.; Dey, G.R.; Bhave, V.

    2001-01-01

    'Radiation treatment of municipal sewage sludge can achieve resource conservation and recovery objectives. The liquid sludge irradiator of Sludge Hygienization Research Irradiator at Baroda (India) was operated for generating data on treatment of raw sludge containing 3-4 % solids. The plant system was modified for irradiating raw sludge without affecting basic irradiator initially designed to treat digested sludge. Hourly samples were analysed for estimation of disinfection dose requirement. Sand separated from the sludge was used as in-situ dosimeter by making use of its thermoluminescence property. Investigations are being carried out for regrowth of Total Coliforms in the sludge samples from this irradiator. Possibility of inadequate treatment due to geometric configuration of irradiator is being checked. (author)

  4. Polina Fedorova, About Camel Meat

    OpenAIRE

    Gedeeva, Darina; Babaev, Andrei

    2016-01-01

    In the past, the Kalmyks ate beef and horse meat. The poor ate camel meat. People who ate camel meat had pimples on their faces. The camel’s pelt and humps were used to make vessels. The intestines were cleaned, stretched and dried. It was used to make strings for dombra instruments. Arcadia

  5. Combination of irradiation with other treatments to improve the shelf-life and quality of meat and meat products

    International Nuclear Information System (INIS)

    Paul, P.; Chawla, S.P.; Kanatt, S.R.

    1998-01-01

    The effects were studied of low dose gamma irradiation in combination with other treatments (acetic acid and a sodium tripolyphosphate dip for buffalo meat; a hot water dip for lamb meat; ascorbic acid for chicken and curing for meat products) on the shelf-life of prepacked meats at chilled and ambient temperatures in terms of the microbiological, chemical and sensory qualities. Meats irradiated at 2.5 kGy had a shelf-life of 4 weeks at 0-3 deg. C, 2 weeks at 7-10 deg. C and 42 h at 28-30 deg. C, and showed a remarkable improvement in the microbiological quality. irradiation resulted in the reduction/elimination of microorganisms of public health significance, e.g. Enterobacteriaceae, Salmonella, staphylococci and faecal coliforms. In contrast, the corresponding control samples had a shelf-life of less than 2 weeks at 0-3 deg. C, 1 week at 7-10 deg. C and 18 h at ambient temperature (28-30 deg. C). A high level of microorganisms such as Enterobacteriaceae, staphylococci, Salmonella and sulphite reducing Clostridia were detected in the control samples during storage. A combination of acetic acid/hot water pretreatment and irradiation further improved the microbiological quality of the meats, while a pretreatment of sodium tripolyphosphate enhanced the retention of colour and the juiciness of the meat samples. The effects were observed at all the storage temperatures. For the meat products, a low dose of irradiation reduced the total viable counts by 1-2 log cycles, and also eliminated Enterobacteriaceae, staphylococci and Salmonella throughout the storage period. The irradiated meat products had a shelf-life of 2 weeks at 0-3 deg. C and 24 h at 28-30 deg. C, while the non-irradiated meat products had a shelf-life of 1 week at 0-3 deg. C and 18 h at 28-30 deg. C. (author)

  6. Evaluation of bi-functionalized mesoporous silicas as reversed phase/cation-exchange mixed-mode sorbents for multi-residue solid phase extraction of veterinary drug residues in meat samples.

    Science.gov (United States)

    Casado, Natalia; Pérez-Quintanilla, Damián; Morante-Zarcero, Sonia; Sierra, Isabel

    2017-04-01

    A SBA-15 type mesoporous silica was synthesized and bi-functionalized with octadecylsilane (C18) or octylsilane (C8), and sulfonic acid (SO 3 - ) groups in order to obtain materials with reversed-phase/strong cation-exchange mixed-mode retention mechanism. The resulting hybrid materials (SBA-15-C18-SO 3 - and SBA-15-C8-SO 3 - ) were comprehensively characterized. They showed high surface area, high pore volume and controlled porous size. Elemental analysis of the materials revealed differences in the amount of C18 and C8. SBA-15-C18-SO 3 - contained 0.19mmol/g of C18, while SBA-15-C8-SO 3 - presented 0.54mmol/g of C8. The SO 3 - groups anchored to the silica surface of the pore walls were 0.20 and 0.09mmol/g, respectively. The bi-functionalized materials were evaluated as SPE sorbents for the multi-residue extraction of 26 veterinary drug residues in meat samples using ultra-high-performance liquid chromatography coupled to mass spectrometry detector (UHPLC-MS/MS). Different sorbent amounts (100 and 200mg) and organic solvents were tested to optimize the extraction procedure. Both silicas showed big extraction potential and were successful in the extraction of the target analytes. The mixed-mode retention mechanism was confirmed by comparing both silicas with SBA-15 mesoporous silica mono-functionalized with C18 and C8. Best results were achieved with 200mg of SBA-15-C18-SO 3 - obtaining recoveries higher than 70% for the majority of analytes. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Searching for radiations in consumed meat in Lebanon in 1986

    International Nuclear Information System (INIS)

    Hage, N.

    1987-01-01

    The thesis is a survey on the contamination of meat in Lebanon following Chernobyl accident, taking into consideration that Lebanon is a big importer of meat from eastern european countries. The first part of the study presents an exhaustive description of radioactivity and different types of irradiation; the impact of Chernobyl accident on environment ; sources of contamination of meat by Iodine 131, Strontium 90 and Cesium 137; radiation doses admitted and radiation effects on men organs. The survey describes radioactivity analysis of one hundred samples of meat collected from different regions in Lebanon along the period dating from June to September 1986. Results showed the absence of radioactive contamination of consumed meat in Lebanon after Chernobyl accident. Recommendations are formulated for a permanent control of food products by Lebanese government in application of IAEA international regulations on preservation of food products from radioactive elements

  8. Evolution of dispersion fuel meat structure caused by interface reaction

    International Nuclear Information System (INIS)

    Xing Zhonghu; Ying Shihao

    2000-01-01

    In reactor operation, the resultant layers are formed by interdiffusion at the fuel particle-matrix interfaces of U 3 Si 2 -Al dispersion fuel. This results in the evolution of meat structure. On the basis of Monte-Carlo method, the author developed simulation method of fuel meat, and simulated the stochastic space locations of spherical fuel particles in the meat. The fuel volume fraction is 43%, and the particles are in definite size distribution. For the 13551 simulated particle samples, the evolution of meat structure is calculated with layer thickness ranging from 0 to 16 μm. The parameters of meat structure include the U 3 Si 2 fuel volume fraction, resultant layer volume fraction, Al matrix volume fraction, particle contact probability and overlap degree as functions of layer thickness

  9. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    Directory of Open Access Journals (Sweden)

    Silvius STANCIU

    2013-06-01

    Full Text Available Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appeared lately. Lack of safety measures in the field can affect business continuity critically, creating significant losses.

  10. High Seroprevalence of Leptospira Exposure in Meat Workers in Northern Mexico: A Case-Control Study

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernandez-Tinoco, Jesus; Sanchez-Anguiano, Luis Francisco; Ramos-Nevarez, Agar; Cerrillo-Soto, Sandra Margarita; Saenz-Soto, Leandro; Martinez-Ramirez, Lucio

    2016-01-01

    Background The seroepidemiology of Leptospira infection in workers occupationally exposed to raw meat has been poorly studied. This work aimed to determine the association between Leptospira exposure and the occupation of meat worker, and to determine the seroprevalence association with socio-demographic, work, clinical and behavioral characteristics of the meat workers studied. Methods We performed a case-control study in 124 meat workers and 124 age- and gender-matched control subjects in Durango City, Mexico. Sera of cases and controls were analyzed for anti-Leptospira IgG antibodies using a commercially available enzyme immunoassay. Data of meat workers were obtained with the aid of a questionnaire. The association of Leptospira exposure with the characteristics of meat workers was analyzed by bivariate and multivariate analyses. Results Anti-Leptospira IgG antibodies were found in 22 (17.7%) of 124 meat workers and in eight (6.5%) of 124 controls (OR = 3.12; 95% CI: 1.33 - 7.33; P = 0.006). Seroprevalence of Leptospira infection was similar between male butchers (17.6%) and female butchers (18.2%) (P = 1.00). Multivariate analysis of socio-demographic, work and behavioral variables showed that Leptospira exposure was associated with duration in the activity, rural residence, and consumption of snake meat and unwashed raw fruits. Conclusions This is the first case-control study of the association of Leptospira exposure with the occupation of meat worker. Results indicate that meat workers represent a risk group for Leptospira exposure. Risk factors for Leptospira exposure found in this study may help in the design of optimal preventive measures against Leptospira infection. PMID:26858797

  11. Prevalence of the Antibiotic Resistance Genes in Coagulase-Positive-and Negative-Staphylococcus in Chicken Meat Retailed to Consumers.

    Science.gov (United States)

    Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S; Moussa, Ihab M I; Hessain, Ashgan M; Girah, Zeinab M S Amin; Abo-Shama, Usama H; Orabi, Ahmed; Saad, Aalaa

    2016-01-01

    The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mec A and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), methicillin-resistant coagulase-negative staphylococci (MRCNS) and methicillin-susceptible coagulase-negative staphylococci (MSCNS) isolated from the retail trade of ready-to-eat raw chicken meat samples collected during 1 year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim, and vancomycin) and their endorsement of the quinolone resistance determining region, mec A and cfr genes. The isolation results revealed 50 isolates, CPS (14) and CNS (36), representing ten species ( S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius , and S. lentus ). Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mec A gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides, and streptogramin B [MLS( B )] in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone

  12. Rep-PCR typing of Staphylococcus spp. strains in meat paste production line and identification of their origin

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2015-05-01

    Full Text Available A meat paste production line and its microbial parameters have been evaluated in single Czech company. The raw meat paste samples before heat treatment were tested positively for the presence of three staphylococci species: Staphylococcus aureus, Staphylococcus haemolyticus and Staphylococcus epidermidis. Subsequent microbial analysis of meat paste components and ingredients (fresh meat, water, spices, equipment identified only the spices used as positive for S. aureus (coriander, cinnamon, badian, mustard – (10 - 40 cfu/g and S. haemolyticus strains (juniper, ginger. The collection of sixteen collected strains (S. aureus (n = 4, S. haemolyticus (n = 4, S. epidermidis (n = 8 has been typed with the rep-PCR method utilising (GTG5 primer. Analysis of the fingerprints using the unweighted pair-group method using arithmetic averages (UPGMA clustering method revealed presence of eleven strain clusters with similarity lower than 90%: two fingerprint clusters of S. aureus, three individual clusters characteristic for S. haemolyticus and six different S. epidermidis specific clusters. The S. aureus strains from different types of spice were identical, resp. very similar. Molecular tracking composed from the rep-PCR analysis of acquired isolates and comparison among all collected fingerprints confirmed the spices to be the source of both S. aureus and S. haemolyticus strains identified in raw meat paste. The additional rep-PCR analysis of the S. epidermidis collection confirmed usability and performance of this method. The antibiotic susceptibility to fourteen individual antibiotics has been examined among the collected staphylococci strains. The predominant erythromycin resistance (68.8% was followed with the resistance to amoxicillin/clavulanic acid (56.2%. Other resistances observed were less frequent (clindamycin – 12.5%, oxacillin – 6.3%, tetracycline – 6.3%, sulphamethoxazole-trimethoprim – 6.3%, chloramphenicol – 6.3%, novobiocin – 6

  13. an intermediate moisture meat

    African Journals Online (AJOL)

    Bunmi

    A total of 50 sticks of Suya weighing from 38.10 - 59.30 grams of sliced meat per stick were prepared for .... prolong shelflife and provide a natural alternative (or supplement) to chemical preservatives. Its antimicrobial ... Although O. gratissimum appears safe to use in both food and as medicine, its level of inclusion in food.

  14. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

    Directory of Open Access Journals (Sweden)

    Valeria Velasco

    Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

  15. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  16. MARKET CHOICES FOR BROILER CHICKEN MEAT IN THE OPINION

    Directory of Open Access Journals (Sweden)

    Anna Augustyńska-Prejsnar

    2014-09-01

    Full Text Available Recently there has, been growing a increase in consumption of poultry meat in Poland. The most important material for slaughter poultry are broilers. Among factors that influence rising demand for poultry meat are: low price, availability of raw materials and promotional campaigns of safe nutrition. Its nutritional and sensory value makes it a choice product. University students are a specific group that has aroused the interest of nutritionists. The students’ lifestyle is characterised by high active social life and intense responsibilities, which ought to be augmented with a carefully chosen diet. The youth do not only have significant impact on the family purchasing decisions but display a strong purchasing power due to financial resources at their disposal and would in the future become mature and rational consumers. The article lists factors that determine purchasing needs, reasons for choice of markets and the consumption frequency of broiler meat. The feeling of lack of other products coupled with current sales promotions were, in the opinion of the students surveyed, often responsible for the decision to purchase of broiler chicken meat. Low price and the ease of preparation were also key reasons for the choice of this meat product. Responding students noted that skinless chicken breast fillet was most commonly consumed.

  17. Quantitative Analysis of Micro-Structure in Meat Emulsions from Grating-Based Multimodal X-Ray Tomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2013-01-01

    Using novel X-ray techniques, based on grating-interferometry, new imaging modalities can be obtained simultaneously with absorption computed tomography (CT). These modalities, called phase contrast and dark field imaging, measure the electron density and the diffusion length of the sample....... Enhanced contrast capabilities of this X-ray technique makes studies on materials with similar attenuation properties possible. In this paper the focus is set on processing grating-based X-ray tomograms of meat emulsions to quantitatively measure micro-structural changes due to heat treatment. The emulsion...... samples were imaged both in a raw and cooked state. Additionally, different fat types were used in the emulsions in order to compare micro-structural differences when either pork fat or sunflower oil was used. From the reconstructed tomograms the different ingredients in the emulsions were segmented using...

  18. Food-related lifestyle and health attitudes of Dutch vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers.

    Science.gov (United States)

    Hoek, Annet C; Luning, Pieternel A; Stafleu, Annette; de Graaf, Cees

    2004-06-01

    The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food Consumption Survey, 1997/1998. Vegetarians (n = 63) and consumers of meat substitutes (n = 39) had similar socio-demographic profiles: higher education levels, higher social economic status, smaller households, and more urbanised residential areas, compared to meat consumers (n = 4313). Attitudes to food were assessed by the food-related lifestyle instrument. We found that vegetarians (n = 32) had more positive attitudes towards importance of product information, speciality shops, health, novelty, ecological products, social event, and social relationships than meat consumers (n = 1638). The health consciousness scale, which was used to assess attitudes to health, supported earlier findings that vegetarians are more occupied by health. Food-related lifestyle and health attitudes of meat substitute consumers (n = 17) were predominantly in-between those from vegetarians and meat consumers. The outcome of this study suggests that in strategies to promote meat substitutes for non-vegetarian consumers, the focus should not only be on health and ecological aspects of foods.

  19. Color image analysis technique for measuring of fat in meat: an application for the meat industry

    Science.gov (United States)

    Ballerini, Lucia; Hogberg, Anders; Lundstrom, Kerstin; Borgefors, Gunilla

    2001-04-01

    Intramuscular fat content in meat influences some important meat quality characteristics. The aim of the present study was to develop and apply image proce