
Sample records for raw material extraction

  1. Extraction of protoactinium from silicaceous raw material

    Energy Technology Data Exchange (ETDEWEB)

    Broda, E.


    This report was written by E. Broda and P.K. Wright at the Cavendish Laboratory (Cambridge) in March 1946 and is about the Extraction of protoactinium from a silicaceous raw material. In this report the isolation of Pa on Er carrier is described and it includes the experiment description and the discussion of the results. (nowak)

  2. Optimizing Pretreatment of Medicinal Raw Materials by RFC Plasma before Extraction

    Directory of Open Access Journals (Sweden)

    O.Yu. Kuznetsova


    Full Text Available Optimization of the RF-plasma treatment modes of chaga raw materials using the Statistica 6.0 software package has been performed. Mathematical design has been carried out to calculate the optimum parameters of RF-plasma treatment using three plasma-forming gases – argon, air, and nitrogen. Plasma treatment of chaga raw materials has been undertaken at the constant parameters: pressure P = 30.0 Pa, anodic current J = 0.7 A, gas consumption G = 0.04 g/s; the variable parameters were power U = 5.0÷7.0 kV and treatment duration at the high-frequency capacitor category of the lowered pressure t = 30÷60 min. Optimization of four key parameters for extraction of chaga raw materials (solid residue, melanin yield, antioxidant activity of both extract and chaga melanin depending on the chosen plasma-forming gas (argon, air, or nitrogen has been achieved. The optimum modes of RF-plasma treatment allowing to obtain the extracts and melanin of chaga mushroom with the improved physicochemical and antioxidant characteristics have been calculated.

  3. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter


    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de


    Directory of Open Access Journals (Sweden)

    Boyko N.N.


    Full Text Available This paper presents data on screening of antimicrobial properties of extracts from some kinds of raw materials (18 plants with hydroquinone, naphtoquinone or anthraquinone derivatives. Some technological parameters of extracts (density and concentration of extraneous substances have been determined. The most appropriate microbiological method of studying antimicrobial properties of extracts, diffusion method of “well”, has been applied; special mathematic method of comparison of antimicrobial properties of extracts vector analysis has been applied in order to study and to compare antimicrobial properties of extracts. Indexes of antimicrobial properties of extracts have been determined: a complex index of medicinal product antimicrobial activity for quantitative estimation of antimicrobial effect - A, and square of correlation coefficient - r², which demonstrates the spectrum of antimicrobial activity of the extracts (degree of similarity to the standard. The most active extracts have been selected; they have antimicrobial properties of medium strength: from the herb of chimaphila umbellata А=2.20; the fruits of rhamnus cathartica А=2.12; the root of rubia tinctorum А=2.11; the bark of frangula alnus А=2.05; the root of rumex confertus А=2.04; the leaf of pyrola rotundifolia А=2.00; and leaf of arctostaphylos uva-ursi А=2.08 (but extract from uva-ursi did not affected on 2 strains of microorganisms r²=0.64. Low levels of antimicrobial activity have been demonstrated by the extract obtained from the leaf of urtica dioica А=0.72, r²=0.34. The mean result of the complex index of antimicrobial activity for the most of extracts from plants containing quinonederivatives is A = 1.77 (on 70% vol. ethanol at a ratio of raw material : extracting agent – 1:7 wt. : vol. and may range from 0.68 to 2.85. The mean result of the correlation coefficient is r = 0.93 and may range from 0.59 to 0.99. The mean result of the concentration of

  5. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.


    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  6. Total flavonoids content in the raw material and aqueous extractives from Bauhinia monandra Kurz (Caesalpiniaceae). (United States)

    Fernandes, Ana Josane Dantas; Ferreira, Magda Rhayanny Assunção; Randau, Karina Perrelli; de Souza, Tatiane Pereira; Soares, Luiz Alberto Lira


    The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC) in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl₃ were evaluated such as herbal amount (0.25 to 1.25 g); solvent composition (ethanol 40 to 80%, v/v); as well as the reaction time and AlCl₃ concentration (2 to 9%, w/v). The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl₃ concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives), showing precision lower than 5% (for both parameters repeatability and intermediate precision), coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl₃ concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  7. Total Flavonoids Content in the Raw Material and Aqueous Extractives from Bauhinia monandra Kurz (Caesalpiniaceae

    Directory of Open Access Journals (Sweden)

    Ana Josane Dantas Fernandes


    Full Text Available The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl3 were evaluated such as herbal amount (0.25 to 1.25 g; solvent composition (ethanol 40 to 80%, v/v; as well as the reaction time and AlCl3 concentration (2 to 9%, w/v. The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl3 concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives, showing precision lower than 5% (for both parameters repeatability and intermediate precision, coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl3 concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  8. Investigation of Inonotus obliquus (Pers. Pil. Extracts and Melanins after RF-plasma Treatment of Raw Material

    Directory of Open Access Journals (Sweden)

    O.Yu. Kuznetsova


    Full Text Available High-frequency capacitive discharge (RF plasma at low pressure was used as preliminary stage for the intensification of extraction from natural medicinal raw material. RF-plasma treatment was carried out in two modes differed by the nature of plasma-forming gas. Chaga (Inonotus obliquus (Pers. Pil. known as the birch mushroom was selected as a perspective source of raw material. Extraction was carried out in two ways – remaceration and maceration. The analy-sis of chaga extracts and melanins was performed using traditional techniques including determination of physical and chemical, antioxidant and spectral characteristics. The obtained extracts and melanins were compared to the control samples and literature data. RF-plasma treatment of medicinal raw material increased the yield of extractive substances, in particular of the main active component of chaga – melanin. The antioxidant activity of chaga extracts grew, while for melanins it remained at the level similar to that of control samples. The IR spectral characteristics of the studied chaga melanins are similar and agree well with the literature data. Insignificant deviations in the position and intensity of absorption strips were observed for the samples after RF treatment. IR spectra of the studied chaga melanins are similar to those for mushroom melanins, thereby confirming the similarity in their nature. RF-plasma treatment of chaga medicinal raw materials allows to modify them partially. The structural and mechanical properties of melanins modified by RF plasma remain the same.

  9. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.


    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  10. Properties of Residue from Olive Oil Extraction as a Raw Material for Sustainable Construction Materials. Part I: Physical Properties

    Directory of Open Access Journals (Sweden)

    Almudena Díaz-García


    Full Text Available Action on climate, the environment, and the efficient use of raw materials and resources are important challenges facing our society. Against this backdrop, the construction industry must adapt to new trends and environmentally sustainable construction systems, thus requiring lines of research aimed at keeping energy consumption in new buildings as low as possible. One of the main goals of this research is to efficiently contribute to reducing the amount of residue from olive oil extraction using a two-phase method. This can be achieved by producing alternative structural materials to be used in the construction industry by means of a circular economy. The technical feasibility of adding said residue to ceramic paste was proven by analyzing the changes produced in the physical properties of the paste, which were then compared to the properties of the reference materials manufactured with clay without residue. Results obtained show that the heating value of wet pomace can contribute to the thermal needs of the sintering process, contributing 30% of energy in pieces containing 3% of said material. Likewise, adding larger amounts of wet pomace to the clay body causes a significant decrease in bulk density values.

  11. Properties of Residue from Olive Oil Extraction as a Raw Material for Sustainable Construction Materials. Part I: Physical Properties. (United States)

    Díaz-García, Almudena; Martínez-García, Carmen; Cotes-Palomino, Teresa


    Action on climate, the environment, and the efficient use of raw materials and resources are important challenges facing our society. Against this backdrop, the construction industry must adapt to new trends and environmentally sustainable construction systems, thus requiring lines of research aimed at keeping energy consumption in new buildings as low as possible. One of the main goals of this research is to efficiently contribute to reducing the amount of residue from olive oil extraction using a two-phase method. This can be achieved by producing alternative structural materials to be used in the construction industry by means of a circular economy. The technical feasibility of adding said residue to ceramic paste was proven by analyzing the changes produced in the physical properties of the paste, which were then compared to the properties of the reference materials manufactured with clay without residue. Results obtained show that the heating value of wet pomace can contribute to the thermal needs of the sintering process, contributing 30% of energy in pieces containing 3% of said material. Likewise, adding larger amounts of wet pomace to the clay body causes a significant decrease in bulk density values.

  12. Investigations on extraction separation of noble metals from secondary raw materials by means of tracer technique application

    International Nuclear Information System (INIS)

    Urban'ski, T.S.; Migdal, V.; Lada, V.


    In laboratory scale equilibrium and kinetics of the liquid extraction of gold, platinum and palladium from chloride and nitrate-chloride solutions were investigated. Experiments were done using model solutions and solutions, obtained in processing of secondary raw materials, for example: solutions in aqua regia of anode slurries after electrical refining of silver and jewelry wastes, as well as solutions after extraction of silver from nitrate mwdia. In investigations for determination of the extraction factor, the radioisotope indicators method have been used. Gold-198, platinum-197, palladium-109, silver-110 m and copper-64 were used. Radioisotope platinum-197 was refined from gold-199 on the ionite Dauex 50VX2 in the medium of hydrobromic acid. Gold was extracted by neutral extraction agents such as tributilphosphate; methylizobutylketone; amylacetate; amil alcohol; 2-ethylhexanol and dibutylcarbitol. In details extraction of palladium and platinum by tri-n-actylamine in different diluents with additions of modifiers, as well as their extraction by aliquat 336 in benzene and by some petroleum products. Influence was determined of the time of phases contact, of application of diluents, influence of extracting agents concentrations on the magnitude of extraction factor and on the separation factor for investigated metals [ru

  13. Near infrared spectroscopy based monitoring of extraction processes of raw material with the help of dynamic predictive modeling (United States)

    Wang, Haixia; Suo, Tongchuan; Wu, Xiaolin; Zhang, Yue; Wang, Chunhua; Yu, Heshui; Li, Zheng


    The control of batch-to-batch quality variations remains a challenging task for pharmaceutical industries, e.g., traditional Chinese medicine (TCM) manufacturing. One difficult problem is to produce pharmaceutical products with consistent quality from raw material of large quality variations. In this paper, an integrated methodology combining the near infrared spectroscopy (NIRS) and dynamic predictive modeling is developed for the monitoring and control of the batch extraction process of licorice. With the spectra data in hand, the initial state of the process is firstly estimated with a state-space model to construct a process monitoring strategy for the early detection of variations induced by the initial process inputs such as raw materials. Secondly, the quality property of the end product is predicted at the mid-course during the extraction process with a partial least squares (PLS) model. The batch-end-time (BET) is then adjusted accordingly to minimize the quality variations. In conclusion, our study shows that with the help of the dynamic predictive modeling, NIRS can offer the past and future information of the process, which enables more accurate monitoring and control of process performance and product quality.

  14. Development and inculcation of new methods in the field of exploring, extraction and reprocessing of uranium raw materials

    International Nuclear Information System (INIS)

    Smirnov, Yu.V.; Efimova, Z.I.; Skorovarov, D.I.; Ivanov, G.F.


    The situation is briefly overviewed in the field of exploration, prospecting, extraction and processing of uranium raw material and industrial introduction of the recently developed methods. The method of underground leaching, including that from deep-seated deposits, is gaining wide acceptance. Of high importance is the industrial introduction of such promising processes as bacterial leaching, continuous column-sorption with a pseudo-luquefied sorbent layer, direct production of UF 6 in an ore-processing factory. Active works are under way now in the field of multi-purpose utilization of uranium ore. New methods are industrially introduced for the extraction of associated uranium from phosphoric acid solutions, copper ore, sea water


    Directory of Open Access Journals (Sweden)

    I. I. Shishatskii


    Full Text Available Summary. Theoretical and experimental researches of extraction processes from plant origin raw materials: barley, acorns and chicory with liquid carbon dioxide, as well as lupin with cheese whey were carried out. Quality indicators of extracts and secondary raw materials are defined. It is established that they are perspective raw sources for the enriched and functional products as they contain amino acids, vitamins and microelements. The dairy-vegetative lupine extract, for example, contains 17 amino acids, including the essential as well as vitamins and minerals. The studies of secondary raw materials, barley, acorns, chicory and lupine quality showed the expediency of their use for foods enrichment. Quality indicators of secondary raw materials are presented in the tables form in the given work. It formed the basis for the development of hardware-technological schemes of obtaining СО2-extracts and their use. The hardware-technological scheme of obtaining СО2-extracts from barley, acorns and chicory includes a number of equipment units: motor transport for raw materials delivery to the enterprise, the scraper hydroconveyor, the jet washer, a photoseparator for of poor-quality raw materials and impurities removal, a blowing machine for removing surface moisture from the raw materials, a jet washer for peeling, a cutter, drying and frying device, a crusher, a roller machine tool and an extracting unit. Hardware providing for yoghurt technology enriched with amino acids, microelements and vitamins which are present in a dairy-plant extract differs from the mentioned above one in the following. The extract used is a cheese whey, and the extraction of a target component is carried out in a vibrating extractor. The hardwaretechnological scheme is made according to Russian technology of yoghurt and furnished with the equipment for dairy-vegetative extract feeding into a product. It includes the following: a vibrating extractor (not shown in fig

  16. Mackerel (Scomber Scrombrus Oil Extraction and Evaluation as Raw Materials for Industrial Utilization

    Directory of Open Access Journals (Sweden)

    A. A. BAWA


    Full Text Available The extraction, evaluation and refining of fish oil from mackerel (scomber scrombrus has been conducted in this work. The total percentage oil yield using solvent extraction and total moisture content was 28.24% and 56.50 %respectively, which were found to increase linearly with time. The analytical properties of the crude and the refined oil were evaluated. It was observed that the crude oil consist from: acid value 2.5 mg/KOH, peroxide value 2.19 mEq/kg, saponification value 201.6 mgKOH/g, iodine value 108.09 I2/100g, specific gravity 0.911, refractive index 1.485 and reddish brown colour. The refined oil was also evaluated as follows: acid value 2.27 mg/KOH, peroxide 1.00 meq/kg, saponification value 147.84 mgKOH/g, iodine value 106.93 I2 /100g and golden brown colour. These values fall within the acceptable standard values. The refining of the oil brought about a notable improvement in the analytical properties of the oil. Thus, leads to a high quality fish oil in terms of the taste, colour, odours, shelf life and market value. Based on the improved characteristics of the oil, it could be suitable for applications in pharmaceutical and food industries.

  17. Innovative solutions for the extraction of technology metals from complex primary and secondary raw materials

    Directory of Open Access Journals (Sweden)

    Kamberović Željko J.


    Full Text Available Presented compilation of scientific, theoretical and experimental results, promotes an innovative synergy of various metals and industrial activities in metallurgy, resulting in profitable transformation of by­products and waste materials into resources. Focusing on treatment of specific by-products from zinc and copper primary production, as well on specific waste streams like WEEE and waste automotive catalysts, group is actively contribute to the Serbia, region and EU sustainability policies. In terms of sustainable development, metallurgy is a traditional part of the solution rather than part of the problem, so it is necessary to take the chance and centuries-old tradition.

  18. Raw materials for aluminium production

    International Nuclear Information System (INIS)

    Galushkin, N.V.


    This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.

  19. Raw Materials Market of China

    Directory of Open Access Journals (Sweden)

    Dmitry Alexandrovich Izotov


    Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore

  20. Sewage sludge as a fuel and raw material for phosphorus recovery: Combined process of gasification and P extraction. (United States)

    Gorazda, K; Tarko, B; Werle, S; Wzorek, Z


    Increasing problems associated with sewage sludge disposal are observed nowadays. As the thermal conversion of sewage sludge (combustion, co-combustion, gasification and pyrolysis) appears to be the most promising alternative for its management, the solid residues left after gasification were examined. The present study evaluates the potential of this waste as an alternative phosphorus source in the context of phosphorus recovery. The obtained solid gasification residues were characterised (chemical and phase composition, thermal properties, surface properties and technological parameters used for phosphorus raw materials) and compared to commercial phosphate raw materials. It was revealed that gasification residue is a valuable source of phosphorus and microelements, comparable to sewage sludge ash (SSA) considered nowadays as secondary phosphorus raw materials. Chemical properties as well as technological parameters characteristic for natural phosphate ores are different. Solid gasification residue was leached with mineral acids (phosphoric and nitric) according to the patented method of phosphorus recovery - PolFerAsh, developed by Cracow University of Technology. It was revealed that phosphorus can be selectively leached from solid gasification residue with high efficiency (73-82%); moreover, most of the iron and heavy metals stay in the solid phase due to the low concentration of acids and proper solid to liquid phase ratio. The obtained leachates are valuable products that can be considered for the production of fertilisers. Combining the gasification process with nutrient recovery provides the opportunity for more environmentally efficient technologies driven by sustainable development rules. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Data extraction from proteomics raw data

    DEFF Research Database (Denmark)

    Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael


    In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...

  2. Topical papers on raw materials

    International Nuclear Information System (INIS)


    In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear


    Directory of Open Access Journals (Sweden)

    S. B. Evseeva


    Full Text Available In contemporary pharmaceutical practice extracts are used as a separate cosmetic product and as an intermediate for external medicinal forms (ointments, gels, liniments and cosmetic forms. Their range is highly diverse.The aim is an overview of the scientific and technical information concerning plant  raw materials extracts using in the external drug and cosmetic products.Methods. To describe the range of extracts proposed for external use the analysis of the proposals of Russian and foreign producers submitted their official websites and online trading platforms was used. The specificity of extraction of biologically active substances of plant extracting agents: water, ethyl alcohol, glycols, vegetable oils, carbon dioxide used to obtain extracts was described on the basis of available scientific literature (eLIBRARY, PubMed, Cyberleninca, Google Books. Results. Examples of external drugs and cosmetic products based on plant raw materials extracts from a range of pharmaceutical organizations are given. It was found that from the extracting solvent used the range is presented by hydrophilic, such as glycol (propylene glycol, glycerin, water, alcoholic extracts; lipophilic (oil, CO2-extracts, and two-phase (caprylic/caprate triglyceride/water extracts. The main features of the extracting solvent used for this category of extracts: the specifics of the use in cosmetics (the skin specific effect, in particular selectivity to groups of biologically active plant substances, microbiological purity, are noted. Results of research data on the study of the prospects for the use of cosmetic ingredients – silicones, caprylic/ capric triglyceride, isopropyl myristate both solvents. The extraction techniques: classical (maceration, percolation and intensified (electro-plasma dynamic extraction, vacuum extraction circulation, CO2 supercritical extraction used in industry to produce cosmetic extracts are described

  4. Method for selecting raw materials to preparing ceramic masses: application to raw material for red ceramic

    International Nuclear Information System (INIS)

    Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor


    We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)

  5. Raw material uranium; Rohstoff Uran

    Energy Technology Data Exchange (ETDEWEB)



    Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.

  6. Niobium, tantalum and titanium extraction from natural and technogenic raw materials of the Kola Peninsula by liquid-liquid extraction methods

    International Nuclear Information System (INIS)

    Kassikova, N.I.; Kassikov, A.G.; Balabanov, Yu.I.; Petrov, V.B.; Kalinnikov, V.T.


    Such rare metals as niobium and tantalum are important strategic materials underlying many of the modern advanced technologies. Since the extraction and processing of rare metal concentrates from own deposits has diminished abruptly in recent years, it is essential to look into the possibility of extracting these elements from various production wastes. This work discusses liquid-liquid extraction and purification of niobium, tantalum and titanium from process solutions of loparite, perovskite and sphene concentrate decomposition with sulphuric and hydrochloric acids; niobium from lithium niobate production wastes decomposed by hydrochloric acid; and tantalum from tantalum capacitor and heat-resistant alloy wastes. (Original)

  7. Raw materials policy: implications for Germany

    Energy Technology Data Exchange (ETDEWEB)

    Gaertner, E


    The contribution characterizes the situation of the national mining industry in 1977, deals with international raw materials policies within the framework of the North-South dialogue and with the policies of the western industrial countries, points out the dangers of worldwide state-controlled raw materials policies and calls for a) the political risk of enterprise cooperation with developing countries to be covered and b) double taxation to be avoided. Finally, the problems of securing the Federal Republic of Germany's raw materials supplies on a long-term basis are portrayed.

  8. Quality quantification model of basic raw materials

    Directory of Open Access Journals (Sweden)

    Š. Vilamová


    Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.

  9. Annual report 1997. Energies and raw materials

    International Nuclear Information System (INIS)


    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  10. Aluminium reprocessing with local mineral raw material

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.


    With the purpose of utilization of ice sediment, receiving from mud fields solutions and flotation tails and at using local aluminium and fluorine-containing raw material was elaborated fundamental technologic scheme presented in this chapter of book

  11. European initiative on cdio in raw material programmes

    NARCIS (Netherlands)

    Edelbro, Catrin; Hulthén, Erik; Clausen, Elisabeth; Tanner, David; Herrera Herbert, Juan; Jonsson, Kristina; Bealieu, Stephan; Kamp, A.; Försth, Michael


    One of five Knowledge and Innovation Communities (KICs), was launched in Europe in 2014 and has its focus on exploration, extraction, mineral processing, metallurgy, recycling and material substitution of raw materials. To reach the vision, where the European Union’s industrial strength is based on

  12. Plastic raw materials in Neolithic pottery production

    Directory of Open Access Journals (Sweden)

    Alexander A. Bobrinsky


    Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.

  13. Aromatic raw materials from coal

    Energy Technology Data Exchange (ETDEWEB)

    Collin, G


    Liquid byproducts of coal carbonization meet some 25% of the world demand for aromatic chemicals, currently at approx. 30 million t/a, in particular 15% of the demand for benzene and over 95% of the demand for condensed aromatics and heteroaromatics. Industrial processing of the aromatic byproducts of coal pressure gasification is carried out to only a minor extent. Other methods that may be employed in future to obtain carbochemical aromatic compounds are solvolysis and supercritical gas extraction, the catalytic liquid-phase hydrogenation and hydropyrolysis of coal, which also permit recovery of benzene and homologues, phenols, and condensed and partially hydrogenated aromatics, and the synthesis of aromatics using methanol as the key compound. As with the present means of obtaining aromatic chemicals from coal, the processes that may in future be applied on an industrial scale to obtain pure aromatics will only be economically feasible if linked with the manufacture of other mass products and combined with the present production of carbochemical aromatics. (In German)

  14. Ethanol is a strategic raw material

    Directory of Open Access Journals (Sweden)

    Baras Josip K.


    Full Text Available The first part of this review article considers general data about ethanol as an industrial product, its qualities and uses. It is emphasized that, if produced from biomass as a renewable raw material, its perspectives as a chemical raw material and energent are brilliant. Starchy grains, such as corn, must be used as the main raw materials for ethanol production. The production of bioethanol by the enzyme-catalyzed conversion of starch followed by (yeast fermentation, distillation is the process of choice. If used as a motor fuel, anhydrous ethanol can be directly blended with gasoline or converted into an oxygenator such as ETBE. Finally, bioethanol production in Yugoslavia and the possibilities for its further development are discussed.


    Directory of Open Access Journals (Sweden)

    Havelka Jaroslav


    Full Text Available It is the existence of the domestic base of raw materials and stable or growing markets that are a precondition for the prospectiveness industrial minerals. Traditional and non-traditional prospective nonmetal-liferous raw materials can be distinguished. The main trends in new industrial applications of industrial minerals are being stated. In the Czech Republic, the following may be ranked among the traditional prospective nonme-talliferous raw materials: kaoline, refractory clays, ceramic and expandable clays, glass and foundry sands, li-mestones, building stones, gypsum, cast basalt, bentonite, diatomite, feldspars, graphite. Alkali rocks, industrial garnets, flaky mica, wollastonite and yet unmined staurolite, minerals of the sillimanite group and others belong to the non-traditional prospective industrial minerals.

  16. Fish oil extracted from fish-fillet by-products is weakly linked to the extraction temperatures but strongly linked to the omega-3 content of the raw material

    DEFF Research Database (Denmark)

    Honold, Philipp; Nouard, Marie-Louise; Jacobsen, Charlotte


    Rainbow trout (Oncorhynchus mykiss) is the mainspecies produced in Danish fresh water farming. Therefore, a large amount of fileting by-products like heads, bones, and tails (HBT) and intestines are available and can be used to produce high quality fish oil. The main aim in this study was to inve......Rainbow trout (Oncorhynchus mykiss) is the mainspecies produced in Danish fresh water farming. Therefore, a large amount of fileting by-products like heads, bones, and tails (HBT) and intestines are available and can be used to produce high quality fish oil. The main aim in this study...... products, % free fatty acids as well as content of omega-3 PUFA. Furthermore, an experiment was carried out to elucidate the effect of extraction temperature on oil produced from raw materials with a different content of omega-3 fatty acids. For this purpose filleting by-products from conventional (low...

  17. Raw materials resources classification and characterisation for ...

    African Journals Online (AJOL)

    Raw materials resources classification and characterisation for ceramic tableware production in Nigeria. PSA Irabor. Abstract. No Abstract. Journal of Applied Science, Engineering and Technology Vol. 2(1) 2002: 48-52. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  18. Recovery of the secondary raw materials, recycling

    International Nuclear Information System (INIS)

    Chmielewska, E.


    In this chapter the recovery and recycling of secondary raw materials is explained. This chapter consists of the following parts: Paper and tetrapaks; Car wrecks; Scrap metal; Plastics; Used tires; Electrical and electronic equipment; Glass; Accumulators and batteries; Spent oil; Low-and non-waste technology.

  19. Raw material studies of West Central Serbia

    Directory of Open Access Journals (Sweden)

    Vera Bogosavljević Petrović


    Full Text Available This paper deals with raw material problems in the territory of West Central Serbia geologically determined as the Čačak-Kraljevo (or West Morava basin. Our research is presented through the most striking case studies, Lojanik, Vlaška Glava and Lazac.  The Lojanik hill is a silicified forest by origin. It has occasionally been in use from the earliest periods of prehistory until today as a source of black and ochre-coloured flint, opal and silicified wood. A detailed prospection, including the mapping of surface finds using square nets, was conducted during two research campaigns.The Vlaška Glava is an open-air Palaeolithic site at which artefacts made of white, ochre, red, brown and black chert, silicified magnesite, volcanic and metamorphic rocks were found. Our research of primary and secondary geological deposits in the vicinity of the site showed equivalent raw material. We also found an interesting primary deposit of high quality bluish grey flint with outcrop activities (Workshop 1.The Lazac shaft is a contemporary magnesite mine, recently abandoned because of the high percentage of silicon-dioxide. We determined the same raw material in collections found at nearby Neolithic sites. Certain similarities between the wooden support systems of ore exploration in the Middle Ages and modern times were established at the entrance of the shaft.Our research in the territory of the West Morava basin resulted in reconstruction of some links between geological deposits and settlements and also creation of a relevant base for future raw material studies.

  20. Globalization determinants of raw materials markets development

    Directory of Open Access Journals (Sweden)

    Olga Yatsenko


    Full Text Available The determinants of development of raw materials markets and the peculiarities of their formation in the terms of world economy globalization have been researched. The empirical base of research is the agricultural food market as one of the most important bases in the sphere of material production and provision of food security of the country. The important social and economic mission of the agricultural sector has been highlighted, along with the export competitiveness and import dependence of agricultural food products in the international trade. The imperative norms have been substantiated and conclusions have been drawn regarding the establishment of respective conditions for the operation of globally integrated markets in Ukraine.

  1. Raw materials for reflector graphite (for reactors)

    International Nuclear Information System (INIS)

    Wilhelmi, G.; Mindermann, D.


    The manufacturing concept for the core components of German high temperature reactor (HTR) types of graphite was previously entirely directed to the use of German tar coke (St coke). As the plants for producing this material no longer complied technically with the current environmental protection requirements, one had to assume that they would soon be shut down. To prevent bottlenecks in the erection of future HTR plants, alternative cokes produced by modern processes by Japanese manufacturers were checked for their suitability for the manufacture of reactor graphite. This report describes the investigations carried out on these materials from the safe delayed coking process. The project work, apart from analysis of the main data of the candidate coke considered, included the processing of the raw materials into directly and secondarily extruded graphite rods on the laboratory scale, including characterisation. As the results show, the material data achieved with the previous raw material can be reproduced with Japanese St coke. The tar coke LPC-A from the Nippon Steel Chemical Co., Ltd was decided on as the new standard coke for manufacturing reflector graphite. (orig.) With 15 tabs., 2 figs [de

  2. Strategic raw materials. Risk management; Strategische Rohstoffe. Risikovorsorge

    Energy Technology Data Exchange (ETDEWEB)

    Bertau, Martin [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Technische Chemie; Gutzmer, Jens [Helmholtz-Institut fuer Ressourcentechnologie Freiberg (Germany); Matschullat, Joerg (ed.) [Technische Univ. Bergakademie Freiberg (Germany). Interdisziplinaeres Oekologisches Zentrum (IOeZ); Kausch, Peter


    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [German] Dieser Band gliedert sich in vier Kapitel: (1) Rohstoffwirtschaft, (2) Primaere Rohstoffe, (3) Sekundaere Rohstoffe und Recycling,(4). Verarbeitung und Produkte. Die Themen zum Kapitel ''Rohstoffwirtschaft'' sind: Substitution von Rohstoffen - Rahmenbedingungen und Umsetzung; Thales: Strategische Rohstoffe; Zeit fuer

  3. Raw materials for pellets; Rohstoffe fuer Pellets

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, H.


    In order to keep the pellet prices stable, producers look for new raw materials. Sawdust as a former basis also competes with the manufacturers of chip boards and paper. Three classes of quality are discussed by the pellet manufacturers: (a) the DINplus pellet as a premium segment for which high-quality sawdust are used; (b) a wood pellet from natural wood with varying quality for the utilization in larger plants with filters; (c) the inexpensive industrial wood pellet which deviates from the DINplus commodity regarding to the ingredients and form and could be fired in larger power stations.

  4. Energies and raw materials. Letter n.28

    International Nuclear Information System (INIS)


    This letter of the DGEMP (General Direction of the Energy and the Raw Materials) deals with the following four main topics: the main recommendations of the final report of the working Group ''Factor 4'' concerning the energy policy; the energy conservation certificates as a tool of the energy control with their implication in the residential and ternary sector; the increase of the solar water heaters and heat pumps sales thanks to the tax credits; the California example facing the climatic change and the energy policy. (A.L.B.)

  5. Raw material selection for object construction

    CSIR Research Space (South Africa)

    Perlow, J


    Full Text Available on their visual appearance. In particular, we present a method for an agent to recognise the required unseen raw material images and link them to corresponding novel object images. This capability provides an agent with an increased degree of resourcefulness... construction from component parts, and in doing so we provide a benchmark for future work to compare against within Minecraft and ShapeNet domains. II. BACKGROUND Our model is inspired by Siamese neural networks, a class of neural network that includes multiple...

  6. Raw materials for advanced ceramics: rare earths separation processes

    International Nuclear Information System (INIS)

    Ricci, D.R.; Nobre, J.S.M.; Paschoal, J.O.A.


    The importance of obtaining purified rare earths oxidesis related, mainly to the increasing use of these compounds as raw materials for advanced ceramics. Processes of rare earths separation and purification are almost always based on the solvent extraction, fractional precipitation and ion exchange chromatography techniques, whose association depends on the initial concentrate and on the desired purity. This paper describes some steps of fractionation of didymium carbonate by using the solvent extraction and fractional precipitation techniques. The experimental conditions presented here have enable the production of lantanium, neodimium - praseodimium, samarium - gadolinium and ytrium concentrates, which constitute the intermediate fractions of the overall process to obtain high purity rare earths. (author) [pt

  7. Agaves as a raw material: recent technologies and applications. (United States)

    Narváez-Zapata, J A; Sánchez-Teyer, L F


    Agave plants are a valuable source of raw material due to its fibrous and complex sugar content of their leaves and core, and their bagasse waste can be use for several aims. This plant genus belongs to the Agavaceae family and until now more than 200 species have been described. A large number of Agave species are currently used as raw material in several biotechnological processes. This review shows the reported applications and patents on fields like alcoholic brewages with special reference to Tequila and Mezcal, the isolation and use of compounds such as saponins and agave fructans, and their potential biotechnological application on several human demands. The process to obtain fibers and cellulose, stock feeds, and several miscellaneous extractives are also reviewed. Some possibilities and problems of cultivation are discussed.

  8. Energies and raw materials. The energy situation

    International Nuclear Information System (INIS)


    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996

  9. Energies and raw materials. The energy situation

    International Nuclear Information System (INIS)


    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996

  10. Uranium in phosphorus-bearing raw materials and technological problems of its recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gorecki, H; Gorecka, H [Politechnika Wroclawska (Poland)


    A problem of uranium recovery from phosphorus-bearinq raw materials is discussed. The different methods of uranium recovery from extractive phosphoric acid are briefly described. The information on their applications in the industry is also given.

  11. Caffeine Extraction from Raw and Roasted Coffee Beans. (United States)

    Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh


    Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.

  12. New raw materials improve packing sealing efficiency

    International Nuclear Information System (INIS)

    Igel, B.; McKeague, L.


    End-users and OEM's using or manufacturing on/off and control valves expect a permanent and effective increase in service life together with an increased sealing capability while at the same time minimizing maintenance concerns. Developing materials which provide consistency and repeatability are essential characteristics to optimizing valve performance. “New Generation” materials and yarn allow us to meet this growing demand while complying with the requirements related to chemical purity and an increased level of safety to both plant workers and equipment in the nuclear environment. Through R&D initiatives and developments in new and improved raw materials; a new mechanical packing generation which optimizes friction coefficients and extended life cycle has been introduced to the industry. Lower friction values drastically optimize actuator effort and size improving efficiency for stem operation with significant improvements in flow control of fluids. Combined with new and improved procedures (installation, torque levels and consolidation recommendations), this new packing generation has provided significant improvement in the mechanical behavior of packing materials (independent tests carried out in collaboration with AECL and CETIM) this has provided the opportunity to develop successful Valve Enhancement Programs which offer improved efficiency, valve operation and repeatability. These NEW generation yarns are available with or without wire reinforcement depending on specific operating parameters and conditions. The purpose of this presentation is to demonstrate that new generation material(s). Which are available to the industry for AOV, MOV and Manual valves? - To highlight the steps taken in R&D and manufacturing contributing to the much improved yarns and finished packing products. - Comply and are designed to meet the stringent requirements in the nuclear industry - Simplify valve maintenance without risk to safety or performance - Increase service

  13. Aerospace Fuels From Nonpetroleum Raw Materials (United States)

    Palaszewski, Bryan A.; Hepp, Aloysius F.; Kulis, Michael J.; Jaworske, Donald A.


    Recycling human metabolic and plastic wastes minimizes cost and increases efficiency by reducing the need to transport consumables and return trash, respectively, from orbit to support a space station crew. If the much larger costs of transporting consumables to the Moon and beyond are taken into account, developing waste recycling technologies becomes imperative and possibly mission enabling. Reduction of terrestrial waste streams while producing energy and/or valuable raw materials is an opportunity being realized by a new generation of visionary entrepreneurs; several relevant technologies are briefly compared, contrasted and assessed for space applications. A two-step approach to nonpetroleum raw materials utilization is presented; the first step involves production of supply or producer gas. This is akin to synthesis gas containing carbon oxides, hydrogen, and simple hydrocarbons. The second step involves production of fuel via the Sabatier process, a methanation reaction, or another gas-to-liquid technology, typically Fischer-Tropsch processing. Optimization to enhance the fraction of product stream relevant to transportation fuels via catalytic (process) development at NASA Glenn Research Center is described. Energy utilization is a concern for production of fuels whether for operation on the lunar or Martian surface, or beyond. The term green relates to not only mitigating excess carbon release but also to the efficiency of energy usage. For space, energy usage can be an essential concern. Another issue of great concern is minimizing impurities in the product stream(s), especially those that are potential health risks and/or could degrade operations through catalyst poisoning or equipment damage; technologies being developed to remove heteroatom impurities are discussed. Alternative technologies to utilize waste fluids, such as a propulsion option called the resistojet, are discussed. The resistojet is an electric propulsion technology with a powered

  14. Uranium as Raw Material for Nuclear Energy

    International Nuclear Information System (INIS)

    Lelek, V.


    There is lot of information bringing our attention to the problem of limited raw material resources. Fortunately uranium for nuclear energy is very concentrated source and that is why its transport brings no problems and could be realized from anywhere. Second question is if overall resources are available for current nuclear energy development. Data documenting reasons for nowadays price growth are presenting and it is clearly shown that the most probable explanation is that there is gap in new uranium mines preparation and the lot of smaller mines were closed in the period of low uranium prices. Conclusion is that there is at least for the first half of this century even for thermal reactors enough uranium. Situation could be changed if there will massive production of liquid fuel using hydrogen, produced through nuclear heating. Public information about former military uranium resources are also included. Contemporary about one half of US nuclear power-stations is using high enriched uranium diluted with natural uranium - it is expected to continue this way up to 2012. Uranium is complicated market (Authors)

  15. Dates as raw material for agricultural distilleries

    Energy Technology Data Exchange (ETDEWEB)

    Laczynski, B


    Pit-containing dates had 88.0 to 89.2% dry matter, 41.7 to 47.5% sucrose, and 2.1 to 2.9% total protein. The mechanical broken charges of raw material were steamed, dispersed to a suspension of 15 to 17/sup 0/ Balling and pH 4.8 to 5.0, enriched with P and N, inoculated with 5 to 7 % of yeast suspension, and acidified to pH > 3.5. Thermophilic yeast cultivated at 27/sup 0/ and fermented below 30/sup 0/ for 2 days gave best results. The fermented liquor had a pH > 3.5, apparent density of 2.0/sup 0/, and contained 7.5 to 9.0 EtOH. From 100 kg dates were obtained 280 t0 340 l of the 15 to 17/sup 0/ dispersion and 320 to 360 l residue containing (per l) 6.0 to 8.5 g protein and 0.04 oat units. EtOH yield (l/quintal) was 914 for potatoes, 28.54 for molasses, 36.29 for cereals, 25.15 for dates, and 18.53 for malt.

  16. Map of critical raw material deposits in Europe (United States)

    Guillaume, Bertrand


    common interoperable EU Geological Knowledge Base. Such a Knowledge Base will support exploration for indigenous mineral resources and strengthen policy and decision making. In 2010, the European Commission identified 14 non energy non-agricultural raw materials as being critical. Criticality is based on both the scarcity of supply and the importance to European industry. This list was updated in 2014 to include 7 new commodities with one being dropped from the original list. The list now comprises: antimony, beryllium, borates, chromium, cobalt, coking coal, fluorspar, gallium, germanium, graphite, indium, magnesite, magnesium, niobium, phosphate rock, platinum group metals, light and heavy rare earth elements (separately), silicon metal and tungsten. ProMine was a European Union (EU) co-funded project, which had as its main objective the stimulation of the extractive industry to deliver new products to manufacturing industry. A major deliverable of the project was the ProMine Mineral Deposit (MD) database that contains information related to almost 13,000 mineral deposits in Europe. In order to extract data to be displayed on the CRM map of Europe, the ProMine MD database was queried for all commodities on the EC CRM list which were in the medium to super-large deposit size. Following this, the dataset was circulated to MREG in order to verify, validate and update the list.

  17. High belite cement from alternative raw materials

    Directory of Open Access Journals (Sweden)

    Ghorab, H. Y.


    Full Text Available Three high belite laboratory clinkers were prepared from traditional and alternative raw materials. Reference clinker was obtained from 77% limestone, 11% sandy clays, 11% fatty clays and 1% iron scales. The fatty clays were replaced by red brick powder in the raw meal of the second clinker and were lowered to 2% with the replacement of 10% of the limestone by egg shells in the third clinker. The SEM examination revealed clear presence of crossed striae and twinning in the rounded belite grains of the reference clinker caused by the transformation of the α´-belite to the β polymorph. Striae were weaker in the second and third clinkers indicating a probable stabilization of the α ‘-belite polymorph. Compressive strength of the respective cements were attained first after 28 days and the early strength did not improve with increasing fineness. Higher compressive strength values were found for the cement prepared from second clinker.Se han preparado tres clinkeres de laboratorio con altos contenidos en belita a partir de materias primas tradicionales y alternativas. El clinker de referencia se obtuvo a partir de una mezcla de caliza, arcillas arenosas y grasas y limaduras de hierro. Las arcillas grasas fueron sustituidas por polvo de ladrillo rojo en la preparación del segundo clinker, y en el tercero el contenido de arcilla grasa fue de solo un 2% y parte de la caliza fue sustituida por cascara de huevo. El estudio realizado por SEM muestra superficies estriadas alrededor de los granos de belita que indican una transformación del polimorfo α´ a la forma β-C₂S, durante el enfriamiento. Esas estrías son menos marcadas en el segundo y tercer clinker, indicando, una estabilización del polimorfo α´-C₂S. Los valores de resistencias a compresión de los correspondientes cementos, a 28 días de curado, no se ven incrementados por la finura de dichos cementos. Las mayores resistencias se obtuvieron en el cemento preparado a partir del cl

  18. Thorium and Uranium in the Rock Raw Materials Used For the Production of Building Materials (United States)

    Pękala, Agnieszka


    Thorium and uranium are constant components of all soils and most minerals thereby rock raw materials. They belong to the particularly dangerous elements because of their natural radioactivity. Evaluation of the content of the radioactive elements in the rock raw materials seems to be necessary in the early stage of the raw material evaluation. The rock formations operated from deposits often are accumulated in landfills and slag heaps where the concentration of the radioactive elements can be many times higher than under natural conditions. In addition, this phenomenon may refer to buildings where rock raw materials are often the main components of the construction materials. The global control system of construction products draws particular attention to the elimination of used construction products containing excessive quantities of the natural radioactive elements. In the presented study were determined the content of thorium and uranium in rock raw materials coming from the Bełachatów lignite deposit. The Bełchatów lignite deposit extracts mainly lignite and secondary numerous accompanying minerals with the raw material importance. In the course of the field works within the framework of the carried out work has been tested 92 samples of rocks of varied petrographic composition. There were carried out analyses of the content of the radioactive elements for 50 samples of limestone of the Jurassic age, 18 samples of kaolinite clays, and 24 samples of siliceous raw materials, represented by opoka-rocks, diatomites, gaizes and clastic rocks. The measurement of content of the natural radioactive elements thorium and uranium based on measuring the frequency counts of gamma quantum, recorded separately in measuring channels. At the same time performed measurements on volume patterns radioactive: thorium and uranium. The studies were carried out in Mazar spectrometer on the powdered material. Standardly performed ten measuring cycles, after which were calculated

  19. Environmental analysis of raw cork extraction in cork oak forests in southern Europe (Catalonia--Spain). (United States)

    Rives, Jesús; Fernandez-Rodriguez, Ivan; Rieradevall, Joan; Gabarrell, Xavier


    Cork oak grows endemically in a narrow region bordering the western Mediterranean, and especially in the Iberian Peninsula. The importance of cork agro-forestry systems lies in the fact that a natural and renewable raw material - cork - can be extracted sustainably without endangering the tree or affecting biodiversity. This paper describes an environmental analysis of the extraction of raw cork in cork oak forests in Catalonia, using data from five representative local forest exploitations. The evaluation was carried out using life cycle assessment (LCA) methodology, and all the forestry management required to obtain a tonne of raw cork was included. The aim of the study was to evaluate the environmental impacts - in terms of global warming, acidification, eutrophication, human toxicity, and so on - caused by cork extraction and determine the carbon dioxide balance of these forestry systems, with a tree lifespan of about 200 years. During the life cycle extraction of cork in Catalonia, 0.2 kg of CO(2) eq. was emitted per kg of raw cork extracted. Moreover, cork cannot be extracted without the tree, which will be fixing carbon dioxide throughout its technological useful life (200 years), despite the fact that the bark is removed periodically: every 13-14 years. If the emission from extraction and the carbon contained in the material is discounted, the carbon dioxide balance indicates that 18 kg of CO(2) are fixed per kg of raw cork extracted. Therefore, cork is a natural, renewable and local material that can replace other non-renewable materials, at local level, to reduce the environmental impacts of products, and particularly to reduce their carbon footprint. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Scoping Future Policy Dynamics in Raw Materials Through Scenarios Testing (United States)

    Correia, Vitor; Keane, Christopher; Sturm, Flavius; Schimpf, Sven; Bodo, Balazs


    The International Raw Materials Observatory (INTRAW) project is working towards a sustainable future for the European Union in access to raw materials, from an availability, economical, and environmental framework. One of the major exercises for the INTRAW project is the evaluation of potential future scenarios for 2050 to frame economic, research, and environmental policy towards a sustainable raw materials supply. The INTRAW consortium developed three possible future scenarios that encompass defined regimes of political, economic, and technological norms. The first scenario, "Unlimited Trade," reflects a world in which free trade continues to dominate the global political and economic environment, with expectations of a growing demand for raw materials from widely distributed global growth. The "National Walls" scenario reflects a world where nationalism and economic protectionism begins to dominate, leading to stagnating economic growth and uneven dynamics in raw materials supply and demand. The final scenario, "Sustainability Alliance," examines the dynamics of a global political and economic climate that is focused on environmental and economic sustainability, leading towards increasingly towards a circular raw materials economy. These scenarios were reviewed, tested, and provided simulations of impacts with members of the Consortium and a panel of global experts on international raw materials issues which led to expected end conditions for 2050. Given the current uncertainty in global politics, these scenarios are informative to identifying likely opportunities and crises. The details of these simulations and expected responses to the research demand, technology investments, and economic components of raw materials system will be discussed.

  1. Determination Of Work Indexes Of Basic Ceramic Raw Materials


    İPEK, Halil; UÇBAŞ, Yaşar


    In this study, the grindability of basic ceramic raw materials have been investigated by using Bond grindability test and the results have been compared. Bond grindability test results show that work indexes of raw materials are dependent on their hardnesses.

  2. 7 CFR 58.332 - Segregation of raw material. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Segregation of raw material. 58.332 Section 58.332... Specifications for Dairy Plants Approved for USDA Inspection and Grading Service 1 Operations and Operating Procedures § 58.332 Segregation of raw material. The milk and cream received at the dairy plant shall meet...

  3. Raw material supply: challenge and chance for economy and state

    Energy Technology Data Exchange (ETDEWEB)

    Casper, W


    The imprint left by the 1973 oil embargo makes all nations aware of their dependence upon this and other raw materials. The author says the brunt of the embargo has dealt a heavier blow than has been realized on industrial nations and developing countries alike. The drastic decline of raw material prices has had threatening consequences for a number of raw-material-producing developing countries, making some nations unite for the purpose of market regulation. The cartel-like union of copper-producing countries is cited; producers of bauxite, iron ore, and tungsten have united; and some producers of tin have united. So far, the attempt to apply the oil strategy to other raw materials has not achieved the desired results; however, raw materials are no longer just a phase of the industrial process but have become a political matter of prime importance. (MCW)

  4. Material Classification Using Raw Time-of-Flight Measurements

    KAUST Repository

    Su, Shuochen; Heide, Felix; Swanson, Robin J.; Klein, Jonathan; Callenberg, Clara; Hullin, Matthias; Heidrich, Wolfgang


    We propose a material classification method using raw time-of-flight (ToF) measurements. ToF cameras capture the correlation between a reference signal and the temporal response of material to incident illumination. Such measurements encode unique

  5. Cellulosic pulps of cereal straws as raw material for the manufacture of ecological packaging


    Vargas González, Fátima; González, Zoilo; Sánchez, Rafael; Jiménez, Luis; Rodríguez Pascual, Alejandro


    The aim of this work was to study the potential application of four types of cereal straws: oats, maize, rapeseed, and barley, in order to obtain cellulose pulp through the Specel® process for use in the manufacture of 100% biodegradable and ecological packaging. Raw materials were chemically characterized to determine alcohol-extractives, ash, lignin, holocellulose, and α-cellulose. Cellulosic pulps obtained from raw materials were characterized to determine yield, Kappa number, and viscosit...

  6. Sulfur Release from Cement Raw Materials during Solid Fuel Combustion

    DEFF Research Database (Denmark)

    Nielsen, Anders Rooma; Larsen, Morten B.; Glarborg, Peter


    During combustion of solid fuels in the material inlet end of cement rotary kilns, local reducing conditions can occur and cause decomposition of sulfates from cement raw materials. Decomposition of sulfates is problematic because it increases the gas-phase SO2 concentration, which may cause...... deposit formation in the kiln system. SO2 release from cement raw materials during combustion of solid fuels has been studied experimentally in a high temperature rotary drum. The fuels were tire rubber, pine wood, petcoke, sewage sludge, and polypropylene. The SO2 release from the raw materials...

  7. Investigation on pyrolysis of some organic raw materials

    Directory of Open Access Journals (Sweden)

    Purevsuren B


    Full Text Available We have been working on pyrolysis of some organic raw materials including different rank coals, oil shale, wood waste, animal bone, cedar shell, polypropylene waste, milk casein and characterization of obtained hard residue, tar and pyrolytic water and gas after pyrolysis. The technical characteristics of these organic raw materials have been determined and the thermal stability characteristics such as thermal stability indices (T5% and T25% determined by using thermogravimetric analysis. The pyrolysis experiments were performed at different heating temperatures and the yields of hard residue, tar, pyrolysis water and gaseous products were determined and discussed. The main technical characteristics of hard residue of organic raw materials after pyrolysis have been determined and the adsorption ability of pyrolysis hard residue and its activated carbon of organic raw materials also determined. The pyrolysis tars of organic raw materials were distilled in air condition and determined the yields of obtained light, middle and heavy fractions and bitumen like residue with different boiling temperature. This is the first time to investigate the curing ability of pyrolysis tars of organic raw materials for epoxy resin and the results of these experiments showed that only tar of milk casein has the highest (95.0%, tar of animal bone has certain (18.70% and tars of all other organic raw materials have no curing ability for epoxy resin.

  8. Irradiation as an alternative environmentally friendly method for microbiological decontamination of herbal raw material

    International Nuclear Information System (INIS)

    Dragusin, M.; Rotaru, R.


    Microbiological contamination of herbal raw materials is a serious problem in the production of therapeutical preparations. A good quality of the product, according to the pharmaceutical requirements may be achieved by applying suitable methods of decontamination. The decontamination treatments should be fast and effective against all microorganisms. It should ensure the decontamination of both packaging and the microorganisms present and must not reduce the sensory and technological qualities of the commodities. Decontamination of herbal raw materials by irradiation is a method by choice. It is because chemical methods are recognized recently as not safe to the consumer. Irradiation, in turn, is technically feasible, very effective and friendly enough to environment process. Under the prevailing production and handling conditions, most herbs contain a large number of microorganisms what is a serious problem in the production of therapeutical preparations. For several years the most widely used methods for decontamination of herbs was fumigation with ethylene oxide or methyl bromide. Both methods today banned in most countries. Irradiation is an alternative and safe method for effective reducing the microbial contamination of herbal raw materials. The following raw materials have been examined: Folium Cynara, Folium Plantago, Flos Chamomillae, Semen Sylibum Marianum and Folium Farfara. The content of biologically active compounds before and after irradiation of the raw materials did not change in a significant degree after irradiation. The dose of radiation for herbals raw materials was 10 kGy. There are two groups of raw materials: - The raw materials designed for preparing granulates, tablets, dragees, capsules, aqueous extracts, infusions, macerations and preparations for external use; - The raw materials assigned for preparing alcoholic preparations, isolated compounds, oil preparations and essential oils. The medical herbs and herbal raw materials before their

  9. VERAM - Vision and Roadmap for European Raw Materials (United States)

    Baumgarten, Wibke; Vashev, Boris


    The overall objective of VERAM project is to produce a Vision and Roadmap for European Raw Materials in 2050 based on raw materials research and innovation (R&I) coordination. Two leading European Technology Platforms (ETPs): ETP SMR (Sustainable Minerals Resources) and FTP (Forest Technology Platform) are joining forces to develop a common vison and roadmap with the support of ECTP (European Construction Technology Platform), represented by UNIVPM, SusChem (ETP for Sustainable Chemistry), represented by Cefic, EuMaT (Advanced Materials ETP), represented by VITO, ERAMIN 2, represented by Research Centre JUELICH and WoodWisdom Network Plus represented by the Agency for Renewable Resources (FNR). This partnership provides VERAM with expertise from downstream applications and additional knowledge on non-biotic and biotic raw materials. The project encourages capacity building as well as transfer of knowledge. It expects to provide an innovation reference point for the European Institute of Innovation & Technology (EIT) Raw Materials (formerly the KIC Raw MatTERS), to coordinate the network involved in the European Innovation Partnership (EIP) on Raw Materials Commitments and relevant proposals funded under Horizon 2020. It provides a platform for identifying gaps and complementarities and enables their bridging. VERAM will be able to advise the European Commission and Member States on future research needs and policies to stimulate innovation and assist in overcoming fragmentation in the implementing the EIP Raw Materials Strategic Implementation Plan. VERAM looks for mutually beneficial information exchange, encourages cross-fertilization between actions undertaken by different raw material industries, and expects to accelerate exploitation of breakthrough innovations. One of the main outcomes of the project is the presentation of a common long term 2050 Vision and Roadmap for relevant raw materials including metals, industrial minerals and aggregates and wood. The

  10. Basic Thermal Parameters of Selected Foods and Food Raw Materials


    Monika Božiková; Ľubomír Híreš; Michal Valach; Martin Malínek; Jan Mareček


    In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of ...

  11. Raw materials for the energy supply of the future. Geology, markets, environmental influences

    International Nuclear Information System (INIS)

    Hagelueken, Christian; Thauer, Rudolf K.; Buchholz, Peter; Gutzmer, Jens; Littke, Ralf; Angerer, Gerhard; Wellmer, Friedrich-Wilhelm


    More and more metals are needed to expand modern energy technologies, but we can not completely dispense with fossil raw materials and biomass in the near future either. Are the incidence of the conversion of energy sources sufficient? The analysis of the academy project ''Energy Systems of the Future'' (ESYS) comes to the conclusion that geologically enough raw materials are available. The challenge, however, is to make the supply safe, affordable and environmentally and socially compatible. The analysis explains the mechanisms of action on the global commodity markets and identifies supply risks. These include, for example, sudden demand on the international markets as well as the unequal distribution of the world's raw material reserves. This is followed by the analysis approaches, in order to recognize warning signals for potential raw material bottlenecks in time, to develop evasive strategies and to secure the raw material supply for the energy turnarounds. For example, the expansion of recycling can help to reduce the dependence on metal imports. In mining, on the other hand, innovative technologies have to be developed in order to improve the exploration and utilization of the deposits. By establishing binding environmental and social standards, the extraction of raw materials could also become more sustainable. The analysis also highlights the importance of bioenergy and fossil raw materials, such as oil and natural gas, for energy generation. The authors describe the advantages and disadvantages of these energy carriers and the measures that can be used to reduce environmental pollution such as greenhouse gas emissions. [de

  12. Tracing and control of raw materials sourcing for vaccine manufacturers. (United States)

    Faretra Peysson, Laurence


    The control of the raw materials used to manufacture vaccines is mandatory; therefore, a very clear process must be in place to guarantee that raw materials are traced. Those who make products or supplies used in vaccine manufacture (suppliers of culture media, diagnostic tests, etc.) must apply quality systems proving that they adhere to certain standards. ISO certification, Good Manufacturing Practices for production sites and the registration of culture media with a 'Certificate of Suitability' from the European Directorate for the Quality of Medicines and Healthcare are reliable quality systems pertaining to vaccine production. Suppliers must assure that each lot of raw materials used in a product that will be used in vaccine manufacture adheres to the level of safety and traceability required. Incoming materials must be controlled in a single 'Enterprise Resource Planning' system which is used to document important information, such as the assignment of lot number, expiration date, etc. Ingredients for culture media in particular must conform to certain specifications. The specifications that need to be checked vary according to the ingredient, based on the level of risk. The way a raw material is produced is also important, and any aspect relative to cross-contamination, such as the sanitary measures used in producing and storing the raw material must be checked as well. In addition, suppliers can reduce the risk of viral contamination of raw materials by avoiding purchases in countries where a relevant outbreak is currently declared. 2010 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.

  13. Glucose from a cellulose-containing raw material

    Energy Technology Data Exchange (ETDEWEB)

    Feniksova, R V


    Glucose was produced by mixing the raw material with an enzyme and water, enzymic hydrolysis of raw material, and separation of the hydrolyzate. To increase the yield of glucose, the hydrolysis took place in 2 stages: at the 1st stage, the hydrolysis was continued until the mixture of glucose and oligosaccharides was obtained under the influence of an active enzyme (1 to 20 units/g of cellulose present in the raw material); at the 2nd stage, cellulase immobilized on an insoluble carrier (by covalent bonds) was used for the hydrolysis of oligosaccharides. The hydromodulus of the suspension of cellulose-containing raw material was maintained 5 to 30. A carrier nonhydrolyzable by cellulase, for instance a homogenious macroporous Aerosil gel, a porous glass, or porous ceramics, was used.


    Directory of Open Access Journals (Sweden)

    O. E. Khodyreva


    Full Text Available Dairy products are the product of daily demand. Nowadays actively assimilate new types of raw materials, tech-nology, formulation. One of the propagation methods of enriching dairy products is a combination of milk and vegetable raw materials. The possibility of making a concentrated paste of Jerusalem artichoke in dairy products was investigated. The ice cream sundae "Vanilla" was chosen as the object of research.

  15. Occurrence of 1,4-dioxane in cosmetic raw materials and finished cosmetic products. (United States)

    Black, R E; Hurley, F J; Havery, D C


    Surveys of cosmetic raw materials and finished products for the presence of the carcinogen 1,4-dioxane have been conducted by the U.S. Food and Drug Administration since 1979. Analytical methods are described for the determination of 1,4-dioxane in ethoxylated cosmetic raw materials and cosmetic finished products. 1,4-Dioxane was isolated by azeotropic atmospheric distillation and determined by gas chromatography using n-butanol as an internal standard. A solid-phase extraction procedure based on a previously published method for the determination of 1,4-dioxane in cosmetic finished products was also used. 1,4-Dioxane was found in ethoxylated raw materials at levels up to 1410 ppm, and at levels up to 279 ppm in cosmetic finished products. Levels of 1,4-dioxane in excess of 85 ppm in children's shampoos indicate that continued monitoring of raw materials and finished products is warranted.

  16. Refining of raw materials, lignite present economic problems

    Energy Technology Data Exchange (ETDEWEB)

    Schirmer, G.


    East Germany seeks an economic intensification program that involves refining raw materials to a higher level. Lignite briquetting prior to liquefaction and gasification illustrates both the theoretical and practical aspects of that goal and also introduces questions of secure supplies. The author describes the special labor processes, use of technology, recycling of waste materials, and other new problems that the approach entails as the refined raw materials become new materials or energy sources. Economics based on the value of the refined product and the cost of the materials determine the degree of refinement. The concept also involves the relationship of producer and user as profits increase.

  17. Raw materials for energy generation in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Robertson, D S


    Canada is self-sufficient in energy. The energy demand in Canada up to the end of the century is predicted, and the present and future of the oil, gas, coal and uranium industries are considered. Since it is now Canadian policy to restrict export of energy sources, in the future Canada will probably make more domestic use of its coal reserves. An increase is forecast in the use of coal for electricity generation and as a feedstock for synthetic gas. A long lead time and large capital expenditure will be needed before coal can be transported from western Canada to markets in the east of the country. A relatively small amount of the coal reserves are extractable by surface mining, and new underground mining techniques will be needed to extract the extremely friable coal from the deformed seams in the mountains.

  18. Raw material ‘criticality’—sense or nonsense?

    International Nuclear Information System (INIS)

    Frenzel, M; Kullik, J; Reuter, M A; Gutzmer, J


    The past decade has seen a resurgence of interest in the supply security of mineral raw materials. A key to the current debate is the concept of ‘criticality’. The present article reviews the criticality concept, as well as the methodologies used in its assessment, including a critical evaluation of their validity in view of classical risk theory. Furthermore, it discusses a number of risks present in global raw materials markets that are not captured by most criticality assessments. Proposed measures for the alleviation of these risks are also presented. We find that current assessments of raw material criticality are fundamentally flawed in several ways. This is mostly due to a lack of adherence to risk theory, and highly limits their applicability. Many of the raw materials generally identified as critical are probably not critical. Still, the flaws of current assessments do not mean that the general issue of supply security can simply be ignored. Rather, it implies that new assessments are required. While the basic theoretical framework for such assessments is outlined in this review, detailed method development will require a major collaborative effort between different disciplines along the raw materials value chain. In the opinion of the authors, the greatest longer-term challenge in the raw materials sector is to stop, or counteract the effects of, the escalation of unit energy costs of production. This issue is particularly pressing due to its close link with the renewable energy transition, requiring more metal and mineral raw materials per unit energy produced. The solution to this problem will require coordinated policy action, as well as the collaboration of scientists from many different fields—with physics, as well as the materials and earth sciences in the lead. (topical review)

  19. Raw material ‘criticality’—sense or nonsense? (United States)

    Frenzel, M.; Kullik, J.; Reuter, M. A.; Gutzmer, J.


    The past decade has seen a resurgence of interest in the supply security of mineral raw materials. A key to the current debate is the concept of ‘criticality’. The present article reviews the criticality concept, as well as the methodologies used in its assessment, including a critical evaluation of their validity in view of classical risk theory. Furthermore, it discusses a number of risks present in global raw materials markets that are not captured by most criticality assessments. Proposed measures for the alleviation of these risks are also presented. We find that current assessments of raw material criticality are fundamentally flawed in several ways. This is mostly due to a lack of adherence to risk theory, and highly limits their applicability. Many of the raw materials generally identified as critical are probably not critical. Still, the flaws of current assessments do not mean that the general issue of supply security can simply be ignored. Rather, it implies that new assessments are required. While the basic theoretical framework for such assessments is outlined in this review, detailed method development will require a major collaborative effort between different disciplines along the raw materials value chain. In the opinion of the authors, the greatest longer-term challenge in the raw materials sector is to stop, or counteract the effects of, the escalation of unit energy costs of production. This issue is particularly pressing due to its close link with the renewable energy transition, requiring more metal and mineral raw materials per unit energy produced. The solution to this problem will require coordinated policy action, as well as the collaboration of scientists from many different fields—with physics, as well as the materials and earth sciences in the lead.

  20. Pellet production from agricultural raw materials - A systems study

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, Daniel; Bernesson, Sven; Hansson, Per-Anders [Department of Energy and Technology, Swedish University of Agricultural Sciences, P.O. Box 7032, SE-75007 Uppsala (Sweden)


    The demand for biofuel pellets has increased considerably in recent years, causing shortage of the traditional raw materials sawdust and wood shavings. In this study, the costs and energy requirements for the production of pellets from agricultural raw materials were analysed. The materials studied were Salix, reed canary grass, hemp, straw, screenings, rape-seed meal, rape cake and distiller's waste. Four production scales were analysed, having an annual output of 80,000, 8000, 800 and 80 tonnes of pellets per year. It was concluded that the raw materials of greatest interest were Salix and reed canary grass. They had competitive raw material costs and acceptable fuel properties and could be mixed with sawdust in existing large-scale pelleting factories. Straw had low production costs but can cause serious ash-related problems and should, as also is the case for screenings, be avoided in small-scale burners. Hemp had high raw material costs and is of less commercial interest, while distiller's waste, rape-seed meal and rape cake had higher alternative values when used as protein feed. The scale of production had a crucial influence on production costs. The machinery was used much more efficiently in large-scale plants, resulting in clear cost savings. Small-scale pelleting, both static and mobile, required cheap raw materials, low labour costs and long utilisation times to be profitable. In most cases, briquetting would be more commercially viable. The energy use in manufacturing pellets from air-dried crops was generally no higher than when moist sawdust was used as the raw material. (author)

  1. Uninterrupted heat-treatment of starch raw materials

    Energy Technology Data Exchange (ETDEWEB)

    Bronshtein, D Z


    A setup is presented, with a Rekord grinder, a Khronos scale, and other equipment of Soviet manufacture, in which oats, rye, wheat, and other grains are treated at 42 to 45 degrees prior to their use as raw materials in the ethanol industry. These materials are analyzed with respect to H/sub 2/O, starch, bulk, weight, screen analysis, and the final ethanol yields/ton of such raw materials. In a three year run in plant, this heat-treatment was advantageous, as compared to the former treatment of the starch materials.

  2. Uninterrupted heat-treatment of starch raw materials

    Energy Technology Data Exchange (ETDEWEB)

    Bronshtein, D Z


    A setup is presented, with a Rekord grinder, a Khronos scale, and other equipment of Soviet manufacture, in which oats, rye, wheat, and other grains are treated at 42 to 45/sup 0/ prior to their use as raw materials in the ethanol industry. These materials are analyzed with respect to H/sub 2/O, starch, bulk weight, screen analysis, and the final ethanol yields/ton of such raw materials. In a three year run in a plant, this heat-treatment was advantageous, as compared to the former treatment of the starch materials.

  3. Basic Thermal Parameters of Selected Foods and Food Raw Materials

    Directory of Open Access Journals (Sweden)

    Monika Božiková


    Full Text Available In general, processing and manipulation with foods and food raw materials have significant influence on their physical properties. The article is focused on thermophysical parameters measurement of selected foods and food raw materials. There were examined thermal conductivity and thermal diffusivity of selected materials. For detection of thermal parameters was used instrument Isomet 2104, which principle of measurement is based on transient methods. In text are presented summary results of thermal parameters measurement for various foods and food raw materials as: granular materials – corn flour and wheat flour; fruits, vegetables and fruit products – grated apple, dried apple and apple juice; liquid materials – milk, beer etc. Measurements were performed in two temperature ranges according to the character of examined material. From graphical relations of thermophysical parameter is evident, that thermal conductivity and diffusivity increases with temperature and moisture content linearly, only for granular materials were obtained non‑linear dependencies. Results shows, that foods and food raw materials have different thermal properties, which are influenced by their type, structure, chemical and physical properties. From presented results is evident, that basic thermal parameters are important for material quality detection in food industry.


    Directory of Open Access Journals (Sweden)

    A. M. Gadzhieva


    Full Text Available Tomatoes grown in the central and southern parts of the country, which contain 5-6 % of solids, including 0.13 % of pectin, 0.86 % of fat, 0.5 % of organic acids; 0.5 % minerals, etc. were used as a subject of research. These tomatoes, grown in the mountains, on soils with high salinity, contain high amounts of valuable components and have a long-term preservation. For the extraction of valuable components from dried tomato pomace CO2 extraction method was applied. Technological and environmental feasibility of tomatoes stage drying in the atmosphere of inert gas in solar dry kiln were evaluated; production scheme of dried tomatoes is improved; a system for tomato pomace drying is developed; a production scheme of powders of pulp, skin and seeds of tomatoes is developed. Combined method of tomato pomace drying involves the simultaneous use of the electromagnetic field of low and ultra-high frequency and blowing product surface with hot nitrogen. Conducting the drying process in an inert gas atmosphere of nitrogen intensified the process of moisture removing from tomatoes. The expediency of using tomato powder as enriching additive was proved. Based on the study of the chemical composition of the tomato powder made from Dagestan varieties of tomatoes, and on the organoleptic evaluation and physico-chemical studies of finished products, we have proved the best degree of recoverability of tomato powder during the production of reconstituted juice and tomato beverages.

  5. Incentivizing secondary raw material markets for sustainable waste management. (United States)

    Schreck, Maximilian; Wagner, Jeffrey


    Notwithstanding several policy initiatives in many countries over a number of years, there remains a general sense that too much municipal solid waste is generated and that too much of the waste that is generated is landfilled. There is an emerging consensus that a sustainable approach to waste management requires further development of secondary raw material markets. The purpose of this paper is to propose a theoretical economic model that focuses upon this stage of a sustainable waste management program and explores policy options that could motivate efficiency in secondary raw material markets. In particular, we show how firm profit and social welfare optimizing objectives can be reconciled in a two-product market of waste management processes: landfilling and material reclamation. Our results provide theoretical support for building out recent Circular Economy initiatives as well as for the relatively recent emergence of landfill mining as a means for procuring secondary raw materials. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Mineral raw materials for power production in legislation of the Republic of Croatia

    International Nuclear Information System (INIS)

    Matisa, Z.


    According to the Constitution of the Republic of Croatia, mineral wealth is a public good of legal interest to the Republic of Croatia and enjoys its special protection. The Mining Law establishes that mineral wealth (including mineral resources that are used for power production) is the property of the Republic of Croatia. Among other mineral raw materials, this refers to mineral raw materials that are used for power production: coal, oil, natural gas, radioactive mineral raw materials and geothermal waters. These mineral resources are as almost all other mineral raw materials with the exception of geothermal waters, an unrecoverable natural resource. The right to use that natural resource may be granted only by a concession. The mining legislation provides for exploration and exploitation of mineral raw materials. Exploration of oil and gas is considered to comprise operations and testing with the aim to establish the existence, position and form of oil and natural gas deposits, their quality and quantity, as well as exploitation conditions. Exploitation of oil and natural gas is considered to comprise extraction from deposits, refining and transport, as well as disposal in geological structures. Mineral raw materials used in power production amount to 63% of national total primary energy production, and they cover 33% of total power consumption in the country. Legislation in the Republic of Croatia, which refers to exploration and exploitation of oil and natural gas, allows economic utilization of that unrecoverable natural wealth to run smoothly and in compliance with practices in our European environment. (author)

  7. Raw materials in the manufacture of biotechnology products: regulatory considerations. (United States)

    Cordoba-Rodriguez, Ruth


    The Food and Drug Administration's Pharmaceutical cGMPs for the 21st Century initiative emphasizes science and risk-based approaches in the manufacture of drugs. These approaches are reflected in the International Conference on Harmonization (ICH) guidances ICH Q8, Q9, and Q10 and encourage a comprehensive assessment of the manufacture of a biologic, including all aspects of manufacture that have the potential to affect the finished drug product. Appropriate assessment and management of raw materials are an important part of this initiative. Ideally, a raw materials program should strive to assess and minimize the risk to product quality. With this in mind, risk-assessment concepts and control strategies will be discussed and illustrated by examples, with an emphasis on the impact of raw materials on cell substrates. Finally, the life cycle of the raw material will be considered, including its potential to affect the drug product life cycle. In this framework, the supply chain and the vendor-manufacturer relationship will be explored as important parts of an adequate raw materials control strategy.

  8. Supercritical CO2 extraction of raw propolis and its dry ethanolic extract

    Directory of Open Access Journals (Sweden)

    L. C. Paviani


    Full Text Available Three types of propolis extract were prepared and analyzed with respect to their global extraction yields and with respect to the concentration of the following markers: 3,5-diprenyl-4-hydroxycinnamic acid; 3-prenyl-4-hydroxycinnamic acid; 4-hydroxycinnamic acid and 4-methoxy-3,5,7-trihydroxyflavone. The extract EEP (ethanolic extract of propolis was obtained by the conventional method from raw propolis using ethanol as solvent. The extracts (SFE were obtained by supercritical solvent extraction from the raw propolis using supercritical carbon dioxide (sc-CO2, with and without the addition of ethanol as a co-solvent. The fractionated supercritical extracts (FSCE were obtained by fractionation (extract and raffinate of the dry EEP with sc-CO2. EEP yields of 39.5% were obtained and maximum global extraction yields were 7.3% for SFE with no co-solvent, 51% for SFE with 15% ethanol and 18% for the FSCE extract fraction. The concentrations of the markers in the different extracts differed as a function of the operational parameters, indicating that the addition of co-solvent and the selectivity of sc-CO2 could be manipulated so as to obtain extracts with the yields and concentrations of interest.

  9. Acoustic assessment of wood quality of raw forest materials : a path to increased profitability (United States)

    Xiping Wang; Peter Carter; Robert J. Ross; Brian K. Brashaw


    Assessment of the quality of raw wood materials has become a crucial issue in the operational value chain as forestry and the wood processing industry are increasingly under economic pressure to maximize extracted value. A significant effort has been devoted toward developing robust nondestructive evaluation (NDE) technologies capable of predicting the intrinsic wood...

  10. 4.2. The kinetics of nitric acid decomposition of calcined borosilicate raw material of Ak-Arkhar Deposit

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.; Kurbonov, A.S.; Mamatov, E.D.


    Present article is devoted to kinetics of nitric acid decomposition of calcined borosilicate raw material of Ak-Arkhar Deposit. The dependence of nitric acid decomposition of calcined boric raw material for extraction of boron oxide on temperature (20-100 deg C) and process duration (15-60 minutes) was defined. It was defined that at temperature increasing the extraction rate of boron oxide increases from 20.8 to 78.6%.

  11. Natural gas as raw material for industrial development

    International Nuclear Information System (INIS)

    Kvisle, Steinar


    Industrial development based on natural gas has broad, industrial implications. Norway has a vital industry based on natural gas as raw material, here under Ormen Lange, Snoehvit LNG, Tjeldbergodden and Petrochemical Grenland. The petrochemical industry has challenges, e.g. the cost of raw materials and energy, localization related to the markets, and recruitment, but considerable investments are made in the sector. The Northern areas in Norway may have special challenges related to bringing the product to the market. Solutions to this challenge are in LNG (liquid natural gas), GTL (gas to liquids), and GTO (gas to olefins)

  12. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms. (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae


    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  13. Control Analysis Of Tobacco Raw Material Supplies Using Eoq Method Economic Order Quantity To Reach Efficiency Total Costs Of Raw Material In Pr. Sukun

    Directory of Open Access Journals (Sweden)

    Wiwik Sudarwati


    Full Text Available The raw material inventory control system determines and guarantees the availability of raw material stock in the right quantity quality and timing. The problem in this research is the procurement of raw materials of tobacco. PR. Sukun still often experiences the excess. This is related to the frequency of raw material purchases and the quantity of raw material purchases which can lead to waste of working capital embedded in raw material inventory raw material ordering costs and raw material storage costs. The purpose of this research is to know how to make an efficiency level in procurement of raw material inventory between EOQ method compared with policy of PR. Sukun. The type of research used is analytic descriptive type. Data analysis begins by analyzing raw material quantity comparison total raw material inventory cost and raw material cost between PR Sukun policy with EOQ method. Based on the results of research known that by using EOQ method can be much more efficient compared to policy of PR. Sukun. The quantity and frequency of purchasing raw materials is less but still take into account the safety stock and reorder point so the production process is not disturbed. In addition the cost of purchasing ordering costs and raw materials storage costs less so as to create efficiencies on the cost of raw materials inventory. PR. Sukun in the procurement of raw material inventory should use EOQ method to be more efficient and take into account the safety stock and reorder point to avoid the inventory excess of raw materials.

  14. Characterization of silica quartz as raw material in photovoltaic applications

    Energy Technology Data Exchange (ETDEWEB)

    Boussaa, S. Anas, E-mail:; Kheloufi, A.; Kefaifi, A.; Kerkar, F. [Division croissance cristalline et procédés métallurgiques CCPM Centre de recherche en technologie des semi-conducteurs pour l’énergétique (C.R.T.S.E) 02 Bd Frantz Fanon BP. 140 Alger 7 merveilles, Alger 16200 (Algeria); Zaourar, N. Boutarek [Laboratoire des technologies des matériaux, USTHB, B.P. 32 El Alia, Bab Ezzouar, Alger, Algérie 16111 (Algeria)


    Raw materials are essential for the functioning of modern societies, and access to these raw materials is vital to the world economy. Sustainable development, both globally level, raises important new challenges associated with access and efficient use of raw materials. High purity quartz, is consider as a critical raw material and it is a rare commodity that only forms under geological conditions where a narrow set of chemical and physical parameters is fulfilled. When identified and following special beneficiation techniques, high purity quartz obtains very attractive prices and is applied in high technology sectors that currently are under rapid expansion such as photovoltaic solar cells, silicon metal - oxide wafers in the semiconductor industry and long distance optical fibers that are used in communication networks. Crystalline silicon remains the principal material for photovoltaic technology. Metallurgical silicon is produced industrially by the reduction of silica with carbon in an electric arc furnace at temperatures higher than 2000 °C in the hottest parts, by a reaction that can be written ideally as: SiO{sub 2} + 2C = Si + 2CO. The aim of this study has been to test experimental methods for investigating the various physical and chemical proprieties of Hoggar quartz with different techniques: X Ray Fluorescence, infra-red spectroscopy, Scanning Electron Microscopy, Optic Microscopy, Carbon Analyzer and Vickers Hardness. The results show finally that the quartz has got good result in purity but need enrichment for the photovoltaic application.

  15. Identification of Particles in Parenteral Drug Raw Materials. (United States)

    Lee, Kathryn; Lankers, Markus; Valet, Oliver


    Particles in drug products are not good and are therefore regulated. These particles can come from the very beginning of the manufacturing process, from the raw materials. To prevent particles, it is important to understand what they are and where they come from so the raw material quality, processing, and shipping can be improved. Thus, it is important to correctly identify particles seen in raw materials. Raw materials need to be of a certain quality with respect to physical and chemical composition, and need to have no contaminants in the form of particles which could contaminate the product or indicate the raw materials are not pure enough to make a good quality product. Particles are often seen when handling raw materials due to color, size, or shape characteristics different from those in the raw materials. Particles may appear to the eye to be very different things than they actually are, so microscope, chemical, and elemental analyses are required for accuracy in proper identification. This paper shows how using three different spectroscopy tools correctly and together can be used to identify particles from extrinsic, intrinsic, and inherent particles. Sources of materials can be humans and the environment (extrinsic), from within the process (intrinsic), and part of the formulation (inherent). Microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and IR spectroscopy are excellent tools for identifying particles because they are fast and accurate techniques needing minimal sample preparation that can provide chemical composition as well as images that can be used for identification. The micro analysis capabilities allow for easy analysis of different portions of samples so multiple components can be identified and sample preparation can be reduced. Using just one of these techniques may not be sufficient to give adequate identification results so that the source of contamination can be adequately identified. The

  16. Use of alternative raw materials for yoghurt production | Farinde ...

    African Journals Online (AJOL)

    Soymilk and maize steep water were used as alternative raw materials to cow milk and commercial starter, respectively, for production of yoghurt. The cow milk used was both Fresh milk and dried powdered milk (DANO). The cost of production of the yoghurt samples as well as their chemical, microbial and organoleptic ...

  17. Mineralogy And Raw Material Characterization Of Esie Stone ...

    African Journals Online (AJOL)

    Electronprobe mineral data of samples of Esie statues is presented as a possible tool for provenance studies. Most of the samples contain talc, chlorite, cummingtonite and rarely tremolite. Other talc-bearing schists are prevalent in the Esie area. However talc-cummingtonite rocks, similar to the raw materials used for the ...

  18. Use of a new borate raw material for glaze formulation

    International Nuclear Information System (INIS)

    Gomez-Tena, M. P.; Moreno, A.; Bou, E.; Cook, S.; Galindo, M.


    The Rio Tinto Minerals company has developed a new borate (E-4972), which can be used in glaze formulation (patent WO 2007/148101). This new borate, synthesised by low-temperature calcination, fundamentally contributes five oxides: silicon oxide (SiO 2 ), aluminium oxide (Al 2 O 3 ), boron oxide (B 2 O 3 ), calcium oxide (CaO), and sodium oxide (Na 2 O), its content in B 2 O 3 being between 10 and 11% by weight. It is largely amorphous, and quartz is the major crystalline phase present. The characteristics of this new borate, such as its low solubility and ability readily to form glassy phase, enable it to be used as a raw material in glaze compositions. Its suitability for glaze formulation has been the result of several years research in collaboration with the Instituto de Tecnologia Ceramica. In this paper, the feasibility has been studied of fabricating ceramic glazes by using a new synthetic borate raw material that contributes boron to the glaze composition without this needing to be done in fritted form. It has been possible to obtain fired glazes with similar technical and aesthetics characteristics to those obtained from industrial glaze compositions that contain typical frits in their compositions, thus enabling glazes to be formulated by using the new synthetic boron raw material. The results obtained show that this new raw material (E-4972) is particularly appropriate for use in producing glazes with low gloss at high temperature. (Author) 15 refs.

  19. Construction raw materials policy and supply practices in Northwestern Europe

    NARCIS (Netherlands)

    Meulen, M.J. van der; Koopmans, T.P.F.; Pietersen, H.S.


    The present contribution is an inventory of the construction raw materials policy and supply practices in The Netherlands, Belgium, North Rhine-Westphalia, Lower Saxony, Great Britain, Norway and Denmark. The work has been commissioned by the Dutch government in order to benchmark its domestic

  20. Decontamination of drug vegetative raw material by relativistic electron beam

    International Nuclear Information System (INIS)

    Gorbanyuk, A.G.; Dikiy, I.L.; Yegorov, A.M.; Linnik, A.F.; Uskov, V.V.


    The new technology of decontamination of drug vegetative raw material and medical products is proposed. Advantages of use of relativistic beams in a range of electron energies from 0.5 MeV to 5 MeV for these purposes are shown in comparison with X-radiation of energy from 80 keV to 1 MeV

  1. Raw material consumption of the European Union--concept, calculation method, and results. (United States)

    Schoer, Karl; Weinzettel, Jan; Kovanda, Jan; Giegrich, Jürgen; Lauwigi, Christoph


    This article presents the concept, calculation method, and first results of the "Raw Material Consumption" (RMC) economy-wide material flow indicator for the European Union (EU). The RMC measures the final domestic consumption of products in terms of raw material equivalents (RME), i.e. raw materials used in the complete production chain of consumed products. We employed the hybrid input-output life cycle assessment method to calculate RMC. We first developed a highly disaggregated environmentally extended mixed unit input output table and then applied life cycle inventory data for imported products without appropriate representation of production within the domestic economy. Lastly, we treated capital formation as intermediate consumption. Our results show that services, often considered as a solution for dematerialization, account for a significant part of EU raw material consumption, which emphasizes the need to focus on the full production chains and dematerialization of services. Comparison of the EU's RMC with its domestic extraction shows that the EU is nearly self-sufficient in biomass and nonmetallic minerals but extremely dependent on direct and indirect imports of fossil energy carriers and metal ores. This implies an export of environmental burden related to extraction and primary processing of these materials to the rest of the world. Our results demonstrate that internalizing capital formation has significant influence on the calculated RMC.

  2. Comparison of Biochars Characteristics from Different Raw Materials


    SUN Tao; ZHU Xin-ping; LI Dian-peng; GU Zhu-yu; ZHANG Jia-xi; JIA Hong-tao


    Biochar is the carbon-rich product from biomass under limited supply of oxygen. Biochar has been well recognized in enhancing terrestrial carbon sequestration and greenhouse gas mitigation as well as in improving soil fertility and plant productivity. To explore the differences of biochars produced from different raw materials, six biochar samples made from alfalfa straw, wheat straw, cotton straw, grape vines, sludge and lignite were selected as test material. Qualitative and quantitative an...

  3. Material Classification Using Raw Time-of-Flight Measurements

    KAUST Repository

    Su, Shuochen


    We propose a material classification method using raw time-of-flight (ToF) measurements. ToF cameras capture the correlation between a reference signal and the temporal response of material to incident illumination. Such measurements encode unique signatures of the material, i.e. the degree of subsurface scattering inside a volume. Subsequently, it offers an orthogonal domain of feature representation compared to conventional spatial and angular reflectance-based approaches. We demonstrate the effectiveness, robustness, and efficiency of our method through experiments and comparisons of real-world materials.

  4. 1996 Activities report on energies and raw materials

    International Nuclear Information System (INIS)


    The 1996 activity survey of the French General Directory for Energy and Raw Materials, which main objectives are to preserve the competitiveness of French economy, enhance environmental protection, secure the long term supply safety and maintain the public service basis for energy supply, is presented. The main themes of the survey are: the nuclear safety in Eastern Europe, the electric power inland market, the evolution of the oil market in 1996, the situation of refining in France, restructuring the BRGM (Mining and Geological Research Bureau), followed by brief facts concerning the sustainable energy development, nuclear energy, electric power, electricity and gas common issues, gas, coal, petroleum products, raw materials and underground materials. A series of global diagrams concludes the survey

  5. Radiation sterilization of some cosmetic raw materials and preparations

    International Nuclear Information System (INIS)

    Achmatowicz-Szmajke, T.; Bryl-Sandelewska, T.; Galazka, M.


    The problem of microbiological purity of cosmetic preparations is discussed. Some results obtained on the influence of ionizing radiation on organoleptic and physicochemical properties of some cosmetic raw materials and final products are reported. The samples of raw materials and the final products were irradiated with a 10 MeV electron beam from an LAE 13/9 linear accelerator located in INR. The doses delivered to the materials were 0.5 - 2.3 Mrad (5-23 kGy). Immediately after irradiation, organoleptic estimations were made and over the next few days physicochemical investigations were performed. Non-irradiated samples were investigated together with irradiated ones. (T.I.)

  6. A framework for evaluating the accessibility of raw materials from end-of-life products and the Earth's crust. (United States)

    Mueller, Sandra R; Wäger, Patrick A; Turner, David A; Shaw, Peter J; Williams, Ian D


    An increasing number of geochemically scarce metallic raw materials are entering into our lives via new technologies. A reversal of this trend is not foreseeable, leading to concerns regarding the security of their supply. However, the evaluation of raw material supply is currently hampered by inconsistent use of fundamental terminologies and incomplete assessment criteria. In this paper, we aim to establish a consistent framework for evaluating raw material supply from both anthropogenic and geological sources. A method for concept extraction was applied to evaluate systematically the use of fundamental terms in the evaluation of raw material supply. The results have shown that 'availability' is commonly used in raw material supply evaluations, whilst other researchers suggest that raw material supply should be evaluated based on 'accessibility'. It was revealed that 'accessibility' actually comprises two aspects: 'availability' and 'approachability'. Raw material 'approachability' has not previously been explicitly addressed at a system level. A novel, consistent framework for evaluating raw material supply was therefore developed. To demonstrate the application of the established framework, we evaluated the raw material supply of four rare earth element case studies. Three case studies are End-of-Life products (the anthroposphere) from Switzerland: (i) phosphors in fluorescent lamps, (i) permanent magnets in the drive motors of electric cars and (iii) fibre optic cable. The fourth case study source is the Earth's crust (the geosphere): Mount Weld deposit in Australia. The framework comprises a comprehensive evaluation of six components relating to raw material mining and processing: their geological knowledge, eligibility, technology, economic, societal and environmental impacts. Our results show that metals are not considered to be fully accessible in any of the case studies due to a lack of necessary technologies and potential societal and environmental

  7. Microalgae as a raw material for biofuels production. (United States)

    Gouveia, Luisa; Oliveira, Ana Cristina


    Biofuels demand is unquestionable in order to reduce gaseous emissions (fossil CO(2), nitrogen and sulfur oxides) and their purported greenhouse, climatic changes and global warming effects, to face the frequent oil supply crises, as a way to help non-fossil fuel producer countries to reduce energy dependence, contributing to security of supply, promoting environmental sustainability and meeting the EU target of at least of 10% biofuels in the transport sector by 2020. Biodiesel is usually produced from oleaginous crops, such as rapeseed, soybean, sunflower and palm. However, the use of microalgae can be a suitable alternative feedstock for next generation biofuels because certain species contain high amounts of oil, which could be extracted, processed and refined into transportation fuels, using currently available technology; they have fast growth rate, permit the use of non-arable land and non-potable water, use far less water and do not displace food crops cultures; their production is not seasonal and they can be harvested daily. The screening of microalgae (Chlorella vulgaris, Spirulina maxima, Nannochloropsis sp., Neochloris oleabundans, Scenedesmus obliquus and Dunaliella tertiolecta) was done in order to choose the best one(s), in terms of quantity and quality as oil source for biofuel production. Neochloris oleabundans (fresh water microalga) and Nannochloropsis sp. (marine microalga) proved to be suitable as raw materials for biofuel production, due to their high oil content (29.0 and 28.7%, respectively). Both microalgae, when grown under nitrogen shortage, show a great increase (approximately 50%) in oil quantity. If the purpose is to produce biodiesel only from one species, Scenedesmus obliquus presents the most adequate fatty acid profile, namely in terms of linolenic and other polyunsaturated fatty acids. However, the microalgae Neochloris oleabundans, Nannochloropsis sp. and Dunaliella tertiolecta can also be used if associated with other

  8. Mesta/Kenaf as raw material for Kraft pulping

    Energy Technology Data Exchange (ETDEWEB)

    Saraf, V. P.; Shiveshwar, R. M.; Meshramkar, P. M.; Deb, U. K.; Jaspal, N. S.; Biyani, B. P.


    In recent years, the shortage of conventional raw materials for pulping has intensified a world-wide search for alternate raw materials. Among other cellulosic materials, attention has focused on agricultural residues and annual plants. In this category, Kenaf, also called Mesta, has been studied as a fiber source in many countries including the USA, Phillippines and India. A comprehensive study on kraft pulping of mesta was carried out where the fiber morphology, pulping, bleaching and papermaking characteristics were investigated. Black liquor properties were also determined. The results of this study are reported and compared to the conventional raw material bamboo. The investigation has shown that mesta is easily pulped and bleached and forms sheets of excellent strength properties, comparable to or better than bamboo pulps. The black liquor from mesta is similar to bamboo in calorific value but is very low in silica, which is highly desirable from the chemical recovery point of view. As with all agricultural residues and annual plants, mesta has a high bulk per unit weight. The problems arising from this, e.g., baling, transportation, proper utilization of digester capacity, have to be studied before mesta can be widely accepted in the paper industry.

  9. Buildings materials and raw materials as a source of exposition of population of the Slovak Republic

    International Nuclear Information System (INIS)

    Cabanekova, H.


    In this presentation author presents specific activities of potassium-40, radium-226, thorium-232 and equivalent of specific activity in some building materials and raw materials used at building-up of flats in the Slovak Republic

  10. Gas condensate--raw material for producing liquid paraffin hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Aliyeva, R.B.; Alikishi-Zade, G.Yu.; Kuliyev, A.M.; Leonidov, A.N.; Pereverzev, A.N.


    The problem of efficient utilization of gas condensates as raw material for removal of a valuable product, liquid paraffins, is examined. A classification of gas condensates is given which is used as raw material for removing these hydrocarbons: gas condensate with high content of n-alkanes (25-40 mass percent), with average content (18-25 mass percent), with low content (12-18 mass percent), light weight fractions compositions, which do not contain fractions up to 200/sup 0/, and also, content ofless than 12% n-alkanes. Gas condensate I-III groups are 30% of the total reserve of gas condensate. Liquid paraffins hydrocarbons, produced from fractions of diesel fuel, which has been removed from Shatlyk gas condensate under conditions which simulate virtual processes of caramide deparaffinization meet all requirements without additional refining.


    Directory of Open Access Journals (Sweden)

    Jana Petrová


    Full Text Available The aim of our study was to evaluate the microbiological quality of raw materials used for preparation of confectionery products. For microbiological evaluation total count of bacteria, mesophilic aerobic bacteria, coliform bacteria, yeast and microscopic filamentous fungi in samples of raw materials used in the manufacture and creams of confectionery products were detected. In addition to these groups of microorganisms the presence of pathogenic microorganisms Salmonella spp. and Staphylococcus aureus in creams was monitored. Products are assessed according to the limit values of the number of microorganisms defined in the Codex Alimentary of the Slovak Republic. For microbiological analysis of confectionery products, sampling of components of confectionary products and cream was carried out according to current health regulations and altogether 65 samples of components and creams were collected: 10 samples of raw materials sugar, 10 samples of flour, 10 samples of butter and 10 samples of eggs, 5 samples of butter yolk from cream-filled disposable bag without rum addition, 5 samples of butter yolk from cream-filled disposable bag with rum addition, 5 samples of cream-filled multiple use paid bag, 5 samples of cream-filled newly purchased paid bag, 5 samples of Venček corpus and 5 samples of the French cubes corpus. From raw material the highest TBC (2.65log CFU was in flour, but the lowest in sugar (1.35 log CFU, the highest years counts was found on flour (2.42, but lowest in butter (1.18, while wasn’t in egg. In samples of creams and corpus were increased occurrence of yeast, coliform bacteria. Salmonella spp. and Staphylococcus aureus weren’t isolated from any tested sample.

  12. Petroleum as a raw material resource for sustainable development

    International Nuclear Information System (INIS)

    Egorov, O.I.


    Author notes that for economic and social region development it is necessary has been created large petroleum chemical plants near by Atyrau city (initial raw material - Tengiz, Korolev and other petroleum deposits of this region) and Aktau (Mangistau and Bazuchin petroleum). Realization of projects for structure changes of petroleum and gas region demands a great investments. It is noted that growing scales of petroleum and gas resources mastering calls already a considerable environmental complications because of Caspian Sea's level marking rise

  13. Raw material procurement for termite fishing tools by wild chimpanzees in the Issa valley, Western Tanzania. (United States)

    Almeida-Warren, Katarina; Sommer, Volker; Piel, Alex K; Pascual-Garrido, Alejandra


    Chimpanzee termite fishing has been studied for decades, yet the selective processes preceding the manufacture of fishing tools remain largely unexplored. We investigate raw material selection and potential evidence of forward planning in the chimpanzees of Issa valley, western Tanzania. Using traditional archaeological methods, we surveyed the location of plants from where chimpanzees sourced raw material to manufacture termite fishing tools, relative to targeted mounds. We measured raw material abundance to test for availability and selection. Statistics included Chi-Squared, two-tailed Wilcoxon, and Kruskall-Wallace tests. Issa chimpanzees manufactured extraction tools only from bark, despite availability of other suitable materials (e.g., twigs), and selected particular plant species as raw material sources, which they often also exploit for food. Most plants were sourced 1-16 m away from the mound, with a maximum of 33 m. The line of sight from the targeted mound was obscured for a quarter of these plants. The exclusive use of bark tools despite availability of other suitable materials indicates a possible cultural preference. The fact that Issa chimpanzees select specific plant species and travel some distance to source them suggests some degree of selectivity and, potentially, forward planning. Our results have implications for the reconstruction of early hominin behaviors, particularly with regard to the use of perishable tools, which remain archaeologically invisible. © 2017 Wiley Periodicals, Inc.

  14. 2.4. The kinetics of hydrochloric-acid decomposition of calcined concentrate of boron raw material of Ak-Arkhar Deposit

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.; Kurbonov, A.S.; Mamatov, E.D.


    Present article is devoted to kinetics of hydrochloric-acid decomposition of calcined concentrate of boron raw material of Ak-Arkhar Deposit. The experimental data of dependence of hydrochloric-acid decomposition of calcined boron raw material for boron oxide extraction on temperature (20-80 deg C) and process duration (15-60 min) were considered. It was defined that at temperature increasing the boron oxide extraction from borosilicate raw material increases from 24.1 till 86.8%. The constants of decomposition rate of boron raw material were calculated.

  15. Effect of the raw materials processing on their dustiness

    International Nuclear Information System (INIS)

    López Lilaoa, A.; Juárezb, M.; Sanfelix Fornera, V.; Mallol Gascha, G.; Monfort Gimeno, E.


    During the handling and/or processing of powdered materials in the CERAMICS INDUSTRY, one of the most important risks regarding the environmental and occupational health is the potential generation of dust. In this regard, a parameter of great interest is the dustiness of the processed materials; this parameter quantifies the tendency of the powdered materials to generate dust when handled. In this study, to determine the dustiness of a ceramic raw material composition (mixture of the body raw materials), the continuous drop method has been used. This test apparatus was selected because it is considered to better simulate how ceramic materials are handled in the CERAMICS INDUSTRY. The obtained results show that the dustiness of the same ceramic composition exhibits significant changes during the manufacturing process, depending on the presentation form. In this regard, the dry milling sample presents the highest dustiness, which can be significantly reduced (>75%) applying the the moisturization and agglomeration. The obtained results also shown that the best presentation form, regarding the minimization of the dust generation, is achieved in the spray-drying process, where the dustiness is reduced by 95%. [es

  16. Oat raw materials and bakery products - amino acid composition and celiac immunoreactivity. (United States)

    Mickowska, Barbara; Litwinek, Dorota; Gambuś, Halina


    The aim of this study was to compare the biochemical and immunochemical properties of avenins in some special oat raw materials and additionally the possibility of using them as a raw material for the gluten-free bakery products. The compared oat raw materials were - oat flakes, commercial oat flours (including gluten-free oat flour) and residual oat flour, which is by-product of β-glucan preparation. Biochemical characteristic included amino acid compositions and SDS-PAGE profiles of extracted avenins. The immunochemical reactivity with polyclonal anti-gluten and monoclonal anti-gliadin antibodies was evaluated qualitatively and quantitatively by immunoblotting and ELISA methods. Additionally, experimental bakery products made of examined raw materials were assessed according to their suitability for the celiac patients' diet. The highest protein content was measured in the β-glucan preparation "Betaven" and gluten-free oat flour. Proteins of all materials are rich in glutamic and aspartic acid, leucine and arginine. Proportions of amino acids in avenins extracted from most of oat raw materials are similar, excluding gluten-free oat flour, which has a very low avenin content and proportions of individual amino acids are different. The SDS-PAGE protein pattern consisted of proteins with molecular weight of about 25-35 kDa. Polyclonal anti-gluten anti-body recognized all protein fractions of molecular weight higher than 20 kDa. Quantitative ELISA analysis shows that the majority of samples has a gliadin-like protein content within the range of 80-260 mg/kg, excluding gluten-free flours and corresponding bakery products. Altogether, β-glucan preparation has extremely high level of gliadin-like proteins. In the examined oat raw materials and foods the contents of immunoreactive amino acid sequences exceeded the limit of 20 mg/kg (considered as gluten-free) except for gluten-free flours (oat and  the prepared mixture) and the bakery products based on gluten

  17. Analysis of Mechanical Properties of Fabrics of Different Raw Material

    Directory of Open Access Journals (Sweden)



    Full Text Available The study analyzes dependence of mechanical properties (breaking force, elongation at break, static friction force and static friction coefficient on integrated fabric structure factor j and raw material density r, among the fabrics of different raw material (cotton, wool, polypropylene, polyester and polyacrylnitrile and woven in different conditions. The received results demonstrate that sometimes strong dependences exist (wool, polypropylene and polyacrylnitrile, whereas in some cases (cotton and polyester there is no correlation. It was also discovered that the breaking force and elongation at break in the direction of weft increase, when fabric structure becomes more rigid. In the meantime variations of the curves in the direction of warp are insignificant. Regarding static friction force and static friction coefficient (found in two cases, when fabrics were rubbing against leather and materials, it was discovered that consistency of the curves is irregular, i. e. they either increase or decrease, when integrated fabric structure factor j growth. It was also identified that some dependences are not strong and relationship between explored and analyzed factors does not exist. Variation of all these mechanical properties with respect to material density r enables to conclude that increase of material density r results in poor dependences or they are whatsoever non-existent.

  18. Radioactivity in polluted cement and its raw materials

    International Nuclear Information System (INIS)

    Khan, K.; Aslam, M.; Orfi, S.D.


    Samples of portland cement manufactured in the North West frontier Province (NWFP) of Pakistan and its different raw materials have been investigated applying gamma-spectrometric techniques for natural gamma-emitting radionuclides. A high purity germanium detector (HPGE) was used for data acquisition. Average values of the total specific activity (in -1/ ) due to all the three radionuclides (/sub 40/K, /sup 226/Ra and /sup 232/Th) were found to be 327.7+ - 168.2 for portland cement; 104.4 + - 21.1 for limestone; 193.2+ - 50.4 for gypsum; 890.4 + - 86.5 for state and 545.6+ - 56.6 for latrite. The average specific activities due to /sup 40/K in Portland cement and all the raw materials were found to be higher as compared to /sub 226/Ra and /sup 232/Th in the respective materials. It is concluded that such materials do not pose any health problem and are not a major source of radiation hazards. However, The data can be utilized in determining radioactivity associated with other building materials. (author)

  19. Reflections on prospective raw materials and materials with regard to the Czech Republic

    International Nuclear Information System (INIS)

    Schejbal, C.; Palas, M.


    Reflections on prospective mineral raw materials and materials must rest upon the expected demographic evolution, the evaluation of economic development and the development of manufacturing technologies and materials corresponding to them, trends in the consumption of mineral raw materials and possibilities of securing them. The evaluation of the given factors under conditions of the Czech Republic shows that one of the decisive prerequisites to transforming the Czech economy is to assure the fuel and energy security of the state. In addition to emphasis put on traditional and newly developed technologies of utilization of domestic resources of coal and the development of nuclear power, a diversification of supplies of oil and gas is necessary. Moreover, it is necessary to ensure domestic resources of raw materials to some prospective material areas, or to provide these raw materials by means of imports and/or entrepreneurial activity abroad. As far as raw materials for building and industrial rocks are concerned, it is necessary to support the exploitation and home utilization through laws and suitable economic tools at respecting environmental limitations. With non-traditional prospective raw materials, it will be desirable to promote exploration and mining especially in those cases when a precondition exists for the securing of sufficient reserves or when reserves are already known

  20. Investigations of radioactivity of building raw and materials

    International Nuclear Information System (INIS)

    Zak, A.; Biernacka, M.; Jagielak, J.; Lipinski, P.


    In 1980, Ministry of Building and Building Materials Industry, the Central Laboratory for Radiological Protection (abbreviated as CLRP), Ministry of Health and Social Welfare have agreed to issue the compulsory regulation of performing the validation of investigations of building raw and materials. Methods of measurement, apparatus and method of evaluation of results of the investigations have been recommended for the whole country. The following two criteria of usefulness of a building material for housing and public building have been accepted, f 1 = 0.00027 S K + 0.0027 S Ra0 .0043 S Th ≤ 1 (this one limit exposition of the whole body to gamma radiation); f 2 = S Ra ≤ 185 Bq/kg (this one limits exposition of lung epithelium to progeny of radon 222 Rn exhaled from the building walls). The CLRP and Institute of Building Technology supervise over correctness (agreement with the regulations) of operation of laboratories in Departments of Building Industry and Energy, organize training of the personnel and collect results of the measurements. From 1980 till 1991, results of measurements of 6550 samples from 550 localities were collected in computer data base organized in CLRP. In this paper, results of examination of selected groups of building raw and materials have been presented. Annual average values of the qualification coefficients f 1 and f 2 have been also analyzed. (author). 7 refs, 13 figs, 2 tabs

  1. Insulating materials from renewable raw materials. 4. ed.; Daemmstoffe aus nachwachsenden Rohstoffen

    Energy Technology Data Exchange (ETDEWEB)

    Brandhorst, Joerg; Spritzendorfer, Josef; Gildhorn, Kai; Hemp, Markus


    The thermal insulation has become a central issue in the construction and renovation of buildings. The question of healthy building materials and appropriate construction follows the desire of a comfartable and allergy-free living. Due to these developments, insulation materials from renewable resources increasingly has raised the consciousness. The brochure under consideration describes the dynamic market of insulation materials consisting of renewable raw materials. Wood fibers, wood wool, sheep wool, flax, hemp, reeds, meadow grass, cork, cellulose, seaweed and bulrushes are considered as renewable raw materials for insulating materials.

  2. System simulation application for determining the size of daily raw material purchases at PT XY (United States)

    Napitupulu, H. L.


    Every manufacturing company needs to implement green production, including PT XY as a marine catchment processing industry in Sumatera Utara Province. The company is engaged in the processing of squid for export purposes. The company’s problem relates to the absence of a decision on the daily purchase amount of the squid. The purchase of daily raw materials in varying quantities has caused companies to face the problem of excess raw materials or otherwise the lack of raw materials. The low purchase of raw materials will result in reduced productivity, while large purchases will lead to increased cooling costs for storage of excess raw materials, as well as possible loss of damage raw material. Therefore it is necessary to determine the optimal amount of raw material purchases every day. This can be determined by applying simulation. Application of system simulations can provide the expected optimal amount of raw material purchases.

  3. Renewable raw materials in the field of industry; Nachwachsende Rohstoffe in der Industrie

    Energy Technology Data Exchange (ETDEWEB)

    Peters, D.


    Being used to the practiced processing of raw materials for many decades the industry had to tap the advantage of renewable raw materials again. Conventional processing methods had to be changed and to be newly developed. This has been a rewarding task considering the ecological advantages but also considering the interesting markets for products based upon renewable raw materials. Today the German industry above all the chemical industry again processes agricultural and forestal raw materials to a considerable extent. Ten percent of the raw materials processed by the chemical industry are renewable. The wood processing industry is an important economic sector that achieves a value creation with the raw material wood exceeding the value creation of other industries by far. This brochure gives an overview of the possible substances, which are processed from renewable raw materials in Germany and it shows the important role that agricultural raw materials and wood already play for the industry nowadays. (orig.)

  4. Method of thermal reprocessing of hydrocarbon raw material

    Energy Technology Data Exchange (ETDEWEB)

    Feygin, Ye.A.; Bakhshiyan, Ts.A.; Barashkov, R.Ya.; Kazhdan, A.Z.; Raud, E.A.; Umanchik, N.P.


    In the method of thermal reprocessing of hydrocarbon raw material, to raise the efficiency of the process the heat exchange is done using a heat carrier in the form of a melt of metals or their salts, circulating in a closed system with a forced heating source in sequence through the pyrolysis zone, cooling zone, and heating zone. For example, the benzine fraction with initial boiling temperatures of 80-186 degrees C, together with steam, in the amount of 20% at 20 degrees C and pressure of 2 atmospheres, goes to the heating zone. Liquid Li goes there from the cooling zone through a closed circuit at 749 degrees C. The benzine, evaporated and heated to 300 degrees C, together with the melt, go to the pyrolysis zone, where the benzine is heated through the wall by the liquid Li coming from the heat carrier heating zone at 1000 degrees C. From the pyrolysis zone, the products, containing 41% C/sub 2/H/sub 4/, 15% C/sub 3/H/sub 6/ and 21% heavy fractions, go with the melt at 900 degrees C to the cooling zone, where they are cooled through the wall to 400 degrees C by the circulating liquid Li. The Li temperature at the entry into the cooling zone is 350 degrees C. The degree of raw material conversion is over 98%; the melt/raw material weight ratio is 0.2. Using this method enables a reduction in the pyrolysis zone from 80 to 8 m and the cooling zone area from 13 to 0.6 m/sup 2/ compared with the existing one, and transition from a multiple-tube cooling zone design to a tube one. The volume of the furnace unit is reduced from 500 to 10 m/sup 3/; the C/sub 2/H/sub 4/ yield is increased from 26-28 to 40-42%.

  5. Effects of gamma irradiation on raw materials and perfumes

    International Nuclear Information System (INIS)

    Guillot, M.; Pelpel, A.


    In order to enlight the strange problem of apparent perfume stability observed in manufactured talc powders sterilized by gamma rays, investigations were made on samples of odorant substances (raw materials, essential oils, or elaborated mixtures). As a rule, no immediate adulteration of olfactive caracteristics resulted at once from gamma irradiation. In several cases, a stabilizing effect appeared immediately and remained effective after long storage in various conditions (of temperature, or light, or oxygen exposure). This unexpected effect seems to be in accordance with previous experiments on gamma or electron irradiations of mixtures of organic molecules, reported in litterature: a mutual inhibition was observed to take place [fr

  6. Time influence in chemical treatment of Brazilian raw materials type

    International Nuclear Information System (INIS)

    Argolo, F.; Dias, C.; Machado, A.; Volzone, C.; Ortiga, J.; Valenzuela Diaz, F.


    Clays are part of raw materials in different industries. The mineralogical composition and purity greatly influence the application thereof. Chemical treatments applied, such as acid attack, modify their properties and thus their possible uses. Taking in to account that, clay minerals, may differ by more or less resistance to chemical attacks, two types of clay were studied with different mineralogical composition to assess the degree of resistance to chemical attack treatment such as acid. Acid treatments that were applied, differ mainly in the contact time between the solid and the liquid. The solids were studied by X-ray diffraction analysis, chemical analysis and infrared analysis

  7. The technological raw material heating furnaces operation efficiency improving issue (United States)

    Paramonov, A. M.


    The issue of fuel oil applying efficiency improving in the technological raw material heating furnaces by means of its combustion intensification is considered in the paper. The technical and economic optimization problem of the fuel oil heating before combustion is solved. The fuel oil heating optimal temperature defining method and algorithm analytically considering the correlation of thermal, operating parameters and discounted costs for the heating furnace were developed. The obtained optimization functionality provides the heating furnace appropriate thermal indices achievement at minimum discounted costs. The carried out research results prove the expediency of the proposed solutions using.

  8. Analytical techniques for characterization of raw materials in cell culture media

    Directory of Open Access Journals (Sweden)

    Sharma Chandana


    Full Text Available Abstract Raw materials are a critical part of any cell culture medium; therefore, it is of utmost importance to understand and characterize them for high-quality product. The raw material characterization (RMC program at SAFC focuses on individual screening of raw materials both analytically and biologically. The goal of the program is to develop the best-in-class knowledge base of the raw materials used in SAFC’s media formulations and their impact on performance of products.

  9. Order acceptance in food processing systems with random raw material requirements

    NARCIS (Netherlands)

    Kilic, Onur A.; van Donk, Dirk Pieter; Wijngaard, Jacob; Tarim, S. Armagan

    This study considers a food production system that processes a single perishable raw material into several products having stochastic demands. In order to process an order, the amount of raw material delivery from storage needs to meet the raw material requirement of the order. However, the amount

  10. Regenerative raw materials - High technology without end; Nachwachsende Rohstoffe - Spitzentechnologie ohne Ende

    Energy Technology Data Exchange (ETDEWEB)

    Wenig, Barbara


    Regenerative raw materials are the basis for a multiplicity of environmentally friendly products. Regenerating raw materials fascinate by special qualities and offer the possibility of preserving only restricted existing fossil resources and climatic friendly managing. The review under consideration reports on areas in which vegetable raw materials already are established as well as on future prospects.

  11. Flotation tailings as a raw material for ceramic building materials

    Energy Technology Data Exchange (ETDEWEB)

    Burmistrov, V N; Karpunina, T I; Smolin, V N


    The VNIIstrom research institute developed a method for utilizing flotation tailings for production of bricks. Tailings are dewatered using filter presses. After dewatering, moisture content in the tailings ranges from 25 to 26%. Tailings are mixed with chamotte with a grain size to 2 mm. Using 30% chamotte improves mechanical and physical properties of the bricks and reduces energy consumption of brick firing. Tailings mixed with chamotte are granulated and dried on a conveyor. Granules with moisture content reduced to the optimum level are mixed a second time and formed in a press. The bricks are fired in a tunnel kiln with modified design. The bricks made of flotation tailings mixed with 30% chamotte are characterized by mechanical properties comparable to those of high quality bricks made of conventional materials.

  12. New technologies and raw materials for iron and steel making

    Energy Technology Data Exchange (ETDEWEB)

    Holappa, L. [Helsinki Univ. of Technology, Otaniemi (Finland). Lab. of Metallurgy


    The current steelmaking is still mainly based on two alternatives routes. The first one is ore based production route via reduction in blast furnaces (BF) to produce carbon-rich hot metal which is then oxidised in basic oxygen converter process (BOF) to crude steel, then refined and alloyed in several secondary (ladle) metallurgical operations to its final composition, further followed by continuous casting and rolling operations. The second main steelmaking route starts from steel scrap as the main raw material, melting of scrap in electric furnaces to crude steel, the subsequent stages being corresponding to those in ore based steelmaking. Both these processes represent well-established and highly developed technologies. However, they have some drawbacks. Blast furnace process needs sinter or pellets and coke as its raw materials. That means erection of large integrates with high investment costs in the production units themselves as well as to avoid severe environmental issues. Scrap-based steelmaking is ideal from the viewpoint of recycling, but it is limited by the scrap availability and quality problems encountered by the noticeable metallic impurities in purchase scrap. Direct reduction of iron ore in solid state to produce direct reduced iron (DRI) has its roots in the early ironmaking history but was firstly commercialised on a modern concept at the end of the 1960's when the first Midrex installation was run into operation. Most of the DR-processes utilise natural gas as the reducing agent but also some processes utilising coal have been introduced and are used in industrial scale. The oil crises in the 1970's slowed down the progress of DRI production but during the last 15 years the production has steadily grown being nowadays about 35 Mton/year. That corresponds to roughly 10 pct of the total solid material input into the world steel production. No doubt, the growth will continue in the near future as well. Quite recently, a new process

  13. From raw material to dish: pasta quality step by step. (United States)

    Sicignano, Angelo; Di Monaco, Rossella; Masi, Paolo; Cavella, Silvana


    Pasta is a traditional Italian cereal-based food that is popular worldwide because of its convenience, versatility, sensory and nutritional value. The aim of this review is to present a step-by-step guide to facilitate the understanding of the most important events that can affect pasta characteristics, directing the reader to the appropriate production steps. Owing to its unique flavor, color, composition and rheological properties, durum wheat semolina is the best raw material for pasta production. Although pasta is traditionally made from only two ingredients, sensory quality and chemical/physical characteristics of the final product may vary greatly. Starting from the same ingredients, there are a lot of different events in each step of pasta production that can result in the development of varieties of pasta with different characteristics. In particular, numerous studies have demonstrated the importance of temperature and humidity conditions of the pasta drying operation as well as the significance of the choice of raw material and operating conditions on pasta quality. © 2015 Society of Chemical Industry.

  14. Utilization of Delignified Sawdust as Raw Material of Biogas Production

    Directory of Open Access Journals (Sweden)

    Zumalla Asfarina


    Full Text Available Biogas is one alternative to replace the irreplaceable energy source that has begun to diminish its existence. The raw materials for biogas manufacture are renewable biomass, usually using plantation waste, agriculture, and livestock. Using biogas can also reduce environmental pollution. One of the agricultural waste that has great potential to become the raw material of biogas is teak sawdust. Wood processing industry in Indonesia quite a lot, but wood has a high lignosesluosa content, so it needs the right method to process it. With the delignification of lignin levels on teak sawdust will decrease. Wood sawdust is soaked using NaOH for 1, 2, 3, and 4 days with 4% w / v concentration. The lowest lignin and hemicellulose content was 25.79% and 87.9% in pretreatment for 4 days, while the highest cellulose level was 57, 34%. The accumulated volume of biogas at 1 day pretreatment, ie 709 ml / g TS. Gcms shows the enlarged peak area of methanamine, N-methyl from before pretreatment. The fastest biogas formation (λ in 4 days pretreatment, 1.60403 days and the largest constant A and U variables at 1 day were 914.5903 ml / g TS and 34.59765 ml / g TS.

  15. Characterization of Limestone as Raw Material to Hydrated Lime (United States)

    Salem Hwidi, Rajeb; Nuraiti Tengku Izhar, Tengku; Saad, Farah Naemah Mohd


    In Malaysia, limestone is essentially important for the economic growth as raw materials in the industry sector. Nevertheless, a little attention was paid to the physical, chemical, mineralogical, and morphological properties of the limestone using X-ray fluorescence (X-RF), X-ray diffraction (X-RD), Fourier transform infrared spectroscopy (FTIR), and Scanning electron microscopy / energy dispersive x-ray spectroscopy (SEM-EDS) respectively. Raw materials (limestone rocks) were collected from Bukit Keteri area, Chuping, Kangar, Perlis, Malaysia. Lab crusher and lab sieved were utilized to prepare five different size of ground limestone at (75 µm, 150 µm, 225 µm, 300, and 425 µm) respectively. It is found that the main chemical composition of bulk limestone was Calcium oxide (CaO) at 97.58 wt.% and trace amount of MnO, Al2O3, and Fe2O3 at 0.02%, 0.35%, and 0.396% respectively. XRD diffractograms showed characteristic peaks of calcite and quartz. Furthermore, main FTIR absorption bands at 1,419, 874.08 and 712.20 cm-1 indicated the presence of calcite. The micrographs showed clearly the difference of samples particle size. Furthermore, EDS peaks of Ca, O, and C elements confirmed the presence of CaCO3 in the samples.

  16. Radiation decontamination (hygienisation) of cosmetic raw materials and products

    International Nuclear Information System (INIS)

    Malec-Czechowska, K.; Migdal, W.; Owczarczyk, H.B.


    Microbiological purity of cosmetics is a problem of today because of growing hygienic requirements to these products. The demand for high hygienic purity from one side and the limitation in the use of conservants to cosmetics from the other side stimulate the research activity, the aim of which is to satisfy present requirements in this field. The application of radiation decontamination (hygienisation) seems to be one of solutions. In present report were present the results of the study on the effect of electron beam irradiation on microbial contamination of selected cosmetics and some raw materials used in cosmetic industry. Radiation doses applied were not higher than 6.0 kGy. The level of microbial contamination in both unirradiated and irradiated samples was determined by applying the standard microbiological methods. In addition, the quality and usefulness of irradiated cosmetics were examined by methods used in cosmetic industry. The results obtained show conclusively that radiation treatment can be successfully used for the decontamination (hygienisation) of cosmetics and some raw materials used in their production, without changing the quality and the usefulness of the product released. (author)

  17. Annual report 2001. General direction of energy and raw materials

    International Nuclear Information System (INIS)


    This report summarizes the 2001 activity of the French general direction of energy and raw materials (DGEMP) of the ministry of finances and industry: 1 - security of energy supplies: a recurrent problem; 2001, a transition year for nuclear energy worldwide; petroleum refining in font of the 2005 dead-line; the OPEC and the upset of the oil market; the pluri-annual planning of power production investments; renewable energies: a reconfirmed priority; 2 - the opening of markets: the opening of French electricity and gas markets; the international development of Electricite de France (EdF) and of Gaz de France (GdF); electricity and gas industries: first branch agreements; 3 - the present-day topics: 2001, the year of objective contracts; AREVA, the future to be prepared; the new IRSN; the agreements on climate and the energy policy; the mastery of domestic energy consumptions; the safety of hydroelectric dams; Technip-Coflexip: the birth of a para-petroleum industry giant; the cleansing of the mining activity in French Guyana; the future of workmen of Lorraine basin coal mines; 4 - 2001 at a glance: highlights; main legislative and regulatory texts; 5 - DGEMP: November 2001 reorganization and new organization chart; energy and raw materials publications; (J.S.)

  18. Prospects for development of hydrocarbon raw materials resources reproduction (United States)

    Vertakova, Y. V.; Babich, T. N.; Polozhentseva, Y. S.; Zvyagintsev, G. L.


    The article presents data on the influence of factors in the field of innovative technology of thermocatalytic depolymerization of solid household wastes (SHW) on the efficiency and prospects for the development of technogenic hydrocarbon raw materials resource reproduction. Process thermodynamics, reactions kinetics, the mechanism of thermolysis of secondary polymers in organic solvents have been studied by means of laboratory experiments. It is shown that different morphological groups of wastes dissolve practically at the same rate at temperatures of 250-310°C. A homogeneous product is formed in the liquid phase; the spread of values for the elements lies in the interval of 1.5-4.5 %; technological requirements of the stages of formation of boiler fuels are satisfied. Using the principles of patent analysis, new techniques of processing household waste components are proposed. The basics of energy-efficient and energy-saving processes of technogenic hydrocarbon raw materials resource reproduction have been laid. The possibility of increasing the production payback and intensification is shown. Ecological and demographic safety for population and technical and economic benefits from SHW processing are achieved.

  19. Synthesis of material microporous using raw materials alternative as a source of silica and alumina

    International Nuclear Information System (INIS)

    Santos, E.A.; Silva, T.L.


    Synthetic zeolites have important properties of a technological viewpoint. Thus, this work aims at the use of natural raw materials such as kaolin waste and wood ash in order to produce these microporous materials. The starting materials were characterized by X-ray diffraction (XRD) and spectroscopy, X-ray fluorescence (XRF); the phases formed as synthesis products were identified by XRD and gravimetric and differential thermal analysis (DTA/TG). Hydrothermal synthesis took place by mixing the raw materials in stoichiometrically calculated batches with NaOH (3M) at 90 °C and time of 6, 20, 24 and 48 hours. The results show the formation of phases of type zeolite A and sodalite, demonstrating the raw materials be an efficient and low cost alternative to producing microporous materials. (author)

  20. Melting behaviour of raw materials and recycled stone wool waste

    DEFF Research Database (Denmark)

    Schultz-Falk, Vickie; Agersted, Karsten; Jensen, Peter Arendt


    Stone wool is a widely used material for building insulation, to provide thermal comfort along with fire stability and acoustic comfort for all types of buildings. Stone wool waste generated either during production or during renovation or demolition of buildings can be recycled back into the sto...... wool melt production. This study investigates and compares the thermal response and melting behaviour of a conventional stone wool charge and stone wool waste. The study combines differential scanning calorimetry (DSC), hot stage microscopy (HSM) and X-ray diffraction (XRD). DSC reveals...... that the conventional charge and stone wool waste have fundamentally different thermal responses, where the charge experiences gas release, phase transition and melting of the individual raw materials. The stone wool waste experiences glass transition, crystallization and finally melting. Both DSC and HSM measurements...

  1. Insulating materials from renewable raw materials. 3. upd. ed.; Daemmstoffe aus nachwachsenden Rohstoffen

    Energy Technology Data Exchange (ETDEWEB)

    Brandhorst, Joerg; Spritzendorfer, Josef; Gildhorn, Kai; Hemp, Markus


    Due to increasing energy prices, obligations to climatic protection and the desire for comfortable, allergy-free living, the thermal insulation is a central question with building and sanitation. Under this aspect, the contribution under consideration describes the very dynamic market of the insulating materials from renewable raw materials and deals with the questions of the users. In particular, the following raw materials are considered in the production of insulating materials: Wood fibre, wood chips, wood wool, sheep wool, flax, hemp, reeds, straw, cellulose.

  2. Methodology for Evaluating Raw Material Changes to RSRM Elastomeric Insulation Materials (United States)

    Mildenhall, Scott D.; McCool, Alex (Technical Monitor)


    The Reusable Solid Rocket Motor (RSRM) uses asbestos and silicon dioxide filled acrylonitrile butadiene rubber (AS-NBR) as the primary internal insulation to protect the case from heat. During the course of the RSRM Program, several changes have been made to the raw materials and processing of the AS-NBR elastomeric insulation material. These changes have been primarily caused by raw materials becoming obsolete. In addition, some process changes have been implemented that were deemed necessary to improve the quality and consistency of the AS-NBR insulation material. Each change has been evaluated using unique test efforts customized to determine the potential impacts of the specific raw material or process change. Following the evaluations, the various raw material and process changes were successfully implemented with no detectable effect on the performance of the AS-NBR insulation. This paper will discuss some of the raw material and process changes evaluated, the methodology used in designing the unique test plans, and the general evaluation results. A summary of the change history of RSRM AS-NBR internal insulation is also presented.

  3. Evaluation of effectiveness of raw materials and materials use in a blast furnace department of a steelworks

    Directory of Open Access Journals (Sweden)

    E. Kardas


    Full Text Available The paper analyses the quality of raw materials used in the production of blast furnace pig iron. The ferruginous sinter and pellets are the basic raw materials used in the process. The paper presents the impact of those raw materials quality on the effectiveness of the blast furnace process. The process effectiveness will be specified by means of selected process parameters.


    Directory of Open Access Journals (Sweden)

    Edith Burbano


    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Emergy analysis of biogas systems based on different raw materials. (United States)

    Wang, Yang; Lin, Cong; Li, Jing; Duan, Na; Li, Xue; Fu, Yanyan


    Environmental pollution and energy crisis restrict the development of China, and the utilization of renewable technology is an effective strategy to alleviate the damage. Biogas engineering has rapidly developed attributes to solve environmental problems and create a renewable energy product biogas. In this paper, two different biogas plants' materials were analyzed by emergy method. One of them is a biogas project whose degraded material is feces (BPF system), and the other is the one whose degraded material is corn straw (BPC system). As a result, the ecological-economic values of BPF and BPC are $28,300/yr and $8,100/yr, respectively. Considering currency, environment, and human inputs, both of the biogas projects have the ability of disposing waste and potential for development. The proportion of biogas output is much more than fertilizer output; so, fertilizer utilization should be emphasized in the future. In comparison, BPF is better than BPC in the aspects of ecological-economic benefits, environmental benefits, and sustainability. The reason is the difficulty of corn straw seasonal collection and degradation. Thus it is proposed that BPC should be combined with the other raw materials.

  6. Emergy Analysis of Biogas Systems Based on Different Raw Materials

    Directory of Open Access Journals (Sweden)

    Yang Wang


    Full Text Available Environmental pollution and energy crisis restrict the development of China, and the utilization of renewable technology is an effective strategy to alleviate the damage. Biogas engineering has rapidly developed attributes to solve environmental problems and create a renewable energy product biogas. In this paper, two different biogas plants’ materials were analyzed by emergy method. One of them is a biogas project whose degraded material is feces (BPF system, and the other is the one whose degraded material is corn straw (BPC system. As a result, the ecological-economic values of BPF and BPC are $28,300/yr and $8,100/yr, respectively. Considering currency, environment, and human inputs, both of the biogas projects have the ability of disposing waste and potential for development. The proportion of biogas output is much more than fertilizer output; so, fertilizer utilization should be emphasized in the future. In comparison, BPF is better than BPC in the aspects of ecological-economic benefits, environmental benefits, and sustainability. The reason is the difficulty of corn straw seasonal collection and degradation. Thus it is proposed that BPC should be combined with the other raw materials.

  7. Emergy Analysis of Biogas Systems Based on Different Raw Materials (United States)

    Wang, Yang; Lin, Cong; Li, Jing; Duan, Na; Li, Xue; Fu, Yanyan


    Environmental pollution and energy crisis restrict the development of China, and the utilization of renewable technology is an effective strategy to alleviate the damage. Biogas engineering has rapidly developed attributes to solve environmental problems and create a renewable energy product biogas. In this paper, two different biogas plants' materials were analyzed by emergy method. One of them is a biogas project whose degraded material is feces (BPF system), and the other is the one whose degraded material is corn straw (BPC system). As a result, the ecological-economic values of BPF and BPC are $28,300/yr and $8,100/yr, respectively. Considering currency, environment, and human inputs, both of the biogas projects have the ability of disposing waste and potential for development. The proportion of biogas output is much more than fertilizer output; so, fertilizer utilization should be emphasized in the future. In comparison, BPF is better than BPC in the aspects of ecological-economic benefits, environmental benefits, and sustainability. The reason is the difficulty of corn straw seasonal collection and degradation. Thus it is proposed that BPC should be combined with the other raw materials. PMID:23476134

  8. Utilization of raw material from early thinnings; Ensiharvennuspuun hyoedyntaeminen

    Energy Technology Data Exchange (ETDEWEB)

    Alen, R; Marttina, M; Toivanen, J [Jyvaeskylae Univ. (Finland). Dept. of Chemistry


    Wood material from early thinnings is one of the most potential new material reserves (4 - 6 million m{sup 3}) for industrial purposes. However, the prerequisites for an enhanced utilisation of this reserve would be, besides more efficient logging, debarking, and chipping, an optimal fractionation of wood material into energy and fibre production. The aim of this project was to promote the use of first-thinning wood as a competitive raw material for energy production by increasing the potential utilisation of the corresponding wood resource for chemical pulping. During the year 1996 the variation of fibre length distribution within the stem and top (total height of 12 m) of a 27-years-old pine wood (Pinus sylvestris) was determined. Tentative calculations indicated that about 67 % of the wood dry matter consists of fibres having an average fibre length more than 2 mm. It was considered that most of this fraction with high quality fibre properties could be recovered and used for pulping. In addition, the detailed FTIR analysis of different samples from the same pine wood showed that there was an adequate correlation between the FTIR spectrometric data and the fibre length averages. (orig.)

  9. Self-compacting paste system using secondary raw materials

    International Nuclear Information System (INIS)

    Rizwan, S.A.


    A study has been carried out on self-compacting paste (SCP) systems using various cements and secondary raw materials (SRM's) including rice husk ash (RHA) and Silica Fume (SF). These systems were characterized by: SRM particle size, powder water demand (WD) and setting times, flow, strength, microstructure and early volume stability. The result show that WD increased by adding SRM's due to their smaller particle size, higher surface area and internal porosity. Inclusion of SRM's in SCP systems as cement replacements also increase strength of SCP systems due to filler, hydration and pozzolanic actions which translate into pore refinement. It is demonstrated that the resultant properties of self-compacting cementitious. System (SCCS) depend upon the nature of SRM used. (author)

  10. Glances on the year 1998. Energies and raw materials

    International Nuclear Information System (INIS)


    This report summarizes 14 key-topics of the year 1998 in relation with the French energy and economic policy: the new start-up of energy mastery; the nuclear industry between passion and reason; the labour inspection in nuclear power plants; the law project for the modernizing and development of the electric power public utility; the main gas transportation systems; the future of Gardanne's mining basin; the raw materials in the upheaval; the French refining activity after the Auto-Oil directive; the oil company fusions; the priorities in petroleum technology research; the policy of automotive fuels distribution; the energy in regions; the mining activity in New Caledonia; the end of the BRGM-Normandy partnership. A calendar of remarkable facts is given at the end. (J.S.)

  11. The characteristics of bioethanol fuel made of vegetable raw materials (United States)

    Muhaji; Sutjahjo, D. H.


    The aim of this research is to identify the most potential vegetable raw as the material to make a bioethanol fuel as the alternative energy for gasoline. This study used experimental method. The high-level bioethanol was obtained through the process of saccharification, fermentation and stratified distillation. ASTM standards were used as the method of testing the chemical element (D 5501, D 1744, D 1688, D 512, D 2622, D 381), and physical test (D 1613, D 240, D 1298-99, D 445, and D 93). The result of the analysis showed that from the seven bioethanols being studied there is one bioethanol from Saccharum of icinarum linn that has physical and chemical properties close to the standard of bioethanol. Meanwhile, the others only meet some of the physical and chemical properties of the standard bioethanol.

  12. National reports on raw materials economy. Vol. 6

    International Nuclear Information System (INIS)

    Haude, H.; Weber, R.


    A review is given of the ore deposits, mine production, and use of mineral resources in Argentina (oil, gas, asphalt, oil shale, coal, uranium, thorium, iron, manganese, chrome, tungsten, vanadium, copper, lead, zinc, tin, antimony, gold, silver, aluminium, beryllium, boron, sulfur, and fluorite). Argentina is dependent on imports of nearly all mineral resources. Only exports of zinc, tungsten, fluorite, and borate have been possible and the only other significant production has been of energy resources, iron, manganese, and lead. The extreme concentration of population in the east, the great distances to the Andes in the west, and the as yet inadequate transport network with the west has limited the mining activity up to the present. As part of industrial development, the government has made great efforts to increase the supply of raw materials through intensive prospecting and use of Argentina's own natural resources. Newly discovered ore deposits confirm that extensive parts of the country are prospective for mineral resources. (orig.) [de

  13. Radioactive contaminants in raw materials and foodstuffs of plant origin

    International Nuclear Information System (INIS)

    Stankovicj, S.; Krainchanicj, M.; Stankovicj, A.


    The paper concentrates on the results of activity level of radioactive caesium 134 and 137 in the samples of raw materials (barley, oats, soybean, sunflower, pumpkin seed, hops, shreded sugar beet, maize), animal feedstuffs (alfalfa, alfalfa meal, rape, concentrates fed to chickens, pigs or bpvines, dry turnip shreds) and foodstuff of plant origin (lettuce, spinach, cabbage, carrot, celery, cucumber, tomato, olives, sesame). All samples - produced locally on the major part but also including some imported stuff -have been subjected to continuous gamma spectrometry starting with the Chernobyl accident in 1986 through 1989. The highest activity of caesium was recorded in the samples of animal feedstuffs (alfalfa, alfalfa meal, rape) in the years 1986 and 1987. In time, however, the activity tends to drop considerably. (author) 4 refs.; 3 tabs

  14. Raw materials problems in connection with fast breeder type reactors

    International Nuclear Information System (INIS)

    Hirsch, H.; Kreusch, J.


    The power supply by the FBR type reactors which depends upon the availability of essential raw materials such as Cr and Mo for structural and special steels is supposed to be less ensured than supply by fossil-fueled power plants. This contribution tries to verify this statement by means of estimates of the annual Cr and Mo demand, of the resources, production and consumption as well as by a study of the possibilities of recycling and substituting Cr and Mo. The only realistic alternative to the fast breeder type reactor is supposed to be a soft path of development according to the principle of decentralization, utilization of renewable energy sources regard to environmental protection, and use of less sophisticated technology. (DG) [de

  15. The Energy Transition and the Challenge of Critical Raw Materials

    International Nuclear Information System (INIS)

    Lepesant, Gilles


    The geopolitical analyses of energy markets are traditionally focused on fossil fuels, and less on renewable energy sources. Yet the huge development perspectives of these renewable energy sources (representing 2/3 of total net power generation capacity additions in 2016) trigger a need to take into account new challenges and vulnerabilities, related to the availability and affordability of critical raw materials, notably rare earths, which are needed to develop wind turbines, solar panels and energy storage technologies. Stakes are geopolitical, economic and environmental and are reinforced by a geography of resources and production which is concentrated within a few key countries and zones (China, Latin America, Australia, Congo mainly). The role of China in particular is at the core of the attention

  16. Cross-laminated timber made of Hungarian raw materials (United States)

    Marko, G.; Bejo, L.; Takats, P.


    Cross-laminated timber (CLT), generally made out of softwood, enjoys increasing popularity throughout Europe. This material offers a versatile, eco-friendly technology to create strong, lightweight and energy-efficient buildings. Unfortunately, the sites and climatic conditions in Hungary are not suitable for growing high-quality coniferous trees. Transporting raw materials from other countries (sometimes thousands of kilometres away) negates the environmental advantages of wood-based construction. Local options are definitely preferable from an ecological aspect. Poplar wood (populus spp.) is of great economic importance in Hungary. There are several relatively high density, high strength varieties growing in large quantities in Hungary, that may be used as alternatives to softwood, with comparable properties. There is an increasing interest in using poplar as a construction material, especially in regions were there is a shortage of traditional construction timber. This paper presents the results of a preliminary investigation to create CLT using poplar lumber. Laboratory-scale CLT specimens were created in a hot press, and tested for their loadbearing capacity. The MOR values of poplar CLT are comparable to, albeit somewhat lowerthan those of softwood CLT. Further investigations are required to establish the economic viability and technological conditions for the commercial production of poplar CLT.

  17. Polymer Industrial Floors - The Possibility of Using Secondary Raw Materials from Solar Panels


    J. Kosikova; B. Vacenovska; M. Vyhnankova


    The paper reports on the subject of recycling and further use of secondary raw materials obtained from solar panels, which is becoming a very up to date topic in recent years. Recycling these panels is very difficult and complex, and the use of resulting secondary raw materials is still not fully resolved. Within the research carried out at the Brno University of Technology, new polymer materials used for industrial floors are being developed. Secondary raw materials are ...

  18. Proto pectin degradation of raw material by the acid hydrolysis

    International Nuclear Information System (INIS)

    Khalikov, D.Kh.; Gorshkova, R.M.; Khalikova, S.; Avloev, Kh.Kh.; Mukhiddinov, Z.K.


    The article presents results of hydrolysis proto pectin apples, an orange and a basket of sunflower depending on ph a solution. The reaction products are divided into three fractions conditionally named as micro gel, pectin substances and oligosaccharide. It was shown that the high-quality pectin extracted from orange, but high percentage of carboxylic group in the sunflower pectin allow it to by used as a drug delivery materials

  19. Influence of man-made aluminosilicate raw materials on physical and mechanical properties of building materials. (United States)

    Volodchenko, A. A.; Lesovik, V. S.; Stoletov, A. A.; Glagolev, E. S.; Volodchenko, A. N.; Magomedov, Z. G.


    It has been identified that man-made aluminosilicate raw materials represented by clay rock of varied genesis can be used as energy-efficient raw materials to obtain efficient highly-hollow non-autoclaved silicate materials. A technique of structure formation in the conditions of pressureless steam treatment has been offered. Cementing compounds of non- autoclaved silicate materials based on man-made aluminosilicate raw materials possess hydraulic properties that are conditioned by the process of further formation and recrystallization of calcium silicate hydrates, which optimizes the ratio between gellike and crystalline components and densifies the cementing compound structure, which leads to improvement of performance characteristics. Increasing the performance characteristics of the obtained products is possible by changing the molding conditions. For this reason, in order to create high-density material packaging and, as a result, to increase the strength properties of the products, it is reasonable to use higher pressure, under which raw brick is formed, which will facilitate the increase of quality of highly-hollow products.

  20. Analysis preliminary phytochemical raw extract of leaves Nephrolepis pectinata

    Directory of Open Access Journals (Sweden)

    Natally Marreiros Gomes


    Full Text Available The Nephrolepis pectinata popularly known as paulista fern, ladder-heaven, cat tail, belongs to the family Davalliaceae. For the beauty of the arrangements of their leaves ferns are quite commercialized in Brazil, however, have not been described in the literature studies on their pharmacological potential. Thus, the objective of this research was to analyze the phytochemical properties of the crude extract of the leaves of Nephrolepis pectinata. To perform the phytochemical analysis were initially made the collection of the vegetable, preparation of voucher specimen, washing, drying and grinding. Then, extraction by percolation method and end the phytochemical analysis. Preliminary results phytochemicals the crude extract of the leaves of Nephrolepis pectinata tested positive for reducing sugars, phenols/tannins (catechins tannins and catechins.

  1. Rare earth elements exploitation, geopolitical implications and raw materials trading (United States)

    Chemin, Marie-Charlotte


    , establishing a company in China can lower the production cost (since the company buys the products used in its production at a lower price). In the fifth session, they study the raw materials trading based on the futures contracts example. A producer, to avoid a rise in prices of raw materials used in his production can use derivative products on the financial market: futures contracts for instance. This product ensures a quantity and quality for a price and a delivery date agreed upon today. Actually, producers can use a method called Fix price hedging in order to fix the price of a specific product. The main idea is to balance out the "physical position" (spot market) and the "paper position" (futures market). Even if the REE are commercialized in form of a non-perishable's oxide, the flow of the stock must be guaranteed and this is why it is important for producers to secure their supply of raw materials. In the last session, students search local companies that use REE in their production process and study their strategy on the market.

  2. Study of chemisrty and hydrolysates drying parameters of feather-downy raw material




    The article describes chemical and amino acid composition of feather-downy raw material. It determines the mass fraction of crude protein, crude fiber, ash, calcium, phosphorus, sodium in the samples of feather-downy raw material. It is stated that the waste from poultry processing obtained from hens of all the studied species are characterized by a high content of crude protein and low in crude fiber and ash. The most valuable feather-downy raw material regarding protein is waste containing ...

  3. Primary Raw Materials for Steelmakers: Scrap and Pig Iron

    Directory of Open Access Journals (Sweden)

    Cristina Bumbac


    Full Text Available Most of the daily steel we so much need is obtained now in electric furnaces, for which the main raw material is scrap. The scrap market is a very sensitive one, depending very much on internal collect, exports and imports, the market of steel and freight. Commerce with scrap is one of the most intense among all the countries of the world and covers all the routes and regions. Every ten years or so importers become exporters and vice versa, due to the period of life of the metallic products. For example, China was for the last 10 years one of the biggest importers (after Turkey, which is number one in importers' hierarchy, but prognoses tell that in 2-3 years China might become self-sufficient due to the investments which began some 20 years ago. USA was one of the largest exporters, but some 3 years ago some analysts advanced the idea that it may become a net importer (it didn't happened, though. The scrap market is not only important, it is also very interesting, with twisted evolutions and volatile prices in some periods.

  4. Bearberry identification by a multidisciplinary study on commercial raw materials. (United States)

    Gallo, Francesca Romana; Multari, Giuseppina; Pagliuca, Giordana; Panusa, Alessia; Palazzino, Giovanna; Giambenedetti, Massimo; Petitto, Valentina; Nicoletti, Marcello


    Herbal species different from the official bearberry, Arctostaphylos uva-ursi, are sold through conventional markets and also through non-controlled Internet websites, putting consumer safety at risk owing to the lack of quality control. Recently, Arctostaphylos pungens has become one of the most used species as a raw material for herbal medicines and dietary supplements in the place of official bearberry, a plant used for the treatment of various urinary disorders. A fingerprint identification based on an integrated application of different analytical techniques (HPTLC, NMR, HPLC-DAD and LC-ESI-MS) is here described to distinguish A. uva-ursi from A. pungens. The HPTLC and HPLC-DAD fingerprints resulted the simplest methods to differentiate the two species, whereas LC-ESI-MS was more useful to quantify arbutin, the main component of bearberry, and to evaluate its different content in the two species. This multidisciplinary study showed for the first time a specific phytochemical fingerprint of the new species A. pungens.

  5. Climate changes, raw materials shortage, and economic development

    International Nuclear Information System (INIS)

    Joest, F.


    The possibility of a climate change being brought about by our national economies has dominated the national and international ecopolitical discussion of the past few years like no other topic. The present study is an attempt at an as comprehensive an examination as possible of this problem. It works from the assumption that examining and solving environmental problems requires the cooperation and creativity of investigators from different disciplines. It accordingly develops a concept permitting an integration of scientific, economic, and ethical questions impinging on the problem of the greenhouse effect. Thus the study contributes to the groundwork of an ecological economics. The interdisciplinary approach to analysing the connections between climate changes, raw materials consumption, and economic development is variously seen to pinpoint the complex temporal structure of the problems. It becomes clear that ecopolitical measures take a long time to actually become effective. Besides shifiting the focus to questions as to the scope and limits of politico-economic action, the temporal strucutre of the problem also reveals the limitations of scientifically founded ecopolitical recommendations. This brings the ethical aspect of analysing and solving environmental problems to the fore. (orig./UA) [de

  6. Plant development effects of biochars from different raw materials (United States)

    Cely, Paola; Méndez, Ana; Paz-Ferreiro, Jorge; Gascó, Gabriel


    Biochar can provide multiple benefits in the ecosystem. However, the presence of phytotoxic compounds in some biochars is an important concern that needs to be addressed and that depends on the raw material and the pyrolysis conditions used in biochar production. For example, sewage sludge biochars can have elevated heavy metal contents as they were present in the feedstock and were enriched during pyrolysis. Also during carbonization, some phytotoxic compounds such as polycyclic aromatic hydrocarbons (PAHs), polyphenols or volatile organic compounds (VOCs) could be formed representing a risk of contamination to soils and crops. In this work we report the results from seed germination and plant development for three biochars prepared from wood, paper sludge plus wheat husks and sewage sludge. Five higher plant species (cress, lentils, cucumber, tomato and lettuce) were studied. Biochar from wood shows seed inhibition in several species and the paper sludge biochar on lettuce. For the rest, the effect on seed germination was positive. No inhibition of root growth was detected, but in some cases leaves and stems growth were inhibited. Our results are significant in terms of advancing or current understanding on the impacts of biochar on vegetative growth and linking those effects to biochar properties.

  7. Use of basaltic waste as red ceramic raw material

    Directory of Open Access Journals (Sweden)

    T. M. Mendes

    Full Text Available Abstract Nowadays, environmental codes restrict the emission of particulate matters, which result in these residues being collected by plant filters. This basaltic waste came from construction aggregate plants located in the Metropolitan Region of Londrina (State of Paraná, Brazil. Initially, the basaltic waste was submitted to sieving (< 75 μm and the powder obtained was characterized in terms of density and particle size distribution. The plasticity of ceramic mass containing 0%, 10%, 20%, 30%, 40% and 50% of basaltic waste was measured by Atterberg method. The chemical composition of ceramic formulations containing 0% and 20% of basaltic waste was determined by X-ray fluorescence. The prismatic samples were molded by extrusion and fired at 850 °C. The specimens were also tested to determine density, water absorption, drying and firing shrinkages, flexural strength, and Young's modulus. Microstructure evaluation was conducted by scanning electron microscopy, X-ray diffraction, and mercury intrusion porosimetry. Basaltic powder has similar physical and chemical characteristics when compared to other raw materials, and contributes to ceramic processing by reducing drying and firing shrinkage. Mechanical performance of mixtures containing basaltic powder is equivalent to mixtures without waste. Microstructural aspects such as pore size distribution were modified by basaltic powder; albite phase related to basaltic powder was identified by X-ray diffraction.

  8. The key numbers of the mineral raw materials

    International Nuclear Information System (INIS)

    Mandil, C.


    Mineral raw materials come from fossil reserves or ores resulting from the geologic and climatic history of the Earth. The access to economic development for 80% of the worldwide population and the high rate of demographic growth (probably 8 billions of inhabitants in 2025) are important factors that can greatly multiply the worldwide consumption of ores. In parallel, environmental concerns and the increasing need for a better equilibrium between wildlife preservation and the supply of economic needs, lead to a more reasonable and mastered use of natural resources. The aim of this book is to shade light and give global elements of thoughts on mineral resources, and for the main of those (about 30 metals and mineral substances), to review the most useful data and references about their production and consumption. For each question, chapters are devoted to the situation of France in its worldwide context. One chapter concerns the uranium ores (reserves, production, prices evolution, consumption, economic flux and companies involved). (J.S.)

  9. Radiation situation during underground mineral raw materials mining

    International Nuclear Information System (INIS)

    Ogorodnikov, B.I.


    One studied the content and the ratio of 4 0 K, 226 Ra, 232 Th and 238 U natural radionuclides in the ores mined in Egypt, Iran, China and Turkey. It is shown that in some ores, for example, in the carbonaceous shale mined in China, in the Iranian bauxite and turquoise Ra eq is higher than 370 Bq/kg, that is, it is higher than the value recommended by the International Scientific Committee on Radiation Effect. The Chinese bituminous shale shows high content of 226 Ra, while 226 Ra/ 232 Th concentration ratio varies between 10 and 60 in contrast to that of other numerous mineral raw materials being close to 1-3. In a number of mines one recorded high concentrations of radon (higher than 300 Bq/m 3 ). Inhalation of such an air results in the essential internal irradiation. The average annual dose equivalents for miners may be higher than the maximum permissible value equal to 20 mSv/g [ru

  10. Study on optimum length of raw material in stainless steel high-lock nuts forging (United States)

    Cheng, Meiwen; Liu, Fenglei; Zhao, Qingyun; Wang, Lidong


    Taking 302 stainless steel (1Cr18Ni9) high-lock nuts for research objects, adjusting the length of raw material, then using DEFORM software to simulate the isothermal forging process of each station and conducting the corresponding field tests to study the effects of raw material size on the stainless steel high-lock nuts forming performance. The tests show that the samples of each raw material length is basically the same as the results of the DEFORM software. When the length of the raw material is 10mm, the appearance size of the parts can meet the design requirements.

  11. Development and Testing the Technology of Complex Transformation of Carbohydrates from Vegetable Raw Materials into Bioethanol

    Directory of Open Access Journals (Sweden)

    S.P. Tsygankov


    Full Text Available Results of development and testing the tentative technology of sweet sorghum and finger millet processing into bioethanol are described. The carbohydrates content and range of the studied vegetable biomass as the raw material is defined. Bioethanol potential output from sugar sorghum and finger millet carbohydrates and key technological parameters of preparation of both types of vegetable raw material for alcohol fermentation are defined. The concept of the tentative technology of bioethanol production from carbohydrate raw material of the first and second generations is offered. Testing of complex transformation of carbohydrates from vegetable raw materials into bioethanol is performed.

  12. Comparison of Different Wood Species as Raw Materials for Bioenergy

    Directory of Open Access Journals (Sweden)

    Bojana Klašnja


    Full Text Available Background and Purpose: Most projections of the global energy use predict that biomass will be an important component of primary energy sources in the coming decades. Short rotation plantations have the potential to become an important source of renewable energy in Europe because of the high biomass yields, a good combustion quality as solid fuel, ecological advantages and comparatively low biomass production costs. Materials and Methods: In this study, the wood of black locust Robinia pseudoacacia, white willow Salix alba L., poplars Populus deltoides and Populus x euramericana cl.I-214, aged eight years were examined. Immediately after the felling, sample discs were taken to assess moisture content, ash content, the width of growth rings, wood densities and calorific values, according to the standard methodology. Results:The mean values of willow, poplar and black locust wood density were 341 kg/m3, 336 kg/m3 and 602 kg/m3,respectively. The average heating values of willow poplar and black locust wood were 18.599 MJ/kg, 18.564 MJ/kg and 21.196 MJ/kg, respectively. The FVI index (average values was higher for black locust (17.186 than for poplar and willow clones, which were similar: 11.312 and 11.422 respectively. Conclusions: Black locust wood with a higher density, calorific value and ash content compared to poplar and willow wood proved to be a more suitable raw material as RES. However, it is very important, from the aspect of the application of wood of these tree species as RES, to also consider the influence of the biomass yield per unit area of the plantations established as “energy plantations”.

  13. Comparative study of the UV spectra of various raw materials OF Urtica dioica L.

    Directory of Open Access Journals (Sweden)

    E. A. Balagozyan


    Full Text Available Stinging nettle (Urtica dioica L. is one of the famous and popular medicinal plants. In Russia the herbal materials are nettle’s leaves which have haemostatic effect. At the same time abroad the rhizomes and roots of nettle are the source of drugs with antitumor activity. The chemical composition of the rhizomes and roots of nettle is quite complicated and is represented by substances such as polysaccharides, lectins, sterols etc. The aim of the present study is the comparative phytochemical research of various parts of raw nettle by spectrophotometry. The study of extracts from various raw materials of nettle has shown, that the presence of flavonoids is peculiar for leaves, flowers and fruits. Sterols dominate in the rhizomes and roots of nettle. It was also noted that the UV-spectra of extracts of female inflorescences and fruits nettle have the same absorption maxima.



    A. A. Gromkovskii; O. I. Sherstyuk


    Summary. In the article examines the statistical data on the development of average weight and average sugar content of sugar beet roots. The successful solution of the problem of forecasting these raw indices is essential for solving problems of sugar producing complex control. In the paper by calculating the autocorrelation function demonstrated that the predominant trend component of the growth raw characteristics. For construct the prediction model is proposed to use an autoregressive fir...

  15. Theoretical backgrounds of non-tempered materials production based on new raw materials (United States)

    Lesovik, V. S.; Volodchenko, A. A.; Glagolev, E. S.; Chernysheva, N. V.; Lashina, I. V.; Feduk, R. S.


    One of the trends in construction material science is development and implementation of highly effective finish materials which improve architectural exterior of cities. Silicate materials widely-used in the construction today have rather low decorative properties. Different coloring agents are used in order to produce competitive materials, but due to the peculiarities of the production, process very strict specifications are applied to them. The use of industrial wastes or variety of rock materials as coloring agents is of great interest nowadays. The article shows that clay rock can be used as raw material in production of finish materials of non-autoclaved solidification. This raw material due to its material composition actively interacts with cementing component in steam treatment at 90–95 °C with formation of cementing joints that form a firm coagulative-cristalized and crystallization structure of material providing high physic-mechanical properties of silicate goods. It is determined that energy-saving, colored finish materials with compression strength up to 16 MPa can be produced from clay rocks.


    Directory of Open Access Journals (Sweden)

    Michal Medvecký2


    Full Text Available Fruits of the highbush blueberries are popular for their beneficial effects on human health and for their excellent sweet-vine taste. Our work is focused on risk assessment of selected elements in relation to the content of bioactive compounds in wild and cultivated of highbush blueberries (Vaccinium corymbosum L.. Anthocyanins are polyphenols that are widely distributed in plants, and contribute to the brilliant blue, red or purple colour in leaves, flowers or fruits. In the samples the antioxidant capacity by the method of Brand – Williams using DPPH (2,2–difenyl-1-pikrylhydrazyl and the content of anthocyanins by the modified method Lapornik in two samples of wild blueberries from different areas of Slovakia (Čertovica and Oravské Veselé and in 6 cultivated varieties highbush blueberry (Bluejay, Bluecrop, Patriot, Berkeley, Brigitta, Nelson were determined. The contents of risky elements - Cd, Pb were assessed by AAS method. The contents of Pb were in all observed samples higher than the maximum limit given by the legislation (cultivated: 0.5612 – 0.9912, wild: 0.792 – 0.874 The measured content values of Cd were in all samples of blueberries lower than hygienic limit. The highest content of anthocyanins from analysed samples was in wild blueberries from surrouding Čertovica 4870.125 ± 22.803, but in this sample was simultaneously the lowest antioxidant capacity of 61.15 ± 1.002 %. The highest antioxidant capacity was measured in sample of cultivated variety Bluejay 87.175 ± 0.45 %. It is important to carry out monitoring of heavy metals to consumption of safe food raw materials and foodstuffs.

  17. Introduction. Physicochemical aspects of uranium concentrates obtaining from the wastes and raw materials

    International Nuclear Information System (INIS)

    Mirsaidov, I.U.


    The uranium deposits of Tajikistan played an immensely significant role in the practical solution of a radioactive raw materials problem which appeared during the post-World War II years in the USSR. The pioneer in this field became complex №6 (currently known as 'Vostokredmet'). The first soviet uranium was produced from the ores extracted from the republic's deposits. For 50 years (1945-1995 y.), uranium bearing raw materials from all over the former USSR were delivered to Tajikistan, and uranium oxide was produced, which was later delivered back to Russia for further production of enriched uranium. The total volume of uranium produced in Tajikistan plants was approximately 100 thousands tons. In Sughd region, during that period, more than 55 million tons of uranium waste was accumulated. The total activity of the waste, according to different calculations, is approximately 240-285 TBq. The total amount of waste in dumps and tailings piles is estimated to be more than 170 million tons, most of which are located in the neighborhoods of hydrometallurgical plants and heap leaching locations. Uranium industry wastes in Northern Tajikistan have become attractive for different investors and commercial companies, from secondary reprocessing of mines and tailings' point of view, since the uranium price is increasing. In this regard, research on developing uranium extraction methods from wastes is broadening. The study of the possibility and economic reasonability of reprocessing former year's dumps requires comprehensive examination, and relates not only to uranium extraction but to safe extraction of dumps from tailings as well.

  18. Exploring China's materialization process with economic transition: analysis of raw material consumption and its socioeconomic drivers. (United States)

    Wang, Heming; Tian, Xin; Tanikawa, Hiroki; Chang, Miao; Hashimoto, Seiji; Moriguchi, Yuichi; Lu, Zhongwu


    China's rapidly growing economy is accelerating its materialization process and thereby creating serious environmental problems at both local and global levels. Understanding the key drivers behind China's mass consumption of raw materials is thus crucial for developing sustainable resource management and providing valuable insights into how other emerging economies may be aiming to accomplish a low resource-dependent future. Our results show that China's raw material consumption (RMC) rose dramatically from 11.9 billion tons in 1997 to 20.4 billion tons in 2007, at an average annual growth rate at 5.5%. In particular, nonferrous metal minerals and iron ores increased at the highest rate, while nonmetallic minerals showed the greatest proportion (over 60%). We find that China's accelerating materialization process is closely related to its levels of urbanization and industrialization, notably demand for raw materials in the construction, services, and heavy manufacturing sectors. The growing domestic final demand level is the strongest contributor of China's growth in RMC, whereas changes in final demand composition are the largest contributors to reducing it. However, the expected offsetting effect from changes in production pattern and production-related technology level, which should be the focus of future dematerialization in China, could not be found.

  19. Comparison of Biochars Characteristics from Different Raw Materials

    Directory of Open Access Journals (Sweden)

    SUN Tao


    Full Text Available Biochar is the carbon-rich product from biomass under limited supply of oxygen. Biochar has been well recognized in enhancing terrestrial carbon sequestration and greenhouse gas mitigation as well as in improving soil fertility and plant productivity. To explore the differences of biochars produced from different raw materials, six biochar samples made from alfalfa straw, wheat straw, cotton straw, grape vines, sludge and lignite were selected as test material. Qualitative and quantitative analysis by fourier transform infrared spectroscopy(FTIR and Boehm titration were used to determine the amount of the surface functional groups of biochars. Meanwhile the scanning electron microscopy(SEM was used to characterize the surface morphology of biochar samples. In addition, the basic physicochemical characteristics of biochar samples, such as pH value, organic carbon content and cation exchange capacity were also determined. The results showed that all of the biochar were alkaline except the sludge biochar was acidic. The organic carbon content of alfalfa biochar was the highest(588.43 g·kg-1 and sludge biochar was the lowest(168.17 g·kg-1. Furthermore, the rank of cation exchange capacity was alfalfa straw biochar, cotton straw biochar > grape vine biochar > wheat straw biochar > sludge biochar > lignite biochar. FTIR spectrum showed that there were the aromatic hydrocarbon and the oxygen group on the surface of biochar and the structure of biochar was mainly based on the aromatic rings skeleton. The total functional groups content of alfalfa straw biochar was the highest, but that of sludge biochar was the lowest. The SEM results showed that there were obvious pore structure on the surface of plant-based biochar, but none on the surface of mineral-based biochar. Alfalfa straw biochar, wheat straw biochar, cotton straw biochar and grape vine biochar can be applied to improve farmland soil quality and increase soil fertility, and lignite biochar

  20. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim


    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  1. Optimizing Transport in Surface Mines, Taking into Account the Quality of Extracted Raw Ore

    Directory of Open Access Journals (Sweden)

    Marian Šofranko


    Full Text Available This articles concerns problemacy of appropriate separation of transporting mechanisms for mining minerals from individulalteritories. In the following sections of the article a model solution is presented with the use of newly created program for optimizationof transport, taking into account the required quality of extracted raw ore. This process is being done through computing analysisand programming language Borland C++ Builder

  2. Chances for a long-term securing of the raw material supply to the FRG. Pt. 1

    International Nuclear Information System (INIS)


    The Federal Republic of Germany is almost completely dependent on raw material imports. Growing raw material consumption and an imminent increase in supply uncertainties will require intensified research and development work in the field of raw material safeguarding. Initial approaches to possible technical solutions are being indicated in connection with four raw materials (aluminium, copper, phosphate and carbon carriers). The material balances of these raw materials are shown and the technical and economic interrelations illustrated in the light of world-wide trends. It is being demonstrated that two essential objectives are to be pursued for securing raw material supplies: 1) extension of the raw material basis for primary and secondary raw materials, 2) improvement of raw material utilization in all sectors of economy. To provide a solution for the wide spectrum of tasks it will be necessary to establish adequate analytical methods and procedures. (orig.) [de

  3. Secondary raw materials for synthesising new kind of cements

    Directory of Open Access Journals (Sweden)

    Goñi, S.


    Full Text Available The present paper is a comparative study of some characteristics of new belite cements obtained from two kind of wastes, which were used as secondary raw materials: fly ash (FA, of low CaO content, from coal combustion, and ash from incineration of municipal solid waste (MSWIA. Cements were synthesised in a range of temperature between 700°C and 900°C from MSWIA and FA, which were previously activated by hydrothermal treatment at 200°C The evolution of cemented phases with the heating temperature was followed by X-ray diffraction (XRD. The results were compared with those obtained from heating the starting FA and MSWIA without the previous hydrothermal treatment. The degree of hydration was quantitatively evaluated by the combined water content, determined from thermogravimetric analyses, during a period of 28 days or 200 days from mixing depending of hydration kinetics of each cement.

    Este trabajo es un estudio comparativo de algunas de las características de nuevos cementos belíticos, obtenidos a partir de dos tipos de residuos, como materia prima secundaria: cenizas volantes (CV de bajo contenido en cal, procedentes de la combustión del carbón y cenizas procedentes de la incineración de residuos sólidos urbanos (CIRSU. Los cementos fueron sintetizados en un rango de temperaturas comprendido entre 700°C y 900°C después de un tratamiento hidrotermal de la CV y CIRSU a 200°C La evolución de las fases cementicias, con la temperatura de calentamiento, fue estudiada por difracción de rayos X (DRX. Los resultados fueron comparados con aquellos obtenidos, directamente, por calentamiento de los residuos, sin un tratamiento hidrotermal previo de los mismos. El grado de hidratación fue cuantitativamente evaluado, por medio del análisis termogravimétrico, a partir del agua combinada de los cementos hidratados durante un período de 28 días o 200 días, dependiendo de la cinética de hidratación de cada cemento.

  4. Characterization of Lignocellulosic Biomass as Raw Material for the Production of Porous Carbon-based Materials

    Directory of Open Access Journals (Sweden)

    Saptadi Darmawan


    Full Text Available Lignocellulosic biomass is a potential raw material that can be used in the synthesis (manufacture of porous carbon stuffs. The properties of such porous carbon products are affected by the species of the raw material and the manufacturing process, among other things. This paper scrutinizes the related characteristics of lignocellulosic raw materials that indicate potential for the production of porous carbon. Three species were used: pine (Pinus merkusii wood, mangium (Acacia mangium wood, and candlenut (Aleurites moluccana shells, representing softwoods, hardwoods, and non-wood stuffs, respectively. Analyses of their chemical compounds and proximate contents were carried out. Additionally, nano scale scrutiny of the lignocellulosic biomass was also conducted using the nano capable instruments, which consisted of SEM, EDS, XRD, FTIR, and DSC. Results revealed that pine wood had the most potential to produce porous carbon. Morphologically, pine wood afforded the best permeability, whereby at the structure of monoclinic cellulose crystals, there were cellulose-I(alpha structures, which contained less cellulose-I(beta structures. Furthermore, pine wood exhibited greater volatile matter content, as confirmed through the FTIR, which greatly assisted the forming of porosity inside its corresponding carbon.

  5. Determination of barium and strontium in Basub(x)Srsub(1-x)Nbsub(2)Osub(6) monocrystals and raw materials after their solvent ' extraction separation with 1-phenyl-3-methyl-4-benzoylpyrazolone-5

    International Nuclear Information System (INIS)

    Sizonenko, N.T.; Egorova, L.A.


    The extraction of milligram amounts of barium and strontium by 1-phenyl-3-methyl-4-benzoylpyrazolone-5 solutions in various diluents has been examined. The possibility has been shown of using the reagent for extraction separation of the elements for determining the stoichiometric composition of barium- and strontium-based compounds. Conditions have been studied for separation of barium and strontium at their different ratios by the chromate method in the presence of EDTA. A procedure has been worked out of determining barium and strontium in the estimation of stoichiometric composition of charge and single crystals of barium-strontium niobates of different composition

  6. Occupational radiation protection in the mining and processing of raw materials

    International Nuclear Information System (INIS)


    The mining and processing of uranium ore, thorium ore and other raw materials containing natural radionuclides are carried out in a number of Member States. There is a clear need to update the guidance on the radiation protection of the workers involved, and this Safety Guide provides such updated guidance. Material from two previous publications has been adapted for inclusion in this Safety Guide. These previous publications - Radiation Monitoring in the Mining and Milling of Radioactive Ores (Safety Series No. 95) and Radiation Protection of Workers in the Mining and Milling of Radioactive Ores (Safety Series No. 26, hereby superseded) - dealt principally with activities involving uranium ore and thorium ore. Activity concentrations of naturally occurring radionuclides are elevated in other mineral deposits such as heavy mineral sands and phosphate rock. Furthermore, high radon levels may be found in mines, irrespective of the activity concentrations of natural radionuclides in the raw material being extracted. In recognition of these circumstances, this Safety Guide is intended to apply also to the mining and processing of any raw material for which radiation protection measures need to be considered. The IAEA Safety Fundamentals publication on Radiation Protection and the Safety of Radiation Sources presents the principles, concepts and objectives of protection and safety. Safety requirements based on the objectives and principles specified in these Safety Fundamentals, including requirements for the protection of workers exposed to ionizing radiation, are established in the International Basic Safety Standards for Protection against Ionizing Radiation and for the Safety of Radiation Sources (the Basic Safety Standards or Bss). These requirements also reflect the recommendations of the International Commission on Radiological Protection (ICRP). Safety Guides provide recommendations on the basis of international experience on the fulfilment of the requirements

  7. Traceability System Model for Quality Gelatin Raw Material of Cattle Hides

    Directory of Open Access Journals (Sweden)

    S Nur


    Full Text Available Several criteria must be accomplished within the provision of quality products in terms of the types of materials, the processing methods and effort to get it. Traceability system involves various parties that have different needs and goals in the process of supplying raw materials. Hence, there is a need for institutional systems engineering that can organize and manage the tracking process, the procurement of raw materials that guarantee the origin of gelatin raw materials, and facilitate the industry and customer to create a standardized quality of product. The purpose of the study formulates the institutional tracking models of gelatin raw material from cattle hide based on various criteria and assessment of the expert opinion. The methods used in this study were Interpretative structural modeling to formulate a representation of institutional tracking efficiently and analytical hierarchy process to determine the tracking strategy of industrial gelatin raw materials from cowhide. The results obtained from the study were some key elements of institutional tracking model for industrial gelatin raw materials from cowhide and the traceability strategies for industrial raw materials from cattle hide gelatin Indonesia. (Animal Production 12(3: 190-198 (2010 Key Words: traceability, institutional model, cattle hide, gelatin

  8. A Technological Comparison of Six Processes for the Production of Reduction-Grade Alumina from Non-Bauxitic Raw Materials (United States)

    Bengtson, K. B.

    The U. S. Bureau of Mines, by means of a contract with Kaiser Engineers and with Kaiser Aluminum & Chemical Corporation as a subcontractor, has sponsored a technological and an economic evaluation of six candidate processes for the manufacture of alumina from certain U. S. raw materials other than bauxite. This paper describes each process. Flow diagrams and the total energy requirement for each process are included. Important characteristics affecting the economics of producing alumina by each process are discussed, and some presently unsolved technical problems are identified. The extraction of alumina from clay via hydrochloric acid with iron separation by solvent extraction, and the crystallization of intermediate AlCl3·6H2O through the introduction of HCl gas into the pregnant mother liquor, appears to be technically feasible and the most attractive of the six raw material/process combinations.

  9. Technological project of serpentine raw material milling from Dobšiná heaps

    Directory of Open Access Journals (Sweden)

    Alena Pietriková


    Full Text Available Serpentine heaps in the surrounding of Dobšiná are an old ecological problem of the city and at the same time a suitable material for the production of MgCl2 and SiO2. The technology of the production is based on the chemical processing of the raw material, which is preceded by the raw material preparation comprising of the mechanical and hydraulic sorting, milling and the magnetic separation operations.

  10. Recovery of uranium and molybdenum elements from gebel gattar raw material, eastern desert, Egypt. Vol. 3

    International Nuclear Information System (INIS)

    El-Hazek, N.T.; Mahdy, M.A.; Mahmoud, H.M.K.


    G. Gatter uranium mineralizations are located along the faults and fracture zones crossing G.Gattar granitic pluton and long the contact of the pluton with the hammamat sediments. Also, molybdenum id presented in more than one mode of occurrence. The molybdenum mineralization treated in this work is the dessimenated type. The uranium and molybdenum raw material was subjected to series of leaching experiments including acid and alkaline agitation, alkaline percolation, and acid heap leaching techniques. Recovery of uranium and molybdenum was achieved by anion-exchange method followed by their elution by acidified sodium chloride. Uranium precipitation was performed in the form of ammonium diuranate (Yellow Cake). On the other hand molybdenum was precipitated in the form of molybdenum oxide. A tentative flowsheet for the extraction of both uranium and molybdenum is proposed and discussed. 13 figs., 3 tabs

  11. Recovery of uranium and molybdenum elements from gebel gattar raw material, eastern desert, Egypt. Vol. 3

    Energy Technology Data Exchange (ETDEWEB)

    El-Hazek, N T; Mahdy, M A; Mahmoud, H M.K. [Nuclear Materials Authority, Cairo, (Egypt)


    G. Gatter uranium mineralizations are located along the faults and fracture zones crossing G.Gattar granitic pluton and long the contact of the pluton with the hammamat sediments. Also, molybdenum id presented in more than one mode of occurrence. The molybdenum mineralization treated in this work is the dessimenated type. The uranium and molybdenum raw material was subjected to series of leaching experiments including acid and alkaline agitation, alkaline percolation, and acid heap leaching techniques. Recovery of uranium and molybdenum was achieved by anion-exchange method followed by their elution by acidified sodium chloride. Uranium precipitation was performed in the form of ammonium diuranate (Yellow Cake). On the other hand molybdenum was precipitated in the form of molybdenum oxide. A tentative flowsheet for the extraction of both uranium and molybdenum is proposed and discussed. 13 figs., 3 tabs.

  12. Importance and possibilities of secondary cycles (recycling), substitution and innovation in mineral raw and primary material supply

    Energy Technology Data Exchange (ETDEWEB)


    Part 1-4 of the series ''The basis of raw materials supply'' is intended to bring about a better understanding of the ''Concept for the supply of Austria with mineral raw- and primary materials''. Part 3 deals with recovery of raw material from old- and waste material as an important contribution to an extension of the supply's basis and to an improvement of raw material utilization.

  13. Globalization and its influence to the availability of the Raw material sources

    Directory of Open Access Journals (Sweden)

    Vodzinský Vladimír


    Full Text Available Process of globalization does not lead only to concentration of physical and financial capital, and to centralization of its managing, what can be considered as its main signs, but at same time it gives whole raw of new claims to realization of technologies and their material basis.One of very important claims is also change in structure and volume of raw materials, that is gradually viewing in increased change from consumption of so-called classical raw materials, without which it is not possible to create basic components of information technologies.Information technologies are then creating important basis for quickly developed new branches of economy.

  14. Quantitative analysis of raw materials mining of Sverdlovsk region in Russia (United States)

    Tarasyev, Alexander M.; Vasilev, Julian; Turygina, Victoria F.


    The purpose of this article is to show the application of some qualitative methods for the analysis of a dataset for raw materials. The main approaches used are related to the correlation analysis and forecasting with trend lines. It is proved that the future mining of particular ores can be predicted on the basis of mathematical modeling. It is also shown that there exists a strong correlation between the mining of some specific raw materials. Some of the revealed correlations have meaningful explanations, and for others one should look for sophisticated interpretations. The applied approach can be used for forecasting of raw materials exploitation in various regions of Russia and in other countries.

  15. INTRAW, the EU Observatory for raw materials: fostering international cooperation and developing new opportunities (United States)

    Correia, Victor; Allington, Ruth; Keane, Christopher


    A secure supply of raw materials is a European priority that extends beyond country borders and national policies. Recent European initiatives have pioneered the development of an EU strategy on raw materials emphasizing the concept of the "added value chain", which continues to pursue the three pillar strategy to: (1) ensure the fair and sustainable supply of raw materials from international markets, promoting international cooperation with developed and developing countries; (2) foster sustainable supply of raw materials from European sources, and (3) reduce consumption of primary raw materials by increasing resource efficiency and promoting recycling. This contribution presents the Horizon 2020 funded project INTRAW, the objective of which is to establish the European Union's International Observatory for Raw Materials. The creation and maintenance of the European Union's International Observatory for Raw Materials is designed to have a strong impact in two dimensions: 1. To narrow the existing gap in aspects of the raw materials knowledge infrastructure in the EU by providing a link with the same knowledge infrastructure in technologically advanced reference countries. This should contribute to the harmonization of mineral policies all over the EU, by providing data that enables evidence-based policies and appropriate, cost-effective management, planning and adaptation decisions by the public sector. This will benefit businesses, industry and society. The Observatory will also provide to policy makers in the EU and its Member States the data they need to facilitate discussion in multilateral forums. 2. To enable a better alignment of the R&I activities among the individual EU members and international cooperation countries AND between the European Union and international cooperation countries by boosting synergies with international research and innovation programmes. This way the EU's role and scientific capabilities in the raw materials area will be

  16. Annual report 2005 General Direction of the Energy and raw materials

    International Nuclear Information System (INIS)


    This 2005 annual report of the DGEMP (General Direction of the Energy and the raw Materials), takes stock on the energy bill and accounting of the France. The first part presents the electric power, natural gas and raw materials market in France. The second part is devoted to the diversification of the energy resources with a special attention to the renewable energies and the nuclear energy. The third part discusses the energy and raw materials prices and the last part presents the international cooperation in the energy domain. (A.L.B.)

  17. Study of mechanoactivation of tungsten-molybdenum containing raw material in gas-jet mill

    International Nuclear Information System (INIS)

    Agnokov, T.Sh.; Gorobets, L.Zh.; Martynenko, V.P.; Fedorov, Yu.P.; Krakhmaleva, M.T.; Sokolova, L.A.


    Investigation is aimed at intensifying autoclave-soda leaching of tungsten-molybdenum-containing raw material. Connection of reactivity and physicochemical properties of crushed tungsten-molybdenum-containing products under different gas-jet crushing parameters is investigated. Optimal technological indices of hydrometallurgical reprocessing of tungsten-molybdenum-containing raw materials and products processed by gas-jet technique are given. The results obtained point out to perspectiveness of applying gas-jet technique of thermomechanical processing for intensifying and increasing the quality of tungsten- and molybdenum-containing raw materials and products of hydrometallurgical production

  18. Mining Pribram in science and technology. Proceedings of Session U - Mineral raw materials treatment

    International Nuclear Information System (INIS)

    Tomasek, J.; Vetejska, K.


    The proceedings of session ''Mineral raw materials treatment'' contain 27 papers of which only one deals with the application of nuclear technology, namely, the effect of fast electrons on the magnetic properties of the polymetallic Rudniany ore. (J.B.)

  19. Influence of stabilizer on the environment and their use as possible secondary raw material

    International Nuclear Information System (INIS)

    Jelenova, M.


    In this paper author deals with the environmental impact of coal combustion in coal fired power plants and with influence of ash and stabilizer on the environment and their use as possible secondary raw material

  20. Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)



    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  1. Influence of raw material properties upon critical quality attributes of continuously produced granules and tablets

    DEFF Research Database (Denmark)

    Fonteyne, Margot; Wickström, Henrika; Peeters, Elisabeth


    over a range of raw material attributes, manufacturing process options and process parameters. This fits further into the Process Analytical Technology (PAT) and Quality by Design (QbD) framework. The present study evaluates the effect of variation in critical raw material properties on the critical......-Lactose-PVP (30-67.5-2.5%) was used as model formulation. Seven different grades of theophylline were granulated. Afterward, the obtained granules were tableted. Both the characteristics of granules and tablets were determined. The results show that differences in raw material properties both affect...... quality attributes of granules and tablets, produced by a continuous from-powder-to-tablet wet granulation line. The granulation process parameters were kept constant to examine the differences in the end product quality caused by the variability of the raw materials properties only. Theophylline...

  2. Annual report 1997. Energies and raw materials; Rapport annuel 1997. Energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)



    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  3. Research and development programme of the EC in the field of raw materials 1982 to 1985

    International Nuclear Information System (INIS)



    Brussels: The EC Cabinet Council was presented a research and development programme in the field of raw materials for the years 1982 to 1985 which covers programmes already running and new actions as an overlapping raw material research programme of the EC. The new programme is divided up into 7 subprogrammes: I) metals and minerals (formerly: primary raw materials, II) uranium, III) ceramics, IV) wood as a renewable raw material, V) recycling of wastes (house and industry, VI) regaining of non-iron metals, VII) substitution. For the continuing of running actions and for beginning new projects in the 4 years plan, a total of 17 million ECU are to be allocated in the budget of the EC which will be used in cost sharing contracts or for coordinative projects. (orig./UA) [de

  4. Indicators for the use of raw materials in the context of sustainable development in Germany; Indikatoren/Kennzahlen fuer den Rohstoffverbrauch im Rahmen der Nachhaltigkeitsdiskussion

    Energy Technology Data Exchange (ETDEWEB)

    Giegrich, Juergen; Liebich, Axel; Lauwigi, Christoph; Reinhardt, Joachim [ifeu-Institut fuer Energie- und Umweltforschung GmbH, Heidelberg (Germany)


    Raw material productivity is a key indicator in the German strategy for sustainable development located in the chapter about ''conservation of resources''. Raw material productivity relates the gross domestic product (GDP) to the sum of domestically extracted abiotic raw materials and imported abiotic raw materials, semi-finished products and finished products. The main objective of this research project was to further develop or supplement this existing indicator. First of all the basic concepts of ''natural resource'' and ''raw material'' was clearly defined and put into the context of existing resource strategies. The broad concept of natural resource was adopted and six types of natural resources were identified (raw material, energy, water, land, biodiversity and the sink function of environmental media) Headline indicators were suggested for each of them. An aggregated indicator was developed and discussed which was called Environmental Impact Load (EVIL). The pressures represented by four resource indicators and four environmental indicators for the sink function were calculated for all imported goods with the help of 130 resource and environmental profiles and the German import statistics of the year 2005. This step was necessary to resolve the asymmetric approach of calculating the pressures caused by imports and domestic production and consumption. The ''rucksacks'' of the imports were accounted with domestic figures and the export ''rucksacks''. The raw material demand of imported goods expressed in raw material equivalent was derived to be twice as high as the domestic material extraction. Finally the function of the different resource indicators to represent each other was tested with the help of correlations. As a first approximation a certain correlation exists between some indicators. But it is recommended that each resource indicator should be kept

  5. Review of scientific Research results in identification of plant raw materials in food products




    Currently, the science-based capabilities have been generated to develop and test various identification methods of food products and reveal adulteration using advanced technique and processes. This article reviews researches and developments to identify the plant raw materials in food products based on morphological, anatomic, physical and chemical test methods and the latest DNA-technologies. Review of physical, chemical, anatomic and morphological test methods to identify raw materials bot...


    Directory of Open Access Journals (Sweden)

    A. M. Bukreev


    Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.

  7. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P. [All-Russia Research Institute of Preservation Technology (Russian Federation); Egorkin, A. V.; Chasovskikh, A. V. [Research Institute of Technical Physics and Automation (Russian Federation); Pavlov, Yu. S., E-mail: [Frumkin Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences (Russian Federation); Prokopenko, A. V., E-mail: [National Research Nuclear University (Moscow Engineering Physics Institute) (Russian Federation); Strokova, N. E. [Moscow State University (Russian Federation); Artem’ev, S. A. [Russian Research Institute of Baking Industry (Russian Federation); Polyakova, S. P. [Russian Research Institute of Confectionery Industry (Russian Federation)


    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  8. Enhancement of efficiency of storage and processing of food raw materials using radiation technologies

    International Nuclear Information System (INIS)

    Gracheva, A. Yu.; Zav’yalov, M. A.; Ilyukhina, N. V.; Kukhto, V. A.; Tarasyuk, V. T.; Filippovich, V. P.; Egorkin, A. V.; Chasovskikh, A. V.; Pavlov, Yu. S.; Prokopenko, A. V.; Strokova, N. E.; Artem’ev, S. A.; Polyakova, S. P.


    The work is dedicated to improvement of efficiency of storage and processing of food raw materials using radiation technologies. International practice of radiation processing of food raw materials is presented and an increase in the consumption of irradiated food products is shown. The prospects of using radiation technologies for the processing of food products in Russia are discussed. The results of studies of radiation effects on various food products and packaging film by γ radiation and accelerated electrons are presented.

  9. Evolution and characterization of eggshell as a potential candidate of raw material

    Directory of Open Access Journals (Sweden)

    T. Zaman

    Full Text Available Abstract Characterization of both uncalcined and calcined eggshells was done in this work. Raw eggshells turned out as a good source of calcite phase. Calcined eggshells had a mixture of lime and portlandite phase. A significant impact of calcination temperature on the percentage of generated phases was observed. Qualitative as well as semi-quantitative phase analysis, morphological characterization and physical property estimation was done for the produced powder. The influence of synthesized raw material on soil stabilization and biomaterial formation was further assessed. The eggshell turned out as a potential source of raw material for various sectors.

  10. Stochastic Modelling and Self Tuning Control of a Continuous Cement Raw Material Mixing System

    Directory of Open Access Journals (Sweden)

    Hannu T. Toivonen


    Full Text Available The control of a continuously operating system for cement raw material mixing is studied. The purpose of the mixing system is to maintain a constant composition of the cement raw meal for the kiln despite variations of the raw material compositions. Experimental knowledge of the process dynamics and the characteristics of the various disturbances is used for deriving a stochastic model of the system. The optimal control strategy is then obtained as a minimum variance strategy. The control problem is finally solved using a self-tuning minimum variance regulator, and results from a successful implementation of the regulator are given.

  11. Biotechnologies for critical raw material recovery from primary and secondary sources: R&D priorities and future perspectives

    NARCIS (Netherlands)

    Hennebel, T.; Boon, N.; Maes, S.; Lenz, M.


    Europe is confronted with an increasing supply risk of critical raw materials. These can be defined as materials of which the risks of supply shortage and their impacts on the economy are higher compared to most of other raw materials. Within the framework of the EU Innovation Partnership on raw

  12. Visual and colorimetric methods for rapid determination of total tannins in vegetable raw materials

    Directory of Open Access Journals (Sweden)

    S. P. Kalinkina


    Full Text Available The article is dedicated to the development of rapid colorimetric method for determining the amount of tannins in aqueous extracts of vegetable raw materials. The sorption-based colorimetric test is determining sorption tannins polyurethane foam, impregnated of FeCl3, receiving on its surface painted in black and green color of the reaction products and the determination of their in sorbent matrix. Selectivity is achieved by determining the tannins specific interaction of polyphenols with iron ions (III. The conditions of sorption-colorimetric method: the concentration of ferric chloride (III, impregnated in the polyurethane foam; sorbent mass in the analytical cartridge; degree of loading his agent; the contact time of the phases. color scales have been developed for the visual determination of the amount of tannins in terms of gallic acid. Spend a digitized image obtained scales using computer program “Sorbfil TLC”, excluding a subjective assessment of the intensity of the color scale of the test. The results obtained determine the amount of tannins in aqueous extracts of vegetable raw rapid method using tablets and analytical cartridges. The results of the test determination of tannins with visual and densitometric analytical signal registration are compared to known methods. Spend a metrological evaluation of the results of determining the amount of tannins sorption rapid colorimetric methods. Time visual and densitometric rapid determination of tannins, taking into account the sample preparation is 25–30 minutes, the relative error does not exceed 28 %. The developed test methods for quantifying the content of tannins allow to exclude the use of sophisticated analytical equipment, carry out the analysis in non-laboratory conditions do not require highly skilled personnel.

  13. Use of raw materials in the United States from 1900 through 2014 (United States)

    Matos, Grecia R.


    The economic growth of an industrialized nation such as the United States requires raw materials for construction (buildings, bridges, highways, and so forth), defense, and processing and manufacture of goods and services. Since the beginning of the 20th century, the types and quantities of raw materials used have increased and changed significantly. This fact sheet quantifies the amounts of raw materials (other than food and fuel) that have been used in the U.S. economy annually for a period of 115 years, from 1900 through 2014. It provides a broad overview of the quantity (weight) of nonfood and nonfuel materials used in the economy and illustrates the use and significance of raw nonfuel minerals in particular as building blocks of society.These data have been compiled to help the public and policymakers understand the changing annual flow of raw materials put into use in the United States. Such information can be helpful in assessing the potential effects of materials use on the environment, assessing materials’ intensity of use, and examining the role that these materials play in the economy. The data presented indicate the substitution and shift in materials usage from renewable to nonrenewable materials during the 20th century. The disaggregated quantities by commodity (not shown in this fact sheet) may be tested against supply adequacy and end of life issues.

  14. Effect of Selected Alternative Fuels and Raw Materials on the Cement Clinker Quality

    Directory of Open Access Journals (Sweden)

    Strigáč Július


    Full Text Available The article deals with the study of the effects of alternative fuels and raw materials on the cement clinker quality. The clinker quality was expressed by the content of two principal minerals alite C3S and belite C2S. The additions of alternative fuels ashes and raw materials, in principle, always increased the belite content and conversely reduced the amount of alite. The alternative fuels with high ash content were used such as the meat-bone meal, sewage sludge from sewage treatment plants and paper sludge and the used alternative raw materials were metallurgical slags - granulated blastfurnace slag, air cooled blastfurnace slag and demetallized steel slag, fluidized bed combustion fly ash and waste glass. Meat-bone meal, sewage sludge from sewage treatment plants and paper sludge were evaluated as moderately suitable alternative fuels which can be added in the amounts of 2.8 wt. % addition of meat-bone meals ash, 3.64 wt. % addition of sewage sludge ash and 3.8 wt. % addition of paper sludge ash to the cement raw mixture. Demetallised steel slag is suitable for production of special sulphate resistant cement clinker for CEM I –SR cement with addition up to 5 wt. %. Granulated blastfurnace slag is a suitable alternative raw material with addition 4 wt. %. Air cooled blastfurnace slag is a suitable alternative raw material with addition 4.2 wt. %. Waste glass is not very appropriate alternative raw material with addition only 1.16 wt. %. Fluidized bed combustion fly ash appears not to be equally appropriate alternative raw material for cement clinker burning with less potential utilization in the cement industry and with addition 3.41 wt. %, which forms undesired anhydrite CaSO4 in the cement clinker.

  15. Characterization of raw materials and manufactured binderless particleboard from oil palm biomass

    International Nuclear Information System (INIS)

    Hashim, Rokiah; Nadhari, Wan Noor Aidawati Wan; Sulaiman, Othman; Kawamura, Fumio; Hiziroglu, Salim; Sato, Masatoshi; Sugimoto, Tomoko; Seng, Tay Guan; Tanaka, Ryohei


    The objective of this study was to examine the extractive, holocellulose, alpha cellulose, lignin, starch, and sugar contents of oil palm biomass and to evaluate its suitability in binderless particleboard production. In this study, bark, leaves, fronds, mid-parts and core-parts of the trunks were used to produce experimental binderless particleboard panels. Binderless particleboard panels were made with a target density of 0.80 g/cm 3 at a temperature of 180 o C and a pressure of 12 MPa in a computer controlled hot press. The modulus of rupture, the internal bond strength, the thickness swelling and the water absorption of the panels were evaluated. Fourier transform infrared spectroscopy and field emission scanning electron microscopy were used to characterize the properties of the raw materials and the manufactured panels. The chemical composition of the oil palm biomass consisted of high holocellulose, lignin, starch and sugar contents that have been found to aid in the production of binderless particleboard. The core-part of the trunk contained the highest amount of starch and total sugar. Samples made from the core-parts and fronds had sufficient modulus of rupture and internal bond strength to meet the Japanese Industrial Standard. The internal bond strength of the mid-part panels also met the standard. However, binderless board prepared from bark and leaves showed poor modulus of rupture and internal bond strength. Samples from the core-parts had the lowest thickness swell and water absorption but did not meet the above standard. The Fourier transform infrared spectroscopy spectra did not show any substantial difference between the raw materials and the manufactured panels. Field emission scanning electron microscopy indicated that the compressed cells varied between raw material types and showed the presence of compressed cells with some starch granules that facilitated adhesion. Based on the findings of this study, oil palm has the potential to be used to

  16. Fuel Pellets from Biomass. Processing, Bonding, Raw Materials

    DEFF Research Database (Denmark)

    Stelte, Wolfgang

    in an increasing interest in biomass densification technologies, such as pelletization and briquetting. The global pellet market has developed quickly, and strong growth is to be expected for the coming years. Due to an increasing demand for biomass, the traditionally used wood residues from sawmills and pulp...... influence of the different processing parameters on the pressure built up in the press channel of a pellet mill. It showed that the major factor was the press channel length as well as temperature, moisture content, particle size and extractive content. Furthermore, extractive migration to the pellet...... surface at an elevated temperature played an important role. The second study presented a method of how key processing parameters can be estimated, based on a pellet model and a small number of fast and simple laboratory trials using a single pellet press. The third study investigated the bonding...

  17. Contamination of the cement raw material in a quarry site by seawater intrusion, Darica-Turkey (United States)

    Camur, M. Zeki; Doyuran, Vedat


    The open pit mining nearby shoreline is planned to be extended into below sea level in order to use additional reserves of the cement raw material (marl). The raw material is currently contaminated by seawater intrusion below a depth of 20 m up to the distance of 90 m from shoreline. Seawater intrusion related contamination of the material used for the cement production was investigated by means of diffusion process for the future two below sea level mining scenarios covering 43 years of period. According to the results, chloride concentrations higher than the tolerable limit of a cement raw material would be present in the material about 10-25 cm inward from each discontinuity surface, controlling groundwater flow, located between 170 and 300 m landward from the shoreline at below sea level mining depths of 0-30 m. The estimations suggest that total amounts of dilution required for the contaminated raw material to reduce its concentration level to the tolerance limit with uncontaminated raw material are about 113- to 124-fold for scenario I (13 years of below sea level mining after 30 years of above sea level mining) and about 126- to 138-fold for scenario II (43 years of simultaneous above and below sea level minings).

  18. Fracture mechanics of polymer mortar made with recycled raw materials


    Jurumenha,Marco Antonio Godoy; Reis,João Marciano Laredo dos


    The aim of this work is to show that industrial residues could be used in construction applications so that production costs as well as environmental protection can be improved. The fracture properties of polymer mortar manufactured with recycled materials are investigated to evaluate the materials behaviour to crack propagation. The residues used in this work were spent sand from foundry industry as aggregate, unsaturated polyester resin from polyethylene terephthalate (PET) as matrix and po...

  19. Decontamination of cosmetic and their raw materials by radiation

    International Nuclear Information System (INIS)

    Virzeu, D.M.


    The effects of gamma radiation over some cosmetic materials (solvent; thickening, talc, wax, vegetal oils, mineral, animal and synthetic oils, grease, emulsifying, conserving anti oxidizing and vitamin) are shown. The doses used were 20 KGy and 50 KGy, that are considered sterilizing and used in medical-surgical materials. The relation of the showed products is useful as a radio sensibility standard, but both can take as an indicator of what can be or not irradiated. (C.G.C.)

  20. Qualification Methods of Al2O3 Injection Molding Raw Materials

    International Nuclear Information System (INIS)

    Egész, Á; Gömze, L A


    For producing ceramic arc tube parts (plugs), there are used two different major components for producing injection molding raw material (feedstock): high purity alumina powder as the main component, and an organic paraffin wax as a binder material. It is expressly important to know the material, physical and chemical properties of these components, since mainly these have effect on the homogenity of feedstock, and therefore on the quality of end product. In this research, both of the main components and the moldable raw material was investigated by visual, physical, and thermal methods. As most important and main statement, the researchers found that the dynamic viscosity of raw material depends more on the applied temperature, than on the deformation speed gradient.Applied analitycal methods were laser granulometry, sieve analysis, differential thermal analysis and rheology analysis. (paper)

  1. Microbiological decontamination of botanical raw materials and corresponding pharmaceutical products by irradiation

    International Nuclear Information System (INIS)

    Katusin-Razem, B.; Novak, B.; Razem, D.


    Microbiological contamination typical of botanical raw materials used in the manufacture of pharmaceuticals decreases with the increasing level of processing, on going from flowers and leaves (10 4 -10 8 CFU/g), to fruits and seeds (10 2 -10 6 CFU/g), to liquid extracts (10 4 -10 6 CFU/g), and to dry extracts (10 2 -10 5 CFU/g). At the same time the resistivity of microflora to irradiation, expressed as a dose required for the first 90% reduction, increases along the same assortment as 2, 4, 5 and 5 kGy, respectively. This results in doses between 4 and 30 kGy required to treat typical contamination, or between 10 and 40 kGy for severe cases. The contamination of final products, phyto-therapeutic ointments (10 4 -10 7 CFU/g), is relatively sensitive to irradiation (D first90%red =1 kGy) and usually does not require doses higher than 8 kGy

  2. Neutron activation determination of rhenium in mineral raw materials of complex composition

    International Nuclear Information System (INIS)

    Shiryaeva, M.B.; Lyubimova, L.N.; Salmin, Yu.P.; Ryumina, K.N.; Tatarkin, M.A.


    The method of neutron-activation rhenium determination in mineral raw material of complex composition is developed, according to which easily hydrolized elements: scandium, iron, lanthanum, ytterbium, protactinium, hafnium and partially ruthenium and osmium are isolated in the form of hydroxides after smelting of a sample, which has been previously irradiated in nuclear reactor (thermal neutron flux 1.2x10 13 n/cm 2 xs for 22 hr) with sodium peroxide and leaching of the melt by water. To separate Re from other interfering elements extraction of perrhenate-ion by methylethylketone from alkali solution is used. Interfering effect of gold is eliminated by its extraction with TBP 30% solution in toluence or benzene from 1 M HNO 3 . Activity of rhenium preparations, singled out from samples of comparison, is measured, using multichannel γ-spectrometer with Ge(Li)-coaxial detector of high resolution (approximately 2.0-2.2 keV over the line 122 keV 5+ Co). Relative standard deviation in Re content range 5x10 -7 -5x10 -2 % does not exceed 0.3

  3. Fracture mechanics of polymer mortar made with recycled raw materials

    Directory of Open Access Journals (Sweden)

    Marco Antonio Godoy Jurumenha


    Full Text Available The aim of this work is to show that industrial residues could be used in construction applications so that production costs as well as environmental protection can be improved. The fracture properties of polymer mortar manufactured with recycled materials are investigated to evaluate the materials behaviour to crack propagation. The residues used in this work were spent sand from foundry industry as aggregate, unsaturated polyester resin from polyethylene terephthalate (PET as matrix and polyester textile fibres from garment industry, producing an unique composite material fully from recycled components with low cost. The substitution of fresh by used foundry sand and the insertions of textile fibres contribute to a less brittle behaviour of polymer mortar.

  4. Free radical interactions between raw materials in dry soup powder. (United States)

    Raitio, Riikka; Orlien, Vibeke; Skibsted, Leif H


    Interactions at the free radical level were observed between dry ingredients in cauliflower soup powder, prepared by dry mixing of ingredients and rapeseed oil, which may be of importance for quality deterioration of such dry food products. The free radical concentrations of cauliflower soup powder, obtained by electron spin resonance (ESR) spectroscopy, rapidly become smaller during storage (40°C and relative humidity of 75%) than the calculated concentrations of free radicals based on the free radical concentrations of the powder ingredients used to make the soup powder and stored separately under similar conditions. Similarly, free radical concentrations decreased faster when any combination of two powder ingredients (of the three major ingredients of the soup powder) were mixed together and stored at 50°C for 1week than when each powder component was stored separately. Furthermore, yeast extract powder was found to play a key role when free radical interactions between powder ingredients occurred. The incubation of rapeseed oil with powder ingredients at 45°C for 24h, indicated the ability of cauliflower powder to increase the concentration of hydroperoxides in rapeseed oil, while yeast extract powder was found to prevent this hydroperoxide formation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Oil Extraction from “Morelos Rice” Bran: Kinetics and Raw Oil Stability

    Directory of Open Access Journals (Sweden)

    J. Zúñiga-Diaz


    Full Text Available “Morelos rice” is a variety of rice with certificate of denomination of origin. It is a large grain of opaque appearance and extra large size that is grown exclusively in Morelos state (Mexico. Thus, the quality and characteristics of its rice bran may affect the kinetic of the extraction process of its oil as well as its stability. Therefore, this work is oriented to determine the extraction kinetics of its oil and its oxidative stability. The latter one is obtained through the proposal of a method based on open-circuit potential measurements. The results showed that the rice bran has 21.44% of raw oil, with a chemical composition (based on fatty acids of 48.48% oleic acid, 35.26% linoleic acid, and 14.54% palmitic acid, as well as a free fatty acid content of 8.15%. A high percentage of its oil content can be recovered in a short time at room temperature, and its extraction kinetics is a function of both the washing and the diffusion of its oil. Under storage conditions the raw oil has a high stability, at least 8 months, and its oxidative stability was of 24, 9, and 7 hours at 50°C, 80°C, and 110°C, respectively.

  6. Raw-materials mixtures from waste of the coal industry for production of ceramic materials

    Energy Technology Data Exchange (ETDEWEB)

    Galpern, E I [Scientific-Manufacturing Enterprise ` ` Ceramics` ` , Donetsk (Ukraine); Pashchenko, L V [Inst. of Physical, Organic and Coal Chemistry of NASU, Donetsk (Ukraine)


    The liquidation of waste dumps on the surface of mining enterprises and realization of measures by environment protection of air and aquatic basins are connected to the complex processing of mining mass. The main directions of utilization of mining rocks and coal wastes realized in Ukraine industry are: - filling of mines worked-out area by grouting solutions; - ceramic brick, porous filling materials and binding materials production; - road-making, construction of hydrostructures and industrial objects; - output of concrete items predominantly for using in mining conditions. The peculiarity of wastes using in above-mentioned fields is the possibility of their mass application in quantities commensurable with valumes of their yields. The experience of enterprises work which process mining rocks into building materials by burning method (ceramic brick, porous aggregates of concretes as aggloporite, expanded clay aggregate) has shown that unconstant and, as the rule, exceeding norms content of carbon and sulphur in the rock results to deterioration of products quality and technological factors of production. Unstability of carbon content in raw material makes the burning process hardly operated. Obtained products having residual carbon in the view of coke residue are often characterized by lower physical-mechanical characteristics. (orig./SR)

  7. Overview of Raw Materials for Oil Field Chemicals and Challenges ...

    African Journals Online (AJOL)

    The local content contribution to the oil industry is however presently not up to five percent. The concept of the local content development is not about awarding of contracts to Nigerians with foreign counterparts, but developing and expanding the industry for the benefit of the majority. Comparative study of the local materials ...

  8. Radioactivity of raw materials, metallurgical and casting products

    International Nuclear Information System (INIS)

    Hons, J.


    At present, the radioactive contamination of metallurgical products and initial materials represent a potential obstacle in foreign and domestic trade. It is of course an undesirable threat o the living environment on the one side and, at the same time, a new incorrectly used means for suppressing competition and forming a protection 'umbrella' of the national market to desirable imports on the other hand

  9. Cost minimization through optimized raw material quality composition (United States)

    Urs Buehlmann; R. Edward Thomas; Xiaoqui Zuo


    Lumber, a heterogeneous, anisotropic material produced from sawing logs, contains a varying number of randomly dispersed, unusable areas (defects) distributed over each boards’ surface area. Each board's quality is determined by the frequency and distribution of these defects and the board's dimension. Typically, the industry classifies lumber into five...

  10. Fuel pellets from biomass - Processing, bonding, raw materials

    Energy Technology Data Exchange (ETDEWEB)

    Stelte, W.


    The present study investigates several important aspects of biomass pelletization. Seven individual studies have been conducted and linked together, in order to push forward the research frontier of biomass pelletization processes. The first study was to investigate influence of the different processing parameters on the pressure built up in the press channel of a pellet mill. It showed that the major factor was the press channel length as well as temperature, moisture content, particle size and extractive content. Furthermore, extractive migration to the pellet surface at an elevated temperature played an important role. The second study presented a method of how key processing parameters can be estimated, based on a pellet model and a small number of fast and simple laboratory trials using a single pellet press. The third study investigated the bonding mechanisms within a biomass pellet, which indicate that different mechanisms are involved depending on biomass type and pelletizing conditions. Interpenetration of polymer chains and close intermolecular distance resulting in better secondary bonding were assumed to be the key factors for high mechanical properties of the formed pellets. The outcome of this study resulted in study four and five investigating the role of lignin glass transition for biomass pelletization. It was demonstrated that the softening temperature of lignin was dependent on species and moisture content. In typical processing conditions and at 8% (wt) moisture content, transitions were identified to be at approximately 53-63 deg. C for wheat straw and about 91 deg. C for spruce lignin. Furthermore, the effects of wheat straw extractives on the pelletizing properties and pellet stability were investigated. The sixth and seventh study applied the developed methodology to test the pelletizing properties of thermally pre-treated (torrefied) biomass from spruce and wheat straw. The results indicated that high torrefaction temperatures above 275 deg

  11. Utilization of Iron Ore Tailings as Raw Material for Portland Cement Clinker Production

    Directory of Open Access Journals (Sweden)

    Li Luo


    Full Text Available The cement industry has for some time been seeking alternative raw material for the Portland cement clinker production. The aim of this research was to investigate the possibility of utilizing iron ore tailings (IOT to replace clay as alumina-silicate raw material for the production of Portland cement clinker. For this purpose, two kinds of clinkers were prepared: one was prepared by IOT; the other was prepared by clay as a reference. The reactivity and burnability of raw meal, mineralogical composition and physical properties of clinker, and hydration characteristic of cement were studied by burnability analysis, differential thermal analysis, X-ray diffraction, and hydration analysis. The results showed that the raw meal containing IOT had higher reactivity and burnability than the raw meal containing clay, and the use of IOT did not affect the formation of characteristic mineralogical phases of Portland cement clinker. Furthermore, the physical and mechanical performance of two cement clinkers were similar. In addition, the use of IOT was found to improve the grindability of clinker and lower the hydration heat of Portland cement. These findings suggest that IOT can replace the clay as alumina-silicate raw material for the preparation of Portland cement clinker.


    Directory of Open Access Journals (Sweden)

    Miroslav Matijaca


    Full Text Available Up to the last two decades cement was produced from mari called »tupina« (with about 76% CaCOj which is an ideal mixture for cement production. Due to the quantity decrease of this raw material, cement production went on using the mixture of other members of the flysch series: limestones, marls, clay, loess, sandstones a.o. By the analysis of natural materials the CaCO^ content has mostly been proved. Therefore, knowing the correlation of oxides in mineral raw material is of special significance. The article discusses investigation results of the correlation between CaCO-i and other oxides of the raw material (the paper is published in Croatian.

  13. One step sintering of homogenized bauxite raw material and kinetic study (United States)

    Gao, Chang-he; Jiang, Peng; Li, Yong; Sun, Jia-lin; Zhang, Jun-jie; Yang, Huan-ying


    A one-step sintering process of bauxite raw material from direct mining was completed, and the kinetics of this process was analyzed thoroughly. The results show that the sintering kinetics of bauxite raw material exhibits the liquid-phase sintering behavior. A small portion of impurities existed in the raw material act as a liquid phase. After X-ray diffraction analyses, scanning electron microscopy observations, and kinetics calculations, sintering temperature and heating duration were determined as the two major factors contributing to the sintering process and densification of bauxite ore. An elevated heating temperature and longer duration favor the densification process. The major obstacle for the densification of bauxite material is attributed to the formation of the enclosed blowhole during liquid-phase sintering.

  14. Reuse and recovery of raw materials: Towards the achievement of a resource-efficient society

    International Nuclear Information System (INIS)

    Brunori, Claudia; Cutaia, Laura; Norabito, Roberto


    Resource efficiency plays a key role in the transition from a linear to a circular economy system. During the last few decades a rapid growth in the number of materials used across complex products has occurred. Given the high economic importance of critical raw materials combined with relatively high supply risk, securing reliable and undistorted access of certain raw materials is of growing concern across the globe. Development of eco-innovative approaches devoted to closing the loop of resources is strongly needed, allowing the connection between production cycles and their territory.

  15. Energy and resource saving raw materials for dactyloscopy

    Directory of Open Access Journals (Sweden)

    Ikonnikova Lyubov F.


    Full Text Available The “developing” properties of ferromagnetic fingerprint powders are defined by the chemical nature and the particle sizes of the pigment which form acidity of its surface, adhesive and magnetic properties, and color spectrum. The optimum ratio of these physical and chemical parameters is observed in the pigment consisting of iron-containing sludge tempered at 800°C, which contains α-Fe2O3 and impurity of clay materials.


    Directory of Open Access Journals (Sweden)

    Artadi Nugraha


    Full Text Available The production and number of processed food industries have slightly increased; as a result, the companies must compete to maximize their profits by conducting their efficient production process. CV. Fiva Food is one of the companies in the field of processed foods, especially in processed meat that has implemented supply chain management. It is necessary for the company to take measurements of its performance and efficiency for the entire supply chain such as procurement of raw materials. The purposes of this study were to analyze the performance of the company's supply chain and determine the most efficient  method of procurement for its raw materials as well as and to provide recommendations for the company to improve its performance of entire supply chain. This study used SCOR in analyzing the performance of supply chain and EOQ and POQ method to be compared with the method that the company uses to determine which method of procurement for raw materials is the most efficient one. The result showed that based on the matrix, the company's performance is unfavorable when it was compared to the benchmark performance of inventory days of supply. In addition, this study showed that the POQ method produces the lowest total inventory cost with savings of Rp6.647.015 for raw materials of MDM whereas EOQ method produced the lowest total inventory cost with savings of Rp222.153,78 for raw materials of FQ85CL. Keywords: performance suppy chain, SCOR, fiva food, EOQ, POQ

  17. Efficiency of raw materials. Relief of the economy, environmental protection; Rohstoffeffizienz. Wirtschaft entlasten, Umwelt schonen

    Energy Technology Data Exchange (ETDEWEB)



    In the contribution under consideration, the Federal Statistical Office (Wiesbaden, Federal Republic of Germany) and the Federal Environmental Agency (Dessau-Rosslau, Federal Republic of Germany) present actual data and analyses from environmentally economic total computations. In Germany, the use of raw materials became more efficient. Thus, 580 tons of raw materials per million Euro of gross domestic product were needed in the year 2008, while still 680 tons of raw materials were needed in the year 2000. The economical handling of natural resources relieves the environment and enables economic chances for individual companies and national economy. The lowering of environmental effects is to be in the focus of withdrawal and use of raw materials. This requires a stronger reduction of the consumption of raw materials. Savings potentials and an increased efficiency must be aspired in the short and medium term. The politics must create suitable incentives and framework conditions. The contribution under consideration presents new activities and strategies in order to achieve these targets.


    Directory of Open Access Journals (Sweden)

    Suyanta Suyanta


    Full Text Available The research about synthesis and characterization of MCM-41 from rice husk has been done. Silica (SiO2 was extracted from rice husk by refluxing with 3M hydrochloric solution at 80 °C for 3 h. The acid-leached rice husk was filtered, washed, dried and calcined at 650 °C for 6 h lead the rough powder of rice husk silica with light brown in color. Characterization was carried out by X-ray diffraction (XRD and FTIR spectroscopy method. Rice husk silica was dissolved into the sodium hydroxide solution leading to the solution of sodium silicate, and used as silica source for the synthesis of MCM-41. MCM-41 was synthesized by hydrothermal process to the mixture prepared from 29 g of distilled water, 8.67 g of cetyltrimethyl ammonium bromide (CTMAB, 9.31 g of sodium silicate solution, and amount mL of 1 M H2SO4. Hydrothermal process was carried out at 100 °C in a teflon-lined stainless steel autoclave heated in the oven for 36 h. The solid phase was filtered, then washed with deionised water, and dried in the oven at 100 °C for 2 h. The surfactant CTMAB was removed by calcination at 550 °C for 10 h with heating rate 2 °C/min. The as-synthesized and calcined crystals were characterized by using FTIR spectroscopy, X-ray diffraction and N2 physisorption methods. In order to investigate the effect of silica source, the same procedure was carried out by using pure sodium silicate as silica source. It was concluded that silica extracted from rice husk can be used as raw materials in the synthesis of MCM-41, there is no significant difference in crystallinity and pore properties when was compared to material produced from commercial sodium silicate.

  19. Ferroelectric thin films using oxides as raw materials

    Directory of Open Access Journals (Sweden)

    E.B. Araújo


    Full Text Available This work describes an alternative method for the preparation of ferroelectric thin films based on pre-calcination of oxides, to be used as precursor material for a solution preparation. In order to show the viability of the proposed method, PbZr0.53Ti0.47O3 and Bi4Ti3O12 thin films were prepared on fused quartz and Si substrates. The results were analyzed by X-ray Diffraction (XRD, Scanning Electron Microscopy (SEM, Infrared Spectroscopy (IR and Rutherford Backscattering Spectroscopy (RBS. The films obtained show good quality, homogeneity and the desired stoichiometry. The estimated thickness for one layer deposition was approximately 1000 Å and 1500 Å for Bi4Ti3O12 and PbZr0.53Ti0.47O3 films, respectively.

  20. Natural radioactivity and human exposure by raw materials and end product from cement industry used as building materials

    International Nuclear Information System (INIS)

    Stojanovska, Z.; Nedelkovski, D.; Ristova, M.


    During the manufacturing process in the cement industry, raw materials of different levels of natural radioactivity are utilized. In this study we present the radiological impact of cements as a building material and the different raw materials used in their manufacture. A total of 218 samples of raw materials and their end product cements were collected from the cement industry of Macedonia (The Former Yugoslav Republic) during the period 2005-2007. The specific activities, evaluated by gamma spectrometry analysis, showed the highest mean specific activity in fly ash ( 226 Ra, 107 ± 45 Bq kg -1 ; 232 Th, 109 ± 30 Bq kg -1 ; 40 K, 685 ± 171 Bq kg -1 ), which is used as a raw material. However, the final cement product usually has relatively lower activity compared with the activity of the raw material and the mean specific activity of the final cement products were lower ( 226 Ra, 42 ± 10 Bq kg -1 ; 232 Th, 28 ± 6 Bq kg -1 ; 40 K, 264 ± 50 Bq kg -1 ). The radium equivalent activity and the hazard index were calculated for each sample to assess the radiation hazard. The mean annual effective dose originating from the cements was found to be 111 ± 22 μSv y -1 , which is below the recommended EC limit of 300 μSv y -1 .

  1. Irradiation as an alternative environment friendly method for microbiological decontamination of herbal raw material

    International Nuclear Information System (INIS)

    Gorecki, P.; Kedzia, B.; Migdal, W.; Owczarczyk, H.B.


    Microbiological contamination of herbal raw materials is a serious problem in the production of therapeutical preparations. A good quality of the product, according to the pharmaceutical requirements may be achieved by applying suitable methods of decontamination. The decontamination treatments should be fast and effective against all microorganisms. It should ensure the decontamination of both packaging and the product in order to act effectively against all the microorganisms present and must not reduce the sensory and technological qualities of the commodities. In the paper, the results of comparative investigations on the microbiological decontamination of herbal raw materials by chemical (ethylene oxide, methyl bromide) and physical method (irradiation) are presented. Decontamination of herbal raw materials by irradiation is a method by choice. It is because chemical methods have been recognized recently as not safe to the consumer. Irradiation, in turn, is technically feasible, very effective and friendly enough to environment process

  2. To the question of peculiarities of thermal activation of natural siliceous raw material

    Directory of Open Access Journals (Sweden)

    Chumachenko Natalya


    Full Text Available The results of research of activity enhancement of natural siliceous raw material are given in the article. Fossil meal of Khotynetsky deposit, diatomite of Sharlovsky deposit, silica clay of Balasheika deposit were used as natural active mineral admixtures. The influence of heat-treating temperature and dispersion on activity of different types of siliceous raw material is studied. The increase of activity of fixation of Ca(OH2 in several times is traced after heat-treating at a certain temperature in the range from 100 to 800°C. The type of activity change is discovered. Explanation is given connected with the change of silica structure in the surface layer. Parameters of the highest activity are defined for every type of siliceous raw material.

  3. Deer Bone Oil Extract Suppresses Lipopolysaccharide-Induced Inflammatory Responses in RAW264.7 Cells. (United States)

    Choi, Hyeon-Son; Im, Suji; Park, Yooheon; Hong, Ki-Bae; Suh, Hyung Joo


    The aim of this study was to investigate the effect of deer bone oil extract (DBOE) on lipopolysaccharide (LPS)-induced inflammatory responses in RAW264.7 cells. DBOE was fractionated by liquid-liquid extraction to obtain two fractions: methanol fraction (DBO-M) and hexane fraction (DBO-H). TLC showed that DBO-M had relatively more hydrophilic lipid complexes, including unsaturated fatty acids, than DBOE and DBO-H. The relative compositions of tetradecenoyl carnitine, α-linoleic acid, and palmitoleic acid increased in the DBO-M fraction by 61, 38, and 32%, respectively, compared with DBOE. The concentration of sugar moieties was 3-fold higher in the DBO-M fraction than DBOE and DBO-H. DBO-M significantly decreased LPS-induced nitric oxide (NO) production in RAW264.7 cells in a dose-dependent manner. This DBO-M-mediated decrease in NO production was due to downregulation of mRNA and protein levels of inducible nitric oxide synthase (iNOS). In addition, mRNA expression of pro-inflammatory mediators, such as cyclooxygenase (COX-2), interleukin (IL)-1β, and IL-12β, was suppressed by DBO-M. Our data showed that DBO-M, which has relatively higher sugar content than DBOE and DBO-H, could play an important role in suppressing inflammatory responses by controlling pro-inflammatory cytokines and mediators.

  4. Raw material generated from pet bottle recycling and its derivatives

    Directory of Open Access Journals (Sweden)

    João Almeida Santos


    Full Text Available The recycling process is no longer a pejorative connotation business to become the main business of any company not only because of the need to conserve virgin resources, but mainly because of the benefits to the environment. In this sense, this paper aims at assessing the possibility of exports of polyethylene terephthalate - PET known for - a type of product that can be recycled and reprocessed into products of various types and applications. This article has been structured based on exploratory research bibliographic database of scientific articles, books, newspapers and magazines where we analyze the main steps involved in the recycling of PET and its exploitation for export. Support of organizations and associations such as the Brazilian Association of PET (ABIPET contributed to the development of theoretical framework. The market operated and what can still be very large, with the possibility of exponential growth supported by: the economy in the use of virgin resources reduces the impact of chemicals in the environment, saving energy used in the production process, reducing the use of financial resources allocated to the reuse of materials.

  5. Prospect of trema orientalis as a pulping raw material in bangladesh

    International Nuclear Information System (INIS)

    Jahan, M.S.


    The pulp and paper industry in Bangladesh is looking for new raw materials with high productivity per hectare. Currently, bamboo and Gmelina arborea are the main pulping raw materials for the pulp and paper industry of the country. Trema orientalis is one of the fastest growing woods in the tropical region. This paper reviews the literature on the topic, in particular, related to the chemical, morphological and physical properties of T. orientalis and its suitability for pulping. In addition, the advantages and disadvantages of various ulping processes proposed in the literature were critically analyzed. It was concluded that T. orientalis is a potential pulp wood for the Bangladesh pulp and paper industry. (author)


    Directory of Open Access Journals (Sweden)

    Ivan Tomašić


    Full Text Available On the basis of performed explorations, in the phase of deposit preparation and development for exploitation the obtained results regarding the raw material quality were transfered to the surface. The results served both for the development and planning of deposit excavation dynamics and for the delineation of boundary contours by mineral raw materials within the deposit space considering the quality, The case presented in the article refers to the marl and limestone open pit for the cement industry, the »Partizan« near Split (the paper is published in Croatian.

  7. Mining of Radioactive Raw Materials as an Origin of the Nuclear Fuel Chain

    Directory of Open Access Journals (Sweden)

    Bedřich Michálek


    Full Text Available The mining of radioactive raw materials may be considered as an origin of the nuclear fuel chain and thus determines the amount of radioactive wastes which have to be stored safety in the final stage of the fuel chain. The paper informs about the existing trends in mining of radioactive raw materials in the world, provides an overview of development in mining in the Czech Republic and of possibilities of future exploiting some uranium deposits. It points a possibility of non-traditional obtaining uranium from mine waters from underground uranium mines closed and flooded earlier.

  8. Colorimetric determination of a paracetamole in raw material and in pharmaceutical dosage forms

    International Nuclear Information System (INIS)

    Usifoh, C.O; Adelusi, S.A.; Adebambo, R.F.


    A rapid, accurate and simple method is proposed for the determination of p-acetaminophen (paracetamole) in raw material, tablets and syrups. The method is based on measuring the intensity of the yellow color that developed when acute acetaminophen is allowed to react with p-dimethylaminobenzaldehyde in 2M HCl after heating. The color which absorbs in the visible region of gamma 450 nm is stable for several hours and the intensity is directly proportional to the concentration of the drug, that is, Beer lambert law is obeyed. The method can be used to analyse paracetamole in raw material and in pharmaceutical dosage forms. (author)

  9. Sensory properties of marinated herring (Clupea harengus) processed from raw material from commercial landings

    DEFF Research Database (Denmark)

    Nielsen, Durita; Hyldig, Grethe; Nielsen, Jette


    Sensory properties of marinated herring processed from raw material from Danish commercial catches were described and related to fishing season and biological, chemical and functional properties. Herring was caught on five cruises and stored on board in tanks or ice. The sensory profile of marina......Sensory properties of marinated herring processed from raw material from Danish commercial catches were described and related to fishing season and biological, chemical and functional properties. Herring was caught on five cruises and stored on board in tanks or ice. The sensory profile...

  10. Fractionation of extracts from paper and board food contact materials forin vitroscreening of toxicity

    DEFF Research Database (Denmark)

    Bengtström, Linda; Trier, Xenia; Granby, Kit


    materials, information on the exposure as well as on the toxicity of substances in the packaging must be obtained. This study describes a comprehensive method for the extraction and fractionation of substances present in paper and board FCMs for further investigation by in vitro testing and chemical...... assay. Both raw extracts and two of the fractions of the raw extracts gave a positive response in the AhR assay. The strategy of extraction followed by fractionation offers a powerful tool in order to make the workflow for screening FCMs for potentially adverse effects more efficient....


    Directory of Open Access Journals (Sweden)

    Karpiuk UV


    Full Text Available The aime of the study was to identify lectins in the Zea mays raw material: roots, stems, heads, leaves and corn silk and study their activity. Lectins activity has been studied using the biological method of ratuserytroagglutination. This method is based on formation of aggregates of lectins and rats erythrocytes. The activity unit was the floor amount of lectins that agglutinate erythrocytes. The protein nature of extracts that agglutinate has been determined using Bradford method. The lectins activity of Zea mays roots was 6,21±0,11 unit/mg of protein; of heads – 2,61±0,17 unit/mg of protein; of leaves – 0,62 ±0,05 unit/mg of protein; of corn silk – 1,06±0,08 unit/mg of protein; of stems – 0,97±0,09 unit/mg of protein. The greatest lectins activity was in leaves, stems and corn silk.

  12. Characterization of industrial wastes as raw materials for Emulsified Modified Bitumen (EMB) formulation (United States)

    Najib Razali, Mohd; Isa, Syarifah Nur Ezatie Mohd; Salehan, Noor Adilah Md; Musa, Musfafikri; Aziz, Mohd Aizudin Abd; Nour, Abdurahman Hamid; Yunus, Rosli Mohd


    This study was conducted to characterize industrial wastes for formulation of emulsified modified bitumen (EMB) in relation to their physical characteristic and elemental composition. This analysis will give information either raw materials from industrial wastes can be used for EMB formulation. Bitumen is produced from crude oil that is extracted from the ground which categorizes the crude oil as one of the non-renewable form of product. A vast environmental problem issues arises in Malaysia cause by the excessive manufacturing activity that lead to a miss-management of industrial waste has leads to the used of industrial waste in the EMB formulation. Industrial waste such as polystyrene, polyethylene and used automotive oil can be used as alternative to formulate bitumen. Then a suitable emulsifier needs to be added to produce the final product which is EMB. The emulsifier will yield a charge depends on its properties to bind the oily bitumen with water. Physical characteristic studies were performed by thermogravimetric Analysis (TGA), differential scanning calorimetry (DSC), flash point test, density rest and moisture content test. Fourier Transform Infrared Spectroscopy (FTIR) analysis was measured to determine the material’s molecular composition and structure.

  13. The raw material and waste activity balance in the projected nuclear power of Russia

    International Nuclear Information System (INIS)

    Adamov, E.O.; Ganev, I.Kh.; Lopatkin, A.V.; Muratov, V.G.; Orlov, V.V.


    Under discussion is the management of long-lived high-level wastes in the nuclear energy sector of Russia, the development of which on a large scale in the next century is motivated by the need for arresting the increasing consumption of fossil fuels. The prerequisites for the nuclear power growth consists in the design of naturally safe reactors and development of a transmutational nuclear fuel cycle (NFC) technology. The choice of operations in such a cycle and of their quantitative characteristics, is aimed at minimizing the wastes to approach the radiation balance with the natural uranium extracted and put to use. The paper discusses the way the approximation to the balance between the raw material and waste activity is influenced by introduction of the transmutational NFC (in case 2), inclusion of transmutation reactors into the energy mix (case 1), partial disposal of actinide wastes into outer space, and by recycling of protactinium (case 3). It is shown that such a balance can be sustained for a considerable time in cases 2 and 3 or throughout the operation stage of the future nuclear power (case 1). (orig.)

  14. Processing biofuels from farm raw materials - A systems study; Pelletering och brikettering av jordbruksraavaror - En systemstudie

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, Daniel; Bernesson, Sven


    Use of processed biofuels (pellets, briquettes) has greatly increased in Sweden in recent decades, mainly to replace fossil fuels in large boilers, e.g. in coal powder boilers. More recently, the demand from private households and residential heating systems has also increased, mainly due to conversion from fossil heating oil. This increased interest in pellets and briquettes for heating is beginning to cause a shortage of the traditional raw materials, sawdust and wood shavings, and therefore attention is turning to using a variety of agricultural products as raw material. Such raw materials include cultivated energy crops and wastes and by-products from agriculture. This study describes the typical systems currently used for production of pellets and briquettes and investigates the possibility of using energy crops (Salix, reed canary-grass and hemp) and various wastes and by-products from processing of farm products (straw, cereal screenings, rape-seed meal and distiller's waste) as raw materials. Previous experiences of pelletizing and briquetting of these raw materials are reviewed in order to comprehensively identify possible combustion problems that may occur. On the basis of the results obtained, scenarios for possible production systems in a five-year perspective are presented and the costs and energy demands for these systems calculated. These future scenarios include large scale plants and micro-scale plants, as well as static and mobile equipment. The five main conclusions from the study are: - The farm raw materials of greatest interest for large-scale production are pelleted Salix and reed canary-grass. They have competitive prices and acceptable fuel properties and could be mixed with sawdust in existing large-scale pelletizing factories in Sweden. - Straw has low production costs but can cause serious ash-related problems. Hemp has too high production costs to be of commercial interest, while distiller's waste and rape-seed meal currently


    Directory of Open Access Journals (Sweden)

    Indramawan Hadi Kuswoyo


    Full Text Available Storage system in the manufacturing industry in this modern era is a very important role especially international scale company, may not directly produce or distribute all of the work unit. this led to the need for raw materials warehouse, warehouse storage systems should not be large in size because if supported by a good inventory of the warehouse to the maximum utilization of the problems faced by the company occurred in the warehouse of raw materials (raw materials. deficiencies in the arrangement of items in the warehouse procedures cause problems in the warehouse, so the warehouse impressed narrow and less structured cause inefficiencies time retrieval and storage of materials, as well as complicate the operator in handling the placement process raw materials. In the method of shared storage and rail space (relationchip chart for the relationship between activity is indicated by activity relationship approach, which shows each activity as a single activity model in the form of a diagram. ARD basic idea of the link between patterns of flow of goods and location of service activities related to production activities. ARD is the development of ARC (activity relationship chart.

  16. Replacement of reserves zinc based on the recycling of technogenic raw materials

    Directory of Open Access Journals (Sweden)

    Olga Sergeevna Bryantseva


    Full Text Available In the article, the perspective trends of the expansion of the mineral-ore base of the Russian producers of zinc by recycling of technogenic raw materials are considered. The important role of recycling of resources for sustainable development of society and improve the environmental safety is justified. The main structural and dynamic characteristics of the use of mineral resource base for the production of zinc in Russia are considered. Raw materials opportunities and constraints for the development of zinc production are analyzed. In the paper, the structure and dynamics of the use of recycled materials by the largest producer of zinc in Russia are investigated. The methodical approach to the estimation of effectiveness of the industrial processing of technogenic metallurgical raw materials with the strategic flexibility of the implementation of projects is proposed and approved. The estimation of the effectiveness of a complex industrial processing of metallurgical zinc-containing dusts in a real production is carried out. The value of the strategic flexibility of the project of the industrial processing of the zinc-containing technogenic raw material is determined on the basis of the developed systematic approach. The value of the processes of recycling for sustainable production of zinc in Russia is revealed.

  17. Utilization of Shrimp Skin Waste (Sea Lobster) As Raw Material for the Membrane Filtration

    International Nuclear Information System (INIS)

    Rupiasih, Ni Nyoman; Windari, Putri; Sumadiyasa, Made; Suyanto, Hery


    In view of the increasing littering of the sea banks by shells of crustaceans, a study was carried out to investigate the extraction and characterization of chitosan from skin waste of sea lobster i.e. ‘Bamboo Lobster’ ( Panulirus versicolor ). Chitosan was extracted using conventional methods such as pretreatment, demineralization, deprotienization, and deacetylation. The result showed that the degree of deacetylation of chitosan obtained is 70.02%. The FTIR spectra of the chitosan gave a characteristic of –NH 2 band at 3447 cm –1 and carbonyl group band at 1655 cm −1 . This chitosan has been used to prepare membrane. The chitosan membrane 2% has been prepared using phase inversion method with precipitation by solvent evaporation. The membranes were characterized by FTIR spectrophotometer, Nova 1200e using BJH method, and filtration method. The results show that thickness of the membrane is about 134 μm. The FTIR spectra show that functional groups present in the membrane are -NH, -CH, C=O, and -OH. Using BJH method obtained that the pore diameter is 3.382 nm with pore density is 8.95 x 10 5 pores/m 3 . By filtration method obtained that pure water flux (PWF) of the membrane are 386.662 and 489.627 1/m 2 .h at pressure 80-85 kPa and 90-100 kPa, respectively. These results show that skin waste of sea lobster was discovered as a raw material to prepare chitosan membrane. The membrane obtained is belonged to mesoporous group which may use in microfiltration process. (paper)

  18. Characterization of raw materials to obtain the mass for white ware, using waste glass

    International Nuclear Information System (INIS)

    Cavalcanti, M.S.L.; Porto, V.S.; Meneses, R.L; Albuquerque, A.V.; Guedes, B.F.R.; Morais, C.R.S.; Santana, L.N.L.


    A major problem faced in the post modern society is the huge amount of glass, accumulated in landfills cities. The glass material is one hundred percent recyclable and has the property to act as fluxes as well as feldspar. Given this premise, this study aimed to characterize materials - raw materials and waste glass regional plan for development of ceramic bodies with the similar behavior produced industrially, using shards of glass to partially replace the feldspar. The materials - raw materials used were clay, ball clay, kaolin, quartz, feldspar and shard of glass, being characterized by the techniques: chemical analysis, size analysis, differential thermal analysis vibrational spectroscopy in the infrared region, the Ray-Diffraction X and scanning electron microscopy. The results showed that the waste had higher rates of vitreous oxides fluxes and similar. (author)

  19. An integrated production-inventory model for food products adopting a general raw material procurement policy (United States)

    Fauza, G.; Prasetyo, H.; Amanto, B. S.


    Studies on an integrated production-inventory model for deteriorating items have been done extensively. Most of the studies define deterioration as physical depletion of some inventories over time. This definition may not represent the deterioration characteristics of food products. The quality of food production decreases over time while the quantity remains the same. Further, in the existing models, the raw material is replenished several times (or at least once) within one production cycle. In food industries, however, a food company, for several reasons (e.g., the seasonal raw materials, discounted price, etc.) sometimes will get more benefit if it orders raw materials in a large quantity. Considering this fact, this research, therefore, is aimed at developing a more representative inventory model by (i) considering the quality losses in food and (ii) adopting a general raw material procurement policy. A mathematical model is established to represent the proposed policy in which the total profit of the system is the objective function. To evaluate the performance of the model, a numerical test was conducted. The numerical test indicates that the developed model has better performance, i.e., the total profit is 2.3% higher compared to the existing model.

  20. On the increasing multifunctionality of agricultural raw materials: three dilemmas for innovation and adoption

    NARCIS (Netherlands)

    Boehlje, M.; Bröring, S.


    The agricultural sector is increasingly becoming multifunctional. It is the entry point of several value chains. Agricultural raw materials are increasingly being used for multiple industries or sectors beyond the traditional fiber and nutrition industries—energy in the form of ethanol and

  1. The increasing multifunctionality of Agricultural Raw Materials: Three dilemmas for Innovation and Adoption

    NARCIS (Netherlands)

    Boehlje, M.; Bröring, S.


    Agricultural raw materials are increasingly being used for multiple industries or sectors beyond the traditional fiber and nutrition industries: energy in the form of ethanol and biodiesel, industrial products such as polymers and bio-based synthetic chemicals and fibers, and pharmaceutical/health

  2. Dependence of quality properties for grey iron on used raw materials

    Directory of Open Access Journals (Sweden)

    E. Weiss


    Full Text Available Grey iron castings keep the first place among castings on base of iron. Present trend in growing entrance production costs of cast stock force manufacturer to cost minimizing. Therefore is most actual deal replacement pig iron by steel scrap. In contribution are presented results research work relating to influence of raw materials on grey iron properties.

  3. Raw material changes and their processing parameters in an extrusion cooking process

    DEFF Research Database (Denmark)

    Cheng, Hongyuan; Friis, Alan

    In this work, the effects of raw material and process parameters on product expansion in a fish feed extrusion process were investigated. Four different recipes were studied with a pilot-scale twin-screw co-rotating extruder according to a set of pre-defined processing conditions. In the four rec...

  4. Uncertainty analysis in raw material and utility cost of biorefinery synthesis and design

    DEFF Research Database (Denmark)

    Cheali, Peam; Quaglia, Alberto; Gernaey, Krist


    are characterized by considerable uncertainty. These uncertainties might have significant impact on the results of the design problem, and therefore need to be carefully evaluated and managed, in order to generate candidates for robust design. In this contribution, we study the effect of data uncertainty (raw...... material price and utility cost) on the design of a biorefinery process network....

  5. Elaborations in the area of complex reprocessing of mineral raw materials

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.


    In present time complex using of raw materials has important significance as it connected with solving problems of creating of waste less and ecologically clean technologies. Elaboration and assimilation of waste less technologies has special significance for chemical, mountain-chemical, metallurgical branches of industry. In this part of book author gives several methods of waste less and ecologically clean technologies

  6. Cocoa pulp juice (sweatings) as a potential raw material for the ...

    African Journals Online (AJOL)

    Cocoa sweatings is a very interesting by-product of cocoa production and it forms the substrate for microbial growth during the fermentation process. Most of the sweatings go to waste during the processing of the cocoa beans and this has led to its utilization as a potential raw material for the development of soft drink to ...

  7. 21 CFR 1304.31 - Reports from manufacturers importing narcotic raw material. (United States)


    ... therefrom. (g) All in-process inventories should be expressed in terms of end-products and not precursors... following information shall be submitted for each type of narcotic raw material (quantities are expressed as... opium, crude alkaloids and other derivatives (quantities are expressed as grams of anhydrous base or...

  8. The transfer of natural Rhodamine B contamination from raw paprika fruit to capsicum oleoresin during the extraction process. (United States)

    Wu, Naiying; Gao, Wei; Lian, Yunhe; Du, Jingjing; Tie, Xiaowei


    Occurrence of Rhodamine B (RhB) contamination in paprika caused by agricultural materials during the vegetation process has been reported. It may transfer during the process of active compounds extraction, and eventually exist in final products. Herein, the re-distribution of RhB during the extraction process was assessed in terms of RhB contents, as well as mass, color value and capsaicinoids yield of each process. Results revealed that natural RhB contamination at 0.55-1.11µg/kg originated from raw paprika fruit then transferred with the extraction proceeded. About 95.5% of RhB was found in red oleoresin. After separation of red oleoresin, 91.6% of RhB was remained in capsicum oleoresin, only 3.7% in paprika red. These results were consistent with total capsaicinoids recovery of each product. The RhB levels in edible capsicum oleoresin in our present study at 0.01-0.34µg/kg did not exceed the legal limits established by the European Union. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Current problems of raw fish material processing while manufacturing dried products

    Directory of Open Access Journals (Sweden)

    Yashonkov A. A.


    Full Text Available The substantiation for using techniques of fish raw material canning has been presented, raw fish being caught or farmed in aquaculture. The main problems in raw fish canning have been reviewed, including significant reduction in thermolabile vitamins in the ultimate product as compared with the raw material due to the thermal processing. Promising canning technique – vacuum drying – has been proposed. This technique makes possible to reduce the temperature of thermal processing down to 50…55 °С and significantly enlarge preservation of thermolabile vitamins from the raw fish. Sampling of raw materials, semi-finished products, finished products, including preparation for analysis has been conducted by standard methods. Disadvantages of this way have been found, it is low energy efficiency of the process. The way to intensify the vacuum drying of aquatic organisms has been proposed based on the method of preliminary pore-forming due to augmenting the area of moisture evaporation. The design of the pilot plant has been proposed in order to research the process of pore forming and vacuum drying. Target species for processing have been suggested. They are as follows: Azov goby (fillet for food products and Black Sea sprat for feeds. The recipes of the feed mixture for granulated floating food for trout have been developed. The results of the first series of the pilot research have been provided. The experiments have proved that preliminary pore forming immediately before vacuum drying makes possible to enlarge the surface area of moisture evaporation by 15…25 %. By processing photomicrographs of sections by means of a special software the authors have got the results demonstrating that when manufacturing dried products by pore forming and drying under pressure 10 kPa the pore take 35...38 % of the inner volume of the product and with drying under pressure 10 kPa – only 18...21 %, and when drying under the atmospheric pressure – 11...13 %.

  10. Improving the Technology of Obtaining Technical Ethanol from Alternative Raw Materials

    Directory of Open Access Journals (Sweden)

    Sergіj Petrov


    Full Text Available The purpose of the article is to study the properties of fallen leaves as raw materials for the production of bioethanol; Improvement of the technology of recycling cellulosic raw materials into bioethanol in the most energy-efficient and ecological way. As a result of the study, it has been found out that the production of biofuels from renewable raw materials is characterized by features of innovative technology: the rapid growth of this sector of economy is accompanied by a significant increase in market share. The use of fallen leaves as raw material will eliminate the current conflict of interests associated with the use of food raw materials for the production of bioethanol, will prevent the withdrawal of resources from the sphere of food production. Significant positive factors in the production and use of biofuels are improvement of environmental conditions, reduction of the harmful effects of exhaust gases on the human body, reducing environmental pollution and, consequently, reducing morbidity and associated costs of medical care. The use of bioethanol as an ecobiopilot makes it possible to increase the octane number of fuel, and, accordingly, increase the efficiency of the engine. Thus, the use of bioethanol leads to a qualitative improvement of technical and economic indicators, which is also an indicator of innovation. The threat of reducing (exhausting non-renewable sources of energy is also the factor that necessitates the development and improvement of biofuel production technology. The relatively low profitability of biofuel production is due to the low yield of the target product and the high cost of pre-treatment of cellulose raw materials. The method of obtaining bioethanol from renewable non-demanded raw materials - fallen leaves - was improved. The technique allows to increase the bioethanol yield due to more effective hydrolysis of hard-hydrolysable polysaccharides. Further development of the study of the differences in

  11. High-Temperature Release of SO2 from Calcined Cement Raw Materials

    DEFF Research Database (Denmark)

    Nielsen, Anders Rooma; Larsen, Morten B.; Glarborg, Peter


    During combustion of alternative fuels in the material inlet end of cement rotary kilns, local reducing conditions may occur and cause reductive decomposition of sulfates from calcined cement raw materials. Decomposition of sulfates is problematic because it increases the gas-phase SO2...... concentration, which may cause deposit formation in the kiln system. In this study, the release of sulfur from calcined cement raw materials under both oxidizing and reducing conditions is investigated. The investigations include thermodynamic equilibrium calculations in the temperature interval of 800–1500 °C...... and experiments in a tube furnace reactor in the temperature interval of 900–1100 °C. The investigated conditions resemble actual conditions in the material inlet end of cement rotary kilns. It was found that the sulfates CaSO4, K2SO4, and Na2SO4 were all stable under oxidizing conditions but began to decompose...

  12. The properties of weft knitted fabric medical and preventive treatment action using eco-raw materials (United States)

    Halavska, L.; Batrak, O.


    A new trend in the world is the clothing production using the new types of ecological raw materials application - milk, pineapple, coconut, hemp, banana, eucalyptus, clams, corn, bamboo, soya, nettle yarn. This makes it possible to create textile materials of new generation with unique antibacterial and antiseptic properties. Such materials have a positive preventive and sometimes therapeutic effect on people, and their health. Eco-raw materials clothing is able to protect the human body from the environment harmful effects: cold, heat, rain, dust, opportunely remove from underclothing layer the steam and gases, sweat; maintain in underclothing layer the necessary microclimate for normal organism functioning. Study of knitwear consumer properties, produced with eco-materials, is an urgent task of the world vector, directed on ecological environmental protection. This paper presents the research results of hygroscopicity and capillarity weft knitted fabrics, what knitted from different types of eco-raw materials: bamboo yarn, yarn containing soybean and nettle yarn. Character of influence of the liquid raising level changes depending on the experiment time and the knitting structure is revealed.

  13. Sustainability evaluation of essential critical raw materials: cobalt, niobium, tungsten and rare earth elements (United States)

    Tkaczyk, A. H.; Bartl, A.; Amato, A.; Lapkovskis, V.; Petranikova, M.


    The criticality of raw materials has become an important issue in recent years. As the supply of certain raw materials is essential for technologically-advanced economies, the European Commission and other international counterparts have started several initiatives to secure reliable and unhindered access to raw materials. Such efforts include the EU Raw Materials Initiative, European Innovation Partnership on Raw Materials, US Critical Materials Institute, and others. In this paper, the authors present a multi-faceted and multi-national review of the essentials for the critical raw materials (CRMs) Co, Nb, W, and rare earth elements (REEs). The selected CRMs are of specific interest as they are considered relevant for emerging technologies and will thus continue to be of increasing major economic importance. This paper presents a ‘sustainability evaluation’ for each element, including essential data about markets, applications and recycling, and possibilities for substitution have been summarized and analysed. All the presented elements are vital for the advanced materials and processes upon which modern societies rely. These elements exhibit superior importance in ‘green’ applications and products subject to severe conditions. The annual production quantities are quite low compared to common industrial metals. Of the considered CRMs, only Co and REE gross production exceed 100 000 t. At the same time, the prices are quite high, with W and Nb being in the range of 60 USD kg‑1 and some rare earth compounds costing almost 4000 USD kg‑1. Despite valiant effort, in practice some of the considered elements are de facto irreplaceable for many specialized applications, at today’s technological level. Often, substitution causes a significant loss of quality and performance. Furthermore, possible candidates for substitution may be critical themselves or available in considerably low quantities. It can be concluded that one preferred approach for the

  14. Raw materials exploitation in Prehistory of Georgia: sourcing, processing and distribution (United States)

    Tushabramishvili, Nikoloz; Oqrostsvaridze, Avthandil


    Study of raw materials has a big importance to understand the ecology, cognition, behavior, technology, culture of the Paleolithic human populations. Unfortunately, explorations of the sourcing, processing and distribution of stone raw materials had a less attention until the present days. The reasons of that were: incomplete knowledge of the archaeologists who are doing the late period archaeology (Bronze Age-Medieval) and who are little bit far from the Paleolithic technology and typology; Ignorance of the stone artifacts made on different kind of raw-materials, except flint and obsidians. Studies on the origin of the stone raw materials are becoming increasingly important since in our days. Interesting picture and situation have been detected on the different sites and in different regions of Georgia. In earlier stages of Middle Paleolithic of Djruchula Basin caves the number of basalt, andesite, argillite etc. raw materials are quite big. Since 130 000 a percent of the flint raw-material is increasing dramatically. Flint is an almost lonely dominated raw-material in Western Georgia during thousand years. Since approximately 50 000 ago the first obsidians brought from the South Georgia, appeared in Western Georgia. Similar situation has been detected by us in Eastern Georgia during our excavations of Ziari and Pkhoveli open-air sites. The early Lower Paleolithic layers are extremely rich by limestone artifacts while the flint raw-materials are dominated in the Middle Paleolithic layers. Study of these issues is possible to achieve across chronologies, the origins of the sources of raw-materials, the sites and regions. By merging archaeology with anthropology, geology and geography we are able to acquire outstanding insights about those populations. New approach to the Paleolithic stone materials, newly found Paleolithic quarries gave us an opportunities to try to achieve some results for understanding of the behavior of Paleolithic populations, geology and

  15. Potential of Technogenic Mineral Raw Materials in Russia and the Issues of its Rational Use

    Directory of Open Access Journals (Sweden)

    Larisa Ivanovna Goncharova


    Full Text Available The increasing negative impact of mining waste on natural ecosystems often leads to their irreversible destruction, a trend that is gradually becoming global. The particular relevance of the research is explained, on the one hand, by the possibilities of minimization of specific volumes of formation of mining waste in all types of industries; on the other hand, by the possibilities of maximization of comp rehensive use of their valuable components as secondary material resources on an economically rational basis and the possibilities of restoring the disturbed natural environment. The rational use of natural and technogenic mineral raw materials is greatly facilitated by the geological exploration and geological-economic evaluation of the resources, which requires the development of specific methodological approaches to the economic justification of resource estimation parameters for outlining and calculating the multicomponent commercial reserves of raw materials and separate valuable components in them. Analysis shows that researchers’ opinions on a number of methodological principles of sustainable mining, complex processing of multicomponent materials are often contradictory. Scientific publications do not consider the issue of the price valuation of mining waste as secondary material resources. Mining waste processing should be considered as an important part of the overall socio-ecological-economic system for rational nature management. The analysis of the existing practice of using the mining waste should be based on the system approach and take into consideration geological, technological, economic, environmental and social characteristics throughout the cycle of production, combined processing and treatment of secondary waste according to the principle “from the earth to the earth”. The article identifies the main barriers to the recycling of mining wastes, proposes several methodological guidelines for the sustainable mining and

  16. Effects of garlic extract on color, lipid oxidation and oxidative breakdown products in raw ground beef during refrigerated storage

    Directory of Open Access Journals (Sweden)



    Full Text Available The study aims to investigate the effects of garlic extracts on color, lipid oxidation, and oxidative breakdown products in raw ground beef during refrigerated storage. The two treatments were:control group (C, with no addition and experiment group (D, 50 mg garlic extracts added to 100 g beef. Adding garlic extracts significant increased a* value (PA ≤ 0.05, and significant decreased TBARS and PV values (PA ≤ 0.05. The pH and –SH value of D group had a decreasing tendency (PA=0.0522 and an increasing tendency (PA=0.0636 respectively compared to C group. Garlic extracts protected phospholipids, fatty acids and polypeptides from oxidation. The results indicatethat garlic extracts have the antioxidant activity, helping maintain the meat color, inhibiting lipid oxidation and protein degradation of raw ground beef during refrigerated storage.

  17. Raw materials evaluation and process development studies for conversion of biomass to sugars and ethanol

    Energy Technology Data Exchange (ETDEWEB)

    Wilke, C.R.; Yang, R.D.; Sciamanna, A.S.; Freitas, R.P.


    A range of cellulosic raw materials in the form of agricultural crop residue was analyzed for chemical composition and assessed for potential yields of sugars through chemical pretreatment and enzymatic hydrolysis of these materials. Corn stover was used as a representative raw material for a preliminary process design and economic assessment of the production of sugars and ethanol. With the process as presently developed, 23 gallons of ethanol can be obtained per ton of corn stover at a processing cost of about $1.80 per gallon exclusive of by-product credits. The analysis shows the cost of ethanol to be highly dependent upon (1) the cost of the biomass, (2) the extent of conversion to glucose, (3) enzyme recovery and production cost and (4) potential utilization of xylose. Significant cost reduction appears possible through further research in these directions.

  18. Lime kiln dust as a potential raw material in portland cement manufacturing (United States)

    Miller, M. Michael; Callaghan, Robert M.


    In the United States, the manufacture of portland cement involves burning in a rotary kiln a finely ground proportional mix of raw materials. The raw material mix provides the required chemical combination of calcium, silicon, aluminum, iron, and small amounts of other ingredients. The majority of calcium is supplied in the form of calcium carbonate usually from limestone. Other sources including waste materials or byproducts from other industries can be used to supply calcium (or lime, CaO), provided they have sufficiently high CaO content, have low magnesia content (less than 5 percent), and are competitive with limestone in terms of cost and adequacy of supply. In the United States, the lime industry produces large amounts of lime kiln dust (LKD), which is collected by dust control systems. This LKD may be a supplemental source of calcium for cement plants, if the lime and cement plants are located near enough to each other to make the arrangement economical.

  19. Calibration curves of a PGNAA system for cement raw material analysis using the MCNP code

    International Nuclear Information System (INIS)

    Oliveira, Carlos; Salgado, Jose


    In large samples, the γ-ray count rate of a prompt gamma neutron activation analysis system is a multi-variable function of the elemental dry composition, density, water content and thickness of the material. The experimental calibration curves require tremendous laboratory work, using a great number of standards with well-known compositions. Although a Monte Carlo simulation study does not avoid the experimental calibration work, it reduces the number of experimental calibration standards. This paper is part of a feasibility study for a PGNAA system for on-line continuous characterisation of cement raw material conveyed on a belt (Oliveira, C., Salgado, J. and Carvalho, F. G. (1997) Optimisation of PGNAA instrument design for cement raw materials using the MCNP code. J. Radioanal. Nucl. Chem. 216(2), 191-198; Oliveira, C., Salgado, J., Goncalves, I. F., Carvalho, F. G. and Leitao, F. (1997a) A Monte Carlo study of the influence of geometry arrangements and structural materials on a PGNAA system performance for cement raw materials analysis. Appl. Radiat. Isot. (accepted); Oliveira, C., Salgado, J. and Leitao, F. (1997b) Density and water content corrections in the gamma count rate of a PGNAA system for cement raw material analysis using the MCNP code. Appl. Radiat. Isot. (accepted).]. It reports on the influence of the density, mass water content and thickness on the calibration curves of the PGNAA system. The MCNP-4A code, running in a Pentium-PC and in a DEC workstation, was used to simulate the PGNAA configuration system

  20. Biodiesel production using calcium manganese oxide as catalyst and different raw materials

    International Nuclear Information System (INIS)

    Dias, Joana Maia; Conceição Machado Alvim-Ferraz, Maria; Fonseca Almeida, Manuel; Méndez Díaz, José Diego; Sánchez Polo, Manuel; Rivera Utrilla, José


    Highlights: ► Biodiesel production using a calcium manganese oxide catalyst was studied. ► The active specie was Ca 0.9 Mn 0.1 O and its deactivation occurred by hydration. ► The studied catalyst presented lower activation temperature than CaO. ► Biodiesel production and quality using different raw materials is reported. ► Compared to the conventional process, biodiesel water content improved. - Abstract: The use of heterogeneous catalysts for biodiesel production aims to simplify the production process as well as to reduce purification costs and related environmental impacts. Calcium manganese oxide was recently identified by the authors as an interesting heterogeneous catalyst for biodiesel production from animal fat; however, the difference between this and other catalysts, the catalyst activation/deactivation mechanisms, its behaviour in the synthesis using different raw materials as well as the impacts of its use on product quality remained unclear. Therefore, the present work: (i) compared biodiesel production using calcium manganese oxide and other catalysts (CaO and NaOH); (ii) studied the reasons leading to activation/deactivation of the heterogeneous catalyst; (iii) analysed biodiesel heterogeneous synthesis using calcium manganese oxide and different raw materials (lard, waste frying oil and a mixture); and (iv) evaluated raw material and catalyst impact on the product quality. Considering the use of different catalysts, the results showed that, after 8 h of reaction, product purity was similar using the different catalysts, being 92.5 wt.% using both NaOH and calcium manganese oxide and 93.8 wt.% using CaO. The active species of the heterogeneous catalysts were CaO, in the case of calcinated calcium carbonate, and Ca 0.9 Mn 0.1 O, in the case of calcinated calcium manganese oxide. Because the deactivating species were different for both catalysts, the calcium manganese oxide required lower activation temperature, which should be an advantage

  1. Method for quantifying the uncertainty with the extraction of the raw data of a gamma ray spectrum by deconvolution software

    International Nuclear Information System (INIS)

    Vigineix, Thomas; Guillot, Nicolas; Saurel, Nicolas


    Gamma ray spectrometry is a passive non destructive assay most commonly used to identify and quantify the radionuclides present in complex huge objects such as nuclear waste packages. The treatment of spectra from the measurement of nuclear waste is done in two steps: the first step is to extract the raw data from the spectra (energies and the net photoelectric absorption peaks area) and the second step is to determine the detection efficiency of the measuring scene. Commercial software use different methods to extract the raw data spectrum but none are optimal in the treatment of spectra containing actinides. Spectra should be handled individually and requires settings and an important feedback part from the operator, which prevents the automatic process of spectrum and increases the risk of human error. In this context the Nuclear Measurement and Valuation Laboratory (LMNE) in the Atomic Energy Commission Valduc (CEA Valduc) has developed a new methodology for quantifying the uncertainty associated with the extraction of the raw data over spectrum. This methodology was applied with raw data and commercial software that need configuration by the operator (GENIE2000, Interwinner...). This robust and fully automated methodology of uncertainties calculation is performed on the entire process of the software. The methodology ensures for all peaks processed by the deconvolution software an extraction of energy peaks closed to 2 channels and an extraction of net areas with an uncertainty less than 5 percents. The methodology was tested experimentally with actinides spectrum. (authors)

  2. Raw material balance and yield of biomass from early thinnings; Biomassatase ja energiapuun kertymae ensiharvennuksissa

    Energy Technology Data Exchange (ETDEWEB)

    Hakkila, P [Finnish Forest Research Inst., Vantaa (Finland)


    Utilization of small-sized wood from early thinnings is a serious problem in the Finnish forestry. The cost of harvesting is high, loss of potential pulpwood in logging and debarking is excessive, and the technical properties of wood are not well known. Project 105 of the Finnish Bioenergy Research Program is aimed to promote the utilization of biomass from early thinnings for pulp and energy. The variation of technical properties of wood (percentage of bark, basic density of wood and bark, amount of acetone extractive and ash, fiber length, moisture content, and fuel value) within the tree, between trees and between sites is studied. Distribution of the above-ground biomass of trees into potential pulpwood and energy wood is determined, and efficient delimbing-debarking methods for segregation of the fiber component from the fuel component are developed. The methods studied include single-log debarking with ring debarkers, and multiple-treatment of logs or tree-sections with drum debarkers and flail delimber-debarkers. A new method, combination of flail debarking-delimbing and dry-drum debarking, is introduced. Biomass balance, showing the recovery and loss of fiber and fuel in the process, is calculated for the options studied. The new method has great development potential for segregation of the fiber and energy components in small-diameter tree-sections. It is shown that high-quality chips can be produced from tree-sections, and it is suggested that special pulps are produced from the raw material under consideration

  3. Raw material balance and yield of biomass from early thinnings; Biomassatase ja energiapuun kertymae ensiharvennuksissa

    Energy Technology Data Exchange (ETDEWEB)

    Hakkila, P. [Finnish Forest Research Inst., Vantaa (Finland)


    Utilization of small-sized wood from early thinnings is a serious problem in the Finnish forestry. The cost of harvesting is high, loss of potential pulpwood in logging and debarking is excessive, and the technical properties of wood are not well known. Project 105 of the Finnish Bioenergy Research Program is aimed to promote the utilization of biomass from early thinnings for pulp and energy. The variation of technical properties of wood (percentage of bark, basic density of wood and bark, amount of acetone extractive and ash, fiber length, moisture content, and fuel value) within the tree, between trees and between sites is studied. Distribution of the above-ground biomass of trees into potential pulpwood and energy wood is determined, and efficient delimbing-debarking methods for segregation of the fiber component from the fuel component are developed. The methods studied include single-log debarking with ring debarkers, and multiple-treatment of logs or tree-sections with drum debarkers and flail delimber-debarkers. A new method, combination of flail debarking-delimbing and dry-drum debarking, is introduced. Biomass balance, showing the recovery and loss of fiber and fuel in the process, is calculated for the options studied. The new method has great development potential for segregation of the fiber and energy components in small-diameter tree-sections. It is shown that high-quality chips can be produced from tree-sections, and it is suggested that special pulps are produced from the raw material under consideration

  4. The profile of Brazilian agriculture as source of raw material to obtain organic cosmetics

    Directory of Open Access Journals (Sweden)

    Neila de Paula Pereira


    Full Text Available With one of the most notable floras in the world for sustainable research, the Brazilian Amazon region currently counts on financial incentives from the Brazilian Government for private national and foreign businesses. The ongoing implantation of a Biocosmetics Research and Development Network (REDEBIO aims to stimulate research involving natural resources from the Brazilian states that make up the zone defined as “Amazônia Legal”. The objective of this region, still under development in Brazil, is principally to aggregate value to products manufactured in small local industries through the use of sustainable technology currently being established. Certain certified raw materials already included in the country’s sustainability program, have also begun to be cultivated according to the requirements of organic cultivation (Neves, 2009. The majority are species of Amazonian vegetation: Euterpe oleracea (Açai, Orbignya martiana (Babaçu, Theobroma grandi-florum (Cupuaçu, Carapas guianensis (Andiroba, Pentaclethra macroloba (Pracaxi, Copaifera landesdorffi (Copaiba, Platonia insignis (Bacuri, Theobroma cacao (Cacao, Virola surinamensis (Ucuuba and Bertholletia excelsa (Brazil nut. These generate phytopreparations, such as oils, extracts, and dyes that are widely used in the manufacture of Brazilian organic cosmetics with scientifically proven topical and capillary benefits. In the final balance, Brazilian organic cosmetics should continue to gain force over the next few years, especially with the regulation of the organic cosmetics market that is being drafted by the Brazilian Ministry of Agriculture. Moreover, lines of ecologically aware products that provide quality of life for both for rural and metropolitan communities show a tendency to occupy greater space in the market.

  5. Use of residues proceeding from marbles and granites finishing and manufacturing processes as raw material for structural ceramic

    International Nuclear Information System (INIS)

    Mello, Roberta Monteiro de


    In order to decrease environmental impact, caused by mud discarding and clay extraction in the ceramic industry, it was used residual mud from marble and granite companies for structural ceramic. Samples were collected in twelve different marble companies located at the metropolitan region of Sao Paulo. However, only four samples were selected, based on its different characteristics. Clay stone was the raw material chosen to prepare the structural ceramic, considering its high use in this segment. Samples and clay stone were both analysed by the following procedures: granulometric analysis, x-rays fluorescent chemical analysis and x-rays diffraction mineralogical analysis, besides, tests in the samples were conducted following NBR 10004 standards. Once raw materials were characterized, the plasticity test was conducted. Test specimen were molded with different levels of mud, then burned and submitted to technological tests, such as: mechanical resistance, water absorption, porosity, specific gravity and retraction, material dilation before burning process and scanning electron microscopy. The final results have shown the viability of using this kind of mud, and pointed some advantages on its usage, but taking in consideration some previous conditions to be adopted. (author)

  6. Energy and raw material potentials of wood residue in the Pacific Coast States: a summary of a preliminary feasibility investigation. (United States)

    John B. Grantham; Eldon Estep; John M. Pierovich; Harold Tarkow; Thomas C. Adams


    Results are reported of a preliminary investigation of feasibility of using wood residue to meet energy and raw material needs in the Pacific Coast States. Magnitude of needs was examined and volume of logging-residue and unused mill residue was estimated. Costs of obtaining and preprocessing logging residue for energy and pulp and particle board raw material were...

  7. Raw materials in Africa and aspects of their utilisation; Rohstoffe in Afrika und Aspekte zu ihrer Nutzung

    Energy Technology Data Exchange (ETDEWEB)

    Leonhardt, Joachim [Dr. Leonhardt Consulting, Essen (Germany)


    Consideration of raw materials in Africa and aspects of their utilisation refers not only to raw materials and their use, but also quite importantly to the prevailing situation in Africa itself and with regard to the population, the economic situation and also the commitment of other countries. (orig.)

  8. Estimation of raw material performance in mammalian cell culture using near infrared spectra combined with chemometrics approaches. (United States)

    Lee, Hae Woo; Christie, Andrew; Liu, Jun Jay; Yoon, Seongkyu


    Understanding variability in raw materials and their impacts on product quality is of critical importance in the biopharmaceutical manufacturing processes. For this purpose, several spectroscopic techniques have been studied for raw material characterization, providing fast and nondestructive ways to measure quality of raw materials. However, investigations of correlation between spectra of raw materials and cell culture performance have been scarce due to their complexity and uncertainty. In this study, near-infrared spectra and bioassays of multiple soy hydrolysate lots manufactured by different vendors were analyzed using chemometrics approaches in order to address variability of raw materials as well as correlation between raw material properties and corresponding cell culture performance. Principal component analysis revealed that near-infrared spectra of different soy lots contain enough physicochemical information about soy hydrolysates to allow identification of lot-to-lot variability as well as vendor-to-vendor differences. The identified compositional variability was further analyzed in order to estimate cell growth and protein production of two mammalian cell lines under the condition of varying soy dosages using partial least square regression combined with optimal variable selection. The performance of the resulting models demonstrates the potential of near-infrared spectroscopy as a robust lot selection tool for raw materials while providing a biological link between chemical composition of raw materials and cell culture performance. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

  9. Farmers as providers of raw materials and energy. Proceedings; Der Landwirt als Energie- und Rohstoffwirt. Konferenzbeitraege

    Energy Technology Data Exchange (ETDEWEB)



    Within the 10th EUROSOLAR conference at 14th to 15th April, 2008, at Leipzig (Federal Republic of Germany), the following lectures were held: (a) Bioenergy in the Federal Republic of Germany: Potentials, state of the art and perspectives (M. Kaltschmitt, V. Lenz, D. Thraen); (b) Chances and risks of the energy production from biomass in rural area (G. Thalheim); (c) To the compatibility of utilizing bio energy and environmental preservation (K. Mueschen); (d) Biorefinery systems - industrial material use of regenerative raw materials (B. Kamm); (e) Agriculturists and forestry experts as producers of raw material - current risks and new chances (H. Fischer); (f) Potentials of the improvement of productivity by means of an expansion of options of useful plants (K. Goedeke); (g) Farmers as providers of energy and raw materials (H. Loick); (h) Problems and challenges of the utilization of biomass (P. Volkmer); (i) Energetic recycling management (G. Mehler); (j) Pure fuels instead of fuel mixtures - The farmer as providers of energy and raw materials (P. Schrum); (k) Feed and distribution of bio-natural gas from the view of a regional provider (J. Horn); (l) Biogasification and feed into natural gas networks - by the example of BGA Darmstadt-Wixhausen (M. Schlegel); (m) The right framework for the feed of bio methane into natural gas nets (S. Reichelt); (n) Virtual power plants - Efficient option of the local energy production (G. Weissmueller); (o) The role of bio energy in the power mix renewable energies (R. Bischof); (p) The autonomous power supply - from the bio energy village to the autonomous solar energy village (K. Scheffer); (q) Bio energy villages at the Lake Constance - Model projects for the rural area (B. Mueller); (r) Bio energy region Mureck / Steiermark (K. Totter); (s) The bio energy in the current German legislation process (H.-J. Fell).

  10. Prospects of rice straw as a raw material for paper making. (United States)

    Kaur, Daljeet; Bhardwaj, Nishi Kant; Lohchab, Rajesh Kumar


    Pulp and paper mills are indispensable for any nation as far as the growth of the nation is concerned. Due to fast growth in population, urbanization and industrialization, the demand and consumption of paper has increased tremendously. These put high load on our natural resources and force the industry to look for alternative raw material. Rice straw is a lignocellulosic material abundantly available in wood short countries like China, India, Bangladesh, etc. and can be used as raw material for this industry. Open burning of rice straw releases noxious green house gases to the air and poses serious threats to global air chemistry and human health. So, it is a dual benefit option (for farmers and industries) to use rice straw as a raw material in pulp and paper industry. Organosolv pulping using acids are the prominent choices of researchers to convert this residue into valuable pulp but in developed countries only. Developing world favours the soda and soda-AQ processes as these are economical. As a virtue of less lignin content in comparison to wood, rice straw requires less harsh conditions for cooking and can be easily pulped. Bleaching is a crucial step of paper making but also responsible for causing water pollution. Many studies revealed that during the process more than 500 chlorinated compounds are released that are highly toxic, bioaccumulative and carcinogenic in nature. Most of the industries over the globe switch on to the elemental chlorine free short sequence bleaching methods using chlorine dioxide, hypochlorite and hydrogen peroxide. This paper presented the effective need of ecofriendly, economically reliable pulping and bleaching sequences in case of rice straw to eliminate the problems of chlorinated compounds in wastewater of paper mills. Such approach of using waste as a raw material with its environmentally safe processing for making paper can prove to be valuable towards sustainable growth. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Radioactivity and associated radiation hazards in ceramic raw materials and end products. (United States)

    Viruthagiri, G; Rajamannan, B; Suresh Jawahar, K


    Studies have been planned to obtain activity and associated radiation hazards in ceramic raw materials (quartz, feldspar, clay, zircon, kaolin, grog, alumina bauxite, baddeleyite, masse, dolomite and red mud) and end products (ceramic brick, glazed ceramic wall and floor tiles) as the activity concentrations of uranium, thorium and potassium vary from material to material. The primordial radionuclides in ceramic raw materials and end products are one of the sources of radiation hazard in dwellings made of these materials. By the determination of the activity level in these materials, the indoor radiological hazard to human health can be assessed. This is an important precautionary measure whenever the dose rate is found to be above the recommended limits. The aim of this work was to measure the activity concentration of (226)Ra, (232)Th and (40)K in ceramic raw materials and end products. The activity of these materials has been measured using a gamma-ray spectrometry, which contains an NaI(Tl) detector connected to multichannel analyser (MCA). Radium equivalent activity, alpha-gamma indices and radiation hazard indices associated with the natural radionuclides are calculated to assess the radiological aspects of the use of the ceramic end products as decorative or covering materials in construction sector. Results obtained were examined in the light of the relevant international legislation and guidance and compared with the results of similar studies reported in different countries. The results suggest that the use of ceramic end product samples examined in the construction of dwellings, workplace and industrial buildings is unlikely to give rise to any significant radiation exposure to the occupants.

  12. Radioactivity and associated radiation hazards in ceramic raw materials and end products

    International Nuclear Information System (INIS)

    Viruthagiri, G.; Rajamannan, B.; Suresh Jawahar, K.


    Studies have been planned to obtain activity and associated radiation hazards in ceramic raw materials (quartz, feldspar, clay, zircon, kaolin, grog, alumina bauxite, baddeleyite, masse, dolomite and red mud) and end products (ceramic brick, glazed ceramic wall and floor tiles) as the activity concentrations of uranium, thorium and potassium vary from material to material. The primordial radionuclides in ceramic raw materials and end products are one of the sources of radiation hazard in dwellings made of these materials. By the determination of the activity level in these materials, the indoor radiological hazard to human health can be assessed. This is an important precautionary measure whenever the dose rate is found to be above the recommended limits. The aim of this work was to measure the activity concentration of 226 Ra, 232 Th and 40 K in ceramic raw materials and end products. The activity of these materials has been measured using a gamma-ray spectrometry, which contains an NaI(Tl) detector connected to multichannel analyser (MCA). Radium equivalent activity, alpha-gamma indices and radiation hazard indices associated with the natural radionuclides are calculated to assess the radiological aspects of the use of the ceramic end products as decorative or covering materials in construction sector. Results obtained were examined in the light of the relevant international legislation and guidance and compared with the results of similar studies reported in different countries. The results suggest that the use of ceramic end product samples examined in the construction of dwellings, workplace and industrial buildings is unlikely to give rise to any significant radiation exposure to the occupants. (authors)

  13. Raman, Infrared, and Laser-Induced Breakdown Spectroscopy Identification of Particles in Raw Materials. (United States)

    Lee, Kathryn; Lankers, Markus; Valet, Oliver


    Raw materials need to be of a certain quality with respect to physical and chemical composition. They also need to have no contaminants, including particles, because these could indicate raw material impurities or contaminate the product. Particle identification allows determination of process conditions that caused them and whether the quality of the final product is acceptable. Particles may appear to the eye to be very different things than they actually are. They may be coated with the raw material and may consist of several components; therefore, chemical and elemental analyses are required for accuracy in proper identification and definitive information about their source. Thus, microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and infrared (IR) spectroscopy are excellent tools for identifying particles in materials. Those tools are fast and accurate, and can provide chemical and elemental composition as well as images that can aid identification. The micro-analysis capabilities allow for easy analysis of different portions of samples so that multiple components can be identified and sample preparation can be reduced or eliminated. The differences in sensitivities of Raman and IR spectroscopies to different functional groups as well as the elemental analysis provided by LIBS and the image analysis provided by the microscopy makes these complementary techniques and provides the advantage of identifying various chemical components. Proper spectral searching techniques and interpretation of the results are important for interpretation and identification of trace contaminants.

  14. Rambutan Seed (Nephelium Lappaceum L.) Optimization as Raw Material of High Nutrition Value Processed Food (United States)

    Wahini, M.; Miranti, M. G.; Lukitasari, F.; Novela, L.


    Rambutan (Nephelium Lappaceum L.) is a plant that identical with Southeast Asian countries, in some areas of Indonesia no exception, but rambutan seed is considered as a waste. Therefore, it needs to be optimized into raw materials of food and processed with high nutritional value and has economic value. The purpose of this research were: 1) to find the best rambutan seed immersion formula; 2) to know the nutritional value of the best immersed rambutan seed; 3) to produce raw material and various processed of rambutan seed product. The research method was quasi experiment with 6 treatments and 2 factorial design, materials for immersion was NaCl and Ca(OH)2. The results showed that: 1) the best rambutan seed immersion formula was using Ca(OH)2; 2) the best rambutan seed contains 1,6 ash, 31,2 protein, 26,9 fat; 3) the best rambutan seed produce flour and processed of seasoned nuts. This research indicates that rambutan seed is very potential to be an alternative high-value raw materials.

  15. New extraction chromatographic material for rhenium separation

    International Nuclear Information System (INIS)

    Lucanikova, M.; Czech Technical University, Prague; Kucera, J.; Czech Technical University, Prague; Sebesta, F.


    Three types of the extraction chromatographic materials, composed from Aliquat R 336 deposited in the polyacrylonitrile (PAN) beads and prepared by different procedures, were compared for extraction of rhenium. The best properties were exhibited when the solid extractant was prepared by impregnation of the ready-made PAN beads. Solid extractant prepared by direct coagulation of the beads from the suspension of Aliquat R 336 in solution of PAN in nitric acid differs only by lower capacity in dynamic conditions. Material prepared from the PAN solution in dimethylsulfoxide was the worst because Aliquat R 336 was washed out from the beads during coagulation of the polymer and the extraction capacity was low. As it is shown, the first two solid extractants are fully comparable with the commercial TEVA Resin. (author)


    CERN Multimedia


    The CERN Raw Materials Stores has recently acquired a new water-jet cutting machine. The machine is capable of cutting all types and shapes of materials up to 70 mm in thickness, with an accuracy of +/- 0.1mm/m. For the time being, users requiring materials to be cut should supply drawings in DXF, DWG or IGES (AutoCad) file format. The machine will be operational as of 1st October 2007. The Stores Team Paulo Dos Santos FI-LS-MM 72308

  17. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  18. Conception for the protection of mineable raw materials in the Land of Brandenburg (Germany)

    International Nuclear Information System (INIS)

    Kopf, M.


    The pit and quarry industry in Brandenburg will within a few years the same importance as the lignite industry. Both industries together may have up to 20 000 employees beyond the year 2000. The same number of employees could result in the enterprises of local and other subcontractors and mine suppliers. The government of Brandenburg creates at present the legal prerequisites to secure the supply with mineable raw materials. The regulation of the protection of mineable raw materials is proposed to be realised within the scope of the second plan for the development of the country, and within the regional plannings. The protection of the basic conditions for mining industries is a permanent task for administration and politics. By encouraged engagement in the case of opposed interests, those of mining can be considered with acceptable results provided the parties are ready to compromise. (orig.) [de

  19. High yield CTMP fibres as a possibility of the more efficient yield of wood raw material

    Directory of Open Access Journals (Sweden)

    Klašnja Bojana A.


    Full Text Available The evident shortage of wood as a raw material has become a limiting factor in the pulp and paper industry which is the greatest consumer of wood in Europe. The situation in our country is similar. During the few past years, the production of poplar and willow pulpwood was 220.000 m3 per year, which is insufficient for the planned increase in the production of sulphate pulp (175.000 tons till 2005. This paper deals with the aspects of the more efficient yield of raw material, based on the significantly higher yield of CTMP fibres, as well as with the significance of the lower adverse effect on the environment. It also analyses the conditions of production and the quality of the obtained fibres, as a possible substitute for chemical pulp and secondary fibres in papers of different quality. The main reasons for the production and use of CTMP fibres in our country are reported.

  20. Energies and raw material. Annual report; Energies et matieres premieres. Rapport annuel

    Energy Technology Data Exchange (ETDEWEB)



    The annual report of the french General Direction of the Energy and the Raw Material (DGEMP) deals with the energy policy. The following subjects are analysed: the french program of fight against the global warming; the biogas; the radioactive wastes management program; the french nuclear industry re-organization; Tchernobyl; the electric power and gas public service; the risk prevention concerning the electric power production; the international Gaz De France protocol; the closing of the Ales mine; the cooperation ELF and TOTAL; the french para-petroleum industry; the raw material prices; the french mining situation; the french energy policy audit by the AIE; the energy accidents of december. The DGEMP organization chart with contacts and the publications are also included. (A.L.B.)

  1. Aspects of investment protection in the case of raw material projects; Aspekte des Investitionsschutzes bei Rohstoffprojekten

    Energy Technology Data Exchange (ETDEWEB)

    Wolkewitz, Mathias [Wintershall Holding GmbH, Kassel (Germany). Bereich Recht, Steuern und Versicherungen; TU Clausthal (Germany). Inst. fuer Energierecht


    Addressing the question of investment protection currently is of particular importance under the tree aspects: (a) Due to the financial crisis and economic crisis, foreign investment in the years 2008 and 2009 have been drastically reduced; (b) There is a growing critique at the system of international investment protection; (c) For the first time, the Articles 206 and 207 of the Treaty of Lisbon of the European Union show a competence for foreign direct investment. These three aspects seem partly contradictory, but have a considerable changing potential in the area of investment protection. The author of the contribution under consideration describes the tools of investment protection as those are used for raw material projects. Subsequently the author picks out investment protection agreements and deals with some aspects that are important for practical applications in business companies. Raw material projects are projects for the exploration and production of oil and gas in foreign states.

  2. The use of foresight methods in strategic raw materials intelligence - an international review (United States)

    Konrat Martins, Marco Antonio; Bodo, Balazs; Falck, Eberhard


    Foresight methods are systematic attempts to look into the longer term future of science, society, economy and technology. There is a range of tools and techniques that can be used individually or combined, most commonly classified into qualitative, quantitative or semi-quantitative methods, that follow an exploratory or normative approach. These tools can help to identify the longer term visions, orienting policy formulation and decisions, triggering actions, among other objectives. There is an identified lack of European strategic foresight knowledge in the raw materials domain. Since the European Raw Materials Initiative was launched in 2008, the EU has been attempting to overcome challenges related to the future access of non-energy and non-agricultural raw materials. In this context, the ongoing H2020 project, MICA (Mineral Intelligence Capacity Analysis, Grant Agreement No. 689648), has been launched to answer to stakeholders needs by consolidating relevant data, determining relevant methods and tools, and investigating Raw Materials Intelligence options for European mineral policy development, all tailored to fit under the umbrella of a European Raw Materials Intelligence Capacity Platform (EU-RMICP). As part of the MICA activities, an assessment of best practices and benchmarks of international raw materials foresight case studies has been carried out in order to review how EU and non-EU countries have employed foresight. A pool of 30 case studies has been collected and reviewed internationally, one third of which were selected for detailed assessment. These were classified according to their background and goals, in function of methods employed, and to the purpose of each method in the study: a total of 12 different methods were identified in these studies. For longer time frames, qualitative predictive methods such as Scenario Development have been repeatedly observed for mineral raw materials foresight studies. Substantial variations were observed in

  3. Freezing of meat raw materials affects tyramine and diamine accumulation in spontaneously fermented sausages. (United States)

    Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen


    Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.

  4. The use of rapid spectroscopic screening methods to detect adulteration of food raw materials and ingredients

    DEFF Research Database (Denmark)

    Sørensen, Klavs Martin; Khakimov, Bekzod; Engelsen, Søren Balling


    with chemometrics appears to be an efficient first choice for testing incoming raw materials and ingredients in the food production. However, in order to realize its full potential, it is necessary to move away from the current thoughts at the Parnassus, namely the targeted approach. This review will focus......International trade in food commodities will continue to increase and the complex food supply chains make adulteration detection and traceability a technical, logistical and financial challenge. There is no magic solution for adulteration testing, but NIR spectroscopy in combination...... on the exploitation of the capability of NIR spectroscopy to fingerprint incoming raw materials and ingredients as an integrated part of the industry's self-monitoring program typically called process analytical technology....

  5. Characterisation of Cements From Dominantly Volcanic Raw Materials of the Carpathian Bend Zone

    Directory of Open Access Journals (Sweden)

    Halmagy Timea


    Full Text Available This paper presents the results of laboratory investigations regarding the production of cements from local raw materials, such as limestone from Varghis, gypsum from Nucsoara, basaltic scoria from Racosul de Jos, volcanic tuff from Racosul de Sus, diatomite from Filia, and red mud from Oradea. The raw mixtures, based on modified Bogue calculations, contain limestone, gypsum, and one or two of the above-mentioned materials. The cements resulted from clinker grinding in a laboratory gas furnace at 1260-1300 °C, with one hour at the peak temperatures, and were characterised for Blaine specific surface area, specific density, and mineral phases. Physico-mechanical properties, such as water content for normal consistency, setting time, soundness, and compressive strength were also determined. Results show that these cements contain belite, ferrite, calcium sulphoaluminate, anhydrite, and some minor compounds.

  6. Selected scientific articles. (Investigations in the field of hydrides chemistry and mineral raw materials processing)

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.


    Articles, included in the present book are covering period 1977-2013 y. The main scientific articles in the field of power-consuming substances, mineral raw-materials and wastes reprocessing, including uranium industry wastes are collected. Scientific works on hydrogen chemistry which carried out basically bu U.M. Mirsaidov without co-authors are considered. These works are on aluminium hydrides and borohydrides lanthanides. Besides, author's popular-science articles on research carried out by Academy of Sciences during the period when he was the President of Academy of Sciences of the Republic of Tajikistan (1995-2005) are included. Mineral raw materials and wastes reprocessing results are given as well. The book is intended for engineer and technical staff, those working in the field of hydrogen chemistry, hydrometallurgy workers, engineering chemists as well as for PhD, post graduate students and students of appropriate profiles.

  7. Exploiting epoxidized natural rubber latex (ENRL) as a starting raw material for latex-based products (United States)

    Siti Nor Qamarina, M.; Fatimah Rubaizah, M. R.; Nurul Suhaira, A.; Norhanifah, M. Y.


    Epoxidized natural rubber latex (ENRL) is a chemically modified natural rubber latex produced from epoxidation process that involves usage of organic peracids. Conversion of the ENRL into dry rubber products has been known to exhibit many beneficial properties, however limited published works were found on diversifiying the ENRL latex-based products applications. In this preliminary work, different source of raw materials and neutralization systems were investigated. The objective was to explore possibilities in producing distinctive ENRL. Findings have demonstrated that different source of raw materials and neutralization systems influenced the typical ENRL specifications, stability behavior and particle size distribution. Morphological observations performed on these ENRL systems appeared to agree with the ENRL characteristics achieved. Since experimenting these two main factors resulted in encouraging ENRL findings, detailed work shall be further scrutinized to search for an optimum condition in producing marketable ENRL specifically for latex-based products applications.

  8. Raw material boom in an industrial country. Rohstoffboom in einem Industrieland

    Energy Technology Data Exchange (ETDEWEB)

    Enders, K S


    First of all, a theoretical investigation is carried out to discover under which conditions a raw material boom displaces traditional sectors of industry, and which groups win and lose in the process. Subsequently, the peculiarities of the adaption process induced by the boom are analysed. Particular attention is paid to the possibility of transition (short-term) unemployment (Dutch disease). In conclusion, Norway's experiences in the oil and gas boom in the North Sea ar described and then compared with theoretical statements.

  9. Regenerative raw materials. High technology without end; Nachwachsende Rohstoffe. Spitzentechnologie ohne Ende

    Energy Technology Data Exchange (ETDEWEB)



    In recent years, the use of renewable raw materials has developed rapidly. Meanwhile, biomass is one of the most important renewable energy source and a serious alternative to fossil fuel-based industry. The brochure under consideration presents an insight into the complex and promising topic ''Renewable Resources''. In particular, the areas in which renewable resources already are established as well as areas that need to be extended in the future are described.

  10. 1.2. X-ray phase analysis of borosilicate raw material

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.; Kurbonov, A.S.; Mamatov, E.D.


    Present article is devoted to X-ray phase analysis of borosilicate raw material. The thermo gram of initial borosilicate ore was considered. The X-ray pattern of initial danburite of Ak-Arhar Deposit was considered as well. The X-ray pattern of danburite of Ak-Arhar Deposit after pre-baking was studied. The X-ray pattern of initial danburite concentrate was studied as well.

  11. Utilization of flotation wastes of copper slag as raw material in cement production

    International Nuclear Information System (INIS)

    Alp, I.; Deveci, H.; Suenguen, H.


    Copper slag wastes, even if treated via processes such as flotation for metal recovery, still contain heavy metals with hazardous properties posing environmental risks for disposal. This study reports the potential use of flotation waste of a copper slag (FWCS) as iron source in the production of Portland cement clinker. The FWCS appears a suitable raw material as iron source containing >59% Fe 2 O 3 mainly in the form of fayalite (Fe 2 SiO 4 ) and magnetite (Fe 3 O 4 ). The clinker products obtained using the FWCS from the industrial scale trial operations over a 4-month period were characterised for the conformity of its chemical composition and the physico-mechanical performance of the resultant cement products was evaluated. The data collected for the clinker products produced using an iron ore, which is currently used as the cement raw material were also included for comparison. The results have shown that the chemical compositions of all the clinker products including those of FWCS are typical of a Portland cement clinker. The mechanical performance of the standard mortars prepared from the FWCS clinkers were found to be similar to those from the iron ore clinkers with the desired specifications for the industrial cements e.g. CEM I type cements. Furthermore, the leachability tests (TCLP and SPLP) have revealed that the mortar samples obtained from the FWCS clinkers present no environmental problems while the FWCS could act as the potential source of heavy metal contamination. These findings suggest that flotation wastes of copper slag (FWCS) can be readily utilised as cement raw material due to its availability in large quantities at low cost with the further significant benefits for waste management/environmental practices of the FWCS and the reduced production and processing costs for cement raw materials

  12. Utilization of flotation wastes of copper slag as raw material in cement production. (United States)

    Alp, I; Deveci, H; Süngün, H


    Copper slag wastes, even if treated via processes such as flotation for metal recovery, still contain heavy metals with hazardous properties posing environmental risks for disposal. This study reports the potential use of flotation waste of a copper slag (FWCS) as iron source in the production of Portland cement clinker. The FWCS appears a suitable raw material as iron source containing >59% Fe(2)O(3) mainly in the form of fayalite (Fe(2)SiO(4)) and magnetite (Fe(3)O(4)). The clinker products obtained using the FWCS from the industrial scale trial operations over a 4-month period were characterised for the conformity of its chemical composition and the physico-mechanical performance of the resultant cement products was evaluated. The data collected for the clinker products produced using an iron ore, which is currently used as the cement raw material were also included for comparison. The results have shown that the chemical compositions of all the clinker products including those of FWCS are typical of a Portland cement clinker. The mechanical performance of the standard mortars prepared from the FWCS clinkers were found to be similar to those from the iron ore clinkers with the desired specifications for the industrial cements e.g. CEM I type cements. Furthermore, the leachability tests (TCLP and SPLP) have revealed that the mortar samples obtained from the FWCS clinkers present no environmental problems while the FWCS could act as the potential source of heavy metal contamination. These findings suggest that flotation wastes of copper slag (FWCS) can be readily utilised as cement raw material due to its availability in large quantities at low cost with the further significant benefits for waste management/environmental practices of the FWCS and the reduced production and processing costs for cement raw materials.

  13. Exploitation and use of raw materials resources for manufacturing nuclear fuels. Present and future

    International Nuclear Information System (INIS)

    Georgescu, Dan; Nica, Dan Bujor; Iuhas, Tiberius; Muntean, Ioan


    The nuclear fuel for Cernavoda Romanian nuclear power plant is based on natural uranium cycle implying mining, concentration-refining and UO 2 manufacturing. For the Uranium National Company securing the raw materials necessary for fuel element manufacturing implies the following sources: - from the production cumulated till the year 2001 in the Security and Consumption Stock; - from the current production of uranium ore. Romania posses two categories of deposits which ensure at present and in the future the uranium ore production: active deposits and production center at Crucea-Botusana; - deposits proposed for the exploitation activity at Tulghes - Grinties. Other two important centers of production in Banat and Bihor ceased the production since 1999 due to the deposit depletion. The uranium reserve of Romania is estimated to 9,233 tones in geological deposits of high confidence level plus 6,344 tones in resources still not searched. The medium- and long-term strategy of CNU to fructify the uranium reserves of Romania is in concordance with the current government policy and is based upon two major investments: - opening a new production unit at Tulghes-Grinties; - Refurbishment of plants R1 and E1. The main amount of uranium currently used for making the needed nuclear fuel comes today from the production center Crucea-Botusana. Here the exploitation is based mainly on pitchblende-rich deposits. Uranium ore processing and concentration is made at 'R' and 'E' plants at Feldioara able to ensure an annual capacity of 300 tones UO 2 . In the assesment of the amount of uranium needed in the nuclear fuel fabrication the degree of uranium recovery was also taken into account. The uranium supply implied by the new electro-nuclear plants to be installed till 2025 was evaluated by taking into account the future advanced fuel solutions, SEU and RU, what will diminish the natural uranium consumption to 55% and 66%, respectively. The price of nuclear fuel has been estimated

  14. New and non-traditional mineral raw materials deposits, perspectives of use

    International Nuclear Information System (INIS)

    Beyseev, O.; Beyseev, A.; Baichigasov, I.; Sergev, E.; Shakirova, G.


    Deposits of new and non-traditional kinds of mineral raw material are revealed, explored and prepared to industrial recovery in Kazakstan, that can be used in frames of conversion process to create new materials with unique properties, to prepare base for new technologies elaboration, and to achieve appreciable economic benefit. These deposits are located mostly in geographic and economic conditions of advanced infrastructure and mining works network, favorable for recovery.On the tests results the following is of heaviest interest: RHODUCITE, NEMALITE-CONTAINING CHRYSOTILE-ASBESTOS, NICKEL-CONTAINING SILICATE-ASBOLAN ORES, MEDICINAL MINERALS, SHUNGITES, FULLERENES, RAW QUARTZ MINERALS - the group of deposits containing 5 min tons of high quality quartz good for manufacture of cut-glass and fibre-optical articles, is explored in details. There are also deposits of other kinds of non-traditional strategic mineral raw material in the Republic of Kazakstan - natural fillers, that can be used in the national economy of the country and bring considerable economic benefit: chrysotile-asbestos, amphibole-asbestos, talk, vollastonite, tremolite, actinolite, vermiculite, zeolite, etc

  15. Raw material from the state of Rio Grande do Norte, Brazil, to obtain sandstone porcelain

    International Nuclear Information System (INIS)

    Sousa, Maria Rosimar de


    Currently, the production of the ceramic industry of the River Great of the North she is restricted to the manufacture of bricks and roofing tiles. development of new ceramic products of bigger added value, such as gres covering porcelanato, using regional raw materials is of basic importance for the growth of the local ceramic industry and economic development of the region. In this work, they had been studied raw materials as kaolin, sodico feldspato and quartz of the State of the Great River of the North for the attainment of an covering of the gres type porcelanato of base white.The ceramic masses had been prepared by the process saw humid. The body-of-tests they had been conformed by uniaxial prensagem of 40MPa, dried in 110 deg C and burnt between 1160 and 1240 deg, used a cycle of fast burning (approximately 60min.). The qualitative analysis of the formed phases disclosed silica, mullite e sodico feldspato after the sintering. The technological properties of burning evaluated they had been: linear retraction, water absorption, apparent specific mass, porosity and breaking strength to the flexal (shipment of 3 points). Results show that raw materials proceeding from the State of the Great River of North could be used in processes for gres porcelanato, therefore they present characteristics technological, similar chemistry, physics and to the standard of reference and the data of literature. (author)

  16. Multicriteria analysis of agricultural raw materials: A case study of BSBIOS and PETROBRAS BIOFUELS in Brazil

    International Nuclear Information System (INIS)

    Zonin, Valdecir José; Valle Antunes, José Antônio; Pinto Leis, Rodrigo


    Energy crises reverberate within societies and encourage worldwide change in this industry. In this context, Brazil has been consolidating the National Program for the Production and Use of Biodiesel (Programa Nacional de Produção e Uso do Biodiesel—PNPB). This article analyzes BSBIOS and PETROBRAS BIOFUELS, which is a company that is incorporated under the PNPB. After providing an overview, the manuscript focuses on the criteria used for the selection of the agricultural raw materials used in the biodiesel industry. A reference model that considered the economic, technological, and social dimensions was developed; these dimensions were analyzed in relation to the production matrices of the soybean, canola, sunflower, and castor plants. The company strategically opted to establish programs for promoting the production of only soybean and canola. In the short term, the company has accepted the evidence that the main source of raw materials is soybean production. This decision was made considering the multicriteria analysis that was developed, which involved a number of economic, technological, and social aspects. Consequently, this analysis used in the decision-making process exhibits both a macro (the national and international environment) and a micro perspective (the companies’ reality). - Highlights: • The economic viability of biodiesel production in Brazil hinges on crop production. • Biodiesel production in Brazil requires developing an efficient production chain. • Oleaginous crops will be diversified by creating a network of suppliers. • Raw material production is diversifying based on an analysis of relevant factors

  17. Analysis of waste coal from the enterprises of Kemerovo region as raw materials for production of ceramic materials (United States)

    Stolboushkin, A. Yu; Akst, D. V.; Fomina, O. A.; Ivanov, A. I.; Syromyasov, V. A.


    The analysis of waste coal from mining enterprises of Kemerovo region as raw materials for production of building ceramics is given. The results of studies of material, chemical and mineralogical compositions of waste coal from Abashevskaya processing plant (Novokuznetsk) are presented. It was established that the chemical composition of waste coal refers to aluminosilicate raw materials with a high content of alumina and coloring oxides, the residual carbon content in the wastes is 12-25 %. According to the granulometric composition the waste coal is basically a sandy-dusty fraction with a small amount of clay particles (1-3 %). Additional grinding of coal waste and the introduction of a clay additive in an amount of up to 30 % are recommended. The results of the study of the mineral composition of waste coal are presented. Clay minerals are represented in the descending order by hydromuscovite, montmorillonite and kaolinite, minerals-impurities consist of quartz, feldspar fine-dispersed carbonates. The results of the investigation of ceramic-technological properties of waste coal, which belong to the group of moderately plastic low-melting raw materials, are given. As a result of a comprehensive study it was been established that with chemical, granulometric and mineralogical compositions waste coal with the reduced residual carbon can be used in the production of ceramic bricks.

  18. Hook tool manufacture in New Caledonian crows: behavioural variation and the influence of raw materials. (United States)

    Klump, Barbara C; Sugasawa, Shoko; St Clair, James J H; Rutz, Christian


    New Caledonian crows use a range of foraging tools, and are the only non-human species known to craft hooks. Based on a small number of observations, their manufacture of hooked stick tools has previously been described as a complex, multi-stage process. Tool behaviour is shaped by genetic predispositions, individual and social learning, and/or ecological influences, but disentangling the relative contributions of these factors remains a major research challenge. The properties of raw materials are an obvious, but largely overlooked, source of variation in tool-manufacture behaviour. We conducted experiments with wild-caught New Caledonian crows, to assess variation in their hooked stick tool making, and to investigate how raw-material properties affect the manufacture process. In Experiment 1, we showed that New Caledonian crows' manufacture of hooked stick tools can be much more variable than previously thought (85 tools by 18 subjects), and can involve two newly-discovered behaviours: 'pulling' for detaching stems and bending of the tool shaft. Crows' tool manufactures varied significantly: in the number of different action types employed; in the time spent processing the hook and bending the tool shaft; and in the structure of processing sequences. In Experiment 2, we examined the interaction of crows with raw materials of different properties, using a novel paradigm that enabled us to determine subjects' rank-ordered preferences (42 tools by 7 subjects). Plant properties influenced: the order in which crows selected stems; whether a hooked tool was manufactured; the time required to release a basic tool; and, possibly, the release technique, the number of behavioural actions, and aspects of processing behaviour. Results from Experiment 2 suggested that at least part of the natural behavioural variation observed in Experiment 1 is due to the effect of raw-material properties. Our discovery of novel manufacture behaviours indicates a plausible scenario for the

  19. Analysis of the possibility for obtaining oil from the spend coffee grounds as potential raw material for biodiesel production

    Directory of Open Access Journals (Sweden)

    Iličković Zoran


    Full Text Available The aim of this paper was to investigate the possibility of obtaining oil from spent coffee grounds, which are left behind after the coffee is prepared, as the potential feedstock for biodiesel production. The effect of process parameters, such as are the type of solvent, the ratio of spent coffee grounds/solvent and the extraction time on oil yielded from coffee grounds was examined. The oil was obtained by maceration and extraction in the Soxhlet apparatus. The obtain results show that the spent coffee grounds could be used as an alternative raw material for biodiesel production, because it contains a significant amount of oil that can be extracted. The oil yield depends on the extraction (maceration process parameters. The maximum oil yield obtained by the Soxhlet extraction with the n-hexane for the period of 5 h was 11.85% (the weight percentage of oil on dry mater, whereas with petroleum ether the oil yield was slightly lower and amounted to 10.44%. The yield of the oil extracted by maceration increases with the decrease of spent coffee grounds/solvent ratio from 1/3 to 1/7 g/cm3, and other parameters being constant. The oil yield increases with the duration of the maceration. Greater oil yield, ranging from 3 to 8.5%, can be obtained with n-hexane compared to the extraction with petroleum ether. Furthermore, n-hexane is less volatile and flammable, compared to petroleum ether, so it is more convenient to use.

  20. New raw materials for radiation curable coatings: what are they, where they come from

    International Nuclear Information System (INIS)

    Rybny, C.B.; Trebellas, J.C.; Vona, J.A.


    The availability of reasonably priced coating systems which meet the criteria of low-energy cure and minimum effluent pollution is of critical concern to the coatings industry. To appreciate the problems associated with radiation curable coatings, those manufacturing and utilizing these materials should be aware of their raw material compositions and the starting products from which they are derived. The utility and economics of ultraviolet coatings are also of prime interest. These topics are discussed, with emphasis on the photocurable polymers and their cross-linking monomers as well as the economics of this new technology in relation to energy cost savings. 7 references

  1. Analysis of zirconia and alumina products and raw materials by X-ray fluorescence spectrometry

    International Nuclear Information System (INIS)

    Boix, A.; Draignaud, M.; Debras-Guedon, J.


    An X-ray fluorescence spectrometric method of analysis for various raw materials and materials based on zirconia, alumina and silica was developed. The measurements were made on beads made from the sample and a borax based flux, in the proportions 1:10. A repeatability test allowed the relative standard deviation to be estimated for the three main constituents: SiO 2 , Al 2 O 3 , ZrO 2 : it is at the level of 1%. The element analyzed are: Si, Al, Fe, Ti, Ca, Hf and Zr [fr

  2. Textile-reinforced concrete using composite binder based on new types of mineral raw materials (United States)

    Lesovik, V. S.; Glagolev, E. S.; Popov, D. Y.; Lesovik, G. A.; Ageeva, M. S.


    To determine the level of development of science, it is necessary to start with a particular stage in the development of society. At present, the purpose of building materials science is to create composites, which ensure safety of buildings and structures, including their protection against certain natural and man-made impacts. A new stage in construction materials science envisages the development of a technology for creating composites comfortable for a particular person. To implement this, a new paradigm for designing and synthesizing building materials with a new raw material base is needed. The optimization of the “human-material-habitat” system is a complex task, for the solution of which transdisciplinary approaches are required.

  3. Mechanochemical modification of the composition and structure of plant raw materials to control the combustion of alternative fuel

    Directory of Open Access Journals (Sweden)

    Bychkov Aleksey


    Full Text Available The possibilities of mechanochemistry in processing of renewable lignocellulose raw material into solid kinds of biofuel are demonstrated in this work. A review of lignocellulose raw materials promising for our country is presented. These raw materials include wastes from agriculture and forestry, and the biomass of rapidly growing plants. The physicochemical properties of lignocellulose materials with different delignification degrees were modeled with the help of the artificial mixtures of plant raw material with purified cellulose and lignin. The data illustrating the effect of disperse state and lignin content on the reactivity of the material in subsequent combustion are presented. The tests at the combustion bench with the thermal power up to 5 MW allowed determining the optimal combustion parameters for the obtained biofuel in the autothermal mode.

  4. VERAM, for a sustainable and competitive future for EU Raw Materials (United States)

    Mobili, A.; Tittarelli, F.; Revel, G. M.; Wall, P.


    The project, VERAM “Vision and Roadmap for European Raw Materials”, aims to deliver a mapping of on-going initiatives on non-food, non-energy raw materials (including metals, industrial minerals, aggregates and wood) at European, Member State, and regional levels both from the Research and Innovation (R&I), industry, and policy perspectives. Moreover, based on a comprehensive gap analysis, VERAM will propose a common long term 2050 Vision and Roadmap in coordination and cooperation with all stakeholders across the value chain. For the first time, two European Technology Platforms (ETPs) together with their corresponding European Research Area Networks (ERA-NETs) are joining forces to develop a common roadmap.

  5. Beyond waste: new sustainable fillers from fly ashes stabilization, obtained by low cost raw materials

    Directory of Open Access Journals (Sweden)

    N. Rodella


    Full Text Available A sustainable economy can be achieved only by assessing processes finalized to optimize the use of resources. Waste can be a relevant source of energy thanks to energy-from-waste processes. Concerns regarding the toxic fly ashes can be solved by transforming them into resource as recycled materials. The commitment to recycle is driven by the need to conserve natural resources, reduce imports of raw materials, save landfill space and reduce pollution. A new method to stabilize fly ash from Municipal Solid Waste Incinerator (MSWI at room temperature has been developed thanks to COSMOS-RICE LIFE+ project ( This process is based on a chemical reaction that occurs properly mixing three waste fly ashes with rice husk ash, an agricultural by-product. COSMOS inert can replace critical raw materials (i.e. silica, fluorspar, clays, bentonite, antimony and alumina as filler. Moreover the materials employed in the stabilization procedure may be not available in all areas. This paper investigates the possibility of substituting silica fume with corresponding condensed silica fume and to substitute flue-gas desulfurization (FGD residues with low-cost calcium hydroxide powder. The removal of coal fly ash was also considered. The results will be presented and a possible substitution of the materials to stabilize fly ash will be discussed.

  6. Biomass based energy. A review on raw materials and processing methods; Energie aus Biomasse. Eine Uebersicht ueber Rohstoffe und Verfahren

    Energy Technology Data Exchange (ETDEWEB)

    Woellauer, P


    The book reviews the variety of biogenic raw materials and the technologically important biomass conversion techniques. The chapter on the different kinds of biomass includes a) wood from forestry, landscape culturing and saw mills, bark and old wood; b) plants (corn, miscanthus, cannabis, wheat, rye, sugar beets, grass, rape, etc.), residuals and wastes (straw, liquid manure, slaughthouse wastes, kitchen wastes, sewage sludge, others). The chapter on biomass conversion processing discusses combustion, oxidation in spercritical water, gasification and reforming, fermentation, extrusion or extraction, and downstream processes. The chapter on biomass based electricity and mechanical energy includes refrigeration engineering, direct utilization: Otto engines, Diesel engines, microgas turbine fuel cells, and heat processing: Striling engine, vapour turbine, ORC turbine, externally fired gas turbine, and the Kalina process.

  7. Physicochemical characterization of raw materials and co-products from the titanium dioxide industry

    International Nuclear Information System (INIS)

    Gazquez, M.J.; Bolivar, J.P.; Garcia-Tenorio, R.; Vaca, F.


    The present study was conducted to characterize several raw materials and co-products from the titanium dioxide industry in relation to their elemental composition (major, minor and trace elements), granulometry, mineralogy, microscopic morphology and physical composition. The main objective was to gain basic information for the future potential application of these co-products in fields such as agriculture, construction, civil engineering, etc. Microscopic studies were performed by applying scanning electron microscopy with X-ray microanalysis (SEM-XRMA) while the mineralogical compositions were analysed by means of the X-ray diffraction (XRD) technique. The concentrations of major elements such as Na, Al, Si, Ca, Ti, Fe, S and K were determined by X-ray fluorescence (XRF), while heavy metals and other trace elements were determined by ICP-MS. The physicochemical characterization of the raw materials used in the titanium dioxide industry, in addition to the characterization of the co-products generated, has enabled the evaluation of the degree of fractionation of different elements and compounds between the different co-products, as well as the control of the possible variations in the physicochemical composition of the raw materials throughout the time and the study of the influence of these variations in the characteristics of the obtained co-products. As a main conclusion of our study, it is possible to indicate that the levels of the pollutant elements associated to the co-products analysed were, in general, within safe limits and, therefore, they could potentially be used in composites as fertilizers or for building materials in road construction, etc. Nevertheless, for the specific application of each of these co-products in agriculture, construction and civil engineering, additional studies need to be performed to evaluate their appropriateness for the proposed application, together with specific studies on their health and environmental impact.

  8. Study of Pellets and Lumps as Raw Materials in Silicon Production from Quartz and Silicon Carbide (United States)

    Dal Martello, E.; Tranell, G.; Gaal, S.; Raaness, O. S.; Tang, K.; Arnberg, L.


    The use of high-purity carbon and quartz raw materials reduces the need for comprehensive refining steps after the silicon has been produced carbothermically in the electric reduction furnace. The current work aims at comparing the reaction mechanisms and kinetics occurring in the inner part of the reduction furnace when pellets or lumpy charge is used, as well as the effect of the raw material mix. Laboratory-scale carbothermic reduction experiments have been carried out in an induction furnace. High-purity silicon carbide and two different high-purity hydrothermal quartzes were charged as raw materials at different molar ratios. The charge was in the form of lumps (size, 2-5 mm) or as powder (size, 10-20 μm), mixed and agglomerated as pellets (size, 1-3 mm) and reacted at 2273 K (2000 °C). The thermal properties of the quartzes were measured also by heating a small piece of quartz in CO atmosphere. The investigated quartzes have different reactivity in reducing atmosphere. The carbothermal reduction experiments show differences in the reacted charge between pellets and lumps as charge material. Solid-gas reactions take place from the inside of the pellets porosity, whereas reactions in lumps occur topochemically. Silicon in pellets is produced mainly in the rim zone. Larger volumes of silicon have been found when using lumpy charge. More SiO is produced when using pellets than for lumpy SiO2 for the same molar ratio and heating conditions. The two SiC polytypes used in the carbothermal reduction experiments as carbon reductants presented different reactivity.

  9. Analytical methods to characterize heterogeneous raw material for thermal spray process: cored wire Inconel 625 (United States)

    Lindner, T.; Bonebeau, S.; Drehmann, R.; Grund, T.; Pawlowski, L.; Lampke, T.


    In wire arc spraying, the raw material needs to exhibit sufficient formability and ductility in order to be processed. By using an electrically conductive, metallic sheath, it is also possible to handle non-conductive and/or brittle materials such as ceramics. In comparison to massive wire, a cored wire has a heterogeneous material distribution. Due to this fact and the complex thermodynamic processes during wire arc spraying, it is very difficult to predict the resulting chemical composition in the coating with sufficient accuracy. An Inconel 625 cored wire was used to investigate this issue. In a comparative study, the analytical results of the raw material were compared to arc sprayed coatings and droplets, which were remelted in an arc furnace under argon atmosphere. Energy-dispersive X-ray spectroscopy (EDX) and X-ray fluorescence (XRF) analysis were used to determine the chemical composition. The phase determination was performed by X-ray diffraction (XRD). The results were related to the manufacturer specifications and evaluated in respect to differences in the chemical composition. The comparison between the feedstock powder, the remelted droplets and the thermally sprayed coatings allows to evaluate the influence of the processing methods on the resulting chemical and phase composition.


    Directory of Open Access Journals (Sweden)

    G. O. Magomedov


    Full Text Available Summary. Developed a new system for producing concentrated semi-finished products in the form of pastes for the food industry. Currently, an important task of the food industry is the creation of new products with the aim of improving the structure of the range, saving scarce raw materials, as well as reduce sugar intake; development of product functionality and products with extended shelf life. The use of local non-traditional types of plant materials can contribute to solving existing problems. Fruit and vegetable pastes are a valuable food products which can be used as a semifinished product in the confectionery, bakery, food concentrates industry. Fruit and vegetable purees have a distinct structurally viscous or pseudo-plastic properties and concentration form a very viscous mass. Already in the beginning of the process of concentration, i.e. at a relatively low degree of evaporation that leads to a rapid increase in the viscosity of the concentrate mass and reduce evaporation. With increasing temperature is the burning mass, and also change its color and flavor. Therefore, for the concentration of fruit and vegetable purees, you must use equipment whose design takes into account the possible rheological and thermal problems. The analysis of literary data structures evaporators and studies, we developed a system for producing concentrated pastes of fruit and vegetable raw materials. Developed installation can increase the quality of the finished product due to the intensification of the process of concentration, to reduce material and energy resources, increase productivity.

  11. Discriminative illumination: per-pixel classification of raw materials based on optimal projections of spectral BRDF. (United States)

    Liu, Chao; Gu, Jinwei


    Classifying raw, unpainted materials--metal, plastic, ceramic, fabric, and so on--is an important yet challenging task for computer vision. Previous works measure subsets of surface spectral reflectance as features for classification. However, acquiring the full spectral reflectance is time consuming and error-prone. In this paper, we propose to use coded illumination to directly measure discriminative features for material classification. Optimal illumination patterns--which we call "discriminative illumination"--are learned from training samples, after projecting to which the spectral reflectance of different materials are maximally separated. This projection is automatically realized by the integration of incident light for surface reflection. While a single discriminative illumination is capable of linear, two-class classification, we show that multiple discriminative illuminations can be used for nonlinear and multiclass classification. We also show theoretically that the proposed method has higher signal-to-noise ratio than previous methods due to light multiplexing. Finally, we construct an LED-based multispectral dome and use the discriminative illumination method for classifying a variety of raw materials, including metal (aluminum, alloy, steel, stainless steel, brass, and copper), plastic, ceramic, fabric, and wood. Experimental results demonstrate its effectiveness.

  12. Extraction products of solid carbonaceous materials

    Energy Technology Data Exchange (ETDEWEB)


    A method is described for the manufacture of liquid products from pressure extracts of solid carbon-containing material by destructive hydrogenation, characterized in that the pressure extracts are hydrogenated in admixture with products of high-molecular weight formed during a previous destructive hydrogenation of another part of the same or other pressure extract and which has been collected as liquid without extensive cooling of the hot products of the reaction, which came from the reaction chamber where the previous destructive hydrogenation took place.

  13. Towards a dynamic assessment of raw materials criticality: linking agent-based demand--with material flow supply modelling approaches. (United States)

    Knoeri, Christof; Wäger, Patrick A; Stamp, Anna; Althaus, Hans-Joerg; Weil, Marcel


    Emerging technologies such as information and communication-, photovoltaic- or battery technologies are expected to increase significantly the demand for scarce metals in the near future. The recently developed methods to evaluate the criticality of mineral raw materials typically provide a 'snapshot' of the criticality of a certain material at one point in time by using static indicators both for supply risk and for the impacts of supply restrictions. While allowing for insights into the mechanisms behind the criticality of raw materials, these methods cannot account for dynamic changes in products and/or activities over time. In this paper we propose a conceptual framework intended to overcome these limitations by including the dynamic interactions between different possible demand and supply configurations. The framework integrates an agent-based behaviour model, where demand emerges from individual agent decisions and interaction, into a dynamic material flow model, representing the materials' stocks and flows. Within the framework, the environmental implications of substitution decisions are evaluated by applying life-cycle assessment methodology. The approach makes a first step towards a dynamic criticality assessment and will enhance the understanding of industrial substitution decisions and environmental implications related to critical metals. We discuss the potential and limitation of such an approach in contrast to state-of-the-art methods and how it might lead to criticality assessments tailored to the specific circumstances of single industrial sectors or individual companies. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. The anti-inflammatory effect of Sonchus oleraceus aqueous extract on lipopolysaccharide stimulated RAW 264.7 cells and mice. (United States)

    Li, Qi; Dong, Dan-Dan; Huang, Qiu-Ping; Li, Jing; Du, Yong-Yong; Li, Bin; Li, Huan-Qing; Huyan, Ting


    Sonchus oleraceus L. (Asteraceae) (SO) is a dietary and traditional medicinal plant in China. However, its underlying mechanism of action as an anti-inflammatory agent is not known. This study evaluates the anti-inflammatory activity of aqueous extract of SO. The extract of SO was used to treat RAW 264.7 cells (in the working concentrations of 500, 250, 125, 62.5, 31.3 and 15.6 μg/mL) for 24 h. Pro-inflammatory cytokines and mediators produced in LPS-stimulated RAW 264.7 cells were assessed. Meanwhile, the expression level of TLR-4, COX-2, pSTATs and NF-κB was tested. Moreover, the anti-inflammatory activity of the extract in vivo was assessed using xylene-induced mouse ear oedema model and the anti-inflammatory compounds in the extracts were analyzed by HPLC-MS. SO extract significantly inhibited the production of pro-inflammatory cytokines and mediators at gene and protein levels with the concentration of 31.3 μg/mL, and suppressed the expression of TLR-4, COX-2, NF-κB and pSTAT in RAW 264.7 cells. The anti-inflammatory activity of SO in vivo has significant anti-inflammatory effects with the concentration of 250 and 125 mg/kg, and less side effect on the weights of the mice at the concentration of 250 mg/kg. Moreover, HPLC-MS analysis revealed that the anti-inflammatory compounds in the extract were identified as villosol, ferulaic acid, β-sitosterol, ursolic acid and rutin. This study indicated that SO extract has anti-inflammatory effects in vitro and in vivo, which will be further developed as novel pharmacological strategies in order to defeat inflammatory diseases.

  15. Lithic assemblages of Azokh Cave (Nagorno Karabagh, Lesser Caucasus: Raw materials, technology and regional context

    Directory of Open Access Journals (Sweden)

    Lena Asryan


    Full Text Available Azokh Cave is a Middle Pleistocene to Holocene site located in Nagorno Karabagh (Lesser Caucasus. The main entrance, Azokh 1, is a large cave that has two geological sequences (lower and upper with nine geo-archaeological units of which only the upper ones (Units I to V have a significant archaeological record.  The faunal remains and lithic artefacts in these units indicate aspects of human occupation, and exploitation of, and association with animals.     The lithic artefacts presented here were recovered from Units V, III and II during the 2002 – 2009 excavation seasons. The available chronological data indicates an age between 293 – 100 Ka for these units. The operational chain is incomplete and artefacts found in the cave are primarily end-products dominated by flake-tools. The assemblage of Unit V is composed primarily of simple, unretouched flakes with a minimal presence of retouched flakes and cores. The Unit II lithic assemblage includes a substantial Levallois component, although with fewer cores and retouched flakes. There are very few flake tools in Unit III. While it is still difficult to assign the Unit V assemblage to a techno-typological group or complex (i.e. Acheulean, Mousterian or other local techno-complexes such as the Kudarian, the Unit II assemblage is clearly associated with Mode 3 or the Mousterian techno-complex.Different local and non-local raw materials were exploited in all units for the production of lithic artefacts, although the range of raw materials is more varied in Unit II. Local chert, flint and basalt were used most commonly, probably due to their easy accessibility. Limestone, jasper and sandstone, from local and non-local sources, are present in small quantities in Units V and II. Obsidian is the only raw material that possibly originates from more distant sources. Flint and chert appear to have been preferentially exploited for flake tool production in all units, but the toolmakers show a

  16. Energies and raw materials. Letter n.28; Energies matieres premieres. Lettre n. 28

    Energy Technology Data Exchange (ETDEWEB)



    This letter of the DGEMP (General Direction of the Energy and the Raw Materials) deals with the following four main topics: the main recommendations of the final report of the working Group ''Factor 4'' concerning the energy policy; the energy conservation certificates as a tool of the energy control with their implication in the residential and ternary sector; the increase of the solar water heaters and heat pumps sales thanks to the tax credits; the California example facing the climatic change and the energy policy. (A.L.B.)

  17. Utilization of silicifed Tertiary wood as raw material for the natural stone industry. [German Democratic Republic

    Energy Technology Data Exchange (ETDEWEB)

    Bellmann, H J; Schuettler, J; Jakisch, E


    This paper discusses the occurrence of silicified tree trunks and stumps in the Boehlen brown coal field. The trees, mainly Taxodium and Sequoia 25 million years old, are located within the top brown coal seam of the deposit and present a major obstacle to excavator operation, together with other forms of so-called 'brown coal quartzite'. The quartz of the silicified trees occurs as opal, cryptocrystalline quartz and low temperature quartz. The separate removal and disposal of this wood as well as efforts made to use selected wood as raw material are briefly summarized. Various products for interior house decoration have been manufactured from the wood. (4 refs.)

  18. Utilisation of biological and secondary raw materials IX. Recycling - conversion to energy

    International Nuclear Information System (INIS)

    Wiemer, Klaus; Kern, Michael; Raussen, Thomas


    The book on the utilization of biological and secondary raw materials covers the following issues: Perspectives of the circular flow and resource economy, waste avoidance, closed substance cycle waste management law and biowaste assessment, economic evaluation and usage alternatives for biogas, consequences of the 4th BlmschV, the BioAbfV and the DueV for the biowaste treatment, alternative techniques of the Biowaste collection, alternative models of the recyclable substance assessment, future of the packaging and recyclable substance utilization, ElectroG and E-scrape recycling, innovative concepts for the municipal waste management, future of the MBA, MVA and EBS management.

  19. Analysis of forecasting and inventory control of raw material supplies in PT INDAC INT’L (United States)

    Lesmana, E.; Subartini, B.; Riaman; Jabar, D. A.


    This study discusses the data forecasting sales of carbon electrodes at PT. INDAC INT L uses winters and double moving average methods, while for predicting the amount of inventory and cost required in ordering raw material of carbon electrode next period using Economic Order Quantity (EOQ) model. The result of error analysis shows that winters method for next period gives result of MAE, MSE, and MAPE, the winters method is a better forecasting method for forecasting sales of carbon electrode products. So that PT. INDAC INT L is advised to provide products that will be sold following the sales amount by the winters method.

  20. Connections between borehole geophysical parameters of the quality of cement raw materials

    International Nuclear Information System (INIS)

    Szabo, L.; Illes, A.


    The raw materials for the cement industry are prospected - according to the recommendations of national authorities - by geophysical methods, too. These include not the determination of the deposit boundary, but also an estimation of the quality of limestone and clay from the point of cement manufacture. No forerunners of such tests exist, so new methods were elaborated. After 12 years of site tests it was found that the correlation between laboratory quality tests and certain geophysical parameters of clay deposits is fair but less close in case of limestone deposits. (author)

  1. The application of isotopic dating methods for prospection and exploration of nuclear raw material

    International Nuclear Information System (INIS)

    Komlev, L.V.; Anderson, E.B.


    Among the geological and geochemical methods for prospecting and searching the nuclear raw material, the isotope-dating methods determine the most important search criterion - the time of the ore-forming. The elaboration and use of these methods in uranium-ore regions reveal a series of geochemical epochs of uranium and thorium accumulation connected naturally with the history of geological evolution of the earth crust. The isotope-dating methods enable with confidence to establish the stages of tectono-magmatic activity resulting in the redistribution and the local concentration of uranium. The wide use of isotopic methods is a necessary condition for reasonable trends of the modern geological exploration [ru

  2. Mechanical Properties and Microstructure of Fast – Fired Clinker Tiles Based on Wierzbka I Raw Material


    Gajek M.; Rapacz-Kmita A.; Dudek M.; Partyka J.


    The article presents results of research on microstructural and mechanical properties of floor tiles clinker manufactured on the basis of Wierzbka I raw material, which is part of the deposit Wierzbka, near Suchedniów. Wierzbka I clay was added in various volume fractions to the standard tile compositions used in industrial practice. The samples were pressed in a range of from 21 MPa to 42 MPa and fired in the laboratory furnace at 1130°C to 1190°C. Selected compositions were pressed at 28 MP...

  3. Determination of optimum mixing time for raw materials with the tracer method in the glass industry

    Energy Technology Data Exchange (ETDEWEB)

    Gallyas, M; Gemesi, J; Kurinka, J


    The authors explain how the optimum mixing time for the raw materials for glass manufacture can be determined with the aid of the radioactive tracer method. Basing themselves on measurements, they indicate the change in the degree of mixing of the individual components (soda (Na-24), sodium sulphate, coke (La-140) and bone meal (P-32) as a function of mixing time. The optimum degree of mixing and mixing time for dry and for wet mixing are determined. Finally, data for determining the permissible storage time of the mixture are given.

  4. Whey as a raw material for the production of functional beverages

    Directory of Open Access Journals (Sweden)

    Bulatović Maja Lj.


    Full Text Available One of the least utilized by-products of food industry, despite the great potential that is described, is the whey, which is obtained as a by-product of the technological process production of cheese and casein. The excess whey, which occurs in this process in very high yields, with failure to processing is becoming a very big polluter, what is completely at odds with the potential that such materials possess. On the other hand, the modern tempo and way of life, and increasingly polluted environmental also, impose the need to produce food products that would help the human body in the fight against harmful agents which are exposed to daily. One of the more effective solution is the production of fermented functional beverages based on whey, which achieved this intention in the most natural and most comfortable way. Considering the rather untapped potential of whey as a raw material and growing food shortages in the world market, the aim of this study was to analyze the possibilities of production of functional beverages based on whey, with satisfactory sensory characteristics, in order to demonstrate the attractiveness of whey as raw material in the food industry. This paper presents an overview of the wide possibilities for the use of whey with a special emphasis on its attractiveness and the necessity of its utilizing.

  5. Mineralogical and technology characterization of raw materials of clay used for ceramic blocks fabrication

    International Nuclear Information System (INIS)

    Campos, N.Q.; Tapajos, N.S.


    In the state of Para, the red ceramic industry has several segments highly generators of jobs and a strong social appeal. With so many companies focused on this productive sector emerge, but many without any administration quality. Therefore, this study focused the technological and mineralogical characterization of the raw material used in the manufacture of ceramic blocks, by Ceramica Vermelha Company, located in the district of Inhangapi-PA. The raw material was obtained by the techniques of X-ray diffraction (XRD) to determine the present crystalline phases through an accurate and efficient procedure, where it was possible to identify the peaks relating to montmorillonite, illite and kaolinite clay in the sample, and kaolinite and quartz in the sample laterite. Another important result was the absorption of water, with average satisfactory according to the standards. According to a sieve analysis, the laterite the sand fraction showed a greater extent compared to the other, while the clay silt exceeding 80% was found to be too plastic material. The resistance to compression, the results were below the required by the standard, suggesting more accurate test methods. (author)

  6. Potential of Electronic Plastic Waste as a Source of Raw Material and Energy Recovery

    International Nuclear Information System (INIS)

    Norazli Othman; Nor Ezlin Ahmad Basri; Lariyah Mohd Sidek


    Nowadays, the production of electronic equipment is one of the fastest growing industrial activities in this world. The increase use of plastic in this sector resulted in an increase of electronic plastic waste. Basically, electronic plastic material contains various chemical elements which act as a flame retardant when electronic equipment is operated. In general, the concept of recycling electronic plastic waste should be considered in order to protect the environment. For this purpose, research has been conducted to different resins of electronic plastic waste to identify the potential of electronic plastic waste as a source of raw material and energy recovery. This study was divided into two part for example determination of physical and chemical characteristics of plastic resins and calculation of heating value for plastic resins based on Dulong formula. Results of this research show that the average calorific value of electronic waste is 30,872.42 kJ/ kg (7,375 kcal/ kg). The emission factor analysis showed that the concentration of emission value that might occur during waste management activities is below the standard set by the Environment Quality Act 1974. Basically, this research shows that electronic plastic waste has the potential to become the source of raw material and energy recovery. (author)

  7. Calcium flouride (CaF2) from oyster shell as a raw material for thermoluminescence dosimeter

    International Nuclear Information System (INIS)

    Coloma, Lyra C.; Fanuga, Lyn N.; Ocreto, Cherries Ann; Rodriguez, Richita


    This study aims to develop a thermoluminescence dosimeter raw material made of calcium fluoride from locally available seashells that is suitable for personal radiation monitoring. Oyster shells were collected and grounded as powder samples and analyzed for calcium fluoride (CaF 2 ) content using XRF and XRD testing. Samples include pure CaF 2 , pure oyster shell, and oyster shells treated with acid. Based from the XRF results, natural oyster shell (w/ and w/o HNO 3 ) had high percentage of calcium about 49.64% and 47.45%, next to the pure calcium fluoride of 51.08%. X-ray diffractrogram shows that oyster sample had the nearest desired structure of CaF 2 compared with two seashells relative to the pure CaF 2 as standard materials. Results show that all of the natural oyster samples displayed TL emission glow curves at the temperature range 200-300 o C. It was also found that pure oyster sample has better TL response as compared to the treated ones. The researchers concluded that the calcium fluoride from oyster shells (without acid and heated) is a potentially good low-cost TLD raw material and may be used as an alternative for the much more expensive LiF dosimeters. (Authors)


    Directory of Open Access Journals (Sweden)

    A. A. Alekhin


    Full Text Available The article deals with creation results of experimental prototype of optical-electronic complex, designed to assess ore dressability of mineral raw materials by optical sorting method.

  9. Cutin from agro-waste as a raw material for the production of bioplastics. (United States)

    Heredia-Guerrero, José A; Heredia, Antonio; Domínguez, Eva; Cingolani, Roberto; Bayer, Ilker S; Athanassiou, Athanassia; Benítez, José J


    Cutin is the main component of plant cuticles constituting the framework that supports the rest of the cuticle components. This biopolymer is composed of esterified bi- and trifunctional fatty acids. Despite its ubiquity in terrestrial plants, it has been underutilized as raw material due to its insolubility and lack of melting point. However, in recent years, a few technologies have been developed to obtain cutin monomers from several agro-wastes at an industrial scale. This review is focused on the description of cutin properties, biodegradability, chemical composition, processability, abundance, and the state of art of the fabrication of cutin-based materials in order to evaluate whether this biopolymer can be considered a source for the production of renewable materials. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email:

  10. use of water extract of moringa oleifera seeds (wemos) in raw water

    African Journals Online (AJOL)


    Availability of clean water is a serious problem, especially in developing ... J. C. Agunwamba, Department of Civil Engineering, University of Nigeria, Nsukka, .... Technical. Feasibility of the Treatment of Domestic. Waste and Raw Water.

  11. Analysis of Cement as Raw Material Inventory on Ready Mix Production Unit at PT. Perdana Beton in Samarinda


    Wahyuni, Novita Eka


    This study aims to identify and analyze the optimal amount of cement supplies in PT. Perdana Beton In Samarinda. Formulation of the problem in this study is whether the supply of cement as raw material for Ready Mix at PT. Perdana Beton In Samarinda already minimizing the cost of inventory cement. The hypothesis in this study is: '' Allegedly cement as raw material supplies ready mix at PT. Perdana Beton In Samarinda not provide minimum inventory costs'. Basic...

  12. Variations in the wood raw material for pellets manufacture and its influence on the quality of wood pellets; Variationer inom traeraavaran foer pelletstillverkning och deras paaverkan paa pelletskvaliteten

    Energy Technology Data Exchange (ETDEWEB)

    Jirjis, Raida; Vinterbaeck, Johan; Engberg, Jessica [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Bioenergy; Oehman, Marcus [ETC Energitekniskt Centrum, Piteaa (Sweden)


    assortments was undertaken using a small Metador press machine. To study the effect of variations in the raw material on pellets quality, the setting of the press equipment was kept unchanged during the pressing of all assortments. Many technical difficulties were encountered during the small-scale manufacturing of the pellets. We only succeeded in pelletizing sawdust from fresh and four-months stored pine but not from 8-months stored pine or spruce assortments. The ash content in sawdust taken from different material was low and varied between 0.2 and 0.35 % of dry weight. The content of ash in the small-scaled produced pellets was close to that of the raw material. The initial average calorific heating values of pine, both thin and large diameter trees, were higher than that of spruce. The concentration of extractives, both those extracted with acetone or with alcohol, were generally higher in pine compared to spruce samples. A marked increase in the concentration of alcohol-soluble extractives was measured during the storing of sawdust from both pine and spruce. The pellets made from this material showed a similar pattern. This increase possibly reflects changes in some chemical components that were affected by the high temperature developed during storage. Attempts to relate the changes occurred in the raw material to the quality of the produced pellets were not totally successful partly due to the large variations within the raw material itself and partly because of the failure to palletise certain assortments. However, general conclusion are still possible to draw. The compact density of individual pellets varied very little between various samples produced by the small-scale pelletizing method. Similar results were obtained in pellets manufactured at the industrial factories. The durability of pellets produced using the small-scale method was generally higher when the raw material was stored before pelletizing. This observation is in agreement with the general opinion

  13. Anthropogenic materials and products containing natural radionuclides. Pt. 1a. Radiation properties of raw materials and waste materials. A literature study

    International Nuclear Information System (INIS)

    Reichelt, A.; Roehrer, J.; Lehmann, K.H.


    Cased on the literature study, the publication presents relevant data on raw materials and wastes containing natural radionuclides. The study is part 1a of the project on ''Anthropogenic materials and waste materials containing natural radionuclides''. Part 1 of the project gives data and information on about 100 different materials and wastes or products for household or industrial applications which contain significant amounts of natural radioactivity. In addition, part 1 presents for some of these materials information on their applications, consumption, radioactivity and resulting radiation doses. The raw materials and waste materials on the list in part 1 are characterised in this 1a report. Wherever appropriate, two or more materials are dealt with in one chapter, as e.g. felspar and felspar sands (pegmatite), talcum, and soapstone. The wastes are dealt with in the chapters discussing the relevant raw materials. The information given is as derived from the literature and does not include comments or evaluation by the authors of this report. Whenever the literature study did not yield information on radiological aspects of a material on the list, an appropriate notice is given. (Orig./DG) [de

  14. Investigation and analysis on ITER in-vessel coils’ raw-materials

    International Nuclear Information System (INIS)

    Jin, Huan; Wu, Yu; Long, Feng; Yu, Min; Han, Qiyang; Liu, Huajun


    Highlights: • The R and D works for the ITER in-vessel coils (IVC) are now being conducted in Institute of Plasma Physics, and the analysis work are being done by Princeton Plasma Physics Laboratory. • There is little published paper about the raw materials for ITER IVC coils. • This manuscript points out the progress of the selected materials for ITER IVC coils. -- Abstract: The ITER in-vessel coils (IVCs) consist of 27 coils edge localized modes (ELM) and 2 coils vertical stabilization (VS) which are all mounted on the vacuum vessel wall behind the shield modules. The IVCs design and manufacturing work is being conducted in between Institute of Plasma Physics Chinese Academy of Sciences (ASIPP) and Princeton Plasma Physics Laboratory (PPPL). Because the position of ELM and VS coils is close and face to the plasma, the IVCs must undergo a severe environment, such as the high dose of radiation and high operation temperature, thus the conventional electrical insulation materials cannot be used. And the technology of “Stainless Steel Jacketed Mineral Insulated Conductor” (SSMIC) is deemed as the best choice to provide the necessary radiation resistance and compatibility strength in ITER's vacuum vessel. While mineral insulated conductor technology is not new, and is similar to the mineral insulated cable used in industrial. Some difficulties still need to be solved, such as searching for the proper raw-materials to make sure that the conductor have the properties of high current carrying capability, the necessary radiation resistance, the proper strength, at the same time, it must be come true in manufacture technology. This paper described the analysis of the materials for VS and ELM coil conductor


    Directory of Open Access Journals (Sweden)

    Fedchenkova Yu.A


    Full Text Available Introduction. In accordance with the last events in Ukraine (considering military operations in anti-terrorist operation in the Luhansk and Donetsk regions the domestic medicine is in great need in preparations with antimicrobial activity. Our attention as the sources of receiving biologically active substances with antimicrobial activity was drawn with birch Betulaceae family plants – hazel ordinary Corylus avellana L. and black alder Alnus glutinosa (L. Gaertn. It is known that in medicine the leaves of hazel ordinary are used as antiseptic, anti-inflammatory, vesselrestorative drug, and the leaves of black alder reveal the antiinflammatory, astringent, wound healing, spasmolytic and choleretic action. However, the drugs with antimicrobial action received from the leaves of these plants are absent on the market of Ukraine. Therefore the studying of antimicrobial activity of this type of raw materials received from hazel ordinary and black alder, for creation of new medicines, is now one of the main directions in pharmacy. For this purpose we have revealed tinctures, spirit, lipophilic and polysacharid fractions received from the leaves of hazel ordinary and black alder. The purpose of our research is studying of antimicrobial activity of revealed substance received from the leaves of black alder and hazel ordinary. Materials and methods. There were being examined tinctures, lipophilic, spirit and polysacharid fractions received from the leaves of hazel ordinary and black alder. The test of antimicrobial effect of substances was carried out by means of serial dilution concerning the following six reference cultures: Staphylococcus aureus ATCC 6538-P, Candida albicans ATCC 885-653, Escherichia coli ATCC 25922, Bacillus subtilis ATCC 6833, Bacillus cereus ATCC 10702, Pseudomonas aeruginosa ATCC 9027, according to the State Pharmacopoeia of Ukraine, in the Department of Microbiology and Immunology of KMAPE. For the experiment there was prepared

  16. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    Energy Technology Data Exchange (ETDEWEB)

    Marambio, E.; Cordano, A. M.; Insunza, M.; Fernández, M.; Astorga, J. [Sección Microbiología de Alimentos, Instituto de Salud Pública de Chile (Chile)


    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  17. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    International Nuclear Information System (INIS)

    Marambio, E.; Cordano, A.M.; Insunza, M.; Fernández, M.; Astorga, J.


    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  18. Iron zircon pigment synthesis: Proposal of a mixing index for the raw materials mixtures

    International Nuclear Information System (INIS)

    Zumaquero, E.; Ortsb, M.J.; Sanz, V.; Mestre, S.


    Iron zircon coral pigments are very interesting from an industrial point of view because of their high colouring power and their stability at high temperatures. However, the pigment's synthesis is particularly troublesome due to its specific reaction mechanism. As an encapsulated pigment it becomes very important how the raw materials are distributed in the reaction mixture. To evaluate the effectiveness of the mixing process, it would be convenient to define a parameter, that is the mixing index, to estimate the degree of homogeneity of the system. In the current investigation, a mixing index is proposed derived from the power spectrum of Fourier transform of scanning electron microscope (SEM) images of the raw material mixture. Concretely, the number of pixels in a certain range of values in the image of the power spectrum, seems to behave relatively well as mixing index. This index allows us to distinguish between samples with different zirconia and iron oxide used as precursors. The proposed mixing index seems to be related to the colouring power of the final pigment when the synthesis generates enough zircon to encapsulate hematite particles. [es

  19. Conference on raw materials and jobs cost variation - Impact on wind turbine manufacturers and operators

    International Nuclear Information System (INIS)

    Chabot, Bernard; Falk, Thorsten; Braeuninger, Michael; Rehfeldt, Knud; Brand, Ruth; Buhr, Ingo de; Jenne, Markus


    In the framework of the 2007 Husum Wind exhibition, the French-German office for Renewable energies (OFAEnR) organised a side event on In the framework of this French-German exchange of experience, participants exchanged views on raw materials and jobs cost variations in the wind power industry in both countries. Its aim was to compare and analyse the French and German respective support systems to renewable energy sources. This document brings together the available presentations (slides) made during this event: 1 - Protecting wind energy tariffs against inflation effects: analysis and suggestions from the French experience (Bernard Chabot); 2 - Wind energy in Germany - Tariff structure in the EEG renewable energy law (Thorsten Falk); 3 - Wind energy competitiveness (Michael Braeuninge, Knud Rehfeldt); 4 - Influence of raw materials price rise on the production costs of ENERCON wind turbines maker (Ruth Brand); 5 - Presentation of the overall costs of an offshore wind energy project (Ingo de Buhr); 6 - Comparison between French and German tariffs profitability using a model wind farm: presentation of the pros and cons of both systems (Markus Jenne)

  20. Effect of ionising radiation on shelf life and potency of herbal raw materials

    International Nuclear Information System (INIS)

    Rama Bhat, P.; Prajna, P.S.; Sanjeev, Ganesh; Padyana, Subramanya; Maurya, D.K.


    Medicinal herbs are involving from fringe to mainstream use with a greater number of people seeking remedies and health approaches free from side effects caused by synthetic chemicals. Unfortunately, the number of reports of people experiencing negative effects, caused by the use of herbal drugs, has also been increasing. There may be various reasons for such problems, poor quality of herbal medicines due to insufficient attention being paid to the quality assurance and control of these products. Plants are associated with their own microflora, in addition to that soil and air act as main inoculum source for causing contamination in crude herbs along with other field practices like harvesting, handling and packing. The study was aimed to determine the type, level of bacterial and fungal load and feasibility of electron beam irradiation to hygenise the commonly used herbal raw materials using electron beam radiation with three different dosages viz., 8 kGy, 12 kGy, 15 kGy. Irradiated and control samples were analysed for microbial load and biochemical compositions. In present study, microbial load was proportionately reduced with increase in dosage compared to non-irradiated samples. Results indicated that non-irradiated samples were highly contaminated with microbial load. E. coli and Staphylococcus spp. were predominant among the bacterial contaminants at varying levels. The fungi enumerated from raw materials includes species of Penicillium, Rhizopus, Mucor and Aspergillus. Minimum variation was recorded in the carbohydrate, protein, phenolic, tannin and ascorbic acid content of the herb samples with irradiation treatment. (author)

  1. Present and future trends in pellet markets, raw materials, and supply logistics in Sweden and Finland

    International Nuclear Information System (INIS)

    Selkimaeki, Mari; Mola-Yudego, Blas; Roeser, Dominik; Prinz, Robert; Sikanen, Lauri


    Wood pellets have become an important fuel in heat and power production, and pellet markets are currently undergoing rapid development. In this paper, the pellet markets, raw materials and supply structures are analyzed for Sweden and Finland, based on a database of the current location and production capacity of the pellet producers, complemented with existing reports and literature. In Sweden, a total of 94 pellet plants/producers were identified, producing 1.4 million tonnes of pellets, while the domestic consumption was 1.7 million tonnes, and about 400,000 t of pellets were imported to fulfil the demand in 2007. In Finland, 24 pellet plants/producers were identified and the production was around 330,000 t while the domestic consumption was 117,000 t in 2007. In Finland, pellet market has been long time export oriented, whereas domestic consumption has been growing mainly in the small scale consumer sector, estimated 15,000 households had pellet heating systems in 2008. In the future, the increasing number of pellet users will require a reliable delivery network and good equipment for bulk pellet deliveries. Provision of new raw materials and ensuring the good quality of pellets through the whole production, delivery and handling chain will be fundamental in order to increase the use of pellets and sustain the ability to compete with other fuels. (author)

  2. Nuclear raw materials. Knowledge status after the Geneva conference (September 1958)

    International Nuclear Information System (INIS)

    Lecoq, M.; Mabile, J.; Carrat, G.; Ginocchio, A.; Roques, E.; Waynbaum, M.; Chervet, J.; Branche, G.; Geffroy, J.; Le Goff, M.


    The authors propose a synthesis of the numerous contributions presented at the Geneva conference. They first address deposits: uranium deposits (studies on uranium geochemistry and metallogeny, descriptions of various deposit types such as those associated with sedimentary layers or tectonic structures or petrographic types), thorium deposits, beryllium deposits, zirconium deposits. A second part addresses research methods and equipment: descriptive mineralogical studies, analytic physical or chemical methods, analytic field methods, isotope analysis, prospecting methods (geochemical techniques, radiometry, geophysical methods, general remarks on prospecting methods, organization of prospecting operations, and techniques of deep prospecting). The third part addresses the issues of reserves and resources: definitions, assessment techniques, geographical distribution of reserves and resources. The fourth part addresses the exploitation: quarries, underground exploitation, measures for personnel protection. The fifth part addresses ore concentration: determination of uranium ore and other raw material, concentration by physical means, ore concentration by chemical means, ore sampling, and plant monitoring and regulation. The last part addresses the economy of raw materials: uranium (cost price and production, and purchase and selling prices in different countries, world market in 1960 and on a longer term), thorium, beryllium, zirconium, lithium and helium


    Directory of Open Access Journals (Sweden)

    COLDEA Alina


    Full Text Available The comfort is undoubtedly the most important human attribute depends upon the moisture transport which in turn depends on the moisture transport behavior of the knitted fabric. Moisture transport is the transfer of liquid water capillary interstices of the yarns and depends on the wettability of fiber surfaces, as well as the structure of the yarn and fabric. Because of its good water absorption property, cotton is often used for next-to-skin wear such as t-shirts, underwear, socks. All these are known as ``moisture management`` which means the ability of a textile fabric to transport moisture away from the skin to the garment’s outer surface in multi-dimensions and it is one of the key performance criteria in today’s apparel industry since it has a significant effect on the human perception of moisture sensations. In order to study, plated knitted fabric for socks were knitted as plated single jersey in the same production conditions, from different types of yarns, produced in different yarn counts (Ne 20, Ne 24, Ne 30 and different raw material. (cotton, bamboo, soybean, polyester, viscose. Were chose two different density on circular knitting machine. The liquid moisture management of the samples was measured in order to determinate moisture transport index. Was study also the influence of raw material and fabric structure related to the moisture transport index. According to the obtained results, it was found that some of the knitted fabrics used in this study have goodmoisture management capability.

  4. Quantitative analysis of the 26 allergens for cosmetic labeling in fragrance raw materials and perfume oils. (United States)

    Leijs, Hans; Broekhans, Joost; van Pelt, Leon; Mussinan, Cynthia


    The adoption of the 7th amendment of the European Cosmetic Directive 76/768/EEC requires any cosmetic product containing any of 26 raw materials identified by the Scientific Committee on Cosmetic Products and Non-Food Products intended for Consumers as likely to cause a contact allergy when present above certain trigger levels to be declared on the package label. Of these 26, 24 are volatile and can be analyzed by GC. This paper describes a method for the quantitative analysis of these volatile raw materials in perfume ingredients as well as complex perfume compositions. The method uses sequential dual-column GC-MS analysis. The full-scan data acquired minimize the false-positive and false-negative identifications that can be observed with alternate methods based on data acquired in the SIM mode. For each sample, allergen levels are determined on both columns sequentially, leading to two numerical results for each allergen. Quantification limits for each allergen in a perfume mixture based on the analysis of a standard are 0.999) and stable for multiple days. Studies on perfumes spiked with multiple allergens at 30, 50, and 70 mg/kg show recoveries close to nominal values.

  5. Evaluation of the biodiesel production using three sources of raw material and ethanol

    Energy Technology Data Exchange (ETDEWEB)

    Radecki, Angela Patricia; Fracaro, Cristiane; Gnoatto, Estor; Kavanagh, Edward; Anami, Marcelo Hidemassa; Fischborn, Marcos; Lobo, Viviane da Silva [Universidade Tecnologica Federal do Parana (UTFPR), Medianeira, PR (Brazil)], E-mail:; Zara, Ricardo Fiori [Prati Donaduzzi e Cia. Ltda., Toledo, PR (Brazil)


    The conversion of different oils in ethyl ester (biodiesel) through the transesterification with anhydrous ethanol, together with its quality and its consumption in mixture with diesel of petroleum in different ratios, they were evaluated using a stationary diesel engine connected to an electric energy generator. The raw materials used in this transformation were oil of refined soybean, oil of refined sunflower and animal fat (swine). In the transesterification reaction it was used an alkaline catalyst (sodium hydroxide), because of its proven effectiveness and the high speed facing other catalyst, beyond being less corrosive and demands less molar' reasons between the alcohol and the vegetal oil. The tests in stationary diesel engine were carried through the dilutions of 0%, 5%, 10%, 15% and 20% of biodiesel produced in mixture with diesel of petroleum. The results showed that the yield of biodiesel gotten by different sources is satisfactory. It was also observed that the basic catalysis is adjusted to the production of biodiesel from raw materials with low acidity. The tests in diesel engine appeared to be sufficiently satisfactory once it was not observed any alteration in the functioning of the engine. The consumption was also not modified by the studied dilutions, demonstrating that the biodiesel can be added to the pure diesel reducing the use of the fuel derived from petroleum. (author)

  6. Gamma activity as a guide for the building raw materials selection and controlling the environmental hazards

    Directory of Open Access Journals (Sweden)

    T. Ibrahim


    Full Text Available The spectrometric measurements can provide an alarm for the radiation activity and radioelement concentra-tions. The activity increase over the ambient background can be achieved by well calibrated gamma-spectrometers. In comparison between Wadi El-Dahl and Abu Zawal quarries for building raw materials (feld-spar, the activity concentration of El-Dahl stream sediments are 54.5 and 44.5 Bq/kg for uranium and thorium respectively. While the activity concentration of Abu Zawal rock quarry are 167.03 and 79.77 Bq/kg for uranium and thorium respectively. These activities yielding effective dose rates of 0.63 mSv/y for Wadi El-Dahl stream sediments and 1.48 mSv/y for Abu Zawal rock quarry. In summary, the spectrometric measurements are excellent selective tool to monitoring the environment against the radiation risk. In this aspect, Wadi El-Dahl stream sedi-ment quarry considered as the more suitable for producing feldspar as a raw materials to building industry. In comparison, Abu Zawal rock quarry has a higher effective dose rate exceeds the international permissible limits which is 1 mSv/y. A total of 19 feldspar samples were completely described regarding their general chemical fea-tures by using x-ray fluorescence. From the study all the samples contain high concentration of barium and ru-bidium which can separate using different methods in order to use in different important industry.

  7. Determination of Au, Pt, Pd in gold ore mineral raw materials by stripping voltammetry

    Directory of Open Access Journals (Sweden)

    Kolpakova N.A.


    Full Text Available The paper considers the possibilities of use of the method of stripping voltammetry for finding platinum metals in mineral gold and ore raw material. A review of new options of electro-concentration of platinum metals on the surface of graphite electrode with the following sediment electro-oxidation and receipt of an analytical signal is presented: platinum finding was carried out by picks of selective electro-oxidation of iridium from intermetallic compound with platinum; gold finding was carried out by picks of gold electro-oxidation on the surface of graphite electrode modified by bismuth; palladium finding was performed by picks of palladium electro-oxidation on the surface of graphite electrode. 1M HCL solution was selected as a supporting electrolyte. Gold and hydrogen elimination on the process of palladium electro-oxidation was performed by means of UV irradiation of solution in the process of electro-concentration of palladium sediment. Gold, platinum and palladium determination was carried out in mineral gold and ore raw material of Verkhneamylskiy gold and ore district.

  8. Evaluation of Apple Pomace as a Raw Material for Alternative Applications in Food Industries

    Directory of Open Access Journals (Sweden)

    Elena Falqué


    Full Text Available In order to measure the potential of apple pomace as a raw material for manufacturing food-related products (such as lactic acid, fiber-rich concentrates and pectin, samples from cider industry were assayed for composition and enzymatic digestibility. Alcohol-soluble compounds (monosaccharides, oligosaccharides and malic acid accounted for 32–45 mass percent of oven-dry pomace. Glucose and fructose were the major components of this fraction. The alcohol-insoluble fraction accounted for 55–68 mass percent of oven-dry pomace and was mainly made up of neutral detergent fiber (62–69 percent of the mass fraction and pectin (16.2–19.7 percent of the mass fraction. The feedstock content of N, P and metal ions (K, Mg, Fe and Mn was favourable for further manufacture of lactic acid fermentation media. Apple pomace showed a high susceptibility to enzymatic hydrolysis: in media with a cellulase loading of 8.5 FPU/g of apple pomace and a cellobiase loading of 5 IU/FPU, about 80 % of the total glucan was converted into glucose after 15 h. Considering the low enzyme charge, liquor to solid ratio employed, reaction time needed to achieve the maximal sugars concentration and N, P and metal ion (K, Mg, Fe and Mn content of samples, it can be concluded that apple pomace is a promising raw material for lactic acid production.

  9. Stimulation of nitric oxide synthesis by the aqueous extract of Panax ginseng root in RAW 264.7 cells. (United States)

    Friedl, R; Moeslinger, T; Kopp, B; Spieckermann, P G


    1. In this study, we investigated the effect of Panax ginseng root aqueous extracts upon inducible nitric oxide synthesis in RAW 264.7 cells. Panax ginseng root extract has been used in the Asian world for centuries as a traditional herb to enhance physical strength and resistance and is becoming more and more popular in Europe and North America. 2. Incubation of murine macrophages (RAW 264.7 cells) with increasing amounts of aqueous extracts of Panax ginseng (0.05 - 0.8 microg microl(-1)) showed a dose dependent stimulation of inducible nitric oxide synthesis. 3. Polysaccharides isolated from Panax ginseng showed strong stimulation of inducible nitric oxide synthesis, whereas a triterpene-enriched fraction from an aqueous extract of Panax ginseng did not show any stimulation. 4. Inducible nitric oxide synthase protein expression was enhanced in a dose dependent manner as revealed by immunoblotting when cells were incubated with increasing amounts of Panax ginseng extract. This was associated with an incline in inducible nitric oxide synthase mRNA-levels as determined by semiquantitative polymerase chain reaction and electromobility shift assay studies indicated enhanced nuclear factor-kappaB DNA binding activity. 5. As nitric oxide plays an important role in immune function, Panax ginseng treatment could modulate several aspects of host defense mechanisms due to stimulation of the inducible nitric oxide synthase.

  10. Mathematical model of silicon smelting process basing on pelletized charge from technogenic raw materials (United States)

    Nemchinova, N. V.; Tyutrin, A. A.; Salov, V. M.


    The silicon production process in the electric arc reduction furnaces (EAF) is studied using pelletized charge as an additive to the standard on the basis of the generated mathematical model. The results obtained due to the model will contribute to the analysis of the charge components behavior during melting with the achievement of optimum final parameters of the silicon production process. The authors proposed using technogenic waste as a raw material for the silicon production in a pelletized form using liquid glass and aluminum production dust from the electrostatic precipitators as a binder. The method of mathematical modeling with the help of the ‘Selector’ software package was used as a basis for the theoretical study. A model was simulated with the imitation of four furnace temperature zones and a crystalline silicon phase (25 °C). The main advantage of the created model is the ability to analyze the behavior of all burden materials (including pelletized charge) in the carbothermic process. The behavior analysis is based on the thermodynamic probability data of the burden materials interactions in the carbothermic process. The model accounts for 17 elements entering the furnace with raw materials, electrodes and air. The silicon melt, obtained by the modeling, contained 91.73 % wt. of the target product. The simulation results showed that in the use of the proposed combined charge, the recovery of silicon reached 69.248 %, which is in good agreement with practical data. The results of the crystalline silicon chemical composition modeling are compared with the real silicon samples of chemical analysis data, which showed the results of convergence. The efficiency of the mathematical modeling methods in the studying of the carbothermal silicon obtaining process with complex interphase transformations and the formation of numerous intermediate compounds using a pelletized charge as an additive to the traditional one is shown.

  11. Natural stone muds as secondary raw materials: towards a new sustainable recovery process (United States)

    Zichella, Lorena; Tori, Alice; Bellopede, Rossana; Marini, Paola


    The production of residual sludge is a topical issue, and has become essential to recover and reuse the materials, both for the economics and the environmental aspect. According to environmental EU Directives, in fact ,the stone cutting and processing should characterized by following objectives, targets and actions: the reduction of waste generated, the decreasing of use of critical raw material, the zero landfilling of sludge and decreasing in potential soil contamination, the prevention of transport of dangerous waste, the reduction of energy consumption, the zero impact on air pollution and the cost reduction . There are many industrial sector in which residual sludge have high concentrations of metals and/or elements deemed harmful and therefore hazardous waste. An important goal, for all industrial sectors, is an increase in productivity and a parallel reduction in costs. The research leads to the development of solutions with an always reduced environmental impact. The possibility to decrease the amount of required raw materials and at the same time the reduction in the amount of waste has become the aim for any industrial reality. From literature there are different approaches for the recovery of raw and secondary materials, and are often used for the purpose chemical products that separate the elements constituting the mud but at the same time make additional pollutants. The aim of the study is to find solutions that are environmentally sustainable for both industries and citizens. The present study is focused on three different Piedmont rocks: Luserna, Diorite from Traversella and Diorite from Vico, processed with three different stone machining technologies: cutting with diamond wire in quarry (blocks), in sawmill (slabs) and surface polishing. The steps are: chemical analysis, particle size analysis and mineralogical composition and characterization of the sludge obtained from the various machining operations for the recovery of the metal material by

  12. Towards a dynamic assessment of raw materials criticality: Linking agent-based demand — With material flow supply modelling approaches

    International Nuclear Information System (INIS)

    Knoeri, Christof; Wäger, Patrick A.; Stamp, Anna; Althaus, Hans-Joerg; Weil, Marcel


    Emerging technologies such as information and communication-, photovoltaic- or battery technologies are expected to increase significantly the demand for scarce metals in the near future. The recently developed methods to evaluate the criticality of mineral raw materials typically provide a ‘snapshot’ of the criticality of a certain material at one point in time by using static indicators both for supply risk and for the impacts of supply restrictions. While allowing for insights into the mechanisms behind the criticality of raw materials, these methods cannot account for dynamic changes in products and/or activities over time. In this paper we propose a conceptual framework intended to overcome these limitations by including the dynamic interactions between different possible demand and supply configurations. The framework integrates an agent-based behaviour model, where demand emerges from individual agent decisions and interaction, into a dynamic material flow model, representing the materials' stocks and flows. Within the framework, the environmental implications of substitution decisions are evaluated by applying life-cycle assessment methodology. The approach makes a first step towards a dynamic criticality assessment and will enhance the understanding of industrial substitution decisions and environmental implications related to critical metals. We discuss the potential and limitation of such an approach in contrast to state-of-the-art methods and how it might lead to criticality assessments tailored to the specific circumstances of single industrial sectors or individual companies. - Highlights: ► Current criticality assessment methods provide a ‘snapshot’ at one point in time. ► They do not account for dynamic interactions between demand and supply. ► We propose a conceptual framework to overcomes these limitations. ► The framework integrates an agent-based behaviour model with a dynamic material flow model. ► The approach proposed makes

  13. Life cycle assessment of sustainable raw material acquisition for functional magnetite bionanoparticle production. (United States)

    Sadhukhan, Jhuma; Joshi, Nimisha; Shemfe, Mobolaji; Lloyd, Jonathan R


    Magnetite nanoparticles (MNPs) have several applications, including use in medical diagnostics, renewable energy production and waste remediation. However, the processes for MNP production from analytical-grade materials are resource intensive and can be environmentally damaging. This work for the first time examines the life cycle assessment (LCA) of four MNP production cases: (i) industrial MNP production system; (ii) a state-of-the-art MNP biosynthesis system; (iii) an optimal MNP biosynthesis system and (iv) an MNP biosynthesis system using raw materials sourced from wastewaters, in order to recommend a sustainable raw material acquisition pathway for MNP synthesis. The industrial production system was used as a benchmark to compare the LCA performances of the bio-based systems (cases ii-iv). A combination of appropriate life cycle impact assessment methods was employed to analyse environmental costs and benefits of the systems comprehensively. The LCA results revealed that the state-of-the-art MNP biosynthesis system, which utilises analytical grade ferric chloride and sodium hydroxide as raw materials, generated environmental costs rather than benefits compared to the industrial MNP production system. Nevertheless, decreases in environmental impacts by six-fold were achieved by reducing sodium hydroxide input from 11.28 to 1.55 in a mass ratio to MNPs and replacing ferric chloride with ferric sulphate (3.02 and 2.59, respectively, in a mass ratio to MNPs) in the optimal biosynthesis system. Thus, the potential adverse environmental impacts of MNP production via the biosynthesis system can be reduced by minimising sodium hydroxide and substituting ferric sulphate for ferric chloride. Moreover, considerable environmental benefits were exhibited in case (iv), where Fe(III) ions were sourced from metal-containing wastewaters and reduced to MNPs by electrons harvested from organic substrates. It was revealed that 14.4 kJ and 3.9 kJ of primary fossil resource

  14. A comparative study of the antacid effect of raw spinach juice and spinach extract in an artificial stomach model. (United States)

    Panda, Vandana Sanjeev; Shinde, Priyanka Mangesh


    BackgroundSpinacia oleracea known as spinach is a green-leafy vegetable consumed by people across the globe. It is reported to possess potent medicinal properties by virtue of its numerous antioxidant phytoconstituents, together termed as the natural antioxidant mixture (NAO). The present study compares the antacid effect of raw spinach juice with an antioxidant-rich methanolic extract of spinach (NAOE) in an artificial stomach model. MethodsThe pH of NAOE at various concentrations (50, 100 and 200 mg/mL) and its neutralizing effect on artificial gastric acid was determined and compared with that of raw spinach juice, water, the active control sodium bicarbonate (SB) and a marketed antacid preparation ENO. A modified model of Vatier's artificial stomach was used to determine the duration of consistent neutralization of artificial gastric acid for the test compounds. The neutralizing capacity of test compounds was determined in vitro using the classical titration method of Fordtran. Results NAOE (50, 100 and 200 mg/mL), spinach juice, SB and ENO showed significantly better acid-neutralizing effect, consistent duration of neutralization and higher antacid capacity when compared with water. Highest antacid activity was demonstrated by ENO and SB followed by spinach juice and NAOE200. Spinach juice exhibited an effect comparable to NAOE (200 mg/mL). ConclusionsThus, it may be concluded that spinach displays significant antacid activity be it in the raw juice form or as an extract in methanol.

  15. From basic raw material goods to cultural and environmental services: the Chinese bamboo sophistication path

    Directory of Open Access Journals (Sweden)

    Manuel Ruiz Pérez


    Full Text Available Bamboo has deep cultural and economic roots in China, the country with the largest bamboo resources in the world. Over the last three decades bamboo has evolved from a supply of raw material for basic goods into the material base of an increasingly diversified array of products and, more recently, into a potentially important source of cultural and environmental services. Based on a general literature review and the lessons learned from detailed case studies in different regions of China, we explored the changing roles of bamboo, and its effects on local economies and farmers' livelihood strategies. As the country develops and new economic activities continue to appear, bamboo production has shifted from a superior income-generating opportunity that largely benefited the better-off to a less attractive option left for those who have no other choice. The nature of the work has also changed, from families working directly on their bamboo plots to an emphasis on hired labor, with prosperous bamboo owners devoting most of their time to more lucrative activities. A similar process can be observed in bamboo processing in counties where previous industrial structures hinged around raw material harvests, but which have now entered into other secondary and tertiary industry activities. At the same time, bamboo has attracted new opportunities as a source of cultural, aesthetic, and leisure-related activities, as well as some potentially important climatic, watershed, and biodiversity functions. We analyze the complementarity between goods and services provided by bamboo and discuss some research issues and future trends that may help in overcoming these conflicts.

  16. Extracting solid carbonaceous materials with solvents

    Energy Technology Data Exchange (ETDEWEB)


    Solvent extraction of solid carbonaceous materials is performed in the presence of powdered catalysts together with alkaline substances. Oxides of nickel or iron or nickel nitrate have been used together with caustic soda or potash solutions or milk of lime. Solvents used include benzenes, middle oils, tars, tetrahydronaphthalene. The extraction is performed at 200 to 500/sup 0/C under pressures of 20 to 200 atm. Finely ground peat was dried and mixed with milk of lime and nickel nitrate and an equal quantity of middle oil. The mixture was heated for 3 h at 380/sup 0/C at 90 atm. 88.5% of the peat was extracted. In a similar treatment brown coal was impregnated with solutions of caustic soda and ferric chloride.

  17. Towards more efficient raw material and water use in the production of fine art paper

    Energy Technology Data Exchange (ETDEWEB)

    Pitkaenen, M. [Metsae-Serla Oyj, Aeaenekoski (Finland)


    Metsae-Serla's Aeaenekoski paper mill produces triple coated fine paper. The production capacity is 150000 t/a and the grammage range from 115 to 280 g/m{sup 2}. About 70% is sheeted at the mill. Profitability of the mill has been systematically improved. Among other things a good on-process wet end control system has been built. Raw material optimization has been done. The target of this two-year development project was to produce an optimized total plan for the raise of the closure degree based on critical examination of the whole paper making process. As a concrete target was a feasible plan how to cut the raw material losses to the effluent by 50% and the consumption of chemical water by 30%. The final target was significant annual cost savings. The project was run as three parallel sub-projects and total optimization was made simultaneously. The mill had two effluent flows; one for fibre containing and one for coating colour waste waters. Survey of both streams was carried out and the sources, amounts and quality of the fractions were determined. The lost raw material was 550 t/ month. One half was lost in the fibre and the other in the coating colour containing waste waters. Technical and economic evaluations were carried out for a proceeding plan. After tests and laboratory and pilot trials FilRec disperser was chosen as the treatment technique for the hydro cyclone reject and ultrafiltration for the recovery of coating colour. The specific consumption of chemical water was 9.1 m{sup 3}/ coated tonne. In the second sub-project a critical survey of the various uses was carried out. Quality demands for the chemical dilution purposes were studied by laboratory tests. Process chemical optimization was carried out. The effect of increasing closure on charge and COD build up was simulated using WinGEMS software. Possible solutions to replace chemical water and reduce its need were considered against the consequent investment costs. A proceeding plan for

  18. Taking the Step towards a More Dynamic View on Raw Material Criticality: An Indicator Based Analysis for Germany and Japan

    Directory of Open Access Journals (Sweden)

    Simon Glöser-Chahoud


    Full Text Available Due to mounting concerns about the security of raw material supplies, numerous studies dealing with the quantification of supply risks and material criticality at the national level have been carried out in previous years. Regarding these studies, most approaches are indicator based static screening methods analyzing large numbers of raw materials and identifying those which are most critical for an economy. The majority of these screening methods quantify supply risks and vulnerabilities for one base year without taking into account temporal changes. Dynamic approaches for specific raw materials analyzing affected value chains in detail have been introduced recently; however, these studies do not intend to provide a screening of larger numbers of commodities. In this paper, we present a simple dynamic screening approach to assess raw material criticality at the country level building upon methods from innovation economics. The indicators applied in this study are only based on broadly available production and trade data, which makes this approach relatively easy to apply. We test our methodology on the example of Germany and Japan—two economies with highly specialized industries and low domestic raw material deposits, and, hence, high import dependency. The results are comparable to those of previously conducted multi indicator based static screening methods. However, they provide additional insight into temporal developments over the previous decade.

  19. Some economic aspects of the conversion of raw materials into final products

    Energy Technology Data Exchange (ETDEWEB)

    Pick, H J [Univ. of Aston, Birmingham, Eng.; Becker, P E


    In a previous paper Pick and Becker analyzed the direct and indirect relations between energy and the ''physical structure'' materials used by the engineering and construction industries. The present paper provides a more general description of materials conversion from natural resources to final products. The cost of raw materials, only some 30 percent of which come from the developing countries, accounts for a relatively small proportion of final product costs, the remaining product costs arising from the progressive application of labor, capital, energy, etc. Emphasis is placed on the complete interdependence of the inputs to manufacturing; a change in any one having implications for the remainder. Materials substitution, while in principle providing an adaptive mechanism to change, also has implications for a wide range of factors of production and for social and industrial issues such as regional employment, the demand for specific trades and professions, for research and development and for industrial structure and capital investment. Full allowance for this interdependence needs to be an integral part of effective long term policy formulation and of research and development planning.

  20. Influence of raw material properties on energy consumption during briquetting process

    Directory of Open Access Journals (Sweden)

    Ivanova Tatiana


    Full Text Available Biomass is doubtless a very significant source of renewable energy being worldwide abundant with high energy potential. This paper deals with assessment energy consumption at especially grinding and briquetting processes, which should result in essential economy of energy at solid biofuel production. Various types of raw materials were used at the experiment such as hemp (Cannabis sativa L. biomass, two species of Miscanthus (Miscanthus sinensis, Miscanthus x gigantheus and apple wood biomass. These materials were dried, grinded and pressed by piston press having pressing chamber diameter of 65 mm. Materials were grinded into three fractions (4 mm, 8 mm and 12 mm. Material throughput (kg.h-1 and energy consumption (kWh.t-1 were registered. As to results: the highest throughput at both grinding cases as well as briquetting was found at apple wood biomass; however the energy consumption during briquetting of apple wood was relatively high. The worst results concerning throughput and energy consumption (especially at briquetting were found at hemp biomass. Nevertheless, briquettes made of hemp had the best mechanical durability. Both Miscunthus species (herbaceous biomass have very similar parameters and showed quite good relation between throughput and energy consumption at the used machines.

  1. Energies and raw materials. The energy situation; Energies et matieres premieres. Conjoncture energetique

    Energy Technology Data Exchange (ETDEWEB)



    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in October 1997: primary energy total consumption has increased (mobile year) of 0.8%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 8.1%), slight increase for petroleum products (+ 1.3%), slowing down increase for gas (+ 2.1%) and moderate increase for electricity (+ 1.4%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a high energy cost level with + 22% on one year, reaching 87.8 billions Francs, to be compared to 72.0 in October 1996

  2. Energies and raw materials. The energy situation; Energies et matieres premieres. Conjoncture energetique

    Energy Technology Data Exchange (ETDEWEB)



    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996

  3. Energies and raw materials. The energy situation; Energies et matieres premieres. Conjoncture energetique

    Energy Technology Data Exchange (ETDEWEB)



    Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996

  4. Role of complex utilization of mineral raw materials In geological research

    Energy Technology Data Exchange (ETDEWEB)

    Takacs, P.; Varju, G.


    Presents Hungarian research efforts on ways of utilizing the secondary raw materials alunite, pumice and slate coal from various mines. The slate coal is separated from brown coal and disposed of at spoil banks of brown coal mines, due to its high ash content (up to 56.8% under dry conditions), silicate content up to 58.2% and low calorific value between 1500 and 2780 kcal/kg. The research proposal for utilizing slate coal is directed at partial separation of the mineral and coal content by comminution, peptization and hydrocentrifugal separation. The larger part of the silicate content is held in the colloid suspension, which could be used for conditioning drilling mud or foundry sand. The produced coal concentrate has a reduced ash content and higher calorific value (between 500 and 800 kcal/kg) and could be employed in soil amelioration or combustion. (10 refs.) (In German)

  5. Cashew nut shell liquid, a valuable raw material for generating semiconductive polyaniline nanofibers

    Directory of Open Access Journals (Sweden)

    Raiane Valenti Gonçalves


    Full Text Available Abstract Cashew nut shell liquid (CNSL is an abundant and renewable by-product of the cashew nut industry. It appears to be a valuable raw material for generating semiconductive polyaniline (PAni nanomaterial with enhanced thermal stability and well-defined nanofiber morphology following a polymerization dispersion process. This study confirms that CNSL acts as a soft template during PAni synthesis, leading to an improvement in the nanofiber aspect. CNSL also improves the thermal stability of the PAni nanomaterial. Moreover, CNSL is an effective surfactant that promotes and stabilizes the dispersion of PAni nanofibers within water, allowing the more ecofriendly preparation of PAni nanomaterial by substituting the commonly used organic solvent with aqueous media. Finally, although CNSL promotes the formation of the conductive emeraldine salt form of PAni, increasing CNSL concentrations appear to plasticize the PAni polymer, leading to reduced electrical conductivity. However, this reduction is not detrimental, and PAni nanofibers remain semiconductive even under high CNSL concentrations.

  6. Microbial decontamination of cosmetic raw materials and personal care products by irradiation

    International Nuclear Information System (INIS)

    Katusin-Razem, B.; Mihaljevic, B.; Razem, D.


    Typical levels of sporadically occurring (dynamic) microbial contamination of cosmetic raw materials: pigments, abrasives and liposomes, as well as of final products for personal care, i.e. toothpaste, crayons, shampoos, cleansers and creams, were evaluated. In most cases, contamination was dominated by a single population of microorganisms, either Gram-negative bacteria or molds. The feasibility of microbial decontamination by irradiation was studied by determining the resistance to gamma radiation of contaminating microflora in situ. It was expressed as a dose required for the first 90% reduction, D first 9 0% red. The values in the range 1-2 kGy for molds and 0.1-0.6 kGy for Gram-negative bacteria were obtained. This relatively high susceptibility to irradiation allowed inactivation factors close to 6 to be achieved with doses generally not exceeding 3 kGy, and yielding endpoint contamination less than 10 g -1 . (author)

  7. Nuclear raw materials prospection mission 1965 report to the Government of the Republic Oriental del Uruguay

    Energy Technology Data Exchange (ETDEWEB)

    Cameron, J


    A preliminary reconnaissance survey of Uruguay for nuclear raw materials has been completed. Over 7.700 kilometers have been surveyed by car borne scintillometer and 112 radioactive anomalies have been discovered. Favourable areas with high incidence of anomalies and indications of uranium occurrences have been de-limited in the Minas- Aigua, Valentines-Treinta y Tres, Las Canas, Minas de Corrales and Melo areas. A possibly important indication of uranium at Paso de Las Piedras, Department of Durazno, has also 'been discovered by other means.The area investigated only comprises 0.83 of the total area of Uruguay and the high incidence of anomalies discovered and the other indications of uranium within this area are favourable and encouraging factors for further work,.

  8. Chemistry Based on Renewable Raw Materials: Perspectives for a Sugar Cane-Based Biorefinery

    Directory of Open Access Journals (Sweden)

    Murillo Villela Filho


    Full Text Available Carbohydrates are nowadays a very competitive feedstock for the chemical industry because their availability is compatible with world-scale chemical production and their price, based on the carbon content, is comparable to that of petrochemicals. At the same time, demand is rising for biobased products. Brazilian sugar cane is a competitive feedstock source that is opening the door to a wide range of bio-based products. This essay begins with the importance of the feedstock for the chemical industry and discusses developments in sugar cane processing that lead to low cost feedstocks. Thus, sugar cane enables a new chemical industry, as it delivers a competitive raw material and a source of energy. As a result, sugar mills are being transformed into sustainable biorefineries that fully exploit the potential of sugar cane.

  9. Innovation processes in technologies for the processing of refractory mineral raw materials (United States)

    Chanturiya, V. A.


    Analysis of the grade of mineral resources of Russia and other countries shows that end products that are competitive in terms of both technological and environmental criteria in the world market can only be obtained by the development and implementation of progressive technologies based on the up-to-date achievements of fundamental sciences. The essence of modern innovation processes in technologies developed in Russia for the complex and comprehensive processing of refractory raw materials with a complex composition is ascertained. These processes include (i) radiometric methods of concentration of valuable components, (ii) high-energy methods of disintegration of highly dispersed mineral components, and (iii) electrochemical methods of water conditioning to obtain target products for solving specific technological problems.

  10. Consumer acceptability of differently processed bacons using raw materials from entire males

    DEFF Research Database (Denmark)

    Lunde, Kathrine; Skuterud, Ellen; Lindahl, Gunilla Karin


    The aim of the present work was to investigate consumers' acceptability of bacons produced from entire males. Three different processing technologies (brine injection, dry salting with and without fermentation) were used. The raw materials had skatole levels from 0.04 to 0.43 mg/kg. The consumers...... showed little variation in liking scores for bacon produced with the different technologies. Assessors trained for recognizing skatole flavour, nevertheless identified the odour and flavour of skatole for more samples and technologies than the consumers did. However, trained sensory panellists could...... not identify taint in all dry salted bacons fermented with Staphylococcus xylosus even at a skatole level of 0.43 mg/kg fat. Sufficient liquid smoke in brine injected bacons masked the skatole flavour of bacons having 0.43 mg skatole/kg fat. (C) 2012 Elsevier Ltd. All rights reserved....

  11. Liquid Whey Protein Concentrates Produced by Ultrafiltration as Primary Raw Materials for Thermal Dairy Gels

    Directory of Open Access Journals (Sweden)

    Marta Henriques


    Full Text Available The aim of this work is to study the gelation properties of liquid whey protein concentrates (LWPC produced by ultrafiltration (UF as raw material for thermally induced gels intended for food applications. LWPC thermal gelation was performed using different types of LWPC (non-defatted, defatted and diafiltered of different protein mass fractions and pH. Most of the produced gels showed viscoelastic behaviour. Non-defatted LWPC gave stronger heat-induced gels with a more cohesive microstructure, a higher water holding capacity and also higher elastic modulus (G’ and viscous modulus (G’’. Gel properties were not improved in products with lower content of non-protein compounds. As expected, the increase in protein mass fraction positively influences protein interactions. However, the pH is responsible for the equilibrium between attraction and repulsion forces in the gel components that influence gel hardness and water holding capacity.

  12. Raw material utilization in slaughterhouses – optimizing expected profit using mixed-integer programming

    DEFF Research Database (Denmark)

    Jensen, Toke Koldborg; Kjærsgaard, Niels Christian

    Slaughterhouses are major players in the pork supply chain, and supply and demand must be matched in order to generate the highest profit. In particular, carcasses must be sorted in order to produce the “right” final products from the “right” carcasses. We develop a mixed-integer programming (MIP) ...... at slaughterhouses. Finally, we comment on the expected effect of variations in the raw material supply and the demand as well as future research concerning joint modelling of supply chain aspects.......Slaughterhouses are major players in the pork supply chain, and supply and demand must be matched in order to generate the highest profit. In particular, carcasses must be sorted in order to produce the “right” final products from the “right” carcasses. We develop a mixed-integer programming (MIP...

  13. Valorisation of food waste to produce new raw materials for animal feed. (United States)

    San Martin, D; Ramos, S; Zufía, J


    This study assesses the suitability of vegetable waste produced by food industry for use as a raw material for animal feed. It includes safety and nutritional viability, technical feasibility and environmental evaluation. Vegetable by-products were found to be nutritionally and sanitarily appropriate for use in animal feed. The drying technologies tested for making vegetable waste suitable for use in the animal feed market were pulse combustion drying, oven and microwave. The different meal prototypes obtained were found to comply with all the requirements of the animal feed market. An action plan that takes into account all the stages of the valorisation process was subsequently defined in agreement with local stakeholders. This plan was validated in a pilot-scale demonstration trial. Finally, the technical feasibility was studied and environmental improvement was performed. This project was funded by the European LIFE+ program (LIFE09 ENV/ES/000473). Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Characterization of sugar cane bagasse ash as raw material for the production of ceramics

    International Nuclear Information System (INIS)

    Fredericci, C.; Indelicato, R.L.; Ferreira Neto, J.B.; Ribeiro, T.R.; Landgraf, F.J.G.; Silva, G.F.B. Lenz e


    The aim of this paper was to analyze the sugar cane bagasse ash from three Sugar and Alcohol Plant of the State of Sao Paulo - Brazil. We intend to show the discrepancies between them, so that this raw material could be used with greater quality control in ceramic industries. The bagasse were analyzed by differential scanning calorimetry (DSC), thermogravimetry (TG) and scanning electron microscopy. The ashes were analyzed by X-ray diffraction, X-ray fluorescence, scanning electron microscopy, energy dispersive spectroscopy, and granulometric separation. The results indicated that the content of SiO 2 ranging from 50-80% by weight depends on the granulometry of the bagasse and on the region where it was collected. The analyses of X-ray diffraction indicate SiO 2 , Fe 2 O 3 , K 2 SO 4 and Mg 2 P 2 O 7 as crystalline phases. (author)

  15. Glances on the year 1998. Energies and raw materials; Regards sur 1998. Energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)



    This report summarizes 14 key-topics of the year 1998 in relation with the French energy and economic policy: the new start-up of energy mastery; the nuclear industry between passion and reason; the labour inspection in nuclear power plants; the law project for the modernizing and development of the electric power public utility; the main gas transportation systems; the future of Gardanne`s mining basin; the raw materials in the upheaval; the French refining activity after the Auto-Oil directive; the oil company fusions; the priorities in petroleum technology research; the policy of automotive fuels distribution; the energy in regions; the mining activity in New Caledonia; the end of the BRGM-Normandy partnership. A calendar of remarkable facts is given at the end. (J.S.)

  16. Nuclear raw materials prospection mission 1965 report to the Government of the Republic Oriental del Uruguay

    International Nuclear Information System (INIS)

    Cameron, J.


    A preliminary reconnaissance survey of Uruguay for nuclear raw materials has been completed. Over 7.700 kilometers have been surveyed by car borne scintillometer and 112 radioactive anomalies have been discovered. Favourable areas with high incidence of anomalies and indications of uranium occurrences have been de-limited in the Minas- Aigua, Valentines-Treinta y Tres, Las Canas, Minas de Corrales and Melo areas. A possibly important indication of uranium at Paso de Las Piedras, Department of Durazno, has also 'been discovered by other means.The area investigated only comprises 0.83 of the total area of Uruguay and the high incidence of anomalies discovered and the other indications of uranium within this area are favourable and encouraging factors for further work,

  17. The Influence of 5% KOH Immersion for Seaweed as Raw Materials for Air Freshener Gel

    Directory of Open Access Journals (Sweden)

    Riardi Pratista Dewa


    Full Text Available The effect of submersion KOH 5% for seaweed as raw materials products air freshener gel has been studied. Seaweed in Indonesia has a big potentially and it is commonly used in food products, beverages, pharmaceuticals and cosmetics. This research aims to use seaweed as a feedstock gel air freshener. Soaking seaweed with KOH was conducted to determine the nature of the water content and gel strength of the gel air freshener products generated given the scent of oranges and cloves. KOH concentration used was 5%. The results showed the water content of seaweed with KOH soaked lower than without KOH, whereas the gel strength with marinated seaweed KOH higher than without KOH. The results of organoleptic test, in this case the sense of smell, the air freshener gel product indicates that the product that uses citrus scent perfuming/lemon, panelists preferred more than the product is scented gel air freshener clove oil.

  18. Microbial decontamination of cosmetic raw materials and personal care products by irradiation

    International Nuclear Information System (INIS)

    Katusin-Razem, Branka; Mihaljevic, Branka; Razem, D.


    Typical levels of sporadically occurring (dynamic) microbial contamination of cosmetic raw materials: pigments, abrasives and liposomes, as well as of final products for personal care: toothpaste, crayons, shampoos, cleansers and creams, were evaluated. In most cases the contamination was dominated by a single population of microorganisms, either Gram-negative bacteria or molds. The feasibility of microbial decontamination by irradiation was studied by determining the resistance to gamma radiation of contaminating microflora in situ. It was expressed as a dose required for the first 90% reduction, D first 9 0% r ed . The values in the range 1-2 kGy for molds and 0.1-0.6 kGy for Gram-negative bacteria were obtained. This relatively high susceptibility to irradiation allowed inactivation factors close to 6 to be achieved with doses generally not exceeding 3 kGy, and yielding endpoint contamination less than 10/g

  19. Sweet whey as a raw material for the dietary supplements obtaining with immunomodulatory effect

    Directory of Open Access Journals (Sweden)

    G. Didukh


    Full Text Available This article presents the results of the study of literary sources to prove the viability of the idea of using sweet whey to deep its fractionation, and to obtain biologically active proteins with immunomodulatory effect. We demonstrated methods for fractionation of milk whey (membrane and chromatographic, as well as the technological scheme of concentration of sweet whey. We introduced the composition of sweet whey and protein content of immunomodulatory action. Modern methods of processing whey, which include, basically, only the process of dehydration and concentration of whey and its use in the complete component composition, which limits its use for food purposes are shown. The necessity of processing of secondary resources in a catastrophic ecological situation on the planet and full use of the composite processing of raw materials for food purposes, and also shows properties of proteins immunomodulating actions which are part of the whey are grounded.

  20. Environmental impact of coal utilization (from raw material to waste resources): Proceedings

    International Nuclear Information System (INIS)

    Sahu, K.C.


    The proceedings contains 27 papers presented at the conference on environmental impact of coal utilization from raw material to waste resources which was held at the Indian Institute of Technology, Bombay, during 14-15 January 1991. The conference was held as a follow-up of the research project to study the impact of coal utilization. The project was undertaken jointly by the Indian Institute of Technology, Bombay and the University of Western Ontario, Canada. The project was funded by the International Development Research Centre, Ottawa (Canada). The principle themes of the conference were : occurrence of trace elements in coal, fate of trace elements during combustion of coal, characterisation of fly ash and its properties and utilization, and environmental impact of ash disposal. (M.G.B.)

  1. Vanadium determination in raw materials and products of aluminium production using pulse polarography

    International Nuclear Information System (INIS)

    Grigor'eva, M.F.; Bal'de, I.; Markovich, I.A.


    Possibility of using differential pulse polarography (DPP) for determination of vanadium in raw materials and products of aluminium production was studied. Ammonium-cheoride buffer solution with pH 9-10, aqueous solution of mixture of sodium carbonate and borax (1:3) and rhodanide-acefic acid solutions (1:1) were tested as a background. Current-voltage curves of vanadium reduction were plotted and peak potentials on DPP were determined against the background of chosen electrolytes. Effect of parameters, providing the maximal height of DPP peak, on the height of measured signal, was studied. Rhodanide background was chosen for polarographic determination of vanadium, because the detection limit of vanadium was the lowest against this background. Pulse polarography enafles to determine vanadium in products of aluminium production in amounts from 1x10 -4 to 0.01 % and more

  2. Cassava and turmeric flour blends as new raw materials to extruded snacks

    Directory of Open Access Journals (Sweden)

    Alessandra Mussato Spinello


    Full Text Available Short cooking time and ability to blend varieties of food ingredients have made extrusion cooking a medium for low-cost and nutritionally improved food products. The effect of moisture, extrusion temperature and amount of turmeric flour mixed with cassava flour on physical characteristic of puffed snacks was evaluated in this work. Extrusion process was carried out using a single-screw extruder in a factorial central composite design with four factors. Results showed effect of extrusion parameters on dependents variables. High expansion, low browning, low water solubility index, intermediate water absorption index and high crispness desirable characteristics to puffed snacks are obtained in conditions of 12% moisture, 5% turmeric flour, 105º C of temperature and 250 rpm of screw speed. These paper point to the potential still unexplored of the use of flours of cassava and turmeric as raw materials in the development of extruded puffed snacks.

  3. Solubility of fragrance raw materials in water: Experimental study, correlations, and Mod. UNIFAC (Do) predictions

    Energy Technology Data Exchange (ETDEWEB)

    Domanska, Urszula, E-mail: [Department of Physical Chemistry, Faculty of Chemistry, Warsaw University of Technology, Noakowskiego 3, 00-664 Warsaw (Poland); Paduszynski, Kamil; Niszczota, Zaneta K. [Department of Physical Chemistry, Faculty of Chemistry, Warsaw University of Technology, Noakowskiego 3, 00-664 Warsaw (Poland)


    The (liquid + liquid) and (solid + liquid) phase equilibria of nine binary mixtures containing fragrance raw materials (FRM) such as aliphatic ketones and compounds based on cyclohexane with water were investigated. The systems {l_brace}2-heptanone, or 2-nonanone, or 2-undecanone, or 2-tridecanone, or cyclohexyl carboxylic acid (CCA), or cyclohexyl acetic acid (CAA), or 2-cyclohexyl ethanol (2CE) or cyclohexyl acetate (CA), or 2-cyclohexyl ethyl acetate (2CEA) + water (2){r_brace} have been measured by a dynamic method in wide range of temperatures from (290 to 360) K and ambient pressure. For all systems immiscibility in the liquid phase was detected. The experimental data was correlated by means of the NRTL equation, utilizing parameters derived from the (liquid + liquid) equilibrium. Additionally, the binary mixtures were predicted with the Mod. UNIFAC (Do) model, with known from literature parameters, with very good results.

  4. Solubility of fragrance raw materials in water: Experimental study, correlations, and Mod. UNIFAC (Do) predictions

    International Nuclear Information System (INIS)

    Domanska, Urszula; Paduszynski, Kamil; Niszczota, Zaneta K.


    The (liquid + liquid) and (solid + liquid) phase equilibria of nine binary mixtures containing fragrance raw materials (FRM) such as aliphatic ketones and compounds based on cyclohexane with water were investigated. The systems {2-heptanone, or 2-nonanone, or 2-undecanone, or 2-tridecanone, or cyclohexyl carboxylic acid (CCA), or cyclohexyl acetic acid (CAA), or 2-cyclohexyl ethanol (2CE) or cyclohexyl acetate (CA), or 2-cyclohexyl ethyl acetate (2CEA) + water (2)} have been measured by a dynamic method in wide range of temperatures from (290 to 360) K and ambient pressure. For all systems immiscibility in the liquid phase was detected. The experimental data was correlated by means of the NRTL equation, utilizing parameters derived from the (liquid + liquid) equilibrium. Additionally, the binary mixtures were predicted with the Mod. UNIFAC (Do) model, with known from literature parameters, with very good results.

  5. Extreme poverty and affluence, the two sides of our world. Energy, raw materials, environment

    Energy Technology Data Exchange (ETDEWEB)

    Bischoff, G


    The author discusses the different economic situtions in the industrialized and in the developing parts of the world, and the resulting fears of the populations. These feelings of fear and apprehension are traced back to their manifold causes, discussing among others unsecure raw material supply and the damage to the environment, hostile attitudes towards industrial exploitation or technical sciences, the role of the press and other media in the 'making' of fear of life, the fear of becoming slave of the machines. The problems' solution lies in the supply and utilisation of energy, and any efforts towards maintaining our natural environment so that life may go on will have to be based, the author says, on the technological development from nuclear power to thermonuclear fusion. (HSCH).

  6. Branding Raw Material to Improve Human Rights: Intel’s Ban on Conflict Minerals

    Directory of Open Access Journals (Sweden)

    Osburg Thomas


    Full Text Available Many companies seek to take over more responsibility for their supply chain and their raw materials. Intel was one of the first companies investigating the origin of conflict minerals like tin, tantalum, gold or tungsten, which are used in many electronic products. Their path to ultimately offering conflict-free microprocessors took more than five years of consistent preparation and intensive reengineering of the business process. They identified smelters as a bottleneck in the supply chain and started cooperating closely with them to trace their minerals’ supply. By developing a bag-and-tag system the company is now able to ensure that their minerals are not sourced from illegal mines, which often finance illegal warlords, for example, in the eastern Democratic Republic of Congo. The cooperation with the smelters brings about higher demand and in consequence higher prices for the legally sourced minerals. Many small miners and their families in the region directly benefit from the higher earnings.

  7. Silica nanoparticles produced by DC arc plasma from a solid raw materials (United States)

    Kosmachev, P. V.; Vlasov, V. A.; Skripnikova, N. K.


    Plasma synthesis of SiO2 nanoparticles in experimental atmospheric pressure plasma reactor on the basis of DC arc plasma generator was presented in this paper. Solid high-silica raw materials such as diatomite from Kamyshlovskoye deposit in Russia, quartzite from Chupinskoye deposit in Russia and milled window glass were used. The obtained nanoparticles were characterized based on their morphology, chemical composition and size distribution. Scanning electron microscopy, laser diffractometry, nitrogen absorption (Brunauer-Emmett-Teller method), X-ray photoelectron spectroscopy and energy-dispersive X-ray spectroscopy were used to characterize the synthesized products. The obtained silica nanoparticles are agglomerated, have spherical shape and primary diameters between 10-300 nm. All samples of synthesized nanopowders were compared with commercial nanopowders.


    Directory of Open Access Journals (Sweden)

    Supawan Vichaphund


    Full Text Available This research aimed to investigate the possibility of utilization basalt fibers as a raw material for ceramic production. Both quartz and feldspar were replaced partially or entirely by basalt fiber in the range of 10-25 wt%. The mixture of ceramic powders and basalt fibers were uniaxially pressed and sintered at temperatures between 1000 and 1200°C for 1 h. The substitution of basalt fibers in ceramic compositions demonstrated the positive effect on the physical and mechanical properties. The addition of basalt fibers in an appropriate amount enhance the densification and reduce sintering temperature of clay-based ceramics (CB-0 from 1200 to 1150°C. The highest density and strength were 2.40 g/cm³ and 116 MPa, respectively, when replacing feldspar and quartz with basalt up to 20 wt% (CB-20 and sintering at 1150°C.

  9. Raw Materials Synthesis from Heavy Metal Industry Effluents with Bioremediation and Phytomining: A Biomimetic Resource Management Approach

    Directory of Open Access Journals (Sweden)

    Salmah B. Karman


    Full Text Available Heavy metal wastewater poses a threat to human life and causes significant environmental problems. Bioremediation provides a sustainable waste management technique that uses organisms to remove heavy metals from contaminated water through a variety of different processes. Biosorption involves the use of biomass, such as plant extracts and microorganisms (bacteria, fungi, algae, yeast, and represents a low-cost and environmentally friendly method of bioremediation and resource management. Biosorption-based biosynthesis is proposed as a means of removing heavy metals from wastewaters and soils as it aids the development of heavy metal nanoparticles that may have an application within the technology industry. Phytomining provides a further green method of managing the metal content of wastewater. These approaches represent a viable means of removing toxic chemicals from the effluent produced during the process of manufacturing, and the bioremediation process, furthermore, has the potential to save metal resources from depletion. Biomimetic resource management comprises bioremediation, biosorption, biosynthesis, phytomining, and further methods that provide innovative ways of interpreting waste and pollutants as raw materials for research and industry, inspired by materials, structures, and processes in living nature.

  10. Radiation decontamination of pharmaceutical raw materials as an integral part of the good pharmaceutical manufacturing practice (GPMP)

    Energy Technology Data Exchange (ETDEWEB)

    Razem, D; Katusin-Razem, B [Institut Rudjer Boskovic, Zagreb (Yugoslavia); Starcevic, M; Galekovic, B [PLIVA Pharmaceutical Works, Zagreb (Yugoslavia)


    The microbiological quality of many raw materials used in the manufacture of pharmaceuticals and adjuvants often fails to meet the standards set by the pharmaceutical industry. Raw materials of biological provenience are particularly susceptible to contamination. This work describes the present situation regarding the microbial load of corn starch. Given the accepted microbiological criteria, irradiation treatment is proposed as integral to Good Pharmaceutical Manufacturing Practice (GPMP). The use of total viable count as a guide for specifying microbial limits for non-sterile materials is supported. Criteria for the choice of dose are discussed. (author).

  11. Radiation decontamination of pharmaceutical raw materials as an integral part of the good pharmaceutical manufacturing practice (GPMP)

    International Nuclear Information System (INIS)

    Razem, D.; Katusin-Razem, B.; Starcevic, M.; Galekovic, B.


    The microbiological quality of many raw materials used in the manufacture of pharmaceuticals and adjuvants often fails to meet the standards set by the pharmaceutical industry. Raw materials of biological provenience are particularly susceptible to contamination. This work describes the present situation regarding the microbial load of corn starch. Given the accepted microbiological criteria, irradiation treatment is proposed as integral to Good Pharmaceutical Manufacturing Practice (GPMP). The use of total viable count as a guide for specifying microbial limits for non-sterile materials is supported. Criteria for the choice of dose are discussed. (author)

  12. Manganese Ores from South Sulawesi: Their Potential Uses as Raw Materials for Metallurgical Industry

    Directory of Open Access Journals (Sweden)

    Sufriadin Sufriadin


    Full Text Available Characterization of manganese ores from Barru and Bone regencies of South Sulawesi has been conducted with the aim at clarification of their mineralogical and chemical composition for their potential uses as the raw materials for metallurgical industry. Mineralogical properties of the ores analyzed by means of optical microscopy and X-ray diffractometry (XRD show that samples from Barru consist mainly of rhodochrosite (MnCO3 with less cryptomelane, groutite, bixbyite, and todorokite. Goethite, calcite and small amount of quartz present as impurities. Manganese ore samples from Bone are predominantly composed of pyrolusite (MnO2 with subordinate ramsdellite and hollandite. Barite, quartz, hematite and clay are present as gangue minerals. Chemical compositions determined by using XRF method revealed that Barru samples contain higher in MnO (average is 40.07 wt% than the Bone samples (average is 34.36 wt%. Similarly, Fe2O3 and CaO are also higher in Barru than those of the Bone samples. In contrast, concentrations of SiO2 and total alkali (K2O + Na2O are lower in the Barru samples. The average P2O5 content of samples in both areas is low (<0.2 wt%. Relatively higher grade of Fe2O3 in the Barru ore implies that it has potential application for ferromanganese production; whereas the elevated SiO2 content of the Bone ore is a good indication for silicomanganese manufacture. However, both ores may not favorable to be directly used as raw materials in metallurgical uses. Prior to be used, the ores should be treated by applying physical beneficiation in order to reduce deleterious elements.

  13. The use of plasticizing additives based on recycled raw materials in the petrochemical rubber mixtures

    Directory of Open Access Journals (Sweden)

    Z. S. Shashok


    Full Text Available At present, the development of alternative products for elastomers based on recycling petrochemical raw materials is a new trend of the rubber industry progress. Petrochemical raw materials include spent lubricants and motor oils are among such recycling products. In this context, the influence of the products of recycling waste engine oil (DVCH and RA in comparison with industrial oil (I-20 on the technological properties of filled elastomeric compositions was investigated. The elastomeric compositions were based on poly isoprene and divinyl rubbers. The plasticizing components were manufactured by IOOO “DVCH-Menedzhment”. They are mixture of hydro-carbons, C16–C20 and differ from each other in the content of linear and branched paraffin. Plastic-elastic properties of rubber compounds on the shear disk viscometer MV2000 in accordance with GOST 10722–76 was carried out. Kinetics of vulcanization on the rheometer ODR2000 according to GOST 12535–84 was defined. It is shown that the introduction of RA test plasticizing component provides a significant effect on Mooney viscosity, as compared to elastomeric compositions containing a plasticizer and I-20 and plasticizing additive DVCH. It revealed that the administration of all components in the studied plasticizing elastomer compositions based on a combination poly isoprene and divinyl rubbers has no significant effect on the rate of relaxation of stress of rubber compounds. It is found that elastomeric compositions containing as additives investigated processing waste oil products (DVCH and RA are characterized by a slightly smaller value of time to reach an optimal degree of vulcanization.

  14. National symposium on raw materials and energy management of mineral based industries

    International Nuclear Information System (INIS)


    Mineral Resources are very essential for industrialization and hence facilitating socioeconomic developments. Resources like coal, iron ore, Bauxite, chromite, limestone, ilmenite and many other ores and minerals are the raw materials for development of various thermal, metallurgical, chemical and refractory industries. The mineral resources are being harnessed from their respective mines and the mining industries have expanded rapidly to meet their growing demands of various 'mineral based industries. The energy and reductants required for these industries are met from both - coking and non coking coal. Nearly 70% of the energy requirement of India is met from coal. In recent years, with the increasing demand of metals, alloys, refractories and thermal energy, most of the high-grade ores and minerals have been consumed. Unfortunately most of the low grade ores and minerals are left at the mine sites as wastes. As a matter of fact, these low grade ores are much larger in quantities compared to the high grade ones. Therefore, it has been essential to mine and beneficiate the low grade ores which can be suitably-utilized in the respective industries. It has also been necessary to develop more efficient technology to utilize these raw materials more effectively producing minimum amount of wastes and also conserving the energy resources as far as possible. Time has come to develop environment friendly most suitable technology to utilize all types of low grade and complex ores and minerals in order to meet the requirements of rapidly expanding mineral based industries of India. Unless effective programmes are made in this regard and implement those in time, India is bound to face a disastrous situation both in industrial and economic sectors. The conference is organised keeping these in view to take a stock of new and economically viable processes for mining and beneficiating low and complex ores and minerals and utilizing these judiciously in the industries. Papers

  15. Uranium refining in South Africa. The production of uranium trioxide, considering raw material properties and nuclear purity requirements

    International Nuclear Information System (INIS)

    Colborn, R.P.; Bayne, D.L.G.; Slabber, M.N.


    Conventional practice results in raw materials being delivered to the uranium refineries in a form more suitable for transportation than for processing, and therefore the refineries are required to treat these raw materials to produce an acceptable intermediate feed stock. During this treatment, it is advantageous to include a purification step to ensure that the feed stock is of the required purity for nuclear grade uranium hexafluoride production, and this usually results in ammonium diuranate slurries of the required quality being produced as the intermediate feed stock. All subsequent processing steps can therefore be standardized and are effectively independent of the origin of the raw materials. It is established practice in South Africa to transport uranium as an ammonium diuranate slurry from the various mines to the Nufcor central processing plant for UOC production, and therefore the process for the production of uranium hexafluoride in South Africa was designed to take cognizance of existing transport techniques and to accept ammonium diuranate slurries as the raw material. The South African refinery will be able to process these slurries directly to uranium trioxide. This paper discusses the conditions under which the various ammonium diuranate raw materials, exhibiting a wide range of properties, can be effectively processed to produce a uranium trioxide of acceptably consistent properties. Mention is also made of the uranium hexafluoride distillation process adopted

  16. The European cement industry's approach to the use of secondary raw materials and fuels

    Energy Technology Data Exchange (ETDEWEB)

    Lawton, J.M.


    Position statements prepared by the European cement industry on the use of secondary raw materials and secondary fuels are introduced and presented. The statements indicate the approach of the industry to the use of these materials and, in the wider context, form part of the industry's overall approach to the environment. (Author). 2 refs.

  17. Comparison of different extraction methods and HPLC quantification of prenylated and unprenylated phenylpropanoids in raw Italian propolis. (United States)

    Taddeo, Vito Alessandro; Epifano, Francesco; Fiorito, Serena; Genovese, Salvatore


    In this paper the presence of selected prenylated and unprenylated phenylpropanoids, namely ferulic acid 1, boropinic acid 2, 4'-geranyloxyferulic acid 3, umbelliferone 4, 7-isopentenyloxycoumarin 5, and auraptene 6, have been determined in Italian raw propolis after having been extracted with different methodologies. An aqueous solution of β-cyclodextrin was the best extraction method for ferulic acid 1, treatment with indifferently EtOH or aqueous β-cyclodextrin were the most effective one for umbelliferone 4, boropinic acid 2 gave the best yields either with H2O/β-cyclodextrin or olive oil treatment or in biphasic systems, maceration with biphasic mixtures of aqueous β-cyclodextrin and olive oil was seen to be the most effective procedure for 7-isopentenyloxycoumarin 5, the only method providing significant quantities of 4'-geranyloxyferulic acid 3 was the maceration of raw propolis with olive oil, and finally auraptene 4 was best extracted with absolute EtOH. "Classic" maceration in general performed better than ultrasound-assisted one. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Accuracy increasing in the nuclear-physical analysis of mineral raw materials of heterogeneous composition

    International Nuclear Information System (INIS)

    Pak, Yu.; Vdovkin, A.; Pak, D.


    the analysis of heterogeneous raw material by the gamma-albedo method it's necessary to optimize the primary gamma-radiation energy choose depending on the material composition of the raw material, its granulometric composition and to reach the maximal presentability of the analysis. For this a method has been suggested which allows to increase substantially the effective study surface without increasing the analyzed object size. The essence of the method consists in the rotation of the object around its axis relatively to the detector reciprocating parallel to the sample in the process of measuring. The optimal laws of the detector motion and the sample rotation provide for the equal presentability of each unit study surface. The experimental approving of the suggested method showed that the optimization of the methodical and geometrical control parameters in the dynamic measuring conditions allow to increase the accuracy of the analysis of disperse raw materials more that twice as large

  19. The Structural Characterisation of Risk in the R&D Process of Functional Raw Materials for Electronic Devices


    Chikamori, Yoji; Nasu, Seigo


    The electronic materials and electronics device industries remain important to Japan in spite of the general decline of the Japanese electronics industry. There is risk and uncertainty when developing functional materials in the electronics industry. However, studies examining the uncertainty and risk variables in the development of functional materials are scarce. This study examines incremental research and development (R&D) developed for raw functional materials for electronics. Our analys...

  20. Indonesian jellyfish as potential for raw materials of food and drug (United States)

    Yusuf, S.; Fahmid, I. M.; Abdullah, N.; Zulhaeriah


    Jellyfish used to be considered as a pest of fish and a nuisance to fishing operations. Yet, forty years ago this jellyfish was found to be materials of food, medicine and cosmetics and the utilization of jellyfish is now familiar in Indonesia after being imported by China and Japan industry. This study aims to determine the potential development of jellyfish commodities as food and drugs from Indonesia with the target to improve the welfare of fishermen. This research used methods of rapid observation, limited interview, processing with immersion experiment and desiccation. In addition, various literatures were also used to enrich the knowledge about jellyfish business. Observation showed that the appearance of jellyfish in Indonesian waters varies based on the fertility of the waters affected by oceanographic conditions. Jellyfish contains low calorie and fat content, high protein and minerals as well as total collagen. Thus, jellyfish is a nutritious food source to be developed into food supplements, nutricosmetics and functional foods. Due to its large size, the jellyfish from Bunyu Island is more viable than jellyfish from Suppa Pinrang to be exported as raw material. Therefore, the manufacture of food and medicines from jellyfish materials is possible to be done in Indonesia.

  1. Raw material variability as archaeological tools: Preliminary results from a geochemical study of the basalt vessel workshop at Iron Age Tel Hazor, Israel

    Directory of Open Access Journals (Sweden)

    Tatjana Gluhak


    Full Text Available The discovery of a basalt vessel workshop at Tel Hazor, one of the most important Iron Age sites in the Near East, marks a turning point in our understanding of stone artifact production and distribution during the1st millennium BCE. It offers a rare opportunity to characterize ancient raw material sources, production sites, and study production, trade and distribution systems. The basalt vessel workshop, the only one of its kind in the Levant, produced large quantities of bowl preforms and production waste. To better understand the production and distribution systems behind this specialized production center, in 2011 we initiated a focused geochemical project that concentrated on the products of this unique workshop.  We measured the major and trace element composition of 44 unfinished basalt vessels from the workshop and other contexts at Hazor, and can demonstrate that the majority of these objects were derived from one specific, geochemically well-constrained, basaltic rock source. Only a few bowls clearly deviate from this geochemical composition and were produced using raw material from other sources. Thus, we believe that one major quarry existed that supplied the Hazor workshop with the majority of the basaltic raw material. The products from this specific extraction site provide us with a “Hazor reference group” that can be used to test whether or not finished vessels from Hazor and contemporary sites were produced in the Hazor workshop.

  2. Coordinated research project on radiation sterilization and decontamination of pharmaceuticals and pharmaceutical raw materials. CRP report

    International Nuclear Information System (INIS)


    Radiation processing is a very convenient tool for imparting desirable effects in materials and it has been an area of enormous interest in the last few decades. Radiation processing of synthetic and natural polymers for improving their characteristics is largely used in laboratory and industrial scale. Radiation sterilization is a well developed and established technology for many products. It is especially useful for the treatment of pharmaceuticals due to flexibility of radiation processing to be carried out at any desired temperature, sterilizability of mixed products in kits, offering simultaneous sterilization and modification of polymer based formulations. The success of radiation technology for processing of synthetic and natural polymers and treatment of pharmaceuticals has been based, to a large extent, on empirical knowledge. But now, the applications of natural polymers are being sought in knowledge-demanding areas such as pharmacy and biotechnology. Reliable analytical methods are being developed for controlling of degradation effects of radiation on polymers. Procedures and chemical formulations are being investigated enhancing or preventing degradation effects depending on the desired application of the process. The Coordinated Research Project (CRP) on the use of radiation processing for sterilization or decontamination of pharmaceuticals and pharmaceutical raw materials has been completed in 2002. The overall objective of the CRP was to coordinate the research and development programmes carried out in different countries in use of radiation processing for sterilization or decontamination of pharmaceuticals and pharmaceutic raw materials. It has been concluded that in addition to well known advantages of radiation sterilization being a well developed and established technology requiring the control of only one parameter, dose, to achieve sterilization; it is especially useful for the treatment of pharmaceuticals due to flexibility of radiation

  3. Coordinated research project on radiation sterilization and decontamination of pharmaceuticals and pharmaceutical raw materials. CRP report

    Energy Technology Data Exchange (ETDEWEB)



    Radiation processing is a very convenient tool for imparting desirable effects in materials and it has been an area of enormous interest in the last few decades. Radiation processing of synthetic and natural polymers for improving their characteristics is largely used in laboratory and industrial scale. Radiation sterilization is a well developed and established technology for many products. It is especially useful for the treatment of pharmaceuticals due to flexibility of radiation processing to be carried out at any desired temperature, sterilizability of mixed products in kits, offering simultaneous sterilization and modification of polymer based formulations. The success of radiation technology for processing of synthetic and natural polymers and treatment of pharmaceuticals has been based, to a large extent, on empirical knowledge. But now, the applications of natural polymers are being sought in knowledge-demanding areas such as pharmacy and biotechnology. Reliable analytical methods are being developed for controlling of degradation effects of radiation on polymers. Procedures and chemical formulations are being investigated enhancing or preventing degradation effects depending on the desired application of the process. The Coordinated Research Project (CRP) on the use of radiation processing for sterilization or decontamination of pharmaceuticals and pharmaceutical raw materials has been completed in 2002. The overall objective of the CRP was to coordinate the research and development programmes carried out in different countries in use of radiation processing for sterilization or decontamination of pharmaceuticals and pharmaceutic raw materials. It has been concluded that in addition to well known advantages of radiation sterilization being a well developed and established technology requiring the control of only one parameter, dose, to achieve sterilization; it is especially useful for the treatment of pharmaceuticals due to flexibility of radiation

  4. 1996 Progress report on energies and raw materials; 1996 rapport d`activite energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)



    The 1996 annual progress report, from the French Department of Energy, reviews the key points of the French policy for energy and raw materials: competitiveness, environmental protection, long term supply safety, and public service. 1996 was marked by positive results for the French energy industry, difficulties for the oil refining industry, and a new impetus for renewable energies. Five surveys are presented: nuclear safety in Eastern Europe, the european directive on electric power domestic market, evolution of the oil market, conditions of refining in France, and restructuring of the Mine bureau (BRGM). 40 prominent facts are briefly reviewed, concerning sustainable energy development, nuclear energy, electric power and gas, coal, oil products, raw materials. Diagrams on energy and raw materials are also included


    Directory of Open Access Journals (Sweden)

    Rodrigo Vera


    Full Text Available The presence and/or accumulation of mycotoxins in foods intended for human and animal nutrition is a constant concern for the harmful health effects resulting from ingestion. The aims of this communication were to analyze samples of feed and raw materials for manufacturing and to determine the presence of strains of filamentous fungi with toxigenic capacity. The values of frequency in the total samples (N = 422, indicated 63% of contamination, where A. flavus represented the most common (29.8%, while in feed and raw materials separately, indicated A. flavus has the highest value in both categories. In the analysis of different type of raw materials, A. flavus contaminated all types of samples, with the bran and soybean meal substrates having higher values for this Aspergillus, and corn substrate more fungal contamination. These results would demonstrate that the presence of mycobiota with toxigenic potential in food for animal feed is a disturbing reality.

  6. Aluminium content of some processed foods, raw materials and food additives in China by inductively coupled plasma-mass spectrometry. (United States)

    Deng, Gui-Fang; Li, Ke; Ma, Jing; Liu, Fen; Dai, Jing-Jing; Li, Hua-Bin


    The level of aluminium in 178 processed food samples from Shenzhen city in China was evaluated using inductively coupled plasma-mass spectrometry. Some processed foods contained a concentration of up to 1226 mg/kg, which is about 12 times the Chinese food standard. To establish the main source in these foods, Al levels in the raw materials were determined. However, aluminium concentrations in raw materials were low (0.10-451.5 mg/kg). Therefore, aluminium levels in food additives used in these foods was determined and it was found that some food additives contained a high concentration of aluminium (0.005-57.4 g/kg). The results suggested that, in the interest of public health, food additives containing high concentrations of aluminium should be replaced by those containing less. This study has provided new information on aluminium levels in Chinese processed foods, raw materials and a selection of food additives.

  7. 1996 Progress report on energies and raw materials; 1996 rapport d`activite energies et matieres premieres

    Energy Technology Data Exchange (ETDEWEB)



    The 1996 annual progress report, from the French Department of Energy, reviews the key points of the French policy for energy and raw materials: competitiveness, environmental protection, long term supply safety, and public service. 1996 was marked by positive results for the French energy industry, difficulties for the oil refining industry, and a new impetus for renewable energies. Five surveys are presented: nuclear safety in Eastern Europe, the european directive on electric power domestic market, evolution of the oil market, conditions of refining in France, and restructuring of the Mine bureau (BRGM). 40 prominent facts are briefly reviewed, concerning sustainable energy development, nuclear energy, electric power and gas, coal, oil products, raw materials. Diagrams on energy and raw materials are also included

  8. Raw material variability of an active pharmaceutical ingredient and its relevance for processability in secondary continuous pharmaceutical manufacturing. (United States)

    Stauffer, F; Vanhoorne, V; Pilcer, G; Chavez, P-F; Rome, S; Schubert, M A; Aerts, L; De Beer, T


    Active Pharmaceutical Ingredients (API) raw material variability is not always thoroughly considered during pharmaceutical process development, mainly due to low quantities of drug substance available. However, synthesis, crystallization routes and production sites evolve during product development and product life cycle leading to changes in physical material attributes which can potentially affect their processability. Recent literature highlights the need for a global approach to understand the link between material synthesis, material variability, process and product quality. The study described in this article aims at explaining the raw material variability of an API using extensive material characterization on a restricted number of representative batches using multivariate data analysis. It is part of a larger investigation trying to link the API drug substance manufacturing process, the resulting physical API raw material attributes and the drug product continuous manufacturing process. Eight API batches produced using different synthetic routes, crystallization, drying, delumping processes and processing equipment were characterized, extensively. Seventeen properties from seven characterization techniques were retained for further analysis using Principal Component Analysis (PCA). Three principal components (PCs) were sufficient to explain 92.9% of the API raw material variability. The first PC was related to crystal length, agglomerate size and fraction, flowability and electrostatic charging. The second PC was driven by the span of the particle size distribution and the agglomerates strength. The third PC was related to surface energy. Additionally, the PCA allowed to summarize the API batch-to-batch variability in only three PCs which can be used in future drug product development studies to quantitatively evaluate the impact of the API raw material variability upon the drug product process. The approach described in this article could be applied to any

  9. The economic geology of clays/shales raw materials for the ceramics industry in Lebanon

    International Nuclear Information System (INIS)

    Atiyyah, Frida


    Author.Field, laboratory and market studies are a must for proper evaluation of natural resources for the mineral industry of lebanon. Sites selectively convenient to the existing major Lebanese ceramics industry centered in the Beqa'a region, were investigated as to their geology, geography and economic character. The raw materials are shales, mud stones, siltstones and other argillaceous rocks of Jurassic to Cretaceous age coming from selective sites in south and central Lebanon. The finished products include wall, floor, roofing tiles, pipes, sanitary ware, pottery and brick specimens. Differential thermal analysis, scanning electron microscopy, firing and physico-chemical tests and analyses characterized the raw materials into two major groups: the suitable are siliceous argillaceous rocks and unsuitable calcareous argillaceous rocks. The suitable group is divided into two varieties. The first is dominantly a disordered Kaolinite with low drying and firing values, low plasticity index, giving a gray firing color, and with low iron and soluble salts content. The second is dominantly illite with the above properties showing medium values, and giving a red color due to the iron content. The unsuitable group is dominantly an intermixed clay type with high plasticity, soluble salts content and shrinkage values. The exposed parts, of the studied 11 sites the proved suitable, have estimated reserves around 23000 m 3 . This is only a fraction of the resources available to meet industrial consumption requirements. Further area coverage investigation and drilling would prove the very high potential existing for the industry. These Lebanese materials as determined by their properties, are used partially or fully in the various products. The foreign import, notably from non-Arab sources can be substituted by nearby economic Arab deposits. The ceramics industry is faced with developmental problems, economic, social and technical. Securing the local and the surrounding

  10. The economic geology of clays/shales raw materials for the ceramics industry in Lebanon

    Energy Technology Data Exchange (ETDEWEB)

    Atiyyah, Frida [Dept. of Geology, American Univ. of Beirut (Lebanon)


    Author.Field, laboratory and market studies are a must for proper evaluation of natural resources for the mineral industry of lebanon. Sites selectively convenient to the existing major Lebanese ceramics industry centered in the Beqa'a region, were investigated as to their geology, geography and economic character. The raw materials are shales, mud stones, siltstones and other argillaceous rocks of Jurassic to Cretaceous age coming from selective sites in south and central Lebanon. The finished products include wall, floor, roofing tiles, pipes, sanitary ware, pottery and brick specimens. Differential thermal analysis, scanning electron microscopy, firing and physico-chemical tests and analyses characterized the raw materials into two major groups: the suitable are siliceous argillaceous rocks and unsuitable calcareous argillaceous rocks. The suitable group is divided into two varieties. The first is dominantly a disordered Kaolinite with low drying and firing values, low plasticity index, giving a gray firing color, and with low iron and soluble salts content. The second is dominantly illite with the above properties showing medium values, and giving a red color due to the iron content. The unsuitable group is dominantly an intermixed clay type with high plasticity, soluble salts content and shrinkage values. The exposed parts, of the studied 11 sites the proved suitable, have estimated reserves around 23000 m{sup 3}. This is only a fraction of the resources available to meet industrial consumption requirements. Further area coverage investigation and drilling would prove the very high potential existing for the industry. These Lebanese materials as determined by their properties, are used partially or fully in the various products. The foreign import, notably from non-Arab sources can be substituted by nearby economic Arab deposits. The ceramics industry is faced with developmental problems, economic, social and technical. Securing the local and the surrounding

  11. Assessing raw materials for carbon black production using 1H- and 13C-nuclear magnetic resonance

    International Nuclear Information System (INIS)

    Bekarek, V.; Meic, Z.


    1 H and 13 C NMR spectroscopy in combination with elemental analysis and/or infrared spetroscopy were used in evaluating raw materials for the preparation of carbon black. Three models and seven industrial mixtures were analysed. The evaluation of experimental results by the Brown-Ladner method yielded information on the basic chemical characteristics of the raw material, ie., the contents of carbon and other elements, the contents of aromatic and aliphatic components and the nature of the aromatic compounds present. The obtained results are in good agreement with theoretical results for the model mixtures and with results of gas chromatography for the industrial mixtures


    Directory of Open Access Journals (Sweden)

    Terttu Heikkilä


    Full Text Available The aim of this study was to evaluate effects of chemical pretreatment and storage on non-wood pulping and on pulp quality. The processes studied were hot water treatment followed by alkaline peroxide bleaching or soda cooking. The results showed that it is possible to store wheat straw outside for at least one year without significant changes in the raw material chemical composition and without adverse effects on the resulting pulp quality. The results are significant to the industry using non-woods to ensure the availability and the quality of the raw-material throughout the year in spite of the short harvesting time.

  13. Hydrolysis technology for producing sugars from biomass as raw material for the chemical industry- SugarTech

    Energy Technology Data Exchange (ETDEWEB)

    Kallioinen, A.; Hytoenen, E.; Haekkinen, M. (VTT Technical Research Centre of Finland, Espoo (Finland)), email: (and others)


    In the SugarTech project, spruce, forest residue, birch and sugar cane bagasse have been studied as raw materials for production of sugars to be processed further to ethanol or other chemicals. These raw materials, containing high proportion of carbohydrates have been analysed and pretreated for enzymatic hydrolysis by steam explosion and oxidative methods. The pretreated materials have been studied in respect to yield and enzymatic hydrolysability. Small carboxylic acids were an interesting side product from oxidation pretreatment. For feasibility study, 8 process cases have been selected and will be compared. Optimal enzyme mixtures have been determined for hydrolysis of pretreated materials. Results show that optimal enzyme composition depends clearly on the raw material and the pretreatment method. Pretreated raw materials were also hydrolysed efficiently in high dry matter conditions with commercial enzymes. Enzyme adsorption and desorption were studied with lignocellulosic substrates aiming at recycling of enzymes in the hydrolysis process. After enzymatic hydrolysis, a major part of the enzymes remained bound to substrate in spite of high degree of hydrolysis. Desorption of enzymes could only be detected with catalytically oxidised spruce. In addition, the induction of hydrolytic system of Trichoderma reesei, which is a widely used fungus for cellulase enzyme production, has been studied in the presence of different substrates. The substrate and the pretreatment method had clear effects on gene expression profile. (orig.)

  14. IPP (Innovation in Products and Processes) For the sector of mineral raw materials and energy

    International Nuclear Information System (INIS)

    Correa E, Alexander; Alvarez, Carlos; Rodriguez, Andres


    This article presents the results of the research project IPP (process and product innovation) which is a systemic and thorough analysis of production chains, based on the study - productivity and processes. This project is working in 4 phases: Intelligence, experimentation, innovation, and technological appropriation, These steps are aimed at continuous improvement of processes, Products of the organization and the interactions between actors in the production of mineral raw materials and energy. In the intelligence phase, we studied the characteristics, needs, market, and environment of the production chain that are the result of the use of natural resources and environment. In the second phase, characterized the development, design and implementation of prototype products and processes that emulate the behavior of the process in a real system and are environmentally friendly. Taking into account the first two phases in the third, saw the formulation and design new processes and products that improve efficiency and productivity. In the last phase of the project is the service that seeks to appropriate technological innovation and knowledge transfer from one end to the chain. Finally the result of the proposed IPP is a center of innovation and development of logistic practices within the National University of Colombia to ensure the ownership and suitability of the solutions to the production chains is an innovation for the mining sector, materials and energy with the early-friendly products and processes with the environment.

  15. Kinetics of Grinding of Secondary Serpentine Raw Material at Cascade Operating Mode

    Directory of Open Access Journals (Sweden)

    Marek Matik


    Full Text Available The paper deals with the grinding of secondary serpentine material from the Dobšiná´s heap in a ball ceramic mill. The raw material was pre-sieved to prepare fraction of +250 –1,000 µm that was fed to the mill. During batch experiment an amount of oversize on the screen with a mesh size of 200 µm was observed as a function of time. Two speed modes were tested. Firstly, it was the mode designed by mill producer implicit from the structure of milling stand equipped by electromotor, friction gear onto driving shaft with given diameter. The speed of this original alignment attains 40 rmp. Secondly, it was cascade speed mode according to the Haase´s equation, namely 53 rmp, achieved by enlargement of driving shaft diameter. As to winning of required final product 90 % –200 µm, increased speed resulted in the shortening of grinding time from 17.5 to15.7 hour.

  16. Recycling of Manganese Secondary Raw Material Via Cold-Bond Pelletizing Process

    International Nuclear Information System (INIS)

    Ahmed, Y.M.Z.; Mohamed, F.M.


    Large quantities of fines were produced during the shipping, transportation, handling and storage of manganese ore sinter imported from different countries to Sinai Company for ferromanganese production. These fines are generally considered as valuable secondary raw materials. Hence, they have a potential to be recycled back to the submerged arc furnace after having been agglomerated. For agglomerates to be considered as feed materials for submerged arc furnace they must have sufficient room temperature strength. Cold-bonded penalization process offers an economically attractive and environmentally viable method for achieving this. Ordinary Portland cement was used in this investigation for the purpose of producing a suitable cold-bonded pellet from such fines. In this investigation, the effect of adding different percentages of Portland cement on the mechanical properties of both green and pellet dried at room temperature for 1, 3, 7, 14, and 28 days of normal curing were studied. The results revealed that, although the compressive strength of green pellets improved with the increase of the amount of cement added. retardation in pellet drop strength was reported. Whereas, the increase in both the cement content and time of drying leads to increase in the mechanical properties of pellets normally cured at room temperature. pellets obtain with the addition of 9% cement shows reasonable mechanical properties to be charged in the submerged are furnace. ferromanganese alloy having a standard range composition was produced in a laboratory submerged are furnace using such pellets

  17. Meteorite as raw material for Direct Metal Printing: A proof of concept study (United States)

    Lietaert, Karel; Thijs, Lore; Neirinck, Bram; Lapauw, Thomas; Morrison, Brian; Lewicki, Chris; Van Vaerenbergh, Jonas


    Asteroid mining as such is not a new concept, as it has been described in science fiction for more than a century and some of its aspects have been studied by academia for more than 30 years. Recently, there is a renewed interest in this subject due the more and more concrete plans for long-duration space missions and the need for resources to support industrial activity in space. The use of locally available resources would greatly improve the economics and sustainability of such missions. Due to its economy in material, use of additive manufacturing (AM) provides an interesting route to valorize these resources for the production of spare parts, tools and large-scale structures optimized for their local microgravity environment. Proof of concept has already been provided for AM of moon regolith. In this paper the concept of In-Situ Resource Utilization is extended towards the production of metallic objects using powdered iron meteorite as raw material. The meteorite-based powder was used to produce a structural part but further research is needed to obtain a high density part without microcracks.

  18. Dry desulfurization product as raw material for building components. Afsvovlingstoerprodukt som raavare fortrinsvis i byggematerialer

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, J P; Tram, B


    The report describes a number of investigations carried out with the purpose of finding useful applications for a waste product form the flue-gas cleaning process at coal-fired power plants, especially applications in the field of industrial building components. The waste product originates from a cleaning device, where the content of sulphur dioxide is removed from the flue-gas by the so called spray absorption method, developed by the Danish company Niro Atomizer A/S. The product is a finely divided, dry powder, consisting of a mix of calcium sulfite, calcium sulfate, calcium hydroxide, calcium carbonate, calcium chloride and fly ash. Trials were made, using the waste product mainly as a filler in the following products: Brick mortar, flue for ceramic tiles, stopping, filler for plastic paint, filler for plastics, filler for paper and paper-coating, autoclaved light-weight concrete, autoclaved fibre-cement sheets. The investigations has shown some interesting possiblilities for the use of named waste product in light-weight concrete, where good mechanical properties could be obtained, using a raw material mix, consisting mainly of the sulfuric waste product and fly ash. Also used as a filler in fibre-cement sheets, the waste material showed some interesting abilities. The waste product affects the properties of cellulosefibre reinforced sheets with a cementsilica matrix in a way, that leads to increased toughness of these, often rather brittle sheets. The MOR however will decrease slightly. (EG).

  19. Introducing LIR (Lithotheque Ireland, a reference collection of flaked stone tool raw materials from Ireland

    Directory of Open Access Journals (Sweden)

    Killian Driscoll


    Full Text Available The LIR (Lithotheque Ireland reference collection of flaked stone tool raw materials from Ireland began in 2013, and is based on the geological prospection from two projects. The first (2013-2015 focused attention primarily on Carboniferous cherts from the northwest of Ireland, collecting 405 samples. The second (2015-2017 is currently collecting samples of the Cretaceous flint primarily from in situ contexts in the northeast of Ireland, but also includes beach surveys of Cretaceous flint from around the island; the first phase of geological prospection in Autumn 2015 collected 239 samples, with the geological prospection continuing in 2016. Therefore, to date the collection contains over 600 hand samples of chert and flint, along with a small number of other materials (siliceous limestone, tuff, mudstone. The physical reference collection is housed at the UCD School of Archaeology, University College Dublin and contains the geological hand samples along with the various thin sections of the samples that are used for petrographic analysis. The physical collection is complemented by an online database that is to be used alongside the physical collection, or can be used as a stand-alone resource. This paper provides an overview of the database’s metadata and the processes of data entry and editing, to serve as a reference point for the database and the fieldwork undertaken to date, and to serve as a template for other researchers undertaking similar work on lithic reference collections.

  20. A hazardous waste from secondary aluminium metallurgy as a new raw material for calcium aluminate glasses. (United States)

    López-Delgado, Aurora; Tayibi, Hanan; Pérez, Carlos; Alguacil, Francisco José; López, Félix Antonio


    A solid waste coming from the secondary aluminium industry was successfully vitrified in the ternary CaO-Al(2)O(3)-SiO(2) system at 1500 degrees C. This waste is a complex material which is considered hazardous because of its behaviour in the presence of water or moisture. In these conditions, the dust can generate gases such as H(2), NH(3), CH(4), H(2)S, along with heat and potential aluminothermy. Only silica sand and calcium carbonate were added as external raw materials to complete the glasses formula. Different nominal compositions of glasses, with Al(2)O(3) ranging between 20% and 54%, were studied to determine the glass forming area. The glasses obtained allow the immobilisation of up to 75% of waste in a multicomponent oxide system in which all the components of the waste are incorporated. The microhardness Hv values varied between 6.05 and 6.62GPa and the linear thermal expansion coefficient, alpha, varied between (62 and 139)x10(-7)K(-1). Several glasses showed a high hydrolytic resistance in deionised water at 98 degrees C.

  1. Radiometric analysis of raw materials and end products in the Turkish ceramics industry (United States)

    Turhan, Ş.; Arıkan, İ. H.; Demirel, H.; Güngör, N.


    This study presents the findings of radiometric analysis carried out to determine the activity concentrations of natural radionuclides in raw materials (clay, kaolin, quartz, feldspar, dolomite, alumina, bauxite, zirconium minerals, red mud and frit) and end products (glazed ceramic wall and floor tiles) in the Turkish ceramics industry. Hundred forty-six samples were obtained from various manufacturers and suppliers throughout the country and analyzed using gamma-ray spectrometer with HPGe detectors. Radiological parameters such as radium equivalent activity, activity concentration index and alpha index were calculated to assess the radiological aspects of the use of the ceramic end products as decorative or covering materials in construction sector. Results obtained were examined in the light of the relevant national and international legislation and guidance and compared with the results of similar studies reported in different countries. The results suggest that the use of ceramic end product samples examined in the construction of dwellings, workplaces and industrial buildings in Turkey is unlikely to give rise to any significant radiation exposure to the occupants.

  2. Radiometric analysis of raw materials and end products in the Turkish ceramics industry

    International Nuclear Information System (INIS)

    Turhan, S.; Arikan, I.H.; Demirel, H.; Guengoer, N.


    This study presents the findings of radiometric analysis carried out to determine the activity concentrations of natural radionuclides in raw materials (clay, kaolin, quartz, feldspar, dolomite, alumina, bauxite, zirconium minerals, red mud and frit) and end products (glazed ceramic wall and floor tiles) in the Turkish ceramics industry. Hundred forty-six samples were obtained from various manufacturers and suppliers throughout the country and analyzed using gamma-ray spectrometer with HPGe detectors. Radiological parameters such as radium equivalent activity, activity concentration index and alpha index were calculated to assess the radiological aspects of the use of the ceramic end products as decorative or covering materials in construction sector. Results obtained were examined in the light of the relevant national and international legislation and guidance and compared with the results of similar studies reported in different countries. The results suggest that the use of ceramic end product samples examined in the construction of dwellings, workplaces and industrial buildings in Turkey is unlikely to give rise to any significant radiation exposure to the occupants.

  3. Effects of natural plant extracts and gamma rays on lactobacillus isolated from Korean traditional raw rice wine

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)


    Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent.

  4. Effects of natural plant extracts and gamma rays on lactobacillus isolated from Korean traditional raw rice wine

    International Nuclear Information System (INIS)

    Nam, Ji Young; Kim, Jae Hun; Lee, Ju Woon; Kim, Jin Kyu


    Recently, Korean traditional raw rice wines (RRW) have received attention because they are a nutritious food with health properties. But the rapid deterioration of fermented RRW is one of the serious problems for brewing and marketing in the world beyond Korea. The goal of this study was to develop a way to enhance the quality and to lengthen the period of circulation of the RRW. A lactic acid bacterium was isolated from RRW. It was identified as Lactobacillus fermentum (98%) based on its biochemical properties, and 16S rRNA sequence. Treatments of RRW with gamma radiation and green tea extracts reduced the bacterial population except for yeasts and Lactobacillus in the RRW. This result suggested that the natural plant extracts and catechin products can be used as an effective natural storage agent

  5. Use of ion exchange during preparation of raw materials for production of molybdenum and tungsten of high purify

    International Nuclear Information System (INIS)

    Blokhin, A.A.; Rumyantsev, V.K.; Taushkanov, V.P.; Maksimkov, S.M.; Majorov, D.Yu.; Pak, V.I.


    The data on the application of selective ionites for the steep purification of ammonium molybdate and tungstate solutions, are given. It is shown that to purify molybdenum and ammonium tungstate solutions from the impuerities of alkali earth and two- and threevalent transition metals, iminodiacetate ampholites of the ANKB-35 type are the most effective sorbents. To purify from phosphorus, silicon and arsenic impurities composition ionites on the base of hydrated oxides of multivalent metals introduced in the granules of porous cationites should be used. To extract phosphorus, silicon, arsenic impurities from ammonium molybdate and tungstate solutions and tungsten from ammonium molybdate solutions the method of their coprecipitation with iron (3) hydroxide can also be used. The best results on the purification of ammonium molybdate from tungstate provides for the application of structural organomineral ionites as well as weak-basicity anionites of the AN-31 type and its different modifications containing hydroxyl groups along with aminogroups. To purity ammonium tungstate solutions from molybdate a method is developed which transforms molybdenum in the form of thiocomplexes and the following selective sorption by strong-basicity anionites. The data on the quality of molybdenum monocrystals which are taken from the raw material purified using ionites, are given

  6. Methanol synthesis using captured CO2 as raw material: Techno-economic and environmental assessment

    International Nuclear Information System (INIS)

    Pérez-Fortes, Mar; Schöneberger, Jan C.; Boulamanti, Aikaterini; Tzimas, Evangelos


    Highlights: • A carbon utilisation plant that synthesise methanol is simulated in CHEMCAD. • The total amount of CO 2 demand is 1.46 t/t methanol . • The CO 2 not-produced compared to a conventional plant is 0.54 t/t methanol . • Production costs results too high for a financially attractive project. • There is a net potential for CO 2 emissions reduction of 2.71 MtCO 2 /yr in Europe. - Abstract: The purpose of this paper is to assess via techno-economic and environmental metrics the production of methanol (MeOH) using H 2 and captured CO 2 as raw materials. It evaluates the potential of this type of carbon capture and utilisation (CCU) plant on (i) the net reduction of CO 2 emissions and (ii) the cost of production, in comparison with the conventional synthesis process of MeOH Europe. Process flow modelling is used to estimate the operational performance and the total purchased equipment cost; the flowsheet is implemented in CHEMCAD, and the obtained mass and energy flows are utilised as input to calculate the selected key performance indicators (KPIs). CO 2 -based metrics are used to assess the environmental impact. The evaluated MeOH plant produces 440 ktMeOH/yr, and its configuration is the result of a heat integration process. Its specific capital cost is lower than for conventional plants. However, raw materials prices, i.e. H 2 and captured CO 2 , do not allow such a project to be financially viable. In order to make the CCU plant financially attractive, the price of MeOH should increase in a factor of almost 2, or H 2 costs should decrease almost 2.5 times, or CO 2 should have a value of around 222 €/t, under the assumptions of this work. The MeOH CCU-plant studied can utilise about 21.5% of the CO 2 emissions of a pulverised coal (PC) power plant that produces 550 MW net of electricity. The net CO 2 emissions savings represent 8% of the emissions of the PC plant (mainly due to the avoidance of consuming fossil fuels as in the conventional Me

  7. The Energy & Raw Materials Factory: Role and Potential Contribution to the Circular Economy of the Netherlands. (United States)

    van Leeuwen, Kees; de Vries, Eli; Koop, Stef; Roest, Kees


    Water is an abundant resource worldwide, but fresh and clean water is scarce in many areas of the world. Increases in water consumption and climate change will affect global water security even further in the near future. With increasing numbers of people living in metropolitan areas, water, energy, and materials need to be used carefully, reused and renewed. Resource scarcity is the driver behind the circular economy. The recovery of materials and energy can add significant new value streams and improve cost recovery and water quality. In this paper, we present the creation of the Energy & Raw Materials Factory (ERMF) of the Dutch Water Authorities, also known as the Resource Factory, as one of the solutions to this global challenge of water in the circular economy. Resources like cellulose, bioplastics, phosphate, alginate-like exopolymers from aerobic granular sludge (bio-ALE), and biomass can be recovered. Bio-ALE is an alginate-like polymer of sugars and proteins and can be used in agriculture and horticulture, the paper industry, medical, and construction industries. The ERMF demands significant investments but the return on investment is high both from a financial and environmental perspective, provided that markets can be realized. Experiences in the Netherlands show that the concept of the ERMF is viable and adds to the creation of a circular economy. Achieving climate neutrality and production of new and promising resources like bio-ALE are possible. The ERMF can contribute to the sustainable development goals (SDGs) of the United Nations on water and sanitation, once fully operational.

  8. Primary Copper Smelter and Refinery as a Recycling Plant—A System Integrated Approach to Estimate Secondary Raw Material Tolerance

    Directory of Open Access Journals (Sweden)

    Olof Forsén


    Full Text Available The primary production of sulfide concentrates includes smelting to copper matte or blister copper, conversion of matte to blister copper, and refining to copper. Smelting, converting, and fire-refining can use a limited amount of secondary materials. Molten copper can effectively dissolve many metals, from valuable noble metals to harmful impurities such as bismuth. However, some of the impurity metals in copper are valuable in other applications. In this paper, we outline the main material flows in copper smelting and electrorefining and describe how minor metals can be recovered from secondary raw materials using copper as a carrier material. We will use a system integrated approach to define the factors that affect the recovery of different metals and copper quality. Metals typical in copper production are used as examples, like noble metals, As, Bi, Se, and Te, including metals in the EU critical raw materials list like PGM and Sb.

  9. Study of the incorporation of marble and granite wastes in the raw material to produce glass wool

    International Nuclear Information System (INIS)

    Rodrigues, Girley Ferreira; Junca, Eduardo; Telles, Victor Bridi; Espinosa, Denise Crocce Romano; Tenorio, Jorge Alberto Soares; Alves, Joner Oliveira


    The study aimed to characterize materials obtained from the melted mixture containing marble and granite wastes, and also chemical reagents. Using the characterization results was defined the feasibility of reuse of the marble and granite wastes, through the incorporation in the raw material to produce glass wool (a material with great consumer market as thermo-acoustic insulator). The batch was poured in a water-filled recipient and also in a Herty viscometer at temperatures of 1400, 1450 and 1500 °C. Samples of produced materials were characterized by morphology using Scanning Electron Microscopy, by atomic structure using X-ray Diffraction, and by thermal behavior using Differential Thermal Analysis. The total amount of marble and granite wastes can reach about 79% replacement in relation to the total weight of the raw material used in the glass wool production. (author)

  10. Hydrolysis technology for producing sugars from biomass as raw material for the chemical industry - SugarTech

    Energy Technology Data Exchange (ETDEWEB)

    Siika-aho, M.; Kallioinen, A.; Pakula, T. (and others) (VTT Technical Research Centre of Finland, Espoo (Finland)), email:


    In SugarTech project, spruce, forest residue, birch and sugar cane bagasse have been studied as a raw material for production of sugars to be processed further to ethanol and other chemicals. These raw materials containing high proportion of carbohydrates have been analysed and pretreated for enzyme hydrolysis by steam explosion and oxidative methods. The pretreated materials have been studied in respect to yield and enzymatic hydrolysability. Birch and bagasse could easily be pretreated with steam explosion. Catalytic oxidation treatment of spruce produced material with superior hydrolysability to steam exploded material. Enzyme adsorption and desorption were studied aiming at recycling of enzymes in the hydrolysis process. Purified cellulase enzymes were found to have high tendency to adsorption on lignocellulosic substrate. Adsorption could be decreased by additives, e.g. urea and BSA. In addition, the hydrolytic system of Trichoderma reesei in the presence of different substrates has been studied. (orig.)

  11. Elaboration of porous gehlenite and anorthite based ceramics using low price raw materials

    Directory of Open Access Journals (Sweden)

    F. Zenikheri

    Full Text Available Abstract Porous ceramics of good quality cost a lot in the world market, which has limited their use in developing countries. This is why this work was mainly devoted to prepare low-cost and good quality ceramics, using kaolin (DD2 type and calcite (CaCO3 available in abundance in Algeria. Based on previous results, 28 wt% CaCO3 ceramic was selected. The presence of CaCO3 favors to achieve porous samples characterized by a high percentage of porosity due to the CO2 release and CaO formation during its calcination at about 700 °C. The choice of these raw materials is based on their natural abundance (low price. It has been found that the samples had interesting characteristics: average pore size between 2.87 and 6.50 μm and porosity between 53 and 57%. It has also been found that the manufactured membrane supports are mainly constituted of gehlenite and anorthite phases. Moreover, the pore size distribution was mono-modal type. The surface and cross-section morphologies observed through a scanning electron microscope were also homogeneous and do not present any possible macro-defects (cracks, etc..

  12. Sintering and dielectric properties of a technical porcelain prepared from economical natural raw materials

    Directory of Open Access Journals (Sweden)

    S. Kasrani

    Full Text Available Abstract In this study, the production of a technical porcelain, for the ceramic dielectric applications by using economical natural raw materials, was investigated. The basic porcelain composition was selected consisting of 30 wt% kaolin, 45 wt% potash-feldspar and 25 wt% quartz. The obtained phases in the sintered samples were investigated by X-ray diffraction, Fourier transform infrared spectroscopy analysis, and scanning electron microscopy images. It has been confirmed by these techniques that the main crystalline phases were quartz and mullite. Dielectric measurements of technical porcelains have been carried out at 1 kHz from room temperature to 200 °C. The dielectric constant, loss factor, dielectric loss tangent, and resistivity of the porcelain sample sintered at 1160 °C were 22-25, 0.32-1.80, 0.006-0.07, and 0.2-9 x 1013 Ω.cm, respectively. The value of dielectric constant was significantly high when compared to that of conventional porcelains which did not exceed generally 9.

  13. Utilization of Sandy Soil as the Primary Raw Material in Production of Unfired Bricks

    Directory of Open Access Journals (Sweden)

    Guilan Tao


    Full Text Available In this study, attempts were made to use sandy soil as the main raw material in making unfired bricks. The sprayed-cured brick specimens were tested for compressive and flexural strength, rate of water absorption, percentage of voids, bulk density, freezing/thawing, and water immersion resistance. In addition, the microstructures of the specimens were also studied using scanning electron microscope (SEM and X-ray diffraction (XRD technique. The test results show that unfired brick specimens with the addition of ground-granulated blast-furnace slag (GGBS tend to achieve better mechanical properties when compared with the specimens that added cement alone, with GGBS correcting particle size distribution and contributing to the pozzolanic reactions and the pore-filling effects. The test specimens with the appropriate addition of cement, GGBS, quicklime, and gypsum are dense and show a low water absorption rate, a low percentage of voids, and an excellent freezing/thawing and water immersion resistance. The SEM observation and XRD analysis verify the formation of hydrate products C–S–H and ettringite, providing a better explanation of the mechanical and physical behavior and durability of the derived unfired bricks. The results obtained suggest that there is a technical approach for the high-efficient comprehensive utilization of sandy soil and provide increased economic and environmental benefits.

  14. A Simple Photometer and Chemometrics Analysis for Quality Control of Sambiloto (Andrographis paniculata Raw Material

    Directory of Open Access Journals (Sweden)

    Rudi Heryanto


    Full Text Available In this paper, we described the use of a light emitting diode (LED-based photometer and chemometric analysis for quality control of king of bitter or sambiloto (Andrographis paniculata raw material. The quality of medicinal plants is determined by their chemical composition. The quantities of chemical components in medicinal plants can be assessed using spectroscopic technique. We used an “in house” photometer to generate spectra of sambiloto. The spectra were analyzed by chemometric methods, i.e. principal component analysis (PCA and partial least square discriminant analysis (PLS-DA, with the aim of herbal quality classification based on the harvesting time. From the results obtained, based on thin layer chromatography analysis, sambiloto with different collection times (1, 2, and 3 months contained different amounts of active compounds. Evaluation of sambiloto, using its spectra and chemometric analysis has successfully differentiated its quality based on harvesting time. PCA with the first two PC’s (PC-1 = 60% and PC-2 = 35% was able to differentiate according to the harvesting time of sambiloto. Three models were obtained by PLS-DA and could be used to predict unknown sample of sambiloto according to the harvesting time

  15. Extrusion Processing of Raw Food Materials and by-products: A Review. (United States)

    Offiah, Vivian; Kontogiorgos, Vassilis; Falade, Kolawole O


    Extrusion technology has rapidly transformed the food industry with its numerous advantages over other processing methods. It offers a platform for processing different products from various food groups by modifying minor or major ingredients and processing conditions. Although cereals occupy a large portion of the extruded foods market, several other types of raw materials have been used. Extrusion processing of various food groups, including cereals and pseudo cereals, roots and tubers, pulses and oilseeds, fruits and vegetables, and animal products, as well as structural and nutritional changes in these food matrices are reviewed. Value addition by extrusion to food processing wastes and by-products from fruits and vegetables, dairy, meat and seafood, cereals and residues from starch, syrup and alcohol production, and oilseed processing are also discussed. Extrusion presents an economical technology for incorporating food processing residues and by-products back into the food stream. In contemporary scenarios, rising demand for extruded products with functional ingredients, attributed to evolving lifestyles and preferences, have led to innovations in the form, texture, color and content of extruded products. Information presented in this review would be of importance to processors and researchers as they seek to enhance nutritional quality and delivery of extruded products.


    Directory of Open Access Journals (Sweden)

    Andrew N. Ivankin


    Full Text Available The problems of the microcomponent composition of modern food systems based on natural raw materials are considered. It is shown  that modern methods of physical and chemical analysis make it  possible to establish the presence of both useful and unsafe microimpurities with a level of their content in the production  from 0.001 to 1–5 mg / kg. The effect of microquantities of free amino and fatty acids, as well as carbohydrates and vitamins,  on the flavor and aromatic characteristics of systems is discussed. Some aspects of the presence of introduced  microcomponents, which include pesticides, antibiotic and  chemotherapeutic drugs, hormonal regulators, polyaromatic  hydrocarbons and some other toxicants, as well as microingredients  formed in products under the influence of biochemical processes during storage are considered. As such microingredients, biogenic amines and other products of transformation of macrocomponents are considered.

  17. Effect of raw materials and hardening process on hardness of manually forged knife (United States)

    Balkhaya, Suwarno


    Knives are normally made by forging process either using a machine or traditional method by means of hammering process. This present work was conducted to study the effects of steel raw materials and hardening process on the hardness of manually forged knives. The knife samples were made by traditional hammering (forging) process done by local blacksmith. Afterward, the samples were heat treated with two different hardening procedures, the first was based on the blacksmith procedure and the second was systematically done at the laboratory. The forging was done in the temperature ranged between 900-950°C, while the final temperature ranged between 650-675°C. The results showed that knives made of spring steel and heat treated in simulated condition at the laboratory obtained higher level of hardness, i.e. 62 HRC. In general, knives heat treated by local blacksmith had lower level of hardness that those obtained from simulated condition. Therefore, we concluded that the traditional knife quality in term of hardness can be improved by optimizing the heat treatment schedule.

  18. Characterization of ceramic masses using raw material of Para, Brazil: kaolin in natura

    International Nuclear Information System (INIS)

    Vida, T.A.; Facury Neto, E.; Rabelo, A.A.


    The incorporation rejects to the mixtures has if shown viable in the reduction of the environmental liability and for the obtaining of a better quality of the ceramic mass. In the present work, is tried to study the potentiality of the use of ceramic formulations with the addition of kaolin in natura to the clays. Formulations with two clays of the area of the municipal district of Maraba with addition of up to 60% in kaolin weight were prepared and characterized. For the determination of the physical and mechanical properties proof bodies were made by prensagem uniaxial and later burned in temperature from 900 to 1200 deg C with landing of 3 hours. The raw materials were characterized through diffraction of rays X (DRX) and thermogravimetric analysis. The proof bodies prepared were used for determination of the lineal retraction (RL), absorption of water, apparent porosity, apparent density, loss to the fire and rupture module the flexing. The results were satisfactory for the smallest kaolin tenors in the ceramic mass, and the mass with 20% presented rupture module elevated, in the temperature of 1200 deg C. (author)

  19. Study of Raw Materials Treatment by Melting and Gasification Process in Plasma Arc Reactor

    Directory of Open Access Journals (Sweden)

    Peter KURILLA


    Full Text Available The world consumption of metals and energy has increased in last few decades and it is still increasing. Total volume production results to higher waste production. Raw material basis of majority metals and fossil fuels for energy production is more complex and current waste treatment has long term tendency. Spent power cells of different types have been unneeded and usually they are classified as dangerous waste. This important issue is the main topic of the thesis, in which author describes pyrometallurgical method for storage batteries – power cells and catalysts treatment. During the process there were tested a trial of spent NiMH, Li – ion power cells and spent copper catalysts with metal content treatment by melting and gasification process in plasma arc reactor. The synthetic gas produced from gasification process has been treated by cogenerations micro turbines units for energy recovery. The metal and slag from treatment process are produced into two separately phases and they were analyzing continually.


    Directory of Open Access Journals (Sweden)

    I. R. Belenkaya


    Full Text Available The article analyses the candied fruit market in Ukraine and describes the main technological operations pertainingto processing of non-traditional candied products – celery and parsnip roots. Darkening of the roots surface caused bythe enzyme oxidation is one of the problems arising when processing white roots, which leads to worse marketable conditionof the product. To prevent darkening, the developed technology provides for soaking raw material in 1% citric acid solutionimmediately after peeling. To improve the diffusion and osmotic processes and to soften roots before boiling in sugar syrup,the steam blanching has been applied. The constructed Gantt diagram proves that the developed technology can shorten thecandied fruit cooking period. The biochemical indicators of the obtained new products have been studied. It was establishedthat the candied fruit possess the appropriate physical and chemical indicators and original organoleptic properties resulting ina demand by consumers. The results of the taste evaluation of the experimental specimen confirmed a high quality of the products.

  1. Concepts on the contribution of chemistry to a sustainable development. Renewable raw materials

    International Nuclear Information System (INIS)

    Metzger, J.O.; Eissen, M.


    The principles of the Rio Conference (1992) and Agenda 21 address the pressing problems of today and also aim at preparing the world for the challenges of this century. The conservation and management of resources for development are the main foci of interest, to which chemistry will have to make a considerable contribution. Since base chemicals are produced in large quantities and important product lines are synthesized from them, their resource-saving production is especially important for a sustainable development. New processes based on renewable feedstocks are significant here. Most products that are obtained from renewable raw materials may, at present, not be able to compete with the products of the petrochemical industry, but this will change as oil becomes scarcer and oil prices rise. The design of chemical products should make sustainable processing and recycling possible, and should prevent their bioaccumulation. Methods and criteria to assess their contribution to a sustainable development are necessary. The time necessary to introduce the new more sustainable processes and products has to be diminished by linking their development with operational innovation management and with efficient environmental-political control procedures. (authors)

  2. Lithic raw material procurement for projectiles points in the prehistory of Uruguay

    Directory of Open Access Journals (Sweden)

    José María López Mazz


    Full Text Available This paper focuses on current research on early colonisation of the Atlantic coast of South America during the early Holocene. We present advances in the investigation of raw material procurement at the Rincón de los Indios site, located in the eastern part of Uruguay. The technological studies suggest that some aspects of different styles of projectile points are related with environmental adaptation processes, experienced by the first American people in the New World. The occupation of new spaces and new forms of exploitation of resources changes the organisation of lithic technology. The distance to good quality rocks were critical for the opportunities and economic organisation of hunting groups. The study of changes in lithic procurement strategies for projectile points helps us develop a more comprehensive knowledge of this important social adaptation process which occurred during this period. These patterns started to become stabilised in the latter part of the early Holocene across the extended territory and confirm the efficient land occupation associated an intensive hunter-gatherer economies.

  3. Stability-indicating spectrofluorimetric method for determination of itopride hydrochloride in raw material and pharmaceutical formulations. (United States)

    Walash, Mohamed I; Ibrahim, Fawzia; Eid, Manal I; El Abass, Samah Abo


    A simple, sensitive and rapid spectrofluorimetric method for determination of itopride hydrochloride in raw material and tablets has been developed. The proposed method is based on the measurement of the native fluorescence of the drug in water at 363 nm after excitation at 255 nm. The relative fluorescence intensity-concentration plot was rectilinear over the range of 0.1-2 μg/mL (2.5 × 10(-7)-5.06 × 10(-6) mole/L), with good correlation (r = 0.9999), limit of detection of 0.015 μg/mL and a lower limit of quantification of 0.045 μg/mL. The described method was successfully applied for the determination of itopride hydrochloride in its commercial tablets with average percentage recovery of 100.11 ± 0.32 without interference from common excipients. Additionally, the proposed method can be applied for determination of itopride in combined tablets with rabeprazole or pantoprazole without prior separation. The method was extended to stability study of itopride. The drug was exposed to acidic, alkaline, oxidative and photolytic degradation according to ICH guidelines. Moreover, the method was utilized to investigate the kinetics of the alkaline, acidic and oxidative degradation of the drug. A proposal for the degradation pathways was postulated.

  4. Sintering and dielectric properties of a technical porcelain prepared from economical natural raw materials

    Energy Technology Data Exchange (ETDEWEB)

    Kasrani, S.; Harabi, A.; Barama, S.-E.; Foughali, L.; Benhassine, M. T., E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Ceramics Lab. Mentouri University of Constantine (Algeria); Aldhayan, D.M., E-mail: [Chemistry Department, Riyadh, King Saud University (Saudi Arabia)


    In this study, the production of a technical porcelain, for the ceramic dielectric applications by using economical natural raw materials, was investigated. The basic porcelain composition was selected consisting of 30 wt% kaolin, 45 wt% potash-feldspar and 25 wt% quartz. The obtained phases in the sintered samples were investigated by X-ray diffraction, Fourier transform infrared spectroscopy analysis, and scanning electron microscopy images. It has been confirmed by these techniques that the main crystalline phases were quartz and mullite. Dielectric measurements of technical porcelains have been carried out at 1 kHz from room temperature to 200 °C. The dielectric constant, loss factor, dielectric loss tangent, and resistivity of the porcelain sample sintered at 1160 °C were 22-25, 0.32-1.80, 0.006-0.07, and 0.2-9 x 10{sup 13} Ω.cm, respectively. The value of dielectric constant was significantly high when compared to that of conventional porcelains which did not exceed generally 9. (author)

  5. Phenolics in Primula veris L. and P. elatior (L. Hill Raw Materials

    Directory of Open Access Journals (Sweden)

    Katarzyna Bączek


    Full Text Available Primula veris L. and Primula elatior (L. Hill represent medicinal plants used for the production of herbal teas and preparations with antioxidant and expectorant activity. Flowers and roots of both species possess the same biological activity. In the presented study, raw materials of wild growing P. veris and P. elatior were compared in terms of the content and composition of phenolic compounds using a fast and simple HPLC-DAD method. The study showed that flowers of both species were rich in flavonoids. However, P. veris flowers were characterized with a distinctly higher content of isorhamnetin-3-O-glucoside, astragalin, and (+-catechin, whereas P. elatior occurred to be a richer source of rutoside and isorhamnetin-3-O-rutinoside. Hyperoside was found exclusively in P. elatior flowers. Phenolic glycosides (primverin and primulaverin were identified only in the roots. Their content was about ten times higher in P. veris in comparison with P. elatior underground organs. The obtained results clearly show that both Primula species differ distinctly in terms of the content and composition of phenolic compounds. The compounds differentiating both species to the highest degree (hyperoside, in flowers, as well as primverin and primulaverin, in the roots may be useful chemical markers in the identification and evaluation of both species.

  6. Use of weathered diesel oil as a low-cost raw material for biosurfactant production

    Directory of Open Access Journals (Sweden)

    A. P. Mariano


    Full Text Available This work aimed to investigate the capability of biosurfactant production by Staphylococcus hominis, Kocuria palustris and Pseudomonas aeruginosa LBI, using weathered diesel oil from a long-standing spillage as raw material. The effect of the culture media (Robert or Bushnell-Haas and of the carbon source (spilled diesel oil or commercial diesel oil on biosurfactant production was evaluated. Erlenmeyer flasks (250 mL containing the cell broth were agitated (240 rpm for 144 h at 27±2ºC. Biosurfactant production was monitored according to the De Nöuy ring method using a Krüss K6 tensiometer. Considering the possibility of intracellular storage of biosurfactant in the cell wall of the cultures S. hominis and K. palustris, experiments were also done applying ultrasound as a way to rupture the cells. For the conditions studied, the cultures did not indicate production of biosurfactants. Results obtained with a hydrocarbon biodegradability test based on the redox indicator 2,6-dichlorophenol indophenol showed that only the commercial diesel was biodegraded by the cultures.


    Directory of Open Access Journals (Sweden)

    Stephen Bunker


    Full Text Available Theorists of hegemony combine a concern with the causes of war and peace with questions of dominant trade regimes. While this combination addresses issues of central importance for studies of international relations, it may somewhat confound the role of hegemony studies within a world systems perspective. The power of the world systems perspective lies in the consideration of entire worlds, not simply as the appropriate unit of analysis, but as integrated units of production and exchange. Hierarchy within this system reflects not simply politically enforced relations of unequal exchange, but the subordination of production in different parts of the world to regimes constructed and manipulated by core powers to their own economic and political advantage. The processes that create the power of the core and the processes by which the core subordinates the periphery constitute the critical questions within this perspective. Part, but only part, of the answer lies in the superior productive capacity and efficiency of the core, and resulting ability to dominate trade. Another part, and we believe this is primary, lies in the ways that, in order to become so productive and so efficient, economies rising to core status must organize other economies and international transport systems to assure the increasing, secure, cheap supplies of the raw materials that support productive efficiency and economic growth.

  8. Perspectives for online analysis of raw material by pulsed neutron irradiation (United States)

    Bach, Pierre; Le Tourneur, P.; Poumarede, B.


    On-line analysis by pulsed neutron irradiation is an example of an advanced technology application of nuclear techniques, concerning real problems in the cement, mineral and coal industries. The most significant of these nuclear techniques is their capability of continuous measurement without contact and without sampling, which can lead to improved control of processes and resultant large financial savings. Compared to Californium neutron sources, the use of electrical pulsed neutron generators allows to obtain a higher signal/noise ratio for a more sensitive measurement, and allows to overcome a number of safety problems concerning transportation, installation and maintenance. An experiment related to a possible new on-line raw material analyzer is described, using a pulsed neutron generator. The key factors contributing to an accurate measurement are related to a suitable generator, to a high count rate gamma ray spectroscopy electronics, and to computational tools. Calculation and results for the optimization of the neutron irradiation time diagram are reported. One of the operational characteristics of such an equipment is related to neutron flux available: it is possible to adjust it to the requested accuracy, i.e. for a high accuracy during a few hours/day and for a lower accuracy the rest of the time. This feature allows to operate the neutron tube during a longer time, and then to reduce the cost of analysis.

  9. Inventory control of raw material using silver meal heuristic method in PR. Trubus Alami Malang (United States)

    Ikasari, D. M.; Lestari, E. R.; Prastya, E.


    The purpose of this study was to compare the total inventory cost calculated using the method applied by PR. Trubus Alami and Silver Meal Heuristic (SMH) method. The study was started by forecasting the cigarette demand from July 2016 to June 2017 (48 weeks) using additive decomposition forecasting method. The additive decomposition was used because it has the lowest value of Mean Abosolute Deviation (MAD) and Mean Squared Deviation (MSD) compared to other methods such as multiplicative decomposition, moving average, single exponential smoothing, and double exponential smoothing. The forcasting results was then converted as a raw material needs and further calculated using SMH method to obtain inventory cost. As expected, the result shows that the order frequency of using SMH methods was smaller than that of using the method applied by Trubus Alami. This affected the total inventory cost. The result suggests that using SMH method gave a 29.41% lower inventory cost, giving the cost different of IDR 21,290,622. The findings, is therefore, indicated that the PR. Trubus Alami should apply the SMH method if the company wants to reduce the total inventory cost.

  10. Natural gas as raw material for clean fuels and chemicals in the next decades

    International Nuclear Information System (INIS)

    Colitti, M.


    Modern industry originates in a change of feedstock, the result of a never-ending quest for a better, cheaper raw material. In the origin, there was coal, a source of both energy and industrial feedstock, the so-called synthesis gas. Then, coal was replaced by liquid hydrocarbons, coming from a refinery or from wells of crude oil and gas. The passage from solid to liquids was part and parcel of a structural change which has produced an extraordinary acceleration of economic growth. We might hope that the same will happen when natural gas will comes in to displace the liquids. New feedstocks do not come in without a fight. It is not only a matter of price, but also of technology, and of the natural tendency of industries to protect their own investments in plants which are all of a sudden made to look old. Rather than repeat for the 'nth' time the list of technologies which can turn natural gas into a basic feedstock for oil and petrochemical industries, the author discusses how will companies decide upon this matter

  11. Sintering and dielectric properties of a technical porcelain prepared from economical natural raw materials

    International Nuclear Information System (INIS)

    Kasrani, S.; Harabi, A.; Barama, S.-E.; Foughali, L.; Benhassine, M. T.; Aldhayan, D.M.


    In this study, the production of a technical porcelain, for the ceramic dielectric applications by using economical natural raw materials, was investigated. The basic porcelain composition was selected consisting of 30 wt% kaolin, 45 wt% potash-feldspar and 25 wt% quartz. The obtained phases in the sintered samples were investigated by X-ray diffraction, Fourier transform infrared spectroscopy analysis, and scanning electron microscopy images. It has been confirmed by these techniques that the main crystalline phases were quartz and mullite. Dielectric measurements of technical porcelains have been carried out at 1 kHz from room temperature to 200 °C. The dielectric constant, loss factor, dielectric loss tangent, and resistivity of the porcelain sample sintered at 1160 °C were 22-25, 0.32-1.80, 0.006-0.07, and 0.2-9 x 10 13 Ω.cm, respectively. The value of dielectric constant was significantly high when compared to that of conventional porcelains which did not exceed generally 9. (author)

  12. The key numbers of the mineral raw materials; Les chiffres cles des matieres premieres minerales

    Energy Technology Data Exchange (ETDEWEB)

    Mandil, C. [Directeur General de l`Energie et des Matieres Premieres, France (France)]|[Ministere de l`Industrie, des Postes et Telecommunications et du Commerce Exterieur, 75 - Paris (France)


    Mineral raw materials come from fossil reserves or ores resulting from the geologic and climatic history of the Earth. The access to economic development for 80% of the worldwide population and the high rate of demographic growth (probably 8 billions of inhabitants in 2025) are important factors that can greatly multiply the worldwide consumption of ores. In parallel, environmental concerns and the increasing need for a better equilibrium between wildlife preservation and the supply of economic needs, lead to a more reasonable and mastered use of natural resources. The aim of this book is to shade light and give global elements of thoughts on mineral resources, and for the main of those (about 30 metals and mineral substances), to review the most useful data and references about their production and consumption. For each question, chapters are devoted to the situation of France in its worldwide context. One chapter concerns the uranium ores (reserves, production, prices evolution, consumption, economic flux and companies involved). (J.S.).


    Directory of Open Access Journals (Sweden)

    Duca G.


    Full Text Available The problem of increase of energy security of Republic Moldova is examined due to use of own power resources. Application of a biodiesel engine, bioethanol in mixes with traditional kinds of fuel (diesel fuel and gasoline is possible without updating a design of existing engines of internal combustion and can be economic for agriculture and on transport. Results of experiments on definition износоустойчивости lubricants received of vegetative raw material of local manufacture are resulted. Use of bioethanol as the additive to gasoline will lower his{its} cost, will reduce consumption of gasoline to 15-20 % and will allow to reduce considerably harmful emissions in an atmosphere, ecological safety that will favorably be reflected on health of the population will be raised. Manufacture of lubricants with use рапсового oils also will allow to receive serious economic benefit.

  14. Quality assessment of baby food made of different pre-processed organic raw materials under industrial processing conditions. (United States)

    Seidel, Kathrin; Kahl, Johannes; Paoletti, Flavio; Birlouez, Ines; Busscher, Nicolaas; Kretzschmar, Ursula; Särkkä-Tirkkonen, Marjo; Seljåsen, Randi; Sinesio, Fiorella; Torp, Torfinn; Baiamonte, Irene


    The market for processed food is rapidly growing. The industry needs methods for "processing with care" leading to high quality products in order to meet consumers' expectations. Processing influences the quality of the finished product through various factors. In carrot baby food, these are the raw material, the pre-processing and storage treatments as well as the processing conditions. In this study, a quality assessment was performed on baby food made from different pre-processed raw materials. The experiments were carried out under industrial conditions using fresh, frozen and stored organic carrots as raw material. Statistically significant differences were found for sensory attributes among the three autoclaved puree samples (e.g. overall odour F = 90.72, p processed from frozen carrots show increased moisture content and decrease of several chemical constituents. Biocrystallization identified changes between replications of the cooking. Pre-treatment of raw material has a significant influence on the final quality of the baby food.

  15. Upper Palaeolithic lithic raw material sourcing in Central and Northern Portugal as an aid to reconstructing hunter-gatherer societies

    Directory of Open Access Journals (Sweden)

    Thierry Aubry


    Full Text Available We present the results of the study of lithic raw materials used in Upper Palaeolithic occupations preserved in caves, rockshelters and open-air sites from two different geological environments in Portugal. For the sites located in the Lusitanian Basin, flint or silcrete sources are easily available in close vicinity. The Côa Valley sites, located in the Iberian Massif, are within a geological environment where restricted fine-grained vein quartz and siliceous metamorphic rocks are available, but no flint or silcrete, even though both are present in the archaeological assemblages. Data from the two clusters of sites are compared with a third newly located site in the Lower Vouga valley, at the limit of the Iberian Massif with the Lusitanian Basin, where quartz vein raw material types are locally available and flint is about 40 kilometres distant. This study reveals prehistoric adaptations to these different geological contexts, with shorter networks for the Lusitanian basin sites contrasting with the long distance ones for the Côa Valley, and the Vouga site at an intermediary position. Finally, we propose that lithic raw material supply networks, defined by a GIS least-cost algorithm, could be used as a proxy not only for territoriality in the case of local and regional lithic raw material sources, but also to infer long-distance social networks between different Palaeolithic human groups, created and maintained to promote the access to asymmetrically distributed resources.

  16. Use of pig by-products (bristles and hooves) as alternative protein raw material in fish feed

    DEFF Research Database (Denmark)

    Gachango, Florence Gathoni; Ekmann, K.S.; Frørup, J.


    Increasing growth in the aquaculture industry calls for employment of innovative technologies that will ensure sustainability in the sector, given the rising competition for feed raw material. A technology that can convert low quality biological waste resources such as pig bristles and hooves int...

  17. Theoretical bases of rotation dynamics of raw materials poller with s ratify consideration for saw gin processing of cotton

    International Nuclear Information System (INIS)

    Saidov, Kh.; Babaeva, A.Kh.


    In this paper is examined motion of raw materials rollers on the base of a stratify models. Foe every layers of the rollers are determined dynamical influences for saw gin processing of cotton. It is noticed that in the gin processing of cotton the second layer of cotton roller plagues an important role

  18. Effects and detection of raw material variability on the performance of near-infrared calibration models for pharmaceutical products. (United States)

    Igne, Benoit; Shi, Zhenqi; Drennen, James K; Anderson, Carl A


    The impact of raw material variability on the prediction ability of a near-infrared calibration model was studied. Calibrations, developed from a quaternary mixture design comprising theophylline anhydrous, lactose monohydrate, microcrystalline cellulose, and soluble starch, were challenged by intentional variation of raw material properties. A design with two theophylline physical forms, three lactose particle sizes, and two starch manufacturers was created to test model robustness. Further challenges to the models were accomplished through environmental conditions. Along with full-spectrum partial least squares (PLS) modeling, variable selection by dynamic backward PLS and genetic algorithms was utilized in an effort to mitigate the effects of raw material variability. In addition to evaluating models based on their prediction statistics, prediction residuals were analyzed by analyses of variance and model diagnostics (Hotelling's T(2) and Q residuals). Full-spectrum models were significantly affected by lactose particle size. Models developed by selecting variables gave lower prediction errors and proved to be a good approach to limit the effect of changing raw material characteristics. Hotelling's T(2) and Q residuals provided valuable information that was not detectable when studying only prediction trends. Diagnostic statistics were demonstrated to be critical in the appropriate interpretation of the prediction of quality parameters. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.

  19. NAA study on characteristics and sources of raw materials of celadon bodies from Qingliangsi kiln and Zhanggongxiang kiln

    International Nuclear Information System (INIS)

    Wu Zhanjun; Zhao Weijuan; Lu Xiaoke; Li Guoxia; Guo Min; Xie Jianzhong; Qiu Xia; Feng Songlin


    Thirty-seven samples of ancient Chinese Ru porcelain bodies unearthed from Qingliangsi kiln (containing 32 Ru official porcelain bodies and 5 Ru folk porcelain bodies), thirty-two samples of ancient celadon bodies from Zhanggongxiang kiln, and fourteen samples of modern mineral, were selected and analyzed by neutron activation analysis (NAA) method. Twenty-three elements were measured. The data of these elemental contents were processed by scatter analysis and principle component analysis methods in order to determine the characteristics and sources of the raw materials of the celadon porcelain bodies from the foregoing two kilns. The results show that Fe, Ce, Ba, Ta, Th, La, Sm and Cr are the fingerprint elements to distinguish the ancient Ru official porcelain bodies from ancient celadon bodies of Zhanggongxiang kiln. The sources of the raw material of the ancient Ru official porcelain bodies from Qingliangsi kiln are more concentrated and stable than those from Zhanggongxiang kiln. The Ru folk porcelain bodies and the Ru official porcelain bodies from Qingliangsi kiln have the same provenance, both sources of which are local. The raw material origins of the ancient celadon bodies from Zhanggongxiang kiln is a little dispersed and the compositions of the raw material are different from the Ru porcelains, but the distance is not far away from each other. (authors)

  20. The influence of raw material, added emulsifying salt and spray drying on cheese powder structure and hydration properties

    DEFF Research Database (Denmark)

    Felix da Silva, Denise; Larsen, Flemming Hofmann; Hougaard, Anni Bygvrå


    The present work has evaluated how raw material, addition of emulsifying salts (ES) and drying technology affect particle characteristics, structure, and hydration of cheese powders. In this context the spray drying technology induced the strongest effect on morphology and swelling of cheese powder...

  1. Extraction of Fucoxanthin from Raw Macroalgae excluding Drying and Cell Wall Disruption by Liquefied Dimethyl Ether (United States)

    Kanda, Hideki; Kamo, Yuichi; Machmudah, Siti; Wahyudiono; Goto, Motonobu


    Macroalgae are one of potential sources for carotenoids, such as fucoxanthin, which are consumed by humans and animals. This carotenoid has been applied in both the pharmaceutical and food industries. In this study, extraction of fucoxanthin from wet brown seaweed Undaria pinnatifida (water content was 93.2%) was carried out with a simple method using liquefied dimethyl ether (DME) as an extractant in semi-continuous flow-type system. The extraction temperature and absolute pressure were 25 °C and 0.59 MPa, respectively. The liquefied DME was passed through the extractor that filled by U. pinnatifida at different time intervals. The time of experiment was only 43 min. The amount of fucoxanthin could approach to 390 μg/g dry of wet U. pinnatifida when the amount of DME used was 286 g. Compared with ethanol Soxhlet and supercritical CO2 extraction, which includes drying and cell disruption, the result was quite high. Thus, DME extraction process appears to be a good method for fucoxanthin recovery from U. pinnatifida with improved yields. PMID:24796299

  2. Analysis of the Toxic Element Concentrations in the Mesozoic Siliceous Rocks in Terms of the Raw Material Importance (United States)

    Pękala, Agnieszka


    As part of an integrated system of environmental protection at every stage of the product life cycle such as: raw material extraction, its transportation and processing as well the subsequent use and development is required to carry out actions towards reducing or completely eliminating products that contain harmful substances to the environment. The purpose of the presented paper is an analysis of the toxic element concentrations in the extracted siliceous minerals at the initial stage of the raw material recognition. The research material is constituted by rocks collected from the Mesozoic bedrock from the Bełchatów lignite deposit. A group of the studied rocks is represented by diatomites, gaizes, opoka-rocks and light opoka-rocks, enriched with minerals from the group of SiO2. Most of the recognized petrographic sediments have a real possibility of potential applications in the building material industry, but it needs to carry out a detailed and thorough research. The studies of the chemical composition were determined by atomic absorption spectroscopy (AAS) using Philips PU 9100Xi Camera SX-100 spectrometer and an atomic emission spectroscopy with inductively coupled plasma (ICP AES) using PLASMA 40 spectrometer. There were carried out a chemical analyses and determined the content of some toxic elements: Pb, Cr, Cd, Ni, Zn, Cu, Co, As, Sr, Ba, Zr. in the studied sedimentary rocks. The analysis of the results draws attention to the high content of cadmium in the case of the studied sediments. The concentration of this element in the described rocks is an average of 0.22 mg/kg -the diatomites, 0.05 mg/kg -the gaizes, 0.4 mg/kg -the opoka-rocks, 2.23 mg/kg -the light opoka-rocks. It was moreover registered varied concentration of arsenic in diatomites, that is formed in the range of 0.05 - 9.6 mg/kg, an average of 6.3 mg/kg. The content of the other designated elements with toxic properties in the analysed groups of rocks does not exceed the limit values. An

  3. The Mousterian lithic assemblage of the Ciota Ciara cave (Piedmont, Northern Italy: Exploitation and conditioning of raw materials

    Directory of Open Access Journals (Sweden)

    Sara Daffara


    Full Text Available The Ciota Ciara cave is situated in Monte Fenera’s karst (Borgosesia – Vercelli, at 670 metres above sea level. It is the most important evidence of a Middle Palaeolithic settlement in Piedmont: the cave was used by Homo neanderthalensis during the OIS 5, in a mild-humid period, as proven by faunal remains. The environment was characterized by deciduous woodland and glades. The intersection between different habitats, the presence of lithic raw materials, the karst morphology and water sources were certainly the main factors that encouraged human settlement during the Upper Pleistocene period, between 80.000 and 70.000 BP.In 2009 systematic excavations began in the cave by the University of Ferrara, in partnership with the Soprintendenza per i Beni Archeologici del Piemonte e del Museo di Antichità Egizie. Research focused on the cave’s atrium where three stratigraphic units were investigated: 13, 103 and 14.The exploited raw materials’ characterization were made by the stereo-microscope observations and through the SEM (Scanning Electron Microscope. Several lithologies are represented in different proportion: quartz is the predominant exploited raw material, followed by spongolite, sandstone, mylonite and opal. The archaeological record consists of various typologies of quartz: macro-crystalline pegmatite quartz, micro-crystalline pegmatite quartz and hyaline quartz. All these types of raw materials have been found in the proximity of the archaeological site, within 5 km range.The lithic assemblage is made of flakes, retouched tools, cores and debris. The raw materials exploitation was achieved through the direct percussion technique with various methods: S.S.D.A., discoid and Levallois. The reduction sequences on quartz are complete, although no refitting was found. The reduction sequence is not complete for most part of the other raw materials. The débitage products are small-medium size (1-4 cm and have different morphologies

  4. Sweet sorghum: A new raw material source for the sugar industry

    Energy Technology Data Exchange (ETDEWEB)

    El Bassam, N; Dambroth, M; Ruehl, G


    The primary uses of sweet sorghum have been as a syrup for human consumption and as a livestock feed. More recently, interest in sweet sorghum has risen because of its potential use as a source of sugar and/or as a raw material for the production of energy and for different biotechnological processes. However, before sweet sorghums may be utilized as a source for both sugar and energy, adequate and adapted genotypes must be identified. The objective of this study is to measure the agronomic performance of different lines and cultivars of sweet sorghum for cold tolerance yield of biomasse, yield of sugar and sugar quality. Of the more than 1000 entries from 20 different world-wide origins, 614 accessions have been cultivated for evaluation purposes in the last 2 years. Among the tested material 18 genotypes exhibited more than 90 tons biomass (FM) per hectare in 1985 and 32 types in 1986. The number of accessions which produced more than 90 th FM/ha in both years was 10, one type produced more than 11 tons FM/ha. The biomasse production of one accession achieved 169 t FM/ha in 1986. The highest sugar content in FM mounted to 9,2% in 1985 and 11,1% in 1986. Five genotypes produced more than 10 tons sugar per hectare, the highest sugar yield was 12 t/ha. In average of the high sugar yielding accessions, more than 50% of the sugar consists of saccharose, 28% of glucose and 19% of fructose. The corresponding quantity of alcohol which can be produced amounts to 7 000 l/ha. (orig.)


    Directory of Open Access Journals (Sweden)

    Y. P. Kolomnikova


    Full Text Available Summary. An important task is the use of catering in the preparation of food products of new types of raw materials, which can solve the problem of nutrition. One way to improve the quality and range of flour culinary products is the use of technology in their enriching additives plant. Among them are a subgroup of additives derived from cereals, pulses, oilseeds, vegetables, fruit and other plant materials. As a result of researches the technology buns bakery products with the addition of oil and meal of wheat germ, pumpkin seed oil cake. Wheat germ oil cake is a source of complete protein and biologically active substances, is rich in essential amino acids, unsaturated ω-3, ω-6 fatty acids, vitamin E, D, B1, B2, B6, PP, pantothenic and folic acid, carotenoids. The composition of pumpkin seed oil cake include essential oils, phytosterols, resinous substances, organic acids, vitamins C and B, carotenoids, carbohydrate melen. In the composition of wheat germ oil contains: all essential, not synthesized by the human amino acid (tryptophan, methionine, leucine, valine, isoleucine, polyunsaturated fatty acids (ω-3, ω-6 and ω-9 acid, a large amount of vitamins, micro - and macronutrients. In the development of the experimental basis for the formulation chosen butter bakery products, in which part of the wheat flour (20 % was replaced by wheat germ oil cake (10 % and pumpkin seed oil cake (10 %. Margarine in the classical formulation was replaced by wheat germ oil, sugar - on natural honey. Insertion additives significantly improve the properties of biotech pastry. The proposed method of production of buns bakery products can reduce the duration of the production process, to intensify the process of gas formation in the test to increase gas-retaining capacity and lift test.

  6. Influence of mechanical and thermal treatments on raw materials containing pyrophyllite

    Directory of Open Access Journals (Sweden)

    Sánchez Soto, P. J.


    Full Text Available In the present work results obtained in a study on the influence of thermal, mechanical by dry grinding, and their combination, in raw materials containing pyrophyllite, are discussed. First of all, it is studied the influence of thermal treatment concerning the development and evolution of crystalline phases (mullite and cristobalite from dehydroxylated pyrophyllite. On the basis of these results, it is analyzed what happens in a natural raw mixture of pyrophyllite with kaolinite and mica (sericite submitted to thermal treatments. The raw pyrophyllite materials are altered under laboratory conditions using mechanical treatments by dry grinding. It is noted that the increase of surface area and particle size reduction is produced by grinding, but other effects are produced on the structure and properties of the solid submitted to grinding. In general, grinding leads to a progressive destruction of the original crystal structure of the present layered silicates, but it is preferentially produced along the “c” axis. In other words, mechanochemical reactions are induced by dry grinding due to the increase of reactivity of the system. Between these reactions, it is enhanced the reagglomeration process that occurs above a determinate limit of grinding time. The grinding treatment can be combined with a subsequent thermal treatment that enhances the increase of reactivity, producing the formation of crystalline phases (mullite and cristobalite at lower temperatures that in unground samples with energy saving. The results are compared taking into account the crystal structures of both kaolinite and pyrophyllite, the thermal transformation of kaolinite to mullite, and the process of grinding kaolinite because this layer silicate is present in the raw materials containing pyrophyllite.

    En el presente trabajo se exponen y discuten resultados obtenidos en el estudio de la influencia de tratamientos térmicos, tratamientos mecánicos por molienda

  7. Nutritional Evaluation of Raw Materials Entering the Structure to Mixed Fodder for the Specie Poecilia reticulata (Guppy

    Directory of Open Access Journals (Sweden)

    Adrian Gruber


    Full Text Available In the ornamental pisciculture is a especial emphasis on the exterior shape and color to the fishes, issues that are dependent directly to the structure of compound feeds in relation to the nutritional characteristics of the raw materials.Own research or focused on analyzing the crude chemical composition with Weende scheme (water content and dry matter, crude ash, crude protein, crude fat, crude fiber, SEN of raw materials can be used in the structure of a compound feeds for the Poecilia reticulata (guppy species, for most of these materials there are no current data in the literature.These materials were analyzed: gelatin, wheat flour, sunflower meal, soybean meal, meal Spirulina platensis, carrot (Daucus carota, Pangasius fillet, Daphnia pulex, grount dandelion (Taraxacum officinale, grount nettle (Urtica dioica and yeast.

  8. An approach for extracting the vein and heart boundaries from raw NM images

    International Nuclear Information System (INIS)

    Mitrovski, Cvetko D.; Kostov, Mitko B.


    In this paper we present our approach on prE.processing chest region dynamical NM images which enables anatomical data extraction of the vena cava and the heart. The aim of the method is developing sophisticated diagnostic software that could automatically offer the optimal positions and the shapes of the regions of interest needed for the heart studies. (Author)

  9. Mineral raw materials used in the archaeological artifacts in Guayacas - Dayman - Paysandu

    International Nuclear Information System (INIS)

    Capdepont, I.; Del Puerto, L.; Castineira, C.; Pineiro, G.


    The purpose of this work is about the election, exploitation and modes of supply mineral raw resources used in the manufacturing of lithic and ceramic archaeological artifacts in Guayacas - Dayman - Paysandu

  10. Complex and rational use fish raw material at production of the fish products


    Saltanova, N.; Saltanov, D.


    There was developed resource saving technology of herring preserves, which allows to rationally use raw, to cut lasting of the technological process, to lower the production costs and rise the economical effectiveness of production. There were defined the optimal conditions of getting broths of herring wastes. There were developed the recipes of fills at the base of broth from collagen-containing wastes of herring with the addition of vegetable raw.

  11. Anti-Inflammatory Activity of the Methanol Extract of Moutan Cortex in LPS-Activated Raw264.7 Cells

    Directory of Open Access Journals (Sweden)

    Seung-Chul Chun


    Full Text Available Moutan Cortex (MCE has been used in traditional medicine to remove heat from the blood, promote blood circulation and alleviate blood stasis. This study was conducted to evaluate the effects of MCE on regulatory mechanisms of cytokines and nitric oxide (NO involved in immunological activity of Raw264.7 cells. Cells were pretreated with methanolic extracts of MCE, and further cultured for an appropriate time after lipopolyssacharide (LPS addition. During the entire experimental period, 0.1 and 0.3 mg ml−1 of MCE had no cytotoxicity. In these concentrations, MCE inhibited the production of NO and prostaglandin E2 (PGE2, the expression of inducible NO synthase (iNOS, cyclooxygenase-2 (COX-2 and phosphorylated inhibitor of κBα (p-IκBα, and the activation of nuclear factor κB (NF-κB. MCE also reduced the concentration of tumor necrosis factor-α (TNF-α, interleukin-1β (IL-1β and interleukin-6 (IL-6 in the Raw264.7 cells that were activated by LPS. These results demonstrate that MCE has anti-inflammatory effects through the inhibition of iNOS and COX-2 expression by suppressing the phosphorylation of I-κBα and the activation of NF-κB.

  12. Biotechnologies for critical raw material recovery from primary and secondary sources: R&D priorities and future perspectives. (United States)

    Hennebel, Tom; Boon, Nico; Maes, Synthia; Lenz, Markus


    Europe is confronted with an increasing supply risk of critical raw materials. These can be defined as materials of which the risks of supply shortage and their impacts on the economy are higher compared to most of other raw materials. Within the framework of the EU Innovation Partnership on raw materials Initiative, a list of 14 critical materials was defined, including some bulk metals, industrial minerals, the platinum group metals and rare earth elements. To tackle the supply risk challenge, innovation is required with respect to sustainable primary mining, substitution of critical metals, and urban mining. In these three categories, biometallurgy can play a crucial role. Indeed, microbe-metal interactions have been successfully applied on full scale to win materials from primary sources, but are not sufficiently explored for metal recovery or recycling. On the one hand, this article gives an overview of the microbial strategies that are currently applied on full scale for biomining; on the other hand it identifies technologies, currently developed in the laboratory, which have a perspective for large scale metal recovery and the needs and challenges on which bio-metallurgical research should focus to achieve this ambitious goal. Copyright © 2013. Published by Elsevier B.V.

  13. A proposal of Transport System Improvement in exploiting and processing of raw materials

    Directory of Open Access Journals (Sweden)

    Ján Sciranko


    Full Text Available In handling earth, aggregate rock, ore, coal and other materials, trucks serve one purpose. They are hauling units which, because of their high speed when operating on suitable roads, have high capacities and provide relatively low hauling costs.They provide a high degree of flexibility as their number may be decreased or increased easily to permit modifications in the total hauling capacity of a fleet.In cyclic operations, the two principal operations are loading and haulage with hoisting as a third optional. In continuous operations, where machines combine the breakage and handling functions, cutting, drilling and blasting are eliminated and extraction and loading are performed in a single operation or function (excavation, e.g. the bucket wheel excavator, auger, highwall mines, continuous miner or the boring machine.Materials handling in modern mechanized mining is equipment oriented. Unit operations are characterized by, and sometimes identified with, an equipment that performs them. Thus the field terminology refers to a mining shovel, stripping dragline or the coal loader. From time to time the mining engineer is faced with the necessity to make a haulage study to determine not only the most suitable method of hauling materials, but also the most effective and economical type of equipment used for the operation. Key words: truck haulage, material handling, mining shovel

  14. Anti-Inflammatory Effects of Angelica sinensis (Oliv. Diels Water Extract on RAW 264.7 Induced with Lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Young-Jin Kim


    Full Text Available The dry root of Angelica sinensis (Oliv. Diels, also known as “female ginseng”, is a popular herbal drug amongst women, used to treat a variety of health issues and cardiovascular diseases. The aim of this study is to evaluate the detailed molecular mechanism for anti-inflammatory effects of Angelica sinensis root water extract (ASW. The anti-inflammatory effect of ASW on lipopolysaccharide (LPS-induced RAW 264.7 mouse macrophages was evaluated by the tetrazolium-based colorimetric assay (MTT, Griess reagent assay, multiplex cytokine assay, real time reverse transcription polymerase chain reaction (RT-PCR, and Fluo-4 calcium assay. ASW restored cell viability in RAW 264.7 at concentrations of up to 200 µg/mL. ASW showed notable anti-inflammatory effects. ASW exhibited IC50 = 954.3, 387.3, 191.7, 317.8, 1267.0, 347.0, 110.1, 573.6, 1171.0, 732.6, 980.8, 125.0, and 257.0 µg/mL for interleukin (IL-6, tumor necrosis factor (TNF-α, monocyte chemotactic activating factor (MCP-1, regulated on activation, normal T cell expressed and secreted (RANTES, granulocyte colony-stimulating factor (G-CSF, granulocyte macrophage colony-stimulating factor (GM-CSF, vascular endothelial growth factor (VEGF, lipopolysaccharide-induced CXC chemokine (LIX, macrophage inflammatory protein (MIP-1α, MIP-1β, MIP-2, IL-10, and intracellular calcium, respectively. Additionally, ASW inhibited the LPS-induced production of nitric oxide and the LPS-induced mRNA expression of CHOP (GADD153, Janus kinase 2 (JAK2, signal transducers and activators of transcription 1 (STAT1, first apoptosis signal receptor (FAS, and c-Fos, NOS2, and PTGS2 (COX2 in RAW 264.7 significantly (p < 0.05. Data suggest that ASW exerts an anti-inflammatory effect on LPS-induced RAW 264.7 via NO-bursting/calcium-mediated JAK-STAT pathway.

  15. Extracting a respiratory signal from raw dynamic PET data that contain tracer kinetics. (United States)

    Schleyer, P J; Thielemans, K; Marsden, P K


    Data driven gating (DDG) methods provide an alternative to hardware based respiratory gating for PET imaging. Several existing DDG approaches obtain a respiratory signal by observing the change in PET-counts within specific regions of acquired PET data. Currently, these methods do not allow for tracer kinetics which can interfere with the respiratory signal and introduce error. In this work, we produced a DDG method for dynamic PET studies that exhibit tracer kinetics. Our method is based on an existing approach that uses frequency-domain analysis to locate regions within raw PET data that are subject to respiratory motion. In the new approach, an optimised non-stationary short-time Fourier transform was used to create a time-varying 4D map of motion affected regions. Additional processing was required to ensure that the relationship between the sign of the respiratory signal and the physical direction of movement remained consistent for each temporal segment of the 4D map. The change in PET-counts within the 4D map during the PET acquisition was then used to generate a respiratory curve. Using 26 min dynamic cardiac NH3 PET acquisitions which included a hardware derived respiratory measurement, we show that tracer kinetics can severely degrade the respiratory signal generated by the original DDG method. In some cases, the transition of tracer from the liver to the lungs caused the respiratory signal to invert. The new approach successfully compensated for tracer kinetics and improved the correlation between the data-driven and hardware based signals. On average, good correlation was maintained throughout the PET acquisitions.

  16. Extracting a respiratory signal from raw dynamic PET data that contain tracer kinetics

    International Nuclear Information System (INIS)

    Schleyer, P J; Thielemans, K; Marsden, P K


    Data driven gating (DDG) methods provide an alternative to hardware based respiratory gating for PET imaging. Several existing DDG approaches obtain a respiratory signal by observing the change in PET-counts within specific regions of acquired PET data. Currently, these methods do not allow for tracer kinetics which can interfere with the respiratory signal and introduce error. In this work, we produced a DDG method for dynamic PET studies that exhibit tracer kinetics. Our method is based on an existing approach that uses frequency-domain analysis to locate regions within raw PET data that are subject to respiratory motion. In the new approach, an optimised non-stationary short-time Fourier transform was used to create a time-varying 4D map of motion affected regions. Additional processing was required to ensure that the relationship between the sign of the respiratory signal and the physical direction of movement remained consistent for each temporal segment of the 4D map. The change in PET-counts within the 4D map during the PET acquisition was then used to generate a respiratory curve. Using 26 min dynamic cardiac NH 3 PET acquisitions which included a hardware derived respiratory measurement, we show that tracer kinetics can severely degrade the respiratory signal generated by the original DDG method. In some cases, the transition of tracer from the liver to the lungs caused the respiratory signal to invert. The new approach successfully compensated for tracer kinetics and improved the correlation between the data-driven and hardware based signals. On average, good correlation was maintained throughout the PET acquisitions. (paper)

  17. Using past transitions to inform scenarios for the future of renewable raw materials in the UK

    International Nuclear Information System (INIS)

    Bennett, Simon J


    Transitions between technological systems involve evolutionary processes. The past both shapes the current system and influences future options and pathways. Understanding the nature of energy transitions has become particularly important in light of the major changes that the world faces in the next century in the way that energy is sourced, converted and used. Policy-makers and decisiontakers need to understand the extent to which they can, or should, manage the transition. This paper proposes that a detailed study the patterns of change in a specific sector's past can improve our understanding of how it might evolve. A methodology is presented and applied to a case study of the prospective transition towards renewable raw material (RRM) use in the production of liquid fuels and organic chemicals in the UK. A process analysis of the historical transition to petroleum-based fuels and chemicals was used to shape a series of contemporary interviews that explored the perceptions and expectations of key actors in RRM and biorefining. The results show that the innovation system is already experiencing the socio-technical dynamics of regime disruption and competing designs. An empirical basis is offered for the the use of past transitions to inform scenarios for the future. - Highlights: ► Two sectors were studies in detail to learn about the dynamics of energy transitions. ► A methodology for linking historical studies with foresight work is presented. ► Interview results from a UK case study on biofuels and biochemicals are discussed. ► Socio-technical dynamics of transitions provide insight for decisions about the future. ► Socio-technical dynamics can be a basis for constructing scenarios to inform policy.

  18. Biomass-fuelled PEMFC systems: Evaluation of two conversion paths relevant for different raw materials

    International Nuclear Information System (INIS)

    Guan, Tingting; Chutichai, Bhawasut; Alvfors, Per; Arpornwichanop, Amornchai


    Highlights: • Anaerobic digestion and gasification are viable biomass conversion technologies. • GF-PEMFC system yields a 20% electric efficiency and 57% thermal efficiency. • AD-PEMFC system has a 9% electric efficiency and 13% thermal efficiency. • AD-PEMFC system has an efficient land-use. • GF-PEMFC system has a high CO_2 emissions offset factor. - Abstract: Biomass-fuelled polymer electrolyte membrane fuel cells (PEMFCs) offer a solution for replacing fossil fuel with hydrogen production. This paper uses simulation methods for investigating biomass-fuelled PEMFCs for different raw materials and conversion paths. For liquid and solid biomass, anaerobic digestion (AD) and gasification (GF), respectively, are relatively viable and developed conversion technologies. Therefore, the AD-PEMFC system and the GF-PEMFC system are simulated for residential applications in order to evaluate the performance of the biomass-fuelled PEMFC systems. The results of the evaluation show that renewable hydrogen-rich gas from manure or forest residues is usable for the PEMFCs and makes the fuel cell stack work in a stable manner. For 100 kWe generation, the GF-PEMFC system yields an excellent technical performance with a 20% electric efficiency and 57% thermal efficiency, whereas the AD-PEMFC system only has an 9% electric efficiency and 13% thermal efficiency due to the low efficiency of the anaerobic digester (AD) and the high internal heat consumption of the AD and the steam reformer (SR). Additionally, in this study, the environmental performances of the AD-PEMFC and the GF-PEMFC in terms of CO_2 emission offset and land-use efficiency are discussed.

  19. Mechanism investigation for poloxamer 188 raw material variation in cell culture. (United States)

    Peng, Haofan; Ali, Amr; Lanan, Maureen; Hughes, Erik; Wiltberger, Kelly; Guan, Bing; Prajapati, Shashi; Hu, Weiwei


    Variability in poloxamer 188 (P188) raw material, which is routinely used in cell culture media to protect cells from hydrodynamic forces, plays an important role in the process performance. Even though tremendous efforts have been spent to understand the mechanism of poloxamer's protection, the root cause for lot-to-lot variation was not clear. A recent study reported that the low performance was not due to toxicity but inefficiency to protect cells (Peng et al., Biotechnol Prog. 2014;30:1411-1418). In this study, it was demonstrated for the first time that the addition of other surfactants even at a very low level can interfere with P188 resulting in a loss of efficiency. It was also found that the performance of P188 lots correlated well with its foam stability. Foam generated from low performing lots in baffled shaker flask lasts longer, which suggests that the components in the foam layers are different. The spiking of foam generated from a low performing lot into the media containing a high performance lot resulted in cell damage and low growth. Analytical studies using size exclusion chromatography (SEC) identified differences in high molecular weight (HMW) species present in the P188 lots. These differences are much clearer when comparing the HMW region of the SEC chromatogram of foam vs. bulk liquid samples. This study shows that low performing lots have enriched HMW species in foam samples due to high hydrophobicity, which can be potentially used as a screening assay. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:767-775, 2016. © 2016 American Institute of Chemical Engineers.

  20. Expansion of the range of pasta products through the use of vegetable raw materials

    Directory of Open Access Journals (Sweden)

    B. A. Iztaev


    Full Text Available The nutritional value of food products is one of the most important factors that determine a health of the population. Based on the importance of the nation's health for the development and county’s security, the Concept of the State Policy on Healthy Nutrition of the Kazakhstan population is defined, providing for a set of activities aimed at creating conditions that meet the needs of various groups of the population in rational, healthy nutrition, taking into account their traditions, habits and economic situation. In the macaroni products market, the dietary and functional products, enriched pasta and high nutritional products occupy a small segment that does not exceed 1%. In connection with this fact, the development of a range of macaroni products of increased nutritional value, with a purposefully changed chemical composition remains topical. In the macaroni industry, the increase in the food and biological value of products is achieved through the introduction of non-traditional types of raw materials and special food additives into the formulation. The research objects are wheat flour of the highest grade, a polydisperse corn flour, chick-pea flour and amaranth flour and the influence of these polydisperse systems on the properties of gluten, the rheological properties of the dough and the quality of the finished products have been determined. Based on the experimental data obtained, it is established that for the production of pasta from bakery flour of high quality with good physical-chemical and organoleptic characteristics, no more than 10.0% of corn and chick-pea flour and not more than 7.5% of amaranth flour can be added to the recipe; further increasing the dosage of flour from cereals and legumes leads to a deterioration in the quality of finished products. The use of polydisperse flour from cereals and legumes is expedient for the enrichment of macaroni products with valuable food ingredients - proteins, essential amino acids